TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-96-3p
miRNA Sequence: AAUCAUGUGCAGUGCCAAUAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr551774 1437 1346 795 530 --1587 1333
NM_000217chr1265020 4814 3866 1932 1158 395 ----1489
NM_000259chr15106242 6128 5797 5529 5160 5011 1856 1430 1140 805 1553 12092 --
NM_000264chr9103181 2955 2741 2629 2130 1050 962 845 546 231 22501 519 ----
NM_000441chr772250 901 828 745 718 681 176 ----21731 707
NM_000448chr1153222 2203 2068 800 550 ----1424
NM_000555chrX67456 5200 2929 1518 1042 818 26907 6370 1811 --
NM_000618chr12105828 5761 5618 5611 5570 5352 4693 2299 957 928 --15632 --
NM_000618chr12105828 5761 5618 5611 5570 5352 4693 2299 957 928 --15632 --
NM_000793chr1453746 3252 3123 1657 133 11028 34967 1684 1504 --
NM_000809chr478538 7679 6599 6582 3032 2851 2312 38880 7227 674 28297 2878 --
NM_000813chr5105495 3537 1861 1523 1420 1161 801 676 620 463 --34978 1881 233 11461
NM_000899chr1263950 3171 3021 1713 1522 861 ----14379
NM_001001668chr1944031 3575 1672 792 23790 1646 2659 462 11496
NM_001001709chr982753 2469 1161 1113 844 478 460 129 --11044 --
NM_001003652chr18108386 8228 8008 7752 6540 6520 3270 1968 782 324 --18277 --
NM_001003674chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_001003675chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_001004065chr973375 1504 830 663 594 546 409 ----12545
NM_001004346chr421081 425 ----2934 103
NM_001004419chr1282898 1721 1690 610 604 345 251 176 11660 --13251
NM_001007023chr1453746 3252 3123 1657 133 11028 34967 1684 1504 --
NM_001007278chr1364182 4065 3340 1799 1263 614 --44765 4240 714 284 --
NM_001008539chr8154817 4657 4639 4381 4359 4075 4024 3938 3684 3545 3315 2164 1693 511 287 --34429 4184 1447 11956
NM_001009554chr464305 3659 1895 1656 1310 1184 ----13238
NM_001009554chr464305 3659 1895 1656 1310 1184 ----13238
NM_001009899chr396510 5583 2254 1606 1563 1389 1107 208 80 14944 16335 --
NM_001011513chr453879 3177 3093 1280 588 --21235 623 14085
NM_001012755chrX84856 4269 3744 3684 3507 3393 1734 567 34868 4062 467 ----
NM_001012761chr582650 2528 2053 1944 1089 894 845 111 ------
NM_001013620chr12118149 7861 7847 7726 7583 7009 6587 1322 674 664 84 18034 37553 5171 1237 27549 6598
NM_001014797chr10108075 8069 8063 7112 5767 5226 5189 3176 1246 56 11647 28216 1528 --
NM_001018067chr194465 4026 3699 3676 3623 1770 1679 1149 958 1586 1460 --
NM_001018068chr194465 4026 3699 3676 3623 1770 1679 1149 958 1586 1460 --
NM_001018069chr194465 4026 3699 3676 3623 1770 1679 1149 958 1586 1460 --
NM_001023567chr1582446 2120 2002 1782 1568 948 424 114 ------
NM_001025266chr3124282 3948 3520 3267 3178 3142 1855 1641 771 724 638 580 --14934 --
NM_001025580chrX104225 4206 4177 1393 1188 1108 631 619 125 104 2670 161 ----
NM_001030055chr14114152 4041 4016 3633 3563 2976 1542 920 784 357 188 --23720 3290 --
NM_001033925chr1062160 769 508 203 195 69 21360 35 1210 --
NM_001037132chr752070 1414 406 310 175 --2361 304 --
NM_001037133chr752070 1414 406 310 175 --2361 304 --
NM_001037174chr252234 2083 904 735 690 --22130 1722 --
NM_001039199chr2095026 3608 3177 1814 1455 1165 196 143 137 --54925 4316 3562 1808 1768 --
NM_001039618chr1183818 3685 3659 1708 1038 886 559 151 --15365 12099
NM_001039693chr284009 3211 2892 2607 730 711 667 267 ----12563
NM_001039840chrX65708 5154 3955 2105 661 600 --25512 2042 --
NM_001040202chr452559 1915 1883 1562 113 12073 11697 --
NM_001040665chr7134635 4216 3975 3162 3123 1880 1519 1334 1023 938 631 567 188 1493 ----
NM_001042355chr1644891 3426 1252 386 ----1287
NM_001042412chr1644891 3426 1252 386 ----1287
NM_001042493chr661452 1393 702 492 485 317 11907 ----
NM_001042550chr951924 1805 1269 633 579 ----1331
NM_001042555chr12114332 4295 3939 3923 3916 1633 1594 1575 660 452 328 --14352 --
NM_001042599chr287888 7834 7236 6794 4801 2045 1408 1269 --1505 --
NM_001042603chr12124879 3948 3497 3439 3381 3323 2083 1261 1220 791 37 27 --25222 4088 --
NM_001042604chr3104823 4782 3884 3414 3139 1505 807 420 413 331 ------
NM_001044387chr1994067 3616 3150 2857 2557 1116 892 757 55 14214 13910 --
NM_001044388chr1994067 3616 3150 2857 2557 1116 892 757 55 14214 13910 --
NM_001099678chr3136258 5943 5086 4832 4743 4439 2333 1649 1409 1029 605 550 264 --26367 647 --
NM_001173chr14114152 4041 4016 3633 3563 2976 1542 920 784 357 188 --23720 3290 --
NM_001186chr214815 679 150 73 12100 22577 2300 --
NM_001204chr287461 7266 7215 6165 5689 5585 4965 2997 12352 --16637
NM_001241chr22508 422 ----21942 291
NM_001241chr22508 422 ----21942 291
NM_001759chr12105177 5119 4520 3898 2094 1905 1845 1273 794 428 --2516 482 15189
NM_001821chr1144255 3548 3499 3406 3253 1858 1690 1575 1548 1315 1267 573 224 82 --2490 107 1527
NM_001918chr1109117 8511 8458 7459 7180 5924 3404 2728 303 115 --56845 2966 2242 1712 393 18522
NM_002006chr464699 4371 3964 3732 2052 34 24518 482 23748 1879 15535
NM_002025chrX198602 8565 8467 8406 7945 7364 7156 7019 6189 5836 3565 2940 2705 2555 2502 2099 1625 1407 384 37134 6314 1675 --13549
NM_002063chrX31025 866 149 ----3316 294 272
NM_002203chr573810 3683 3499 3281 1125 322 305 --1231 1346
NM_002210chr252361 2336 2220 1150 496 --11390 1551
NM_002214chr7105721 4751 4520 4461 4361 4279 4235 3819 1441 158 ----25527 4587
NM_002270chr575652 4804 1992 1786 1736 1428 1235 12091 25030 499 --
NM_002486chr981803 1606 1559 984 554 450 402 146 1213 ----
NM_002709chr252506 1345 981 328 104 ----11205
NM_002737chr1785148 4955 4912 4592 2591 2414 1443 598 16640 16393 11514
NM_002745chr2243983 1610 1380 1128 2617 425 23445 346 13373
NM_002748chr1531253 1124 352 ----21059 439
NM_003034chr12136868 6735 6417 5193 4998 3036 2891 2444 1917 1810 1202 819 215 --1268 --
NM_003046chr8154817 4657 4639 4381 4359 4075 4024 3938 3684 3545 3315 2164 1693 511 287 --34429 4184 1447 11956
NM_003099chr1584358 4121 4067 2581 2297 2085 930 396 16426 12594 --
NM_003108chr266797 6760 6263 6103 2419 383 --36333 4977 200 --
NM_003144chr651615 1566 665 640 383 11717 12059 --
NM_003199chr1854635 4548 3803 995 454 --44756 3616 3505 1218 --
NM_003262chr384915 4859 4796 4688 4269 4254 928 81 --11691 --
NM_003412chr332751 1964 1016 --12976 22774 1147
NM_003489chr2173082 3059 2978 2735 2374 1126 78 197 ----
NM_003566chr1293398 3230 3169 2944 2812 2717 599 521 389 ------
NM_003574chr1895768 5721 5211 5069 4973 4456 4293 2284 680 24383 569 1385 --
NM_003590chr233951 3450 3417 --33370 1629 1040 --
NM_003615chr343910 3265 1352 942 12717 33148 1064 200 --
NM_003909chr832942 2215 103 --2729 303 1452
NM_003913chr624016 189 1119 23104 2769 13839
NM_003994chr1263950 3171 3021 1713 1522 861 ----14379
NM_004171chr11189168 9135 8866 8617 8273 8043 8003 3615 2965 2429 2175 1745 1625 1593 1273 1012 505 341 --28429 1905 --
NM_004232chr1863544 3259 2654 1566 1134 794 --12799 12529
NM_004319chr193165 3117 2942 2670 1220 1117 188 171 100 --1720 --
NM_004338chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_004464chr454230 4193 1549 1487 486 --23723 754 1347
NM_004586chrX74657 4539 1626 1429 784 273 32 34488 1217 962 45131 3830 1580 228 --
NM_004726chrX64646 3563 879 853 610 134 35786 5530 3913 35747 4835 3524 --
NM_004748chr1583609 3557 1228 1073 813 572 270 30 1446 1164 --
NM_004775chr1831688 743 453 21988 1882 --1786
NM_004857chr14104466 4174 4155 3689 3226 3008 1757 1714 1438 591 14212 ----
NM_004866chr5115041 4805 4533 4439 4298 4243 3726 3428 3121 861 309 --14193 --
NM_004956chr7114578 4263 3296 3113 1767 1759 1631 1380 811 595 309 24193 3620 --11028
NM_005010chr752070 1414 406 310 175 --2361 304 --
NM_005056chr12125123 4192 3741 3683 3625 3567 3404 1505 1464 1035 281 271 --25466 4332 --
NM_005065chr1484889 4319 4243 3673 1585 1569 1294 988 13882 14619 --
NM_005197chr1475656 4886 1853 1761 1367 1360 1119 11804 35980 2296 2232 --
NM_005233chr321848 127 --62476 2369 2352 1772 1591 347 --
NM_005235chr287888 7834 7236 6794 4801 2045 1408 1269 --1505 --
NM_005264chr106824 354 348 333 327 312 ------
NM_005399chr122911 217 --12715 34398 4393 530
NM_005400chr242735 2086 1134 840 12040 --12207
NM_005497chr17136103 6019 5897 5649 5565 5531 5313 5269 5134 4232 4011 1671 123 15085 14320 15225
NM_005596chr985390 5007 4710 2451 1325 914 612 363 25355 444 24395 2558 --
NM_005665chr194745 4516 4131 3185 3162 1750 1587 1091 925 24900 3498 54351 3241 1422 983 54 --
NM_005668chr573550 3342 2882 1622 1197 892 593 11702 13320 13728
NM_005798chr1364182 4065 3340 1799 1263 614 --44765 4240 714 284 --
NM_005901chr18108386 8228 8008 7752 6540 6520 3270 1968 782 324 --18277 --
NM_006080chr742469 1924 1184 79 11158 --12179
NM_006135chr1------21153 63
NM_006251chr532176 1159 728 12502 1146 13367
NM_006252chr167519 5855 5673 5456 4722 109 1210 34959 4798 1795 15277
NM_006315chr474064 3403 3313 3287 1274 552 449 23940 382 13415 --
NM_006379chr782227 1612 1462 508 446 392 204 195 31604 1594 169 21574 1548 --
NM_006457chr453879 3177 3093 1280 588 --21235 623 14085
NM_006467chr572062 1498 683 637 264 254 32 --1464 --
NM_006614chr383661 2997 2630 2415 2312 1383 636 471 12505 33535 3353 2344 --
NM_006620chr6104585 4495 4476 4026 3778 3220 1799 1105 865 766 11078 1711 --
NM_006654chr12114332 4295 3939 3923 3916 1633 1594 1575 660 452 328 --14352 --
NM_006717chr953367 2504 1110 945 708 --22190 2160 1573
NM_006750chr16107446 7147 6454 6406 5878 3142 2754 2514 2382 2020 12840 15832 16720
NM_006885chr1684273 4127 4103 3940 3917 3287 3226 840 1833 ----
NM_007050chr20108067 7744 6623 6482 5981 5452 5430 2551 1952 1878 --17487 --
NM_007137chrX115136 4825 4747 4487 3414 1682 1242 1153 961 809 98 25473 4623 --11497
NM_007203chr973375 1504 830 663 594 546 409 ----12545
NM_007249chr13149369 8556 8207 6821 6765 6714 6527 6167 6005 5995 3207 3053 954 490 19141 11342 16755
NM_007331chr4102447 2167 2108 1906 978 841 816 641 560 323 ----22398 593
NM_007375chr172580 2418 1747 816 516 445 201 22266 64 --12490
NM_012097chr252234 2083 904 735 690 --22130 1722 --
NM_012164chr9107383 6774 5735 5090 1782 1086 992 920 427 84 ------
NM_012262chr175144 4192 3825 3719 1836 1575 101 ----14978
NM_012281chr761645 1557 609 425 407 273 21700 542 ----
NM_012287chr343331 3102 1660 26 23564 3393 21115 524 --
NM_012294chr7104084 3941 3842 3203 3162 2997 1301 373 301 268 --1818 --
NM_012382chr593819 3298 3270 2936 1792 1779 1749 680 190 22945 365 14373 --
NM_012395chr793220 2823 2623 2482 1365 677 264 236 90 ----23426 2866
NM_013231chr1453832 3665 3328 3027 2827 --12680 1961
NM_013269chr1282825 1648 1617 537 531 272 178 103 11587 --13178
NM_013381chr1241754 907 466 249 11791 21775 557 1293
NM_013989chr1453746 3252 3123 1657 133 11028 34967 1684 1504 --
NM_014021chr163172 3048 2885 2715 2598 2485 12288 1509 11027
NM_014048chr1695100 3844 3713 3205 1639 1335 1057 978 46 --14523 --
NM_014112chr8155371 5198 5177 4773 4558 4523 3738 3520 3447 3433 1929 1725 968 607 122 ------
NM_014155chr11117524 6645 5053 5039 1827 1794 1578 908 838 828 636 12314 37449 482 50 --
NM_014296chr341410 1123 601 533 --31320 273 212 --
NM_014331chr486403 6035 5962 1487 1442 1354 897 447 12184 17699 16668
NM_014423chr5115192 4825 4737 4313 4002 3717 3551 1604 1033 625 606 22048 255 11502 --
NM_014721chr696816 6257 5826 5492 5005 2973 1465 1391 1145 --12811 --
NM_014747chr1115780 4969 4925 4584 4171 1795 1507 1070 955 320 197 12173 15817 --
NM_014755chr2104249 4080 4032 3394 2896 2711 1335 1127 618 517 1581 ----
NM_014829chr552361 456 440 217 40 ----1754
NM_014877chr17147074 6725 6459 6181 6138 5963 5855 4954 3114 2436 2135 1873 1570 584 17748 ----
NM_014893chrY82362 2287 2227 2034 2015 798 469 205 1326 ----
NM_014904chr10104020 3631 3526 3495 3431 829 693 651 473 317 --24046 1273 13764
NM_014982chr14105124 4787 4703 4469 4196 4152 2170 399 340 244 --24050 2159 --
NM_015026chr1274665 4187 3973 1632 1531 1415 766 --1667 --
NM_015071chr5106528 5867 5563 4706 3955 2427 2336 774 169 131 ----138
NM_015247chr1644891 3426 1252 386 ----1287
NM_015271chr483982 3889 3701 3203 2997 2959 1698 31 12825 11130 12667
NM_015272chr1671558 841 783 484 431 64 50 ----1267
NM_015310chr8107316 3362 3173 2530 2449 2289 1666 1601 532 247 11640 --28389 2809
NM_015336chr12102435 2353 2173 1995 980 903 743 689 395 172 --1329 --
NM_015365chrX104225 4206 4177 1393 1188 1108 631 619 125 104 2670 161 ----
NM_015375chr184259 3316 3250 3154 1955 700 461 386 --24213 788 11186
NM_015455chr532517 615 453 24076 3926 43006 1505 677 463 --
NM_015569chr164691 3410 3219 3032 829 360 2806 161 11464 13488
NM_015640chr194465 4026 3699 3676 3623 1770 1679 1149 958 1586 1460 --
NM_015713chr832798 2714 262 22535 722 --21285 1146
NM_016206chr3108718 8569 8203 7620 7252 3540 2031 1931 1697 1691 --12000 18989
NM_016260chr295749 5156 4832 4781 4746 2849 2377 358 49 16435 --11503
NM_016353chr832451 1748 130 1768 --11613
NM_017637chr988559 8378 8050 8035 7219 6936 5820 3032 --1707 27386 6742
NM_017650chr795514 5247 4840 4171 2231 1792 1446 552 339 11864 25267 4654 --
NM_017737chr152216 1774 1492 466 114 1679 1131 1743
NM_018247chr652973 2787 2050 353 178 --1274 11165
NM_018364chr121434 483 32792 943 905 11178 1765
NM_018374chr755263 5021 4419 4124 3621 11341 21824 1142 11842
NM_018440chr878642 8119 6283 5245 2360 968 950 --36235 2209 1423 12230
NM_019001chr3104823 4782 3884 3414 3139 1505 807 420 413 331 ------
NM_019022chr1872945 2811 2431 2422 1283 157 81 23181 2408 12005 --
NM_019094chr12103773 3587 3192 2936 2822 2687 2381 1511 1468 523 ------
NM_019114chr972576 1920 1914 936 362 124 34 --1317 22168 603
NM_020119chr773200 3087 2825 2689 2482 885 705 --11114 --
NM_020122chr285360 4675 4501 4119 1936 1469 395 374 --12058 1155
NM_020297chr1273313 2613 2565 2444 2274 1285 804 --11044 --
NM_020337chr463001 2522 2136 1005 817 358 23081 2974 ----
NM_020390chr354334 4045 3691 1374 1199 12995 11763 1837
NM_020425chr661452 1393 702 492 485 317 11907 ----
NM_020647chr862207 2178 2124 2051 1527 1518 ------
NM_020673chr20137431 7424 6498 5829 5683 5657 5315 3093 2982 2367 2286 2143 696 12931 27551 5882 --
NM_020739chr1583609 3557 1228 1073 813 572 270 30 1446 1164 --
NM_020774chr1855797 5559 4564 2086 1834 14028 11164 1460
NM_020918chr1063308 3207 2747 2537 2454 2385 ----1379
NM_020940chr1031789 891 477 12695 --22874 601
NM_021255chr1443652 1310 662 149 --53171 1432 829 725 137 13042
NM_021647chr464305 3659 1895 1656 1310 1184 ----13238
NM_021911chr5105495 3537 1861 1523 1420 1161 801 676 620 463 --34978 1881 233 11461
NM_021964chr386496 6050 4481 2623 2614 2497 768 128 21808 1379 --16617
NM_021998chrX1991 --1970 21200 42
NM_022048chr15105930 5389 2546 2173 2045 1661 1649 1087 880 788 15103 12501 --
NM_022058chr241701 1549 1408 127 --11798 1599
NM_022843chr1351423 1249 1022 466 411 --1254 1508
NM_023929chr892717 2566 2128 1130 767 686 340 215 47 ----32403 836 821
NM_024341chr1994067 3616 3150 2857 2557 1116 892 757 55 14214 13910 --
NM_024345chr9115863 5527 5075 4794 4650 2270 1993 1233 1122 878 640 24020 278 11638 --
NM_024638chr382281 1875 1714 872 630 156 69 59 11791 12066 --
NM_024665chr384506 4144 3286 1561 1521 1188 507 267 13667 13947 --
NM_024713chr1531593 1482 492 31109 630 581 --11641
NM_024770chr2116348 5880 5813 4633 4399 4143 2457 2359 1476 786 740 11237 1907 --
NM_024947chr3138330 7825 7579 6912 6848 6772 6762 6563 5965 2965 2791 223 87 38490 2689 257 21166 963 --
NM_024953chr1262232 1883 913 119 87 45 1851 ----
NM_024989chr2117915 7642 7447 7146 5068 2411 1030 831 677 315 177 --37629 948 637 15346
NM_030621chr1453720 3300 3178 2779 2753 1770 24139 1612 --
NM_030627chr562948 2925 2795 2527 1547 190 --23107 1558 --
NM_030648chr465500 5441 5400 5170 4936 250 25090 4106 ----
NM_030670chr1282290 2209 1531 725 416 258 161 130 --12192 --
NM_030671chr1282290 2209 1531 725 416 258 161 130 --12192 --
NM_030674chr1255373 3918 1914 1802 511 14112 44633 4442 3781 159 1329
NM_030755chr1462888 2698 2499 2412 198 31 1621 1182 1576
NM_031418chr1192795 2729 2515 2453 2443 2196 1713 1097 865 ------
NM_031442chrX93193 3176 3069 3047 2432 2258 2054 731 279 13079 --12065
NM_031469chr673175 3111 2734 1333 1151 1119 170 --11629 --
NM_032373chr1084062 3729 3602 2244 1424 1289 1173 277 1250 13988 --
NM_032435chr142101 1890 1808 1727 --2773 158 11630
NM_032446chr563700 2807 523 279 249 125 13075 --23018 2964
NM_032828chr19134471 4319 4232 4059 3768 3614 3349 3216 1697 782 477 457 411 14313 --1713
NM_032832chr631657 1382 203 --11724 11218
NM_032869chr871886 1793 1625 449 289 161 115 12060 ----
NM_032968chrX73716 3441 2917 2799 1623 1300 1229 13485 23866 3316 13142
NM_032969chrX73716 3441 2917 2799 1623 1300 1229 13485 23866 3316 13142
NM_032973chrY73708 3437 2912 2794 1622 1300 1229 13481 23858 3311 13137
NM_033143chr454561 4524 2905 1818 817 --24054 1085 1678
NM_033224chr7106983 6873 6204 6124 6091 5272 5217 3117 1910 1362 --25926 5172 --
NM_033505chr276367 5766 5155 5107 1542 1177 1089 36085 2483 2408 25485 4550 --
NM_052811chr1364182 4065 3340 1799 1263 614 --44765 4240 714 284 --
NM_052832chr843023 2354 2208 789 --22574 263 13043
NM_053016chr9166733 6502 6240 6199 5942 5801 5792 4998 3133 3082 2930 2775 2761 2518 984 756 --11443 11559
NM_053064chr1463069 2332 2082 2061 2049 774 1623 12617 1688
NM_058241chr22408 322 ----21842 191
NM_058241chr22408 322 ----21842 191
NM_080867chr1484977 4835 4796 3839 1965 1575 1183 1056 --34536 303 278 --
NM_133170chr20108067 7744 6623 6482 5981 5452 5430 2551 1952 1878 --17487 --
NM_133646chr245029 1374 629 134 1538 23884 1502 15223
NM_138468chr285378 5067 4397 3862 2256 2193 2131 2098 11757 44557 2283 1454 1097 --
NM_138473chr1285015 4354 3934 3275 1351 323 115 82 --21415 374 --
NM_138694chr653371 2675 640 564 210 ----12991
NM_138731chr1473680 3397 3077 2884 1021 621 486 --13440 12951
NM_138782chr542109 1543 442 91 --1596 11592
NM_144571chr4136297 5208 5197 5182 4981 4515 2436 2321 2312 2078 1779 881 622 35350 2612 536 16941 1554
NM_144578chr1465442 5191 4914 3690 1063 59 --15112 15185
NM_144599chr1584815 4492 3875 1681 1234 607 95 61 --21985 1112 1354
NM_145259chr286646 6002 5458 2076 930 513 341 141 21247 823 11359 --
NM_145284chrX32475 456 368 --12061 12418
NM_145793chr106824 354 348 333 327 312 ------
NM_147150chr973375 1504 830 663 594 546 409 ----12545
NM_148955chr1584358 4121 4067 2581 2297 2085 930 396 16426 12594 --
NM_152624chr536922 5070 2794 34799 2143 1588 11662 15889
NM_152636chr1183019 2875 2628 2406 2316 2278 638 264 22810 1065 12742 --
NM_152673chr384383 4242 4125 4076 3812 1587 1395 1032 13684 34406 1627 810 --
NM_152723chr1121123 335 1142 1776 1936
NM_152756chr584048 3684 3376 2914 1440 690 218 141 13242 ----
NM_152774chr771955 1665 1087 1039 780 348 316 --22294 1738 --
NM_152826chr1584358 4121 4067 2581 2297 2085 930 396 16426 12594 --
NM_152902chr121674 643 ----21992 1510
NM_152999chr7134635 4216 3975 3162 3123 1880 1519 1334 1023 938 631 567 188 1493 ----
NM_153188chr575652 4804 1992 1786 1736 1428 1235 12091 25030 499 --
NM_153207chr1273853 3699 3482 3115 2494 1158 823 1519 ----
NM_153456chr1385588 4995 4859 4579 4395 4346 1102 352 --26002 1202 --
NM_153607chr563211 2282 1966 646 198 154 12366 12684 23091 978
NM_153712chr293705 3499 3437 3300 2537 2507 2413 686 141 13222 33262 1443 754 1705
NM_170710chr452531 2511 2458 995 709 1951 22888 2737 --
NM_172070chr221509 1380 --2872 484 11804
NM_173468chr465636 3859 2278 1868 1111 999 24680 501 12269 14685
NM_173519chr862022 2008 1983 1916 684 678 --11277 --
NM_173536chr4125160 4283 3533 1998 1699 1567 1458 1443 1205 773 296 186 --24946 4407 --
NM_173582chr11105985 5192 4868 4813 4583 2312 2091 1961 1681 1176 1361 ----
NM_173808chr153551 3545 311 228 114 24320 531 1866 11352
NM_175861chr1285591 4825 4450 4368 4220 2180 958 636 14405 15998 --
NM_177438chr1453720 3300 3178 2779 2753 1770 24139 1612 --
NM_177966chr321454 65 ----11192
NM_177985chr252234 2083 904 735 690 --22130 1722 --
NM_178151chrX67456 5200 2929 1518 1042 818 26907 6370 1811 --
NM_178152chrX67456 5200 2929 1518 1042 818 26907 6370 1811 --
NM_178153chrX67456 5200 2929 1518 1042 818 26907 6370 1811 --
NM_181265chr452531 2511 2458 995 709 1951 22888 2737 --
NM_181481chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_181482chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_181483chr1876506 6166 2798 2579 1025 628 485 16818 --197
NM_181504chr5114003 3699 3578 2789 2639 1641 1345 1167 1161 334 187 --12822 --
NM_181523chr5114003 3699 3578 2789 2639 1641 1345 1167 1161 334 187 --12822 --
NM_181524chr5114003 3699 3578 2789 2639 1641 1345 1167 1161 334 187 --12822 --
NM_181787chr843853 2621 643 440 2726 581 1247 13056
NM_182503chr695629 5448 5427 4982 4493 4157 3965 1783 1405 --14323 1764
NM_182515chr19116729 6047 5306 5263 2551 2148 1993 1774 1695 1088 350 15344 14643 --
NM_194291chr852460 2411 1163 658 344 --32291 833 740 --
NM_194314chr184912 4898 4113 4012 1893 1835 758 164 --22189 1818 --
NM_194434chr1895768 5721 5211 5069 4973 4456 4293 2284 680 24383 569 1385 --
NM_198270chrX123519 3298 3069 2809 2486 2273 2255 2247 2233 707 655 50 --1629 --
NM_198581chr286689 5874 5526 5417 4729 2169 710 137 --1368 16844
NM_198715chr195572 3871 2306 2225 1928 1720 1714 1041 337 13848 45602 4992 4631 1851 --
NM_198859chr364793 4458 1862 1687 1673 938 --15126 11807
NM_199040chr12103773 3587 3192 2936 2822 2687 2381 1511 1468 523 ------
NM_199072chr793213 3011 2965 2648 2334 1981 937 398 98 --2518 169 --
NM_199421chr1484977 4835 4796 3839 1965 1575 1183 1056 --34536 303 278 --
NM_199462chr184259 3316 3250 3154 1955 700 461 386 --24213 788 11186
NM_206853chr6104055 3780 3338 3194 2909 2762 1324 1057 589 399 12630 12783 --
NM_206854chr6105316 5041 4599 4455 4170 4023 1850 1660 297 132 13891 24044 722 11005
NM_206855chr6116281 6006 5564 5420 5135 4988 1262 1097 870 749 684 24856 3977 25009 1687 11970
NM_206866chr214815 679 150 73 12100 22577 2300 --
NM_206876chr252506 1345 981 328 104 ----11205
NM_206907chr532176 1159 728 12502 1146 13367
NM_206909chr8107316 3362 3173 2530 2449 2289 1666 1601 532 247 11640 --28389 2809
NM_207303chr1053564 1511 1389 1140 531 22972 833 --23533 1371
NM_207406chr4106157 5851 5576 4713 4498 3983 2171 1876 1344 383 12618 12298 --
NM_212558chr973012 2835 1598 1287 618 370 38 11506 --23064 1133
NM_213589chr2145401 5179 4704 4172 2229 2093 1445 1213 1014 867 792 695 577 99 21476 27 ----
NM_213590chr1364182 4065 3340 1799 1263 614 --44765 4240 714 284 --