TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-191-5p
miRNA Sequence: CAACGGAAUCCCAAAAGCAGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1151088 989 868 730 704 --12597 --
NM_000176chr563379 2889 2597 1397 1375 117 --1394 --
NM_000216chrX64056 3627 3096 2640 1370 145 ------
NM_000259chr1585350 4928 4817 4458 4419 1587 940 187 35495 4024 1846 1705 --
NM_000310chr131149 822 275 ----1182
NM_000332chr697027 6474 6240 6218 5203 4612 2790 2139 867 --22406 118 --
NM_000362chr2243573 3523 2756 2463 12310 11067 --
NM_000430chr1773577 2525 938 873 471 363 81 --13079 11336
NM_000489chrX33134 2810 2435 12795 --12416
NM_000555chrX87851 7828 5620 5545 1497 1434 845 346 ------
NM_000618chr1222591 889 16388 --16012
NM_000618chr1222591 889 16388 --16012
NM_000633chr1864360 4239 3848 2073 1765 351 --24476 1899 --
NM_000719chr1266417 5062 1526 1383 388 59 --31559 849 125 --
NM_000813chr524903 267 --14034 15260
NM_000814chr1542800 2618 1678 1203 1922 1766 11121
NM_000844chr321079 379 ----1996
NM_000875chr1557083 6835 5934 5067 1133 --16918 14887
NM_000891chr1743316 3299 561 47 ----23239 2662
NM_000899chr1253235 1101 128 98 31 --11596 --
NM_000926chr1199464 9290 8631 8417 8285 5982 2722 1356 1116 --16712 --
NM_000950chrX33632 3514 236 13076 --12693
NM_000963chr142499 2130 437 103 12093 1220 --
NM_001001342chr1021013 986 --1966 1401
NM_001001419chr544662 3613 3423 2041 --35084 4404 1935 15130
NM_001001420chr544662 3613 3423 2041 --35084 4404 1935 15130
NM_001001664chr223573 772 --13789 198
NM_001003652chr18108088 8048 6290 3094 2636 1432 1220 925 155 51 2459 442 18379 --
NM_001003712chr1252880 1570 1141 1046 146 --13802 --
NM_001004419chr1284553 4487 4065 4050 3425 1482 1276 503 ------
NM_001005386chr231648 1558 233 --22186 913 11625
NM_001005404chr1774482 2801 1639 1439 1100 230 200 --23681 560 --
NM_001005473chr565129 4737 4390 4358 4115 2329 ------
NM_001006623chr221591 49 12345 --12425
NM_001006657chr263217 2740 2432 892 802 87 --22087 723 --
NM_001007246chr2121395 761 ----21933 531
NM_001007466chr685126 4981 4632 4412 3292 899 297 36 --14561 --
NM_001008408chr7116368 5162 5007 4739 4051 4029 2186 1838 1523 1070 923 --45835 5507 5412 253 --
NM_001008895chr1331389 594 549 ----1234
NM_001009909chr1133570 3467 1503 ----1563
NM_001010867chr165767 2233 2015 1966 1956 637 15003 ----
NM_001010891chr546718 4928 1490 1381 --66562 6297 4423 1173 448 331 --
NM_001010934chr731115 793 397 1846 21153 1060 --
NM_001011513chr444019 2859 2799 2779 14004 23607 1622 13818
NM_001012393chr1175075 5035 4777 2017 1520 1079 599 ----1108
NM_001012968chrX31823 434 204 137 1936 1642
NM_001013620chr1256729 5674 1661 1602 896 13356 18022 --
NM_001017395chr363619 2953 2615 1400 1355 118 --1494 --
NM_001017523chr1231751 1179 570 --21481 1240 11876
NM_001017999chr141953 911 899 524 ----1917
NM_001017999chr141953 911 899 524 ----1917
NM_001018000chr141953 911 899 524 ----1917
NM_001018000chr141953 911 899 524 ----1917
NM_001018001chr141953 911 899 524 ----1917
NM_001018067chr144694 964 929 147 14451 25278 46 --
NM_001018068chr144694 964 929 147 14451 25278 46 --
NM_001018069chr144694 964 929 147 14451 25278 46 --
NM_001018072chr1231751 1179 570 --21481 1240 11876
NM_001018074chr563379 2889 2597 1397 1375 117 --1394 --
NM_001018075chr563379 2889 2597 1397 1375 117 --1394 --
NM_001018076chr563379 2889 2597 1397 1375 117 --1394 --
NM_001018077chr563379 2889 2597 1397 1375 117 --1394 --
NM_001024094chr563379 2889 2597 1397 1375 117 --1394 --
NM_001024948chr153491 3277 3148 2576 2191 ----12655
NM_001025076chr1076112 5889 4887 4034 3920 3832 794 --25918 1894 --
NM_001025077chr10107470 7247 6245 5392 5278 5190 5059 2152 1369 706 --17276 --
NM_001025356chr1262980 2938 1119 711 411 342 --1323 --
NM_001029998chr431307 1122 21 ----11433
NM_001030055chr1474140 3625 1452 1118 754 560 293 ------
NM_001031732chr453643 2596 2502 1152 1079 --12411 13559
NM_001033045chr221740 122 --13984 13664
NM_001034841chr1665458 4822 4051 353 283 268 14977 ----
NM_001035005chr18--1603 1652 2235 214
NM_001039618chr1135841 542 248 --22210 392 14977
NM_001039840chrX86024 5494 4491 4077 4018 3928 816 24 --35346 1167 856 --
NM_001040284chr1635158 4707 2287 11557 --11428
NM_001040429chr1321291 554 33295 2427 320 2198 46 --
NM_001040450chr1532245 2085 118 --1338 22289 1868
NM_001040453chr1532245 2085 118 --1338 22289 1868
NM_001042355chr1675400 4578 3592 1987 643 551 141 --177 --
NM_001042412chr1675400 4578 3592 1987 643 551 141 --177 --
NM_001042537chrX31840 1606 219 ----1259
NM_001042599chr257401 4790 2927 551 406 ----17692
NM_001042601chr332431 2336 141 ----13154
NM_001042603chr12105351 3634 3527 3469 3411 3353 3345 1936 1565 1459 --24661 2141 1530
NM_001042604chr344852 4224 3452 1835 --14372 11519
NM_001042681chr162609 1975 1835 1000 794 167 --2940 919 --
NM_001042682chr162609 1975 1835 1000 794 167 --2940 919 --
NM_001042682chr162609 1975 1835 1000 794 167 --2940 919 --
NM_001099678chr346278 5305 4656 925 ----15374
NM_001106chr378455 8447 7331 7141 3099 1173 326 --27201 6287 --
NM_001167chrX56751 6679 6416 504 369 --32210 1798 855 --
NM_001173chr1474140 3625 1452 1118 754 560 293 ------
NM_001204chr257063 6508 5210 1807 1533 1246 27779 6611 16023
NM_001256chr1722604 2336 --32858 401 258 12952
NM_001259chr756398 5186 777 459 228 --12086 15413
NM_001364chr1174067 4047 3367 3303 3276 1644 1283 1877 ----
NM_001419chr1974874 2991 1947 1615 774 650 209 --44077 4033 2958 1122 11128
NM_001429chr22188 --1768 1791
NM_001491chr652588 1741 1008 631 569 1983 ----
NM_001527chr664793 4087 3710 1584 408 357 11520 23766 138 --
NM_001709chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_001759chr1265222 5082 3863 3510 1873 693 11213 11346 1848
NM_001875chr22695 140 --1942 11071
NM_002024chrX2808 41 --1388 11875
NM_002025chrX57347 7177 6245 2662 2588 18515 33430 1585 1116 --
NM_002092chr464910 3961 3413 1823 1458 1004 ------
NM_002140chr921082 423 --1112 1295
NM_002211chr101842 1464 --1355
NM_002214chr715732 12191 25696 5587 13851
NM_002264chr374594 4578 4394 4358 3708 1894 1551 --34097 4092 808 --
NM_002310chr576556 6439 5948 4348 2223 1500 593 --42194 967 344 339 15187
NM_002387chr563741 1661 1317 830 350 247 --24663 1479 --
NM_002481chr177912 5867 4989 2736 2425 899 585 11948 --16550
NM_002499chr1552417 2201 988 855 770 ----12071
NM_002501chr1984049 3990 3605 2646 2638 2568 1533 1198 --12651 14096
NM_002515chr1451767 1594 1545 1265 202 11314 --195
NM_002545chr1175075 5035 4777 2017 1520 1079 599 ----1108
NM_002613chr1685316 4616 3417 2106 1029 916 617 521 --11932 --
NM_002709chr232359 1252 532 33431 2486 200 ----
NM_002719chr1462189 1838 1553 355 120 53 --1804 --
NM_002740chr362796 2740 1999 376 318 160 --12510 --
NM_002837chr1284459 4172 3080 2898 1716 1388 893 201 --24464 98 --
NM_002851chr73579 261 90 ----184
NM_002886chr353608 3441 1878 1507 871 ----14897
NM_003071chr31313 ----21852 203
NM_003108chr277023 6616 5768 5705 2268 2259 1064 --12127 --
NM_003199chr1855135 4645 4557 1844 800 --15557 --
NM_003257chr151344 --21332 900 21359 304
NM_003298chr385910 5714 4519 4351 2190 1264 621 521 35823 1277 137 ----
NM_003342chr1743178 2286 1292 1077 --23214 103 --
NM_003574chr1843996 2030 1052 362 ----1752
NM_003583chr1263765 3632 3549 2690 827 802 13894 1449 --
NM_003589chr1331389 594 549 ----1234
NM_003590chr223089 1371 --31430 1323 1006 --
NM_003615chr363022 2891 2600 813 495 304 12835 23082 248 1229
NM_003714chr553036 2424 2317 303 111 ----11016
NM_003887chr231585 841 129 12121 21608 677 146
NM_003895chr2122181 503 11584 --12012
NM_003913chr654178 2914 1241 460 174 1286 1694 --
NM_003941chr752306 506 367 72 59 ------
NM_003983chr1634162 2778 1150 24461 838 11295 1926
NM_003994chr1253235 1101 128 98 31 --11596 --
NM_004093chr1363243 2602 2593 2383 2312 639 --13082 1512
NM_004130chr32619 576 189 --1187
NM_004171chr1168975 8900 8418 7739 2779 1970 22985 125 ----
NM_004229chrX41466 876 854 243 --21641 270 --
NM_004232chr1853725 3416 2905 761 665 --23916 656 --
NM_004392chr1322542 362 ----1519
NM_004458chrX21000 775 11932 1252 12576
NM_004569chr143492 177 73 ----1632
NM_004586chrX84842 4249 3808 1148 694 681 489 411 ------
NM_004612chr974615 4051 3526 1098 1074 659 194 --24045 766 13441
NM_004745chr866764 4419 2785 2665 1292 82 15658 11344 --
NM_004755chr1431238 453 436 ----11091
NM_004774chr1773114 3050 2493 2155 614 543 479 --22401 636 --
NM_004788chr1152061 1865 733 499 267 --2620 82 --
NM_004866chr565069 4587 3314 3244 880 641 ------
NM_004992chrX87732 7164 5673 5429 5188 2053 1998 146 --37021 6810 2407 --
NM_004992chrX87732 7164 5673 5429 5188 2053 1998 146 --37021 6810 2407 --
NM_005044chrX64475 4154 4088 3417 3266 764 --24116 3785 --
NM_005056chr12105595 3878 3771 3713 3655 3597 3589 2180 1809 1703 --14905 1774
NM_005063chr1043741 2456 342 61 11477 12571 13439
NM_005124chr63683 414 397 ----1147
NM_005126chr321589 1484 --1386 1643
NM_005156chr945278 4943 3574 1154 23812 720 35304 3649 3404 --
NM_005188chr1198245 8060 7080 5589 1598 1129 1082 651 604 --25979 2590 --
NM_005197chr1496180 5922 5913 5735 4901 4457 4174 1718 989 14935 1752 15989
NM_005207chr2243666 3383 3083 2683 11475 43479 1225 463 330 --
NM_005233chr352374 1827 1725 888 520 1863 ----
NM_005235chr257401 4790 2927 551 406 ----17692
NM_005342chrX42826 2780 573 85 ----1788
NM_005359chr1866473 5061 4167 1898 1776 773 --26214 4996 --
NM_005400chr252754 2563 2006 1218 454 1691 ----
NM_005436chr1063246 3229 2891 2726 1346 870 --1540 12557
NM_005613chr131662 653 498 --1378 11862
NM_005722chr231648 1558 233 --22186 913 11625
NM_005730chr1253605 3447 3276 2418 1117 --32940 1007 765 --
NM_005746chr752457 2227 2082 1869 1704 --12611 1993
NM_005828chr1744694 933 781 356 --25026 1027 11399
NM_005901chr18108088 8048 6290 3094 2636 1432 1220 925 155 51 2459 442 18379 --
NM_005903chr544662 3613 3423 2041 --35084 4404 1935 15130
NM_005941chr833836 3705 2979 1917 21344 714 13942
NM_006007chr964459 3954 3623 3320 1163 595 ----14484
NM_006036chr222418 1006 1441 22230 1885 11834
NM_006060chr774434 4125 3778 3583 2956 1195 1044 --12727 --
NM_006095chr454137 4045 3670 3653 780 130 1963 --
NM_006212chr165279 4831 4609 4379 1339 336 --23672 3430 --
NM_006226chr231371 1011 326 ----1313
NM_006252chr142963 2693 1349 916 --17349 124
NM_006282chr2053068 2992 1654 461 307 ----22904 1669
NM_006359chrX31840 1606 219 ----1259
NM_006457chr444019 2859 2799 2779 14004 23607 1622 13818
NM_006482chr1263765 3632 3549 2690 827 802 13894 1449 --
NM_006489chr1451767 1594 1545 1265 202 11314 --195
NM_006526chr2022054 1539 ----1185
NM_006538chr253947 2814 1494 1280 625 1867 23168 169 --
NM_006544chr1441936 1912 914 489 11675 32358 1469 384 --
NM_006546chr1776535 6439 6107 2425 2227 1231 756 --22317 1195 --
NM_006561chr1076112 5889 4887 4034 3920 3832 794 --25918 1894 --
NM_006572chr1763428 1055 582 507 408 221 --22596 54 --
NM_006599chr1698264 7730 6380 6311 5747 2895 2821 2437 1526 --22966 1587 --
NM_006614chr351312 1017 691 652 57 12539 ----
NM_006626chr962655 2450 854 770 196 59 ------
NM_006717chr923345 2295 13338 --1365
NM_006756chr831247 1022 161 1358 21135 230 1348
NM_006775chr623108 129 ----12183
NM_006827chr1452287 821 732 651 322 --12963 12199
NM_006873chr243113 2874 2476 1415 --21118 667 --
NM_006888chr1453416 3331 2720 724 148 --23072 110 --
NM_007011chr1546490 4255 1826 1368 24367 1990 --15873
NM_007106chr1332844 2142 286 11857 11761 22786 1932
NM_007107chr332335 2213 2193 ----12259
NM_007157chrX52795 2416 2306 1867 901 --22536 2522 --
NM_007249chr13139277 7281 7163 5835 3757 3269 2986 2242 1652 828 767 697 255 1474 59259 8913 7373 3117 684 --
NM_007350chr1243894 3737 1342 1292 14439 21477 1174 --
NM_012096chr342951 1506 1275 286 ----12500
NM_012102chr162609 1975 1835 1000 794 167 --2940 919 --
NM_012164chr9117462 6829 5985 5977 5500 5370 5003 2086 1366 652 568 26138 369 17069 17211
NM_012224chr42486 423 ----2999 919
NM_012328chr721057 73 ----11421
NM_012330chr1041788 1535 1155 345 ----2308 224
NM_012431chr772605 2570 2514 827 465 283 106 ------
NM_013231chr1433279 1313 1206 --14275 11065
NM_013233chr2------2930 419
NM_013269chr1284480 4414 3992 3977 3352 1409 1203 430 ------
NM_013277chr1221016 374 ----1977
NM_013372chr1522358 1183 ----12179
NM_013438chr951726 1533 1196 168 99 --11315 11186
NM_014112chr844015 2095 1997 782 15486 55383 5357 3583 3568 3362 --
NM_014155chr11127301 7251 6524 5240 4597 3022 3010 2105 1934 1281 463 86 --27550 6096 1824
NM_014283chr11604 ----2610 419
NM_014333chr1162361 1054 891 782 583 294 --72678 2264 979 697 495 450 208 --
NM_014372chr1----21737 625 11704
NM_014399chr7252 28 --1175 2966 64
NM_014423chr565658 4974 3759 3506 380 244 --11155 --
NM_014548chr1531466 391 97 ----1108
NM_014666chr52415 383 ----11328
NM_014682chr831759 1515 814 162 --1746
NM_014739chr633076 2572 444 12603 --11349
NM_014761chr1641170 1102 255 187 1111 2742 101 11024
NM_014776chr1243066 2550 2178 27 ----1606
NM_014803chr1052891 2652 2232 1921 138 12252 --11030
NM_014830chr1243420 2835 835 792 --42854 2780 850 116 --
NM_014840chr1263042 2750 2662 2222 1124 192 --23421 3381 --
NM_014848chr1542602 1851 1809 692 --2865 652 --
NM_014878chr9148 --253 41 --
NM_014893chrY32242 553 274 ----1231
NM_014951chr1031025 752 618 --22598 1969 1430
NM_014982chr1424713 3980 --14182 31152 714 261
NM_014988chr44847 637 148 141 22292 2033 ----
NM_015008chr363619 2953 2615 1400 1355 118 --1494 --
NM_015071chr555773 4639 512 141 114 --26450 991 --
NM_015097chr351662 627 523 447 150 --41487 910 137 132 --
NM_015144chr1623032 2581 --23921 452 11125
NM_015191chr1161954 1897 1079 1016 334 198 --22773 2478 --
NM_015206chr1553730 2881 1294 1253 1137 11225 13283 --
NM_015209chr141953 911 899 524 ----1917
NM_015247chr1675400 4578 3592 1987 643 551 141 --177 --
NM_015265chr232074 888 138 --11767 1848
NM_015271chr474264 4048 3900 3749 3540 1375 175 1336 ----
NM_015291chr143323 3138 2142 1378 ----13117
NM_015313chr1154450 1909 1557 359 195 --23895 1732 11535
NM_015349chr622688 73 --32646 2011 744 12783
NM_015397chr961867 1426 1294 1274 1186 394 --11904 --
NM_015423chr1141370 1344 502 49 --11393 11547
NM_015455chr554103 3975 3765 2649 2558 --34052 3648 2752 --
NM_015569chr134044 3144 3077 --2432 411 --
NM_015571chr622215 2038 ----1255
NM_015640chr144694 964 929 147 14451 25278 46 --
NM_015879chr1886935 5629 5514 2979 2540 2213 1971 1142 --28641 6906 --
NM_015906chr174596 3695 3546 3042 956 836 209 --24665 260 --
NM_016076chr122866 208 22359 265 33009 740 248 --
NM_016083chr623842 1105 13744 --1669
NM_016132chr1552694 1349 985 669 35 --22959 364 22627 2383
NM_016206chr318554 --48638 7367 6236 490 --
NM_016221chr522014 753 --1869 1459
NM_016227chr11604 ----2610 419
NM_016260chr2127616 7365 6237 5746 5672 5643 5565 5103 2867 2492 1558 1091 25586 4611 35059 1661 1426 11728
NM_016322chr96692 541 410 127 84 48 --1931 --
NM_016396chr1562979 2543 2338 1971 707 369 11029 1284 1406
NM_016424chr1721233 555 ----11979
NM_016531chr423632 521 --12770 13365
NM_017637chr959335 8819 7796 2833 1363 --39260 3269 2107 12072
NM_017658chr1414645 23156 1458 --13392
NM_017737chr142200 1986 1857 360 ----11364
NM_017754chr645036 4320 3227 888 --24733 3718 1650
NM_017801chr331013 977 300 ----2457 310
NM_017831chr1864751 4292 3864 1695 376 183 ------
NM_017848chrX34630 4612 188 --34266 4256 4246 14639
NM_017919chr945596 4126 3906 843 ----15669
NM_018200chr1552541 1774 1639 1040 809 --21958 799 1281
NM_018227chr412077 --12014 12495
NM_018246chr822805 776 1545 --1403
NM_018257chr2042563 1941 1933 992 --12104 --
NM_018330chr1011518 11528 1636 11698
NM_018351chr1264098 3711 3698 2877 1846 24 --1586 --
NM_018361chr853979 3237 2516 989 542 --1813 1360
NM_018364chr143802 3498 3428 2648 21638 616 1235 11158
NM_018374chr755107 4152 3431 1577 664 --44520 1783 1381 1376 13216
NM_018440chr898527 8462 5842 5621 3369 3340 1515 660 58 ------
NM_018452chr6_random21449 882 11286 1278 11134
NM_018571chr23175 144 63 ----1488
NM_018638chr12105683 5668 5448 5347 3565 3545 572 344 333 316 --193 15605
NM_018650chr142038 1808 1564 1536 --32242 252 241 --
NM_018700chr531194 289 96 11398 21045 360 --
NM_019001chr344852 4224 3452 1835 --14372 11519
NM_020122chr286033 5836 5493 4294 4273 4105 1647 1457 14323 ----
NM_020205chr152620 2379 982 601 268 1690 12727 --
NM_020245chr675032 4887 4538 4318 3198 805 203 --14467 --
NM_020338chr1043707 2866 1055 1008 --23247 1013 --
NM_020432chr712341 1765 --11877
NM_020443chr156995 5522 4776 2258 2171 --35732 5154 905 --
NM_020673chr2067481 6550 6474 2058 1907 1768 26273 1350 32325 1323 147 1409
NM_020718chr1676328 6246 5993 5861 5697 2051 1494 11139 --26460 970
NM_020728chr763053 1972 1959 1278 1236 184 12517 13152 --
NM_020742chrX42281 805 567 423 ----1249
NM_020772chr17106875 6580 5667 5569 3408 3387 2919 2345 999 427 26673 2699 --25904 280
NM_020774chr1875392 5093 4327 2151 1109 1035 854 12361 36206 5165 2001 --
NM_020779chr263217 2740 2432 892 802 87 --22087 723 --
NM_020805chr1851844 1545 1503 684 465 --1550 --
NM_020841chr1252880 1570 1141 1046 146 --13802 --
NM_020844chr847524 5406 4933 1419 --15541 17608
NM_020871chrX2888 86 ----12332
NM_020909chr263170 1401 1101 159 52 39 --12785 --
NM_020917chr1953632 2432 960 566 286 --13491 --
NM_020940chr1022926 2501 --22199 2077 22220 334
NM_020948chr143384 3025 2886 651 12467 12546 --
NM_021005chr1531085 896 457 ----180
NM_021190chr12234 209 --11211 11271
NM_021629chr333622 3455 1261 --11092 14854
NM_021911chr524903 267 --14034 15260
NM_021912chr1542800 2618 1678 1203 1922 1766 11121
NM_021964chr346086 4563 4135 819 16270 24186 160 --
NM_022133chr821721 1665 11806 --1245
NM_022459chr1361784 1573 1055 856 729 537 16288 ----
NM_022763chr342055 2017 1110 109 --1297 1846
NM_022776chr361401 1324 609 412 387 43 ----11453
NM_022781chr942829 2387 2340 1138 --32410 1190 825 --
NM_022898chr1464615 3614 3462 3390 726 228 --44139 3840 1370 291 --
NM_022900chr751201 1067 819 139 129 --11151 --
NM_022977chrX21000 775 11932 1252 12576
NM_024491chr31657 ----2530 450
NM_024524chr342047 851 629 520 12781 11246 1755
NM_024665chr394540 4363 3435 3388 1783 1678 1431 1081 746 --43816 3160 482 204 --
NM_024757chr93441 400 374 --11137 11079
NM_024989chr288052 7475 5365 5135 5095 2798 1934 286 --15382 --
NM_025146chr331729 1099 246 ----12361
NM_030579chr163971 806 212 --43316 1251 1127 284 --
NM_030647chr746196 2108 2024 776 --46235 6094 4504 825 --
NM_030650chr273962 3425 3292 3246 3003 2627 304 21473 1238 13861 --
NM_030791chr1431832 1327 660 ----1198
NM_030796chr75558 551 195 64 57 --21851 204 --
NM_031216chr1822089 1965 --1241 11451
NM_031262chr921025 366 --155 1238
NM_031263chr921082 423 --1112 1295
NM_031268chr1685316 4616 3417 2106 1029 916 617 521 --11932 --
NM_031461chr811746 1594 --22166 509
NM_032121chrX32590 2011 1974 ----12280
NM_032221chr201402 11581 --21430 232
NM_032228chr1143255 2819 730 521 --22970 2238 --
NM_032352chr141240 --21343 1217 11145
NM_032373chr1045824 1642 1238 573 --25805 1688 --
NM_032436chr132687 209 ----1909
NM_032491chr1271207 1111 1055 295 279 250 223 ------
NM_032810chr101434 11370 --11185
NM_032837chr173674 277 26 ----11889
NM_032859chr1333973 3725 410 1303 13457 --
NM_032873chr1183619 3257 2892 1302 1207 958 672 50 --1281 --
NM_032968chrX14240 11374 22860 1366 --
NM_032969chrX14240 11374 22860 1366 --
NM_033020chr174596 3695 3546 3042 956 836 209 --24665 260 --
NM_033181chr623842 1105 13744 --1669
NM_033224chr746763 6308 2543 2054 1760 47202 7180 2416 271 --
NM_033285chr863893 3052 2887 1159 815 556 13501 ----
NM_033430chr433096 434 272 ----1817
NM_033437chr433096 434 272 ----1817
NM_033512chr853033 2950 2847 657 502 13103 12772 --
NM_052879chr1252719 1449 885 564 412 --33959 1201 1027 --
NM_052885chr1264245 3880 3852 1529 930 421 13285 ----
NM_052917chr243053 2378 446 140 --12467 12671
NM_052918chr1073730 3290 2823 1203 994 706 655 --1120 --
NM_053016chr978003 7584 7560 7026 5526 5154 1583 25975 2162 17915 1595
NM_053043chr7116368 5162 5007 4739 4051 4029 2186 1838 1523 1070 923 --45835 5507 5412 253 --
NM_057169chr1243066 2550 2178 27 ----1606
NM_057170chr1243066 2550 2178 27 ----1606
NM_080759chr1322542 362 ----1519
NM_080760chr1322542 362 ----1519
NM_080867chr1434896 4085 878 --12002 11569
NM_133334chr446383 6226 5036 104 ----15604
NM_133370chr453643 2596 2502 1152 1079 --12411 13559
NM_133496chr143912 3812 1281 1015 11234 1314 --
NM_138270chrX33134 2810 2435 12795 --12416
NM_138292chr1151088 989 868 730 704 --12597 --
NM_138576chr1464615 3614 3462 3390 726 228 --44139 3840 1370 291 --
NM_138621chr253947 2814 1494 1280 625 1867 23168 169 --
NM_138713chr1698264 7730 6380 6311 5747 2895 2821 2437 1526 --22966 1587 --
NM_138714chr1698264 7730 6380 6311 5747 2895 2821 2437 1526 --22966 1587 --
NM_138959chr125070 327 11272 45289 2225 1787 399 1258
NM_144571chr4116563 6238 5392 4969 4583 2709 2561 2450 1801 849 33 --16076 --
NM_144578chr1452114 1833 1525 1195 1161 ----15247
NM_145011chr102345 156 1740 --11994
NM_145284chrX1420 --11900 11708
NM_145307chr1023885 728 ----11671
NM_145649chr652588 1741 1008 631 569 1983 ----
NM_145655chr652588 1741 1008 631 569 1983 ----
NM_147156chr1021340 1311 ----1600
NM_152263chr146090 5593 568 22 11694 35923 5464 5435 --
NM_152529chr221740 122 --13984 13664
NM_152754chr732709 1546 1379 1989 23052 57 --
NM_152793chr754673 2082 2041 1807 1154 15083 34705 3519 1477 --
NM_152835chr132721 2708 481 --2903 44 12859
NM_152836chr821721 1665 11806 --1245
NM_152837chr821721 1665 11806 --1245
NM_152924chr1546490 4255 1826 1368 24367 1990 --15873
NM_153456chr1316200 --159 13926
NM_153607chr523077 2508 22414 274 33010 1068 73 --
NM_170731chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_170732chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_170733chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_170734chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_170735chr1152562 2553 1880 448 427 12422 32573 576 399 --
NM_172071chr187473 7088 5228 2638 1344 498 339 259 --25728 2228 12579
NM_173214chr1698264 7730 6380 6311 5747 2895 2821 2437 1526 --22966 1587 --
NM_173582chr1176188 4880 2340 1157 585 541 335 --11967 1273
NM_173602chr1263638 2872 1080 421 279 171 12439 13825 --
NM_173642chr177641 7297 7286 3589 2099 1637 837 ------
NM_173809chr1021013 986 --1966 1401
NM_173851chr833749 2586 939 23497 1371 --13962
NM_175610chr151344 --21332 900 21359 304
NM_175748chr1442152 1627 106 95 1325 1703 --
NM_175854chr1322670 2105 ----12603
NM_175873chr531299 1074 479 --2447 104 --
NM_178151chrX87851 7828 5620 5545 1497 1434 845 346 ------
NM_178152chrX87851 7828 5620 5545 1497 1434 845 346 ------
NM_178153chrX87851 7828 5620 5545 1497 1434 845 346 ------
NM_178586chr1462189 1838 1553 355 120 53 --1804 --
NM_181332chrX42281 805 567 423 ----1249
NM_181645chr112557 130 --3721 108 103 --
NM_182485chr463657 3397 2928 2470 1415 22 ----13598
NM_182515chr1966535 6203 5999 5371 2489 1750 --11722 15632
NM_182646chr463657 3397 2928 2470 1415 22 ----13598
NM_182758chr1513185 ----23034 271
NM_194291chr811904 --21098 358 12640
NM_194314chr154252 4140 1142 527 152 11853 ----
NM_194328chr942829 2387 2340 1138 --32410 1190 825 --
NM_194329chr942829 2387 2340 1138 --32410 1190 825 --
NM_194330chr942829 2387 2340 1138 --32410 1190 825 --
NM_194332chr942829 2387 2340 1138 --32410 1190 825 --
NM_194434chr1843996 2030 1052 362 ----1752
NM_198066chr1443023 2590 671 518 ----11063
NM_198273chr562195 2102 1262 1132 1042 719 1965 ----
NM_198468chr634025 1459 283 11513 33232 1184 98 --
NM_198581chr2127527 7514 6578 5500 4786 3019 2720 2246 1494 1406 1028 924 --12823 15923
NM_199188chr1252719 1449 885 564 412 --33959 1201 1027 --
NM_199190chr1252719 1449 885 564 412 --33959 1201 1027 --
NM_199324chr421209 217 --43659 3151 3039 1153 --
NM_199421chr1434896 4085 878 --12002 11569
NM_201437chr831247 1022 161 1358 21135 230 1348
NM_203394chr1232497 2178 2114 --1983 1125
NM_203446chr2142991 681 197 114 12394 --12822
NM_206854chr664253 3395 599 455 274 73 --1383 --
NM_206855chr685218 4360 1564 1420 1239 1038 654 215 --11348 --
NM_206876chr232359 1252 532 33431 2486 200 ----
NM_207043chr162242 2070 2052 1603 442 425 ----1182
NM_207044chr162242 2070 2052 1603 442 425 ----1182
NM_207047chr162242 2070 2052 1603 442 425 ----1182
NM_212558chr944211 3093 1490 702 1437 13112 13263
NM_213594chr1271207 1111 1055 295 279 250 223 ------