TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-96-5p
miRNA Sequence: UUUGGCACUAGCACAUUUUUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521261 975 ------
NM_000052chrX53009 2891 2465 835 23 33465 3068 296 ----
NM_000061chrX1380 ------
NM_000084chrX46831 6038 2454 2391 35648 5234 5119 24880 2433 --
NM_000088chr1731062 930 887 ------
NM_000090chr22249 73 --1690 --
NM_000091chr211811 22395 2314 12307 12606
NM_000092chr263938 3255 1263 903 579 275 43635 3429 3169 1638 31362 921 72 --
NM_000110chr131025 267 172 ----1913
NM_000112chr585566 4519 3667 1929 1463 1028 889 556 13591 ----
NM_000115chr1342332 2192 1688 1019 22031 77 1702 --
NM_000125chr654141 4010 2625 1483 575 14107 ----
NM_000129chr621413 1065 1571 1229 --
NM_000138chr1552475 860 835 608 423 ------
NM_000161chr143231 44 32 1264 1683 2429 420
NM_000163chr531662 933 233 1917 ----
NM_000165chr61555 1477 1542 --
NM_000176chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_000192chr1231518 1102 1017 --11566 --
NM_000202chrX33669 2895 1019 33271 2832 1339 23262 1184 --
NM_000210chr221853 1643 --11577 12278
NM_000214chr2031336 181 67 2572 313 ----
NM_000216chrX63718 3215 3163 953 680 148 1254 ----
NM_000217chr1255166 4649 3882 724 139 14275 ----
NM_000232chr433178 2435 1204 ----13053
NM_000245chr761736 1661 763 704 555 482 198 ----
NM_000248chr312867 32703 2644 2486 ----
NM_000255chr61154 ------
NM_000259chr15106353 5334 5137 4760 2367 2323 2267 2023 698 545 1585 16270 --
NM_000266chrX3864 847 332 1914 ----
NM_000276chrX42226 1996 1548 198 ------
NM_000282chr13------1237
NM_000297chr421793 125 1334 ----
NM_000310chr121213 526 ----1291
NM_000313chr31145 1845 ----
NM_000314chr1053018 2933 683 212 98 ----2944 235
NM_000315chr11165 --197 --
NM_000328chrX1168 ------
NM_000332chr656550 4494 2816 1040 334 14338 27212 2795 --
NM_000337chr575949 4123 2533 2388 1112 421 68 36411 2098 1040 --16213
NM_000346chr1711566 ----1353
NM_000349chr831331 1301 347 ----11250
NM_000351chrX22889 388 ------
NM_000353chr1621242 118 ------
NM_000362chr2242760 2509 1088 243 33517 2499 250 ----
NM_000368chr954833 4717 4534 3685 1934 14677 ----
NM_000378chr111419 ------
NM_000396chr1188 ------
NM_000408chr252965 2902 2159 789 160 23390 983 ----
NM_000426chr6--136 1140 --
NM_000430chr1743048 2752 852 317 1573 --11205
NM_000437chr132192 1901 711 ------
NM_000439chr542441 2029 528 453 12248 --1670
NM_000441chr731880 859 268 12036 ----
NM_000451chrX2853 431 12052 ----
NM_000462chr151461 11626 ----
NM_000489chrX1117 12248 2846 840 --
NM_000492chr741533 517 325 296 ------
NM_000494chr10195 ------
NM_000495chrX2394 113 ------
NM_000503chr811271 ------
NM_000523chr231187 338 104 ------
NM_000525chr1141518 1466 1379 1041 ------
NM_000531chrX1364 ------
NM_000555chrX67061 6715 6206 1491 560 264 36565 6499 1114 ----
NM_000596chr71226 ------
NM_000602chr711229 ------
NM_000609chr1062738 2459 2386 209 112 89 --1414 --
NM_000615chr1142646 2251 707 558 22261 617 ----
NM_000618chr1246575 1218 1210 908 36062 4171 521 14628 --
NM_000618chr1246575 1218 1210 908 36062 4171 521 14628 --
NM_000619chr121431 ------
NM_000621chr133909 528 144 ------
NM_000633chr1843915 1443 1118 316 1211 1739 --
NM_000663chr1662771 2741 2022 1932 761 402 151 23021 386 11095
NM_000668chr41266 ------
NM_000681chr1031348 441 187 21224 1123 ----
NM_000684chr102831 486 ------
NM_000719chr1255624 5323 4248 2551 863 14600 11640 --
NM_000721chr151696 1028 917 877 564 12265 12515 --
NM_000724chr102659 193 ------
NM_000726chr241125 1032 131 53 2968 577 1107 --
NM_000793chr1455103 4972 4138 3659 1891 ------
NM_000806chr511370 21739 383 ----
NM_000807chr43477 164 85 ------
NM_000809chr448161 7593 6323 2179 41748 1218 822 26 ----
NM_000813chr555043 4802 2182 490 169 21688 698 14027 --
NM_000814chr1521570 65 23457 1632 ----
NM_000818chr101157 1169 --1355
NM_000826chr442061 1908 710 46 1226 --12465
NM_000827chr552221 1990 1645 1638 217 11745 11929 173
NM_000829chr111414 194 ----
NM_000831chr176181 5372 5219 4798 461 226 150 --24939 893 --
NM_000838chr652147 1082 777 414 389 12761 2955 656 --
NM_000840chr71160 ------
NM_000845chr7------1441
NM_000868chrX22291 2234 22534 1738 ----
NM_000875chr1536144 4659 2068 56654 5828 5714 5073 593 ----
NM_000891chr1732780 1312 393 21333 526 ----
NM_000899chr1251314 1018 775 576 504 23869 3566 ----
NM_000910chr431928 1774 538 ------
NM_000919chr52437 200 1458 ----
NM_000926chr11109225 9132 8634 8053 7936 6249 3305 2960 1948 871 36984 6520 2928 21729 407 18552
NM_000933chr2021799 511 ----1603
NM_000935chr3------11220
NM_000945chr22839 722 11649 21763 427 --
NM_000949chr52838 286 1352 ----
NM_000950chrX21435 1253 13649 ----
NM_000959chr151098 1063 908 850 199 2330 159 --12809
NM_000963chr122044 2005 1779 12135 --
NM_000990chr1152722 1546 823 470 32 1842 ----
NM_001001132chr211443 ------
NM_001001330chr1021077 874 140 ----
NM_001001331chr332460 1890 1662 12575 ----
NM_001001395chr1232551 720 257 12206 ----
NM_001001419chr565224 3899 3428 3197 2045 1148 23186 1804 ----
NM_001001420chr565224 3899 3428 3197 2045 1148 23186 1804 ----
NM_001001436chr163635 252 143 ------
NM_001001481chr833487 624 230 22751 242 ----
NM_001001483chr111360 ------
NM_001001557chr831770 1756 190 11727 ----
NM_001001664chr242872 2844 2828 1530 ------
NM_001001669chr532217 2188 1851 130 --12081
NM_001001890chr2134035 3021 1079 13619 11161 --
NM_001001936chr10133 ------
NM_001001971chr102239 74 ------
NM_001002258chr241746 1526 755 93 11778 ----
NM_001002264chr13187 ------
NM_001002265chr103730 304 64 1844 ----
NM_001002266chr103730 304 64 1844 ----
NM_001002759chr10--1438 ----
NM_001002843chr15156 11070 ----
NM_001002860chr1444042 3788 164 91 24400 3888 23473 1846 --
NM_001002909chr173477 297 262 ------
NM_001003652chr1837720 7690 5783 38393 7570 691 15769 --
NM_001003674chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_001003675chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_001003682chr151265 1005 580 177 48 ----11413
NM_001003694chr31659 ------
NM_001003712chr1234048 3059 1274 33899 3775 3116 1218 --
NM_001003792chr31381 ------
NM_001003793chr31381 ------
NM_001003800chr943563 3517 2713 78 --11339 12630
NM_001003810chr43552 306 92 ------
NM_001003940chr1521097 793 1216 11393 --
NM_001003942chr1521097 793 1216 11393 --
NM_001003943chr1521101 797 1220 11397 --
NM_001003954chr8146 ------
NM_001004051chrX1256 1126 ----
NM_001004317chr6104483 3881 3508 3282 3247 3113 1729 530 219 177 --11336 --
NM_001004342chr1126116 4916 4110 4018 3931 3830 1541 1505 1383 1284 227 135 13705 11270 --
NM_001004346chr42403 171 11113 --1950
NM_001004360chr2192 ------
NM_001004419chr1234490 1572 280 --2256 21 --
NM_001005266chr151553 1540 ----
NM_001005267chr151553 1540 ----
NM_001005268chr151553 1540 ----
NM_001005269chr151553 1540 ----
NM_001005353chr111049 ------
NM_001005353chr111049 ------
NM_001005386chr252278 2151 946 631 57 ------
NM_001005463chr1032427 2063 1727 1916 --12039
NM_001005473chr595648 5233 4379 4143 2639 1806 1485 1111 694 14180 ----
NM_001005476chr22508 486 ------
NM_001005739chr22621 567 ------
NM_001005746chr241125 1032 131 53 2968 577 1107 --
NM_001005747chr241125 1032 131 53 2968 577 1107 --
NM_001005910chr3155 ------
NM_001005911chr3155 ------
NM_001006115chr372411 2336 2159 1104 1045 812 479 22807 2141 ----
NM_001006618chr9125 ------
NM_001007023chr1455103 4972 4138 3659 1891 ------
NM_001007024chr1754252 3497 624 564 487 1401 1749 12912
NM_001007025chr1754252 3497 624 564 487 1401 1749 12912
NM_001007088chrX----150 --
NM_001007098chr11900 --1101 --
NM_001007102chr631512 518 492 ------
NM_001007156chr1531895 1524 104 ------
NM_001007226chr1721353 1285 ----1509
NM_001007227chr1721353 1285 ----1509
NM_001007228chr1721353 1285 ----1509
NM_001007229chr1721353 1285 ----1509
NM_001007230chr1721353 1285 ----1509
NM_001007237chr122644 275 42213 989 869 756 ----
NM_001007243chr831331 1301 347 ----11250
NM_001007246chr2141838 604 496 485 ----1767
NM_001007257chr141470 1269 1017 570 ------
NM_001007277chr116942 859 435 387 227 203 21069 98 ----
NM_001007278chr1355255 3212 1768 1570 511 --14497 14284
NM_001007527chr5----1108 --
NM_001007559chr181550 --12023 --
NM_001007793chr10----1285 --
NM_001007794chr11635 ------
NM_001008220chr5103832 3803 2723 1365 1352 779 744 626 321 278 13173 ----
NM_001008225chr71480 ------
NM_001008392chr343548 3261 2629 1085 13582 ----
NM_001008495chr832088 40 25 ------
NM_001008541chr1052165 2058 1904 1809 653 ------
NM_001008541chr1052165 2058 1904 1809 653 ------
NM_001008564chr1332272 1793 1704 11840 ----
NM_001008707chr1431799 377 150 11391 1594 --
NM_001008895chr13171 ----21206 317
NM_001008925chr443196 694 422 302 12338 ----
NM_001009185chr51295 2483 219 ----
NM_001009571chr721221 164 1591 1477 --
NM_001009880chr2264763 4193 3879 3223 288 57 21743 794 ----
NM_001009881chr1------1491
NM_001009882chr1------1491
NM_001009894chr1231662 1288 1183 ------
NM_001009899chr344685 2422 2123 1476 34451 1784 1290 21592 663 --
NM_001009993chr244413 3112 774 527 --24455 3387 --
NM_001010861chr132147 655 138 22172 1124 ----
NM_001010888chrX54562 3070 2865 1350 1228 --13654 --
NM_001010891chr596809 4646 4441 2646 2274 2250 2069 2044 1566 36920 6342 210 --15807
NM_001010924chr102884 878 143 --11188
NM_001010984chr142181 1946 1806 480 1334 ----
NM_001011513chr442550 899 893 499 --11066 --
NM_001011515chr421088 176 ------
NM_001011516chr421088 176 ------
NM_001011657chrX2411 111 ------
NM_001011658chrX31660 398 291 11879 22027 1654 --
NM_001011666chr765541 4918 1121 594 459 383 16016 11744 --
NM_001011724chr13--1292 ----
NM_001011725chr13--1292 ----
NM_001011885chr15122 21675 1515 --1256
NM_001012267chr931856 1292 674 1193 ----
NM_001012393chr11135078 4898 4884 4833 4787 4327 4018 3506 3314 3257 1689 800 591 --11334 --
NM_001012420chr1552812 2786 2175 1811 703 ------
NM_001012423chr1552812 2786 2175 1811 703 ------
NM_001012478chr191607 ------
NM_001012755chrX84487 3852 3783 3598 3418 1069 582 277 --21824 1235 --
NM_001013399chr61109 ------
NM_001013406chr721504 1266 ------
NM_001013415chr43577 571 561 ------
NM_001013620chr1267313 7001 6015 5944 3283 843 12349 16041 --
NM_001013693chr162710 2590 2482 2218 2168 1928 22335 525 22083 536 --
NM_001013693chr162710 2590 2482 2218 2168 1928 22335 525 22083 536 --
NM_001013699chr12----1543 --
NM_001013839chr1732424 886 43 ------
NM_001013843chr15--1580 ----
NM_001014286chr13192 ------
NM_001014797chr1046217 5728 2004 1021 45819 2760 428 250 --15539
NM_001014809chr41637 ------
NM_001014812chr15------1421
NM_001015877chrX1779 3634 537 512 1263 --
NM_001015887chr331649 1330 1196 --1247 1358
NM_001017368chr17--1475 --12358
NM_001017395chr323588 3114 ------
NM_001017396chr232183 832 670 12174 ----
NM_001017923chr1441674 1520 1256 643 11243 ----
NM_001017926chr821645 1588 ----1163
NM_001017999chr142135 1774 1632 242 ------
NM_001017999chr142135 1774 1632 242 ------
NM_001018000chr142135 1774 1632 242 ------
NM_001018000chr142135 1774 1632 242 ------
NM_001018001chr142135 1774 1632 242 ------
NM_001018005chr15------1176
NM_001018037chr921234 952 2513 123 ----
NM_001018053chr12792 573 11943 ----
NM_001018056chr9--1484 --1591
NM_001018064chr931636 826 719 11822 ----
NM_001018065chr984920 4880 4368 2420 2357 1683 855 32 15832 ----
NM_001018066chr984920 4880 4368 2420 2357 1683 855 32 15832 ----
NM_001018067chr121945 1744 33665 608 493 32080 1706 832 --
NM_001018068chr121945 1744 33665 608 493 32080 1706 832 --
NM_001018069chr121945 1744 33665 608 493 32080 1706 832 --
NM_001018074chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_001018075chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_001018076chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_001018077chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_001018090chr1542699 2535 1139 79 ------
NM_001018102chr1542699 2535 1139 79 ------
NM_001018111chr764020 3648 2478 1280 315 62 11211 --13501
NM_001020658chr111479 1597 ----
NM_001020658chr111479 1597 ----
NM_001020825chr52211 77 11392 11033 --
NM_001023567chr1542204 2178 1832 410 --1706 --
NM_001024094chr543324 2736 2602 1292 33917 3214 754 13558 --
NM_001024372chr831484 1449 481 11932 32289 1556 102 --
NM_001024647chr1287639 6984 6266 6205 6140 5791 2963 2457 1241 --1730
NM_001024649chr522716 315 22835 2168 ----
NM_001024666chrX1547 ----2241 85
NM_001024912chr1911389 --31486 556 310 --
NM_001024947chr5--1863 ----
NM_001024948chr153088 2287 2240 2200 23 12138 ----
NM_001024956chr1134277 3840 1246 54724 4598 3580 916 220 34707 3752 1179 --
NM_001025076chr1085861 5626 5431 4226 2127 1810 1699 671 --14989 11090
NM_001025077chr1077219 6984 6789 5584 2029 235 103 --16347 12448
NM_001025079chr353905 3764 3315 1023 433 11605 ----
NM_001025100chr1863256 3072 3010 2906 1377 761 12437 12877 --
NM_001025107chr142301 836 587 34 ------
NM_001025107chr142301 836 587 34 ------
NM_001025108chr242866 587 459 70 ----1375
NM_001025248chr1521265 980 11291 ----
NM_001025249chr1521265 980 11291 ----
NM_001025266chr374627 4092 3790 3068 1728 1205 241 ------
NM_001025366chr621749 1468 1285 1451 --
NM_001025366chr621749 1468 1285 1451 --
NM_001025367chr621749 1468 1285 1451 --
NM_001025367chr621749 1468 1285 1451 --
NM_001025368chr621749 1468 1285 1451 --
NM_001025368chr621749 1468 1285 1451 --
NM_001025369chr621765 1484 1301 1467 --
NM_001025369chr621765 1484 1301 1467 --
NM_001025370chr621749 1468 1285 1451 --
NM_001025370chr621749 1468 1285 1451 --
NM_001025616chr431872 1285 197 1723 1527 --
NM_001025780chr9--1304 --11605
NM_001029858chr663110 3101 2109 1023 722 708 1377 ----
NM_001029863chr622797 642 32995 2726 2396 ----
NM_001029884chr622591 547 1986 ----
NM_001030006chr1722091 797 --2274 141 --
NM_001030055chr1433533 3022 1037 24317 1844 1413 --
NM_001031623chr62726 564 21518 609 1170 --
NM_001031679chr1223037 115 21127 576 ----
NM_001031695chr2235152 3576 1939 11663 ----
NM_001031709chr10187 ----1329
NM_001031716chr22436 397 1953 ----
NM_001031723chr4------1475
NM_001031740chr111234 ------
NM_001031748chr121569 ------
NM_001031804chr1664103 3529 3433 1344 1337 280 41445 1232 839 748 1710 --
NM_001031812chr522267 2164 1218 1344 --
NM_001032280chr621322 311 11662 ----
NM_001032288chr202220 201 ------
NM_001032380chr1021443 661 11864 ----
NM_001032394chr622625 217 ------
NM_001032395chr622492 84 ------
NM_001033047chr422527 661 ------
NM_001033049chr211425 12344 ----
NM_001033057chr331865 530 433 1244 --136
NM_001033087chr2053237 2523 1198 1156 1054 13152 ----
NM_001033117chr344420 4275 1194 1110 --23562 206 --
NM_001033564chr6121 11303 1685 --
NM_001033566chr171842 ------
NM_001033568chr171842 ------
NM_001033576chr1742643 2488 1857 1021 11732 ----
NM_001033578chr821526 1502 12325 ----
NM_001033756chr621683 1402 1219 1385 --
NM_001033756chr621683 1402 1219 1385 --
NM_001034025chr1231006 737 640 ------
NM_001037132chr741997 1463 754 425 1559 ----
NM_001037133chr741997 1463 754 425 1559 ----
NM_001037164chr711497 1528 1406 --
NM_001037172chr32291 36 1261 11303 --
NM_001037174chr21588 12244 ----
NM_001037317chr132147 655 138 22172 1124 ----
NM_001037332chr532207 1002 512 22370 1923 ----
NM_001037333chr532207 1002 512 22370 1923 ----
NM_001037494chr12197 ------
NM_001037495chr12197 ------
NM_001037738chr5185 ------
NM_001037954chr1121131 602 32511 1286 614 --1112
NM_001038702chr562617 2325 1041 1003 286 232 22082 488 22434 2100 --
NM_001039350chr751646 1351 1253 1158 434 --11295 --
NM_001039465chr14--176 ----
NM_001039479chr1432336 954 606 32166 879 583 ----
NM_001039538chr223452 2708 22367 1252 --23333 1019
NM_001039580chr4114730 4534 4228 3784 3644 3353 1698 1354 1344 500 44 33214 1873 113 ----
NM_001039585chr161355 1320 1165 1107 456 136 2587 416 --13066
NM_001039590chrX43599 940 220 160 --23764 2616 --
NM_001039591chrX43599 940 220 160 --23764 2616 --
NM_001039618chr1145394 2032 1897 240 161 --11352
NM_001039762chr105901 614 580 198 187 22200 1479 ----
NM_001039840chrX54275 4199 1698 702 636 23941 3711 --25980 1419
NM_001039937chr1333164 1520 730 33844 1666 353 1281 --
NM_001040020chr71154 11458 ----
NM_001040057chr721260 1033 11153 11419 --
NM_001040100chr31249 21189 1027 ----
NM_001040101chr451118 477 160 130 30 --1414 21464 1212
NM_001040152chr775106 4940 3474 3323 1406 1371 815 33460 1507 1473 --11227
NM_001040157chr432685 2001 203 --1309 --
NM_001040159chr41259 ------
NM_001040202chr42899 389 ------
NM_001040284chr1655857 5162 4554 4327 2023 23987 1718 15376 --
NM_001040402chr42825 232 32891 529 455 ----
NM_001040409chr22341 290 ------
NM_001040429chr1322628 2447 22945 1402 12705 --
NM_001040441chr164341 4331 3641 1441 1126 744 ------
NM_001040446chr551725 671 617 569 69 1765 1365 --
NM_001040450chr1522416 288 ------
NM_001040453chr1522416 288 ------
NM_001040653chr322131 898 12456 1973 --
NM_001040665chr7104783 4230 3696 3274 3138 1787 1183 930 846 183 190 ----
NM_001040666chr71485 ------
NM_001040712chr942818 2400 1388 886 21116 350 --12387
NM_001040876chr441759 1661 393 384 ------
NM_001041chr32160 26 ------
NM_001042355chr1674500 3813 3367 1969 1684 1470 1361 ------
NM_001042412chr1674500 3813 3367 1969 1684 1470 1361 ------
NM_001042413chr93597 543 294 13744 1994 1960
NM_001042424chr453199 2982 1162 674 279 22907 871 ----
NM_001042425chr621322 311 11662 ----
NM_001042453chrX11423 11301 ----
NM_001042481chr1432298 650 86 ------
NM_001042493chr641737 532 243 105 --11963 --
NM_001042494chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_001042495chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_001042496chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_001042497chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_001042555chr1283671 3205 3139 2944 1768 1356 825 376 43906 3391 1460 979 14180 --
NM_001042601chr332044 1078 464 1733 11125 --
NM_001042603chr1265045 4855 4539 3531 2148 589 1809 2403 319 14515
NM_001042604chr364701 4011 3981 960 594 216 ------
NM_001042669chr431872 1285 197 1723 1527 --
NM_001043318chr1433109 1548 1313 ----13547
NM_001044305chr621406 201 --1658 --
NM_001044385chr243838 2924 1428 1397 23409 1192 ----
NM_001044722chr522267 2164 1218 1344 --
NM_001044723chr522267 2164 1218 1344 --
NM_001046chr542904 1168 1065 880 22620 394 ----
NM_001071775chr1331927 1828 32 --1336 --
NM_001076chr42455 186 ------
NM_001076chr42455 186 ------
NM_001083620chr442059 1906 709 46 1225 --12463
NM_001100108chr1138343 8267 8160 8105 7575 7345 7088 3333 2718 2616 2607 550 321 11697 ----
NM_001106chr3169639 8727 8420 8393 7544 7013 6593 3554 3308 2934 2884 2496 2227 2162 1612 1095 11328 29618 3861 29138 8626
NM_001111chr142301 836 587 34 ------
NM_001113490chrX53382 1332 1306 956 825 22512 1048 ----
NM_001121chr1031909 1803 326 1590 ----
NM_001122679chr521261 975 ------
NM_001123chr103521 232 220 1531 --1593
NM_001126chr141033 855 243 185 1210 --1886
NM_001148chr421782 678 21948 1732 1412 --
NM_001149chr1041244 950 311 41 ------
NM_001153chr2------1830
NM_001167chrX45260 4457 4256 2000 1635 11018 --
NM_001173chr1433533 3022 1037 24317 1844 1413 --
NM_001174chrX22334 913 21993 1704 1214 22066 718
NM_001201chr433310 1211 95 33040 2697 705 13397 1445
NM_001204chr256877 5183 2588 1357 1233 46827 2379 2264 1537 ----
NM_001206chr922289 2177 ------
NM_001219chr71673 21412 496 1916 --
NM_001241chr232100 1781 1738 --12307 --
NM_001241chr232100 1781 1738 --12307 --
NM_001256chr1751861 512 188 130 100 ----21983 467
NM_001270chr511060 11053 ----
NM_001271chr1573035 2322 2011 805 669 354 120 --32756 1049 748 --
NM_001280chr19--1139 ----
NM_001282chr1722091 797 --2274 141 --
NM_001313chr41637 ------
NM_001329chr1031553 1262 445 ----11433
NM_001331chr1162389 2157 811 687 292 108 --1101 --
NM_001351chr311581 ------
NM_001356chrX22507 2075 130 ----
NM_001378chr21190 ------
NM_001379chr19177 ------
NM_001386chr81978 12171 ----
NM_001387chr553079 2809 2106 656 571 --1693 --
NM_001394chr83849 666 261 1636 ----
NM_001396chr2142158 1917 1021 336 11779 ----
NM_001397chr122336 898 ----1318
NM_001415chrX--1263 ----
NM_001419chr1954572 4217 2976 1029 539 14634 --11848
NM_001427chr71229 ------
NM_001432chr442634 1471 633 172 23197 1390 11525 --
NM_001447chr51568 ------
NM_001449chrX----1295 --
NM_001452chr61268 1695 --1491
NM_001497chr972608 2459 2226 1877 1699 252 64 31048 402 326 ----
NM_001498chr611200 ------
NM_001527chr633713 3594 3510 44437 1121 1051 253 14397 --
NM_001542chr122644 275 42213 989 869 756 ----
NM_001543chr584858 4760 4479 4411 1408 1217 855 769 11591 11857 23817 970
NM_001565chr42254 94 ------
NM_001584chr111804 ------
NM_001587chrX42226 1996 1548 198 ------
NM_001616chr251175 817 474 175 54 23398 612 1721 --
NM_001650chr1863038 2685 1628 1548 1430 533 22767 1308 1292 --
NM_001655chr1141560 1361 226 172 11863 ----
NM_001656chr531974 1852 560 11673 ----
NM_001662chr71356 ------
NM_001679chr32325 298 ------
NM_001682chr122834 642 1177 ----
NM_001683chr332460 1890 1662 12575 ----
NM_001689chr241746 1526 755 93 11778 ----
NM_001693chr83822 211 171 --1147 --
NM_001695chr863724 3259 3022 1644 1393 498 --149 --
NM_001699chr192560 447 --1379 --
NM_001701chr931433 1218 1137 1502 ----
NM_001706chr3--2421 285 ----
NM_001709chr1142335 965 494 258 ------
NM_001723chr63711 309 139 ------
NM_001729chr4----1373 --
NM_001730chr131395 11246 ----
NM_001730chr131395 11246 ----
NM_001742chr731691 368 325 21667 1328 ----
NM_001743chr2--1100 ----
NM_001745chr51376 ------
NM_001746chr522716 315 22835 2168 ----
NM_001753chr731629 1220 82 --161 --
NM_001754chr2134035 3021 1079 13619 11161 --
NM_001759chr1243631 3245 1700 654 23619 3560 ----
NM_001777chr353905 3764 3315 1023 433 11605 ----
NM_001792chr1811175 ------
NM_001812chr4------1281
NM_001819chr201251 ------
NM_001844chr122368 331 ----1380
NM_001845chr1331374 314 37 1845 ----
NM_001854chr1268 50 11150 ----
NM_001855chr91218 ------
NM_001858chr654421 2071 1905 1387 1037 24721 437 ----
NM_001859chr943977 3288 3148 1008 12840 ----
NM_001863chr191113 ------
NM_001893chr17--1389 ----
NM_001903chr51773 180 ----
NM_001920chr121290 2777 59 ----
NM_001931chr111169 11025 --1950
NM_001936chr751646 1351 1253 1158 434 --11295 --
NM_001938chr11158 11373 ----
NM_001942chr1811385 11925 --1416
NM_001945chr541372 1264 1145 1009 2966 159 11109 1183
NM_001948chr1521265 980 11291 ----
NM_001949chr632157 2080 457 22739 2602 ----
NM_001955chr621086 712 ------
NM_001966chr31311 ------
NM_001967chr31522 --1498 --
NM_001977chr41673 ------
NM_001987chr1254082 3887 3751 3709 1427 --12990 --
NM_002006chr435074 3701 2151 44931 1593 760 548 ----
NM_002009chr15--1672 ----
NM_002015chr1332199 653 241 21266 607 --22146 271
NM_002024chrX2444 133 31794 1517 650 --12156
NM_002025chrX49282 8107 2042 1712 46570 2666 512 460 12400 --
NM_002028chr1451078 1016 430 260 88 2210 141 ----
NM_002031chr6----1663 --
NM_002035chr1833761 1243 562 23606 58 ----
NM_002039chr4----1842 --
NM_002061chr13614 141 93 11818 ----
NM_002063chrX11013 ------
NM_002072chr93847 775 667 31021 1004 836 ----
NM_002076chr1243204 852 734 198 11160 1750 12267
NM_002078chr32663 36 1497 ----
NM_002092chr433988 1919 1562 13189 --1654
NM_002114chr61153 ------
NM_002126chr1731197 486 274 --12672 --
NM_002128chr1322246 1713 11692 ----
NM_002129chr42408 62 ------
NM_002138chr43552 306 92 ------
NM_002139chrX1513 ------
NM_002140chr91982 ------
NM_002145chr17--1107 ----
NM_002154chr5153 ------
NM_002158chr283704 3664 3526 3412 3089 2329 1163 636 23425 1315 ----
NM_002160chr91411 ------
NM_002166chr2--1574 ----
NM_002182chr332181 926 818 ------
NM_002203chr522567 296 22980 2926 --32646 1179 798
NM_002210chr223516 152 --1115 --
NM_002211chr1031132 1017 180 1719 ----
NM_002214chr775016 2225 1756 1462 1454 372 109 21100 450 1725 --
NM_002221chr192856 2543 2178 1137 1017 884 798 735 402 22944 1898 22380 2000 --
NM_002222chr3--1487 --1216
NM_002233chr111340 ------
NM_002240chr21--1612 ----
NM_002264chr3104766 4013 3741 3601 3286 3233 1447 1408 1252 31 14828 --24587 3344
NM_002270chr514879 24076 677 15506 --
NM_002271chr1331789 1618 603 --11557 --
NM_002285chr242866 587 459 70 ----1375
NM_002293chr122312 2019 ----1532
NM_002294chrX1193 ------
NM_002333chr192972 927 21256 486 21148 949 --
NM_002336chr1241794 773 565 214 31697 1651 704 ----
NM_002349chr221133 72 1167 ----
NM_002351chrX4456 433 288 52 1299 --1499
NM_002356chr632505 473 353 22130 462 167 --
NM_002359chr1743569 1233 1153 679 14211 11322 --
NM_002374chr223452 2708 22367 1252 --23333 1019
NM_002376chr142421 395 ----1379
NM_002381chr2296 84 ------
NM_002397chr571880 1685 1569 885 306 97 54 1362 ----
NM_002402chr71253 --1363 1775
NM_002430chr2222140 580 --1879 --
NM_002444chrX31442 476 122 11552 22018 208 --
NM_002449chr51100 21133 967 --1450
NM_002480chr1231146 953 431 1122 1377 --
NM_002482chr11296 1748 ----
NM_002486chr932073 1889 23 12544 ----
NM_002487chr151242 ----1277
NM_002522chr1743776 2825 938 435 23668 566 12556 --
NM_002524chr121016 440 ------
NM_002527chr121274 ------
NM_002544chr17--1331 ----
NM_002545chr11135078 4898 4884 4833 4787 4327 4018 3506 3314 3257 1689 800 591 --11334 --
NM_002576chr1131236 1006 497 --131 1301
NM_002578chrX--1461 ----
NM_002581chr93741 508 487 34630 4133 22 ----
NM_002583chr121609 ------
NM_002589chr4195 ------
NM_002590chr132543 460 1357 ----
NM_002594chr2042249 643 481 142 ------
NM_002595chr1211795 1324 21824 1739 --
NM_002605chr1531156 323 183 11081 --1785
NM_002613chr1683563 1615 1198 708 695 331 92 34 --11570 --
NM_002646chr141981 1539 742 655 --1271 --
NM_002651chr12730 233 ------
NM_002655chr895226 4478 4446 4339 4270 4090 3713 689 224 ----14165
NM_002657chr2053827 3569 2976 2887 622 ------
NM_002703chr42569 342 ------
NM_002709chr232372 1086 171 23464 1445 ----
NM_002711chr71311 --1777 --
NM_002715chr52140 86 --11237 --
NM_002718chr312496 42722 2422 572 485 ----
NM_002719chr14177 --12147 --
NM_002731chr142841 2281 405 205 1487 ----
NM_002734chr173607 550 278 11824 12245 1802
NM_002736chr721454 84 ------
NM_002737chr1745206 4826 4150 831 15585 16064 --
NM_002740chr332719 2537 2531 1211 ----
NM_002742chr141152 125 ----
NM_002745chr2261605 1421 766 714 645 218 ------
NM_002750chr10260 40 ------
NM_002761chr162134 114 ------
NM_002763chr11433 ------
NM_002816chr171235 ------
NM_002819chr1911276 ------
NM_002828chr18149 1275 ----
NM_002829chr93898 482 409 ------
NM_002833chr1511360 --21249 463 --
NM_002837chr1243307 1139 1011 761 --23986 87 --
NM_002839chr942818 2400 1388 886 21116 350 --12387
NM_002843chr1123473 1098 22330 356 12822 --
NM_002848chr1211228 21188 1035 1807 --
NM_002857chr162518 2191 1753 887 140 86 22289 1701 ----
NM_002858chr11189 11059 ----
NM_002869chr111877 12230 ----
NM_002881chr23924 918 271 ----21302 996
NM_002886chr333880 716 590 13211 11078 24733 735
NM_002890chr52852 170 3666 341 87 ----
NM_002912chr62140 30 ------
NM_002923chr11562 1504 --1600
NM_002924chr11457 ------
NM_002940chr441759 1661 393 384 ------
NM_002941chr331358 456 361 ------
NM_002959chr121139 382 1992 1829 33598 3449 1544
NM_002968chr161809 ------
NM_002973chr121145 1364 ----
NM_002977chr232867 1174 669 2917 85 ----
NM_002998chr82568 337 12218 12131 12198
NM_003010chr1721953 808 21714 756 ----
NM_003014chr731489 1413 1163 ----1928
NM_003020chr15--1179 ----
NM_003022chrX1257 21230 871 ----
NM_003032chr322695 1770 32719 1684 316 ----
NM_003043chr343823 1622 1223 388 1640 --13142
NM_003051chr12643 262 11624 ----
NM_003060chr511055 2326 50 --11045
NM_003072chr191418 1430 ----
NM_003093chr61209 ------
NM_003099chr15106163 5985 5709 5701 5561 5400 5159 4000 1031 352 25763 2435 --15832
NM_003108chr266908 6000 5187 4524 1956 830 ------
NM_003110chr1711102 ------
NM_003112chr722311 1084 12989 ----
NM_003115chr11480 ------
NM_003133chr11706 1801 ----
NM_003139chr113903 841 327 ------
NM_003150chr1722062 1904 ------
NM_003161chr1743527 2484 2473 2467 --22280 814 --
NM_003162chr21942 ------
NM_003178chr372112 1974 1914 1430 244 148 96 22025 607 ----
NM_003182chr7----2152 41 --
NM_003182chr7----2152 41 --
NM_003185chr202934 306 1248 ----
NM_003199chr1844935 4573 1859 1402 --25201 838 --
NM_003200chr1921836 255 --12304 --
NM_003203chr21438 3473 305 25 2532 465 --
NM_003211chr1241199 391 76 53 1408 ----
NM_003216chr2263282 2985 2489 1186 1141 364 13068 1749 --
NM_003217chr1221509 229 --11799 --
NM_003220chr621322 311 11662 ----
NM_003221chr662663 1205 1112 874 832 728 33856 3249 2753 1388 --
NM_003222chr201297 1368 ----
NM_003234chr342100 2065 628 536 2817 407 12366 171
NM_003243chr141131 1031 303 60 11231 ----
NM_003244chr18--1115 ----
NM_003247chr651748 1331 1235 805 145 21913 1562 ----
NM_003253chr2111800 31929 1840 641 ----
NM_003262chr344375 3687 3419 1508 --1905 --
NM_003269chr63981 288 134 1955 ----
NM_003270chrX1910 ------
NM_003281chr195283 4885 4455 3324 1775 1345 1232 539 320 --45185 4218 3801 1728 11704
NM_003290chr191113 ------
NM_003298chr375968 4571 4176 2009 1771 511 21 2851 504 11324 --
NM_003338chr1041491 1475 699 467 ------
NM_003340chr41565 ------
NM_003341chr31524 --1680 --
NM_003342chr1752969 2911 2371 1130 154 1585 22733 188 11180
NM_003344chr721383 282 ------
NM_003348chr1241254 1076 579 45 ------
NM_003349chr202220 201 ------
NM_003373chr1041406 723 512 484 11684 ----
NM_003376chr621749 1468 1285 1451 --
NM_003376chr621749 1468 1285 1451 --
NM_003380chr101217 ------
NM_003383chr9--1484 --1591
NM_003385chr22335 186 1631 ----
NM_003390chr112216 101 2950 384 ----
NM_003392chr353625 3373 3197 960 734 ------
NM_003403chr141191 1728 --1315
NM_003404chr20133 ------
NM_003405chr222724 713 1752 --192
NM_003411chrY31651 427 402 ------
NM_003412chr331069 726 137 ----1763
NM_003439chr733110 895 871 23255 1063 1565 --
NM_003442chr111589 ------
NM_003453chr132600 289 ------
NM_003463chr652898 2858 2597 2147 1022 1310 --22225 353
NM_003468chr253584 3198 3053 1377 70 1985 13118 --
NM_003474chr103765 736 158 ------
NM_003478chr1143224 2778 2286 154 11130 12401 --
NM_003489chr2132092 1033 640 1529 ----
NM_003498chr1652667 2183 767 544 528 --22269 1922 --
NM_003508chr71104 ------
NM_003563chr1721353 1285 ----1509
NM_003566chr1242980 2920 1208 241 12677 ----
NM_003574chr1844582 489 425 401 24445 1725 ----
NM_003575chr721108 1060 --1409 11328
NM_003583chr1223103 1029 12500 --1328
NM_003586chr161626 ------
NM_003589chr13171 ----21206 317
NM_003590chr223869 767 33999 3711 3198 13012 --
NM_003613chr152702 627 1512 ----
NM_003615chr343497 2882 2524 728 22762 1584 12925 --
NM_003626chr1121297 1165 ------
NM_003628chr22508 486 ------
NM_003633chr552015 1998 1574 869 284 ------
NM_003644chr17126006 5521 4709 4513 1880 1571 779 725 455 427 298 71 16285 12223 --
NM_003651chr122456 202 ----1443
NM_003654chr11--1751 --1719
NM_003663chr343404 3160 393 225 1667 ----
NM_003671chr942403 1254 1106 789 11144 --1417
NM_003672chr131970 1761 1238 ------
NM_003688chrX177 ------
NM_003701chr134930 885 741 351 1852 ----
NM_003714chr533021 2080 607 ----1537
NM_003743chr211997 22259 1680 1728 --
NM_003746chr12197 ------
NM_003749chr131963 22113 2008 ----
NM_003758chr1541076 396 187 23 188 1153 --
NM_003758chr1541076 396 187 23 188 1153 --
NM_003759chr451392 1309 969 869 35 --13119 --
NM_003760chr11672 ------
NM_003783chr111025 2975 46 11069 --
NM_003787chr181241 ------
NM_003792chr9--1144 ----
NM_003794chr31293 11096 ----
NM_003796chr191220 ------
NM_003829chr92794 307 ------
NM_003831chr1821356 52 11539 --1147
NM_003872chr242697 2145 2078 574 23007 2499 ----
NM_003885chr1752456 2409 821 462 151 --11793 --
NM_003909chr842412 2123 974 331 12954 1176 --
NM_003913chr624097 220 24111 2776 1244 1449
NM_003916chrX1120 11296 ----
NM_003924chr41347 ------
NM_003930chr732379 2038 1725 2494 480 ----
NM_003934chr9--145 ----
NM_003947chr311226 ------
NM_003968chr33622 587 56 ------
NM_003980chr611111 ------
NM_003983chr1663813 3645 3591 1227 1100 991 13362 ----
NM_003994chr1251314 1018 775 576 504 23869 3566 ----
NM_004024chr111325 ------
NM_004028chr1863038 2685 1628 1548 1430 533 22767 1308 1292 --
NM_004055chr1141993 1669 305 256 1575 ----
NM_004061chr52497 210 1619 ----
NM_004067chr72991 105 11485 ----
NM_004093chr1353045 2977 2021 660 252 23026 2532 ----
NM_004094chr1482651 2547 2536 2440 2423 2101 1875 339 12771 --13032
NM_004098chr1041290 1279 1273 377 ------
NM_004100chr632293 1870 177 ------
NM_004109chr1142175 923 419 202 ------
NM_004117chr642146 1920 558 477 11794 ----
NM_004124chr1443363 2713 1031 842 42827 2666 2385 413 ----
NM_004136chr1521163 195 2869 209 ----
NM_004161chr2----11023 --
NM_004162chr311212 ------
NM_004170chr931802 1363 491 1706 --21531 484
NM_004171chr1199066 7567 7524 6767 3669 2922 2850 950 285 38604 7997 189 --13579
NM_004172chr521671 1487 ------
NM_004183chr11--1646 ----
NM_004229chrX2677 249 1299 11941 --
NM_004232chr1863676 3231 3188 1303 951 158 12415 1622 --
NM_004236chr151472 ------
NM_004242chr6187 ------
NM_004267chr31149 ------
NM_004274chr1422555 2140 12917 ----
NM_004279chr752162 1503 938 713 503 --22284 2070 --
NM_004285chr185963 5898 5746 4717 4581 4213 2480 1874 26425 5181 25796 4564 --
NM_004296chr1453668 3079 1214 537 530 ----11199
NM_004302chr1282708 2493 2361 993 596 513 363 250 12193 31834 564 369 --
NM_004306chr8146 ------
NM_004319chr142299 751 226 204 42851 2169 1049 29 ----
NM_004320chr16134 ------
NM_004321chr2113301 3250 3161 3086 2891 2820 2499 896 196 157 139 22671 96 13043 --
NM_004326chr121227 915 21092 34 123 --
NM_004327chr2252325 1810 1602 351 127 --12040 --
NM_004329chr101135 11306 ----
NM_004330chr15--1245 ----
NM_004331chr832695 2059 327 ------
NM_004338chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_004342chr72845 748 ------
NM_004346chr441426 1055 294 41 1390 ----
NM_004349chr82398 373 ------
NM_004354chr4--1678 ----
NM_004370chr61201 ------
NM_004380chr1622491 701 ------
NM_004384chr522267 2164 1218 1344 --
NM_004392chr1311023 --11949 --
NM_004414chr2121321 1129 --1324 --
NM_004418chr22627 461 ------
NM_004430chr842716 2626 2309 2027 12298 ----
NM_004431chr1171 ----1652
NM_004432chr911860 22080 617 --11982
NM_004434chr1431799 377 150 11391 1594 --
NM_004438chr253188 2629 1320 1173 693 22420 321 12641 --
NM_004440chr651709 677 644 601 163 1342 ----
NM_004441chr311296 ------
NM_004449chr21--2945 201 --1292
NM_004459chr172716 213 ------
NM_004481chr151683 1677 1067 790 470 ----22440 2326
NM_004483chr163485 432 139 ------
NM_004484chrX------1256
NM_004494chr121075 55 ------
NM_004499chr51346 ------
NM_004500chr1421820 1803 1521 ----
NM_004513chr1541261 986 346 265 --32523 1061 919 --
NM_004525chr231156 501 297 --11349 --
NM_004529chr941399 1237 1043 545 ------
NM_004530chr1621180 766 ------
NM_004561chr1121795 250 11454 2740 671 --
NM_004569chr143676 473 297 1260 1610 --
NM_004583chr171778 ------
NM_004588chr1173919 2565 2460 1359 1048 1042 254 ------
NM_004598chr513175 1348 ----
NM_004607chr5--1155 ----
NM_004612chr953845 3463 3151 1687 652 --34351 3789 1883 13035
NM_004614chr1671912 1899 1589 1519 827 208 49 ------
NM_004622chr251853 1645 529 450 45 21765 99 ----
NM_004634chr31659 ------
NM_004643chr141849 ------
NM_004660chrY42000 1979 1454 251 ------
NM_004663chr15183 --11293 --
NM_004681chrY2700 512 ------
NM_004685chr1363005 2586 2511 2266 736 463 ------
NM_004703chr1742584 1999 1904 1579 ----22361 912
NM_004709chrX31396 1382 126 11784 1622 --
NM_004713chr142519 227 ------
NM_004719chr1221819 1768 --11144 --
NM_004725chr102415 25 11017 11506 --
NM_004726chrX105764 5587 4920 4825 3994 1293 714 575 214 43 3807 635 556 15539 1103
NM_004730chr531644 822 197 11972 ----
NM_004731chr1231707 1649 598 11665 11914 --
NM_004734chr132935 317 ------
NM_004736chr132188 821 236 ------
NM_004740chr17188 ------
NM_004742chr331683 1446 425 ----1254
NM_004744chr453874 2876 1343 1187 718 33963 3786 3597 13565 --
NM_004745chr835937 4995 452 25057 1134 1581 36434 4695 1255
NM_004747chr102404 208 ------
NM_004753chr11269 ------
NM_004755chr143912 326 231 ------
NM_004760chr752173 1694 949 691 177 21535 136 --1337
NM_004772chr52561 159 ------
NM_004774chr17--12645 1723 21047 230
NM_004775chr1841782 836 520 90 ------
NM_004779chr521266 378 ------
NM_004781chr11261 2682 600 ----
NM_004781chr11261 2682 600 ----
NM_004792chr2160 1192 ----
NM_004796chr14------11546
NM_004798chr2023157 772 1747 ----
NM_004815chr184456 3626 3609 3603 1598 1591 946 621 34493 3827 109 11579 --
NM_004822chr1743509 3009 2456 1056 23662 3154 ----
NM_004834chr243251 2758 2375 260 13267 23364 2905 --
NM_004845chrX123947 3779 3559 3531 3482 1463 1333 1140 957 654 259 134 1433 ----
NM_004846chr2172 ----1190
NM_004857chr1424017 3003 33798 1366 254 --1143
NM_004859chr1722527 1929 12834 1480 --
NM_004862chr1651357 1021 1005 230 33 ------
NM_004863chr1455215 5046 3805 3258 1754 1197 ----
NM_004867chrX--1170 ----
NM_004871chr1754252 3497 624 564 487 1401 1749 12912
NM_004879chr116820 737 313 265 105 81 1947 ----
NM_004897chr10--1864 ----
NM_004898chr432648 1929 166 1278 ----
NM_004904chr765541 4918 1121 594 459 383 16016 11744 --
NM_004906chr62447 31 1239 ----
NM_004912chr721504 1266 ------
NM_004922chr102405 231 ------
NM_004929chr811104 11443 ----
NM_004939chr21130 ------
NM_004956chr721101 732 33860 3840 1311 13247 --
NM_004965chr211269 ------
NM_004969chr101586 1127 ----
NM_004985chr1231814 1678 858 13777 54214 2757 1731 1271 186 --
NM_004992chrX108127 7149 5980 3030 2297 2191 1679 1646 1387 405 --48093 6909 5727 5299 --
NM_004992chrX108127 7149 5980 3030 2297 2191 1679 1646 1387 405 --48093 6909 5727 5299 --
NM_004993chr1411523 11080 --188
NM_004999chr644424 3704 1466 1438 1281 ----
NM_005006chr21393 11038 --1369
NM_005010chr741997 1463 754 425 1559 ----
NM_005025chr31156 ------
NM_005032chrX21009 909 ------
NM_005056chr1255289 5099 4783 3775 833 11053 2647 563 14759
NM_005063chr1063374 2698 1299 1191 721 182 196 ----
NM_005065chr1474252 3320 3295 2083 1002 359 216 11470 ----
NM_005066chr11267 --1569 --
NM_005068chr621387 976 --11028 --
NM_005076chr133637 767 75 13760 13103 197
NM_005088chrX--1743 ----
NM_005095chr121756 550 11418 ----
NM_005103chr111232 ------
NM_005126chr3--2491 287 --2909 53
NM_005135chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_005155chr61542 ------
NM_005156chr944659 4440 3595 797 23832 1663 ----
NM_005157chr941767 451 274 23 --11507 1648
NM_005164chr121698 22127 1894 ----
NM_005168chr211182 21190 235 ----
NM_005171chr1231027 424 283 --1517 --
NM_005180chr10183 11121 ----
NM_005188chr11128221 8082 6776 6728 6702 6238 5851 5225 2513 2425 2403 2384 15815 25113 969 --
NM_005189chr1742448 2162 1897 414 11593 --11794
NM_005190chr61109 ------
NM_005197chr1485935 5626 5103 2379 1977 737 690 348 26116 4742 21918 562 13984
NM_005201chr32247 129 11100 ----
NM_005206chr17--21301 220 ----
NM_005207chr2273718 3283 3158 2561 1181 1088 1028 31383 197 105 --12619
NM_005231chr113957 875 205 2981 285 ----
NM_005233chr3------22443 718
NM_005249chr141166 ------
NM_005254chr1521109 486 ------
NM_005261chr82790 406 ------
NM_005277chr41712 1288 11880 --
NM_005295chr71228 178 ----
NM_005296chrX--3694 670 210 1747 --
NM_005302chr71289 ------
NM_005316chr1121069 813 ------
NM_005328chr81527 2574 158 ----
NM_005329chr1621855 676 12368 --2706 310
NM_005338chr753047 2821 1586 1084 595 1566 22760 129 --
NM_005339chr443722 801 577 363 ------
NM_005359chr1851964 800 627 467 284 26389 964 15839 --
NM_005397chr764020 3648 2478 1280 315 62 11211 --13501
NM_005400chr232633 822 27 22308 620 --13038
NM_005402chr721766 1274 ------
NM_005406chr1811015 ------
NM_005407chr1421550 402 1485 ----
NM_005415chr22623 144 --128 1163
NM_005433chr1832458 2017 923 137 ----
NM_005436chr1043896 3566 2987 2708 12732 ----
NM_005445chr10--1257 ----
NM_005455chr11629 ----1197
NM_005460chr52498 410 ------
NM_005465chr121674 1281 ------
NM_005493chr61696 ------
NM_005497chr1786154 6067 2383 1759 1511 1130 1017 430 ----16051
NM_005499chr191449 ------
NM_005502chr953220 2850 921 611 540 --1505 1491
NM_005504chr1245597 5377 2492 1379 25416 159 --11301
NM_005509chr51681 --11183 --
NM_005520chr5--1758 ----
NM_005537chr1321065 995 ----11014
NM_005542chr721787 368 ------
NM_005544chr22676 327 --1215 --
NM_005559chr18136 ------
NM_005574chr111300 ------
NM_005578chr342037 1331 1324 378 24422 3749 ----
NM_005596chr955469 5305 5097 4740 4455 ----124
NM_005605chr82279 256 ------
NM_005610chr11740 ------
NM_005614chr73866 794 423 ------
NM_005619chr191122 ------
NM_005626chr1----1406 --
NM_005629chrX11064 ----11331
NM_005637chr181550 --12023 --
NM_005639chr1211679 1292 ----
NM_005647chrX13279 33207 3109 2376 --1352
NM_005649chr5--1511 ----
NM_005662chr81372 ------
NM_005664chr152375 254 ------
NM_005665chr133868 3227 3067 21787 180 11339 --
NM_005667chr21131 ------
NM_005668chr544534 4091 3969 215 --11531 --
NM_005711chr51695 ------
NM_005722chr252278 2151 946 631 57 ------
NM_005725chr132407 1499 118 21533 869 ----
NM_005730chr1263451 2697 2678 1218 446 158 2409 174 --13033
NM_005738chr711497 1528 1406 --
NM_005739chr1521953 414 12237 ----
NM_005746chr722311 229 1723 11969 1203
NM_005748chr1262694 1058 729 552 220 64 ------
NM_005752chr1631005 431 155 1244 ----
NM_005759chr284706 4687 3343 1513 1496 1446 1030 736 1253 23186 403 13195
NM_005779chr533221 2770 246 33071 1421 916 12668 1500
NM_005780chr132993 116 ------
NM_005786chr182902 491 ----1384
NM_005795chr252136 1852 1116 752 508 12474 --12921
NM_005798chr1355255 3212 1768 1570 511 --14497 14284
NM_005801chr17----1238 --
NM_005806chr2121052 1028 ----11284
NM_005808chr343548 3261 2629 1085 13582 ----
NM_005822chr6--169 12092 --
NM_005828chr1754178 4168 3193 1307 1186 11709 ----
NM_005840chrX65520 3019 2243 2069 223 133 32646 1804 731 --11020
NM_005843chr22777 562 1386 11269 --
NM_005851chr11--1401 ----
NM_005859chr531319 1292 1156 1254 ----
NM_005862chr32312 196 1911 ----
NM_005877chr223692 491 21 ------
NM_005880chr161660 ------
NM_005885chr52664 353 11339 ----
NM_005901chr1837720 7690 5783 38393 7570 691 15769 --
NM_005903chr565224 3899 3428 3197 2045 1148 23186 1804 ----
NM_005907chr621420 1070 11694 ----
NM_005909chr554116 3499 1621 180 135 1120 ----
NM_005927chr531054 1019 228 2146 88 --1858
NM_005933chr1142883 2812 2770 451 12864 22374 595 1572
NM_005935chr455200 4017 1509 758 567 --14947 --
NM_005938chrX41386 1353 1237 925 --1232 11411
NM_005941chr843458 2877 2821 2739 22854 1223 ----
NM_005955chr144831 4724 1549 785 15485 14950 --
NM_005962chr1052165 2058 1904 1809 653 ------
NM_005962chr1052165 2058 1904 1809 653 ------
NM_005984chr221523 1147 --188
NM_005996chr1231228 1192 155 --1386 --
NM_005999chr111353 11311 1459 --
NM_006007chr924386 4231 2719 582 --1292
NM_006011chr1554240 3694 1009 477 43 --11187 --
NM_006016chr621913 1771 1281 --1397
NM_006022chr1331074 1048 63 ------
NM_006035chr1431304 456 302 --159 --
NM_006036chr232331 2112 691 32076 2049 2019 ----
NM_006038chr2032130 747 244 ----1580
NM_006040chr162325 308 --1101 --
NM_006047chr2063479 3459 2424 1341 665 371 23561 3006 12417 --
NM_006054chr1131511 1451 93 ------
NM_006076chr753084 2912 1974 609 584 --21287 117 --
NM_006079chr62858 852 1525 1725 --
NM_006089chrX21674 1578 ------
NM_006090chr11635 ------
NM_006095chr444444 2897 221 73 32949 533 265 ----
NM_006136chr7176 1445 ----
NM_006139chr272856 2415 2407 2114 1056 223 126 1803 ----
NM_006141chr1662119 2022 1104 958 517 59 32139 1899 1804 11990 --
NM_006145chr1921105 370 11166 ----
NM_006153chr3--1422 ----
NM_006154chr1541818 501 407 350 21967 1930 12063 --
NM_006156chr141245 ------
NM_006164chr21165 ------
NM_006166chr1232499 1916 910 --12393 --
NM_006167chr831825 633 353 ------
NM_006180chr931636 826 719 11822 ----
NM_006186chr2152 ------
NM_006190chr23909 711 449 ------
NM_006194chr141963 --1148 --
NM_006196chr21315 ------
NM_006203chr575320 3660 3575 1143 713 421 105 11340 ----
NM_006206chr432570 2465 1996 32678 1897 687 ----
NM_006211chr8--1224 ----
NM_006212chr154032 3635 2114 1857 972 1995 ----
NM_006224chr1732436 2223 193 ------
NM_006226chr211304 --1214 --
NM_006242chr2021337 576 31904 1849 1495 ----
NM_006243chr11219 ------
NM_006245chr63992 843 816 ------
NM_006246chr141395 ------
NM_006251chr531020 641 520 12773 12578 --
NM_006252chr197116 6493 5653 5634 5110 2156 1607 1507 954 11487 ----
NM_006265chr81161 ------
NM_006277chr22550 256 ------
NM_006283chr874905 4774 4699 4487 4401 3832 157 21947 1903 14726 14086
NM_006294chr81368 --1493 --
NM_006303chr71116 --1123 --
NM_006306chrX44919 2184 964 132 --22078 1012 --
NM_006310chr1741345 1295 1076 83 1904 ----
NM_006315chr444417 3968 829 88 23899 2880 14465 --
NM_006320chr421075 418 1180 ----
NM_006330chr831120 550 127 11213 11421 --
NM_006334chr91213 ------
NM_006352chr11304 --12080 1734
NM_006364chr1421299 1128 ------
NM_006371chr354521 4382 1502 1074 359 ----14498
NM_006375chrX31514 1362 233 1272 ----
NM_006377chr921254 282 --122 --
NM_006379chr711953 11537 11804 --
NM_006380chr1784266 4199 3431 3135 2783 1025 929 698 34386 3188 2926 ----
NM_006393chr1053997 3651 3211 1493 235 13938 ----
NM_006415chr921042 133 ------
NM_006416chr63622 611 171 ------
NM_006421chr821088 233 ------
NM_006431chr121170 ------
NM_006451chr511017 2905 159 ----
NM_006454chr483000 2386 1153 569 333 172 107 50 ----12971
NM_006457chr442550 899 893 499 --11066 --
NM_006459chr101265 ----11488
NM_006469chr131045 309 102 ------
NM_006482chr1223103 1029 12500 --1328
NM_006491chr141309 ------
NM_006504chr1042865 2587 862 230 12505 12448 --
NM_006519chr6------1247
NM_006526chr201547 ------
NM_006534chr2053053 2907 849 700 313 ------
NM_006537chr151128 ------
NM_006544chr1444804 4093 2233 29 24364 926 11739 --
NM_006546chr17126484 6428 6007 5927 5851 5133 5057 5019 4536 4264 4146 225 24245 712 11942 --
NM_006549chr1252723 2684 2483 2067 1039 2787 297 ----
NM_006557chr9--11292 ----
NM_006559chr121227 993 11206 ----
NM_006561chr1085861 5626 5431 4226 2127 1810 1699 671 --14989 11090
NM_006572chr1741387 1058 1038 1002 22824 2740 1334 --
NM_006577chr21873 11190 ----
NM_006599chr1697878 6119 6068 5737 3088 2943 2930 1840 1458 --13253 26698 5532
NM_006602chr201655 ----1541
NM_006609chr212149 32235 1993 1128 22067 1867 --
NM_006614chr333313 2575 178 11316 12762 --
NM_006621chr141885 1645 1469 323 11586 ----
NM_006628chr1544213 3717 1505 713 24639 31 1797 --
NM_006629chr1852866 2527 2144 1994 952 ------
NM_006633chr51165 1740 ----
NM_006636chr22341 290 ------
NM_006650chr5103832 3803 2723 1365 1352 779 744 626 321 278 13173 ----
NM_006654chr1283671 3205 3139 2944 1768 1356 825 376 43906 3391 1460 979 14180 --
NM_006675chr1272839 2792 2511 896 874 784 69 22611 248 23042 174 13439
NM_006681chr41122 ------
NM_006691chr1121148 889 ------
NM_006706chr5--1796 ----
NM_006713chr51182 1587 ----
NM_006717chr952766 2391 1291 1102 125 123 12817 12938
NM_006721chr103521 232 220 1531 --1593
NM_006722chr312867 32703 2644 2486 ----
NM_006729chrX44252 4211 3763 409 21219 669 ----
NM_006734chr621542 1313 ------
NM_006738chr1533067 1110 1000 24035 463 --14446
NM_006750chr1687424 7359 6401 5358 1572 1531 1185 438 52867 1826 1416 1279 283 17252 --
NM_006754chr731247 105 56 ------
NM_006766chr831923 1767 977 ------
NM_006775chr652896 2223 1075 769 619 1591 ----
NM_006777chrX22781 2750 22478 2229 ----
NM_006788chr1851619 1556 1433 706 234 ------
NM_006790chr5--1436 ----
NM_006806chr21126 ------
NM_006813chr61585 1374 1308 --
NM_006814chr202374 326 --1851 --
NM_006824chr1186 ------
NM_006826chr21927 ------
NM_006838chr121207 --31429 739 706 --
NM_006839chr2--140 ----
NM_006852chr1732236 1939 893 21051 971 ----
NM_006868chr1851113 998 878 405 372 22356 267 1528 --
NM_006874chr43842 468 451 ------
NM_006875chrX2337 271 ------
NM_006885chr1613462 22741 469 ----
NM_006888chr1432789 655 278 1136 ----
NM_006902chr133080 2165 95 --2145 50 --
NM_006908chr731469 1337 121 21213 315 1349 --
NM_006915chrX12317 2750 106 ----
NM_006918chr1134277 3840 1246 54724 4598 3580 916 220 34707 3752 1179 --
NM_006920chr222036 1624 32027 1563 98 ----
NM_006922chr21895 31952 511 96 167 --
NM_006924chr1721103 501 2856 443 12975 --
NM_006925chr14--176 ----
NM_006939chr141787 1232 ----
NM_006940chr1251826 1712 1701 412 251 --1375 1722
NM_006954chr1043277 2792 2171 224 13223 12248 --
NM_006962chrX----150 --
NM_006974chr1043277 2792 2171 224 13223 12248 --
NM_006981chr922035 279 11846 --12608
NM_006990chr142355 543 392 62 11700 ----
NM_006991chr321027 735 ------
NM_007007chr1221795 1617 --22971 1302 13309
NM_007017chr51681 1745 ----
NM_007023chr25705 687 379 320 257 ----1968
NM_007030chr574259 4232 3541 3404 1120 1076 822 --35203 843 639 --
NM_007034chr11302 ------
NM_007036chr5--11014 ----
NM_007038chr2165011 4220 4071 2008 1951 115 44938 3937 1586 1183 14914 --
NM_007039chr1411467 21605 557 ----
NM_007050chr2067892 6747 5480 1625 1325 1307 36929 4990 944 ----
NM_007073chr654152 4011 3329 3223 1224 22931 2608 --21343 1328
NM_007106chr1322185 907 22438 1106 ----
NM_007125chrY21430 133 1244 ----
NM_007137chrX44029 3498 1188 1013 15319 ----
NM_007172chr2242066 1134 741 32 12766 1171 --
NM_007175chr833535 583 463 --12485 11174
NM_007187chr131238 196 ----
NM_007200chr1533067 1110 1000 24035 463 --14446
NM_007202chr172691 497 ------
NM_007217chr31264 ------
NM_007218chr81152 ----2633 317
NM_007222chr821645 1588 ----1163
NM_007236chr1572005 1916 1864 1622 391 318 146 12161 ----
NM_007249chr1367890 3561 3272 2254 2051 1346 15955 16443 16288
NM_007271chr641451 747 619 401 --11603 --
NM_007279chr191607 ------
NM_007282chr34961 788 347 167 1802 ----
NM_007313chr941767 451 274 23 --11507 1648
NM_007345chr1821738 187 ------
NM_007347chr1542856 1980 336 250 --22864 2644 --
NM_007358chr12779 158 ------
NM_007361chr14------1538
NM_007372chr171345 1679 ----
NM_007373chr103266 245 132 1569 ----
NM_007375chr142571 1096 449 318 --1809 --
NM_012081chr522292 1378 22424 1429 11157 --
NM_012089chr111481 1329 ----
NM_012096chr332596 1296 627 --11215 --
NM_012097chr21588 12244 ----
NM_012111chr14--1203 ----
NM_012124chr111612 1594 ----
NM_012134chr131512 1401 28 1639 ----
NM_012137chr151986 636 324 105 97 2803 207 --12844
NM_012141chr1333164 1520 730 33844 1666 353 1281 --
NM_012153chr1162516 2354 2098 1871 673 330 ------
NM_012164chr987322 6788 2729 423 338 206 147 38 27058 1534 1533 --
NM_012177chr6--1579 ----
NM_012183chr11528 ------
NM_012193chr1134074 1356 48 15315 11031 --
NM_012199chr123504 62 11289 --1323
NM_012210chr93623 563 310 21558 1491 ----
NM_012214chr266373 6164 5959 5757 2176 1603 35371 4434 1902 12455 15678
NM_012215chr1021872 457 ------
NM_012219chr312645 ----1579
NM_012223chr221201 397 --11260 --
NM_012234chr353547 2437 2423 855 123 23541 3386 ----
NM_012238chr1011562 21442 61 1643 --
NM_012244chr1441542 1214 268 71 ----1728
NM_012247chr1021009 734 ----1343
NM_012249chr222880 2199 33476 767 625 ----
NM_012250chr1131389 1301 319 ------
NM_012252chr744492 4220 1037 52 11777 --14890
NM_012257chr71719 ----1292
NM_012262chr195230 4415 3893 3830 3506 3383 2110 1039 515 --14570 --
NM_012266chr92361 291 ------
NM_012279chr521822 561 1422 1650 --
NM_012281chr721792 894 11582 ----
NM_012290chr21163 11041 ----
NM_012293chr25870 725 406 286 38 21802 457 ----
NM_012294chr742638 713 600 62 43534 2976 1370 430 1311 --
NM_012297chr412070 ------
NM_012300chr552469 2459 2319 2227 1609 ----1428
NM_012304chr572318 2140 2004 1676 951 618 508 22490 1823 1843 --
NM_012309chr1184657 3906 3769 1779 1768 1351 1033 77 ------
NM_012316chr134482 2193 1044 21514 1151 15173 --
NM_012325chr2051538 1131 1069 618 525 11496 ----
NM_012326chr21108 ------
NM_012327chr1841085 1065 568 423 ------
NM_012330chr1021542 1311 1659 1511 --
NM_012399chr2231960 1771 458 134 ----
NM_012414chr12718 216 1648 ----
NM_012416chr92354 104 ------
NM_012419chr6--4665 625 420 210 ----
NM_012464chr442748 2120 1100 356 22944 2046 ----
NM_012471chrX41505 1484 483 334 11943 1669 --
NM_013231chr1474177 3839 1304 1236 954 292 175 23797 2721 ----
NM_013233chr21939 ------
NM_013242chr161385 ------
NM_013250chr11--11511 ----
NM_013255chr746460 3110 922 481 78809 8252 7729 6159 2224 1866 1307 ----
NM_013257chr821526 1502 12325 ----
NM_013261chr453683 3300 1397 942 254 33270 1189 838 ----
NM_013262chr6--11331 ----
NM_013269chr1234417 1499 207 --1183 --
NM_013281chr20--11072 ----
NM_013286chr383419 3318 2645 2534 1265 1174 773 36 ------
NM_013336chr341484 802 736 145 1233 11266 --
NM_013338chr13142 ------
NM_013348chr1921118 862 11030 ----
NM_013357chr81841 ------
NM_013372chr151539 33390 2551 818 ----
NM_013381chr1232014 962 612 ------
NM_013410chr111049 ------
NM_013423chrX11296 1955 --11028
NM_013427chrX11296 1955 --11028
NM_013937chr621017 218 1467 ----
NM_013960chr82654 31 ------
NM_013989chr1455103 4972 4138 3659 1891 ------
NM_013996chr7----2152 41 --
NM_013996chr7----2152 41 --
NM_013997chr7----2152 41 --
NM_013997chr7----2152 41 --
NM_013998chr7----2152 41 --
NM_013998chr7----2152 41 --
NM_014000chr1041406 723 512 484 11684 ----
NM_014007chr92453 83 --11018 --
NM_014011chr212577 ----12409
NM_014021chr143013 975 572 72 22814 2427 12268 --
NM_014035chr531367 341 244 1505 ----
NM_014043chr31496 31195 464 166 ----
NM_014048chr1684657 4543 4454 4337 3717 1294 1193 1079 24669 236 13787 --
NM_014056chr321446 749 12261 ----
NM_014089chr1332272 1793 1704 11840 ----
NM_014106chr1542296 1973 1039 949 12279 ----
NM_014112chr855294 5222 4510 4027 2085 --14934 --
NM_014117chr1642370 2075 584 410 22116 2057 ----
NM_014141chr764951 4508 4313 1720 579 551 12128 24124 3437 --
NM_014154chr31179 ------
NM_014155chr11107183 6753 5519 5480 5173 4937 2824 2036 1862 1053 22267 1787 16907 1190
NM_014159chr33565 145 101 ------
NM_014181chr222654 37 12888 --1316
NM_014223chr11718 ------
NM_014248chr22------1153
NM_014263chr1041351 495 264 131 ------
NM_014282chr91115 ------
NM_014283chr131526 953 543 --1160 --
NM_014294chr821263 1247 1438 ----
NM_014309chr2235142 3566 1929 11653 ----
NM_014313chr131543 1380 304 1241 --1398
NM_014319chr1211594 ------
NM_014325chr1231586 281 133 22250 422 ----
NM_014331chr436839 5468 1324 37573 6469 2291 ----
NM_014333chr111748 12621 11844 --
NM_014335chr153886 366 89 ------
NM_014342chr1121406 1000 31271 1227 929 ----
NM_014350chr51418 2930 186 ----
NM_014352chr1111008 ----1391
NM_014363chr1321274 83 11131 ----
NM_014368chr961731 1458 1313 841 549 342 ------
NM_014372chr131862 1524 616 --1722 --
NM_014376chr532207 1002 512 22370 1923 ----
NM_014382chr32524 464 11546 ----
NM_014392chr451118 477 160 130 30 --1414 21464 1212
NM_014395chr421422 393 ------
NM_014411chr751941 1925 1803 1704 252 2499 93 ----
NM_014423chr555585 3812 1724 872 48 25610 3566 --15479
NM_014426chr201753 ------
NM_014445chr352328 2275 2214 903 138 2860 832 --11634
NM_014456chr1021669 265 1400 ----
NM_014488chr11----1632 --
NM_014489chr11------1268
NM_014496chrX--193 ----
NM_014548chr152572 466 ----11155
NM_014563chrX31660 398 291 11879 22027 1654 --
NM_014574chr141159 ----11015
NM_014575chr33505 381 180 173 ----
NM_014584chr141381 --11645 --
NM_014588chr202537 119 123 ----
NM_014606chr411129 11452 ----
NM_014613chr542814 2351 2297 1003 12114 12823 --
NM_014614chr211211 ----11457
NM_014615chr1663409 3199 2692 2258 2250 116 13116 ----
NM_014618chr9----1341 --
NM_014630chr1572966 2707 2637 2592 807 310 144 --12714 141
NM_014632chr11144 ------
NM_014634chr2273418 2995 2915 2890 2298 2276 773 23610 3438 33649 2505 756 --
NM_014635chr231527 1076 697 2241 85 ----
NM_014636chr942953 1274 1033 733 23178 897 1658 13989
NM_014647chr1632283 375 91 ------
NM_014660chr711110 ------
NM_014666chr5176 ------
NM_014669chr161131 ------
NM_014673chr8187 ------
NM_014676chr111479 1597 ----
NM_014682chr821519 81 11954 ----
NM_014702chr643312 2713 2707 370 21378 51 ----
NM_014705chr7--21557 323 ----
NM_014711chr1621516 286 11793 --11973
NM_014717chr191869 ----1763
NM_014720chr1021359 1256 1563 1607 --
NM_014721chr656288 6280 6266 1686 1241 25103 632 26526 615 --
NM_014727chr191313 ------
NM_014730chr1245088 1841 1199 1004 --1640 13529
NM_014730chr1245088 1841 1199 1004 --1640 13529
NM_014732chr1675534 4762 4435 1860 1706 1575 44 11605 2723 264 25809 207
NM_014733chr542155 399 328 289 1429 ----
NM_014738chr172750 140 --1743 --
NM_014743chr421199 655 1243 2809 365 --
NM_014746chr244220 3914 1100 127 11026 --11678
NM_014751chr812011 11935 --1268
NM_014752chr11--2793 264 ----
NM_014755chr231477 1310 1050 24103 1650 ----
NM_014760chr341826 1807 1795 1639 --1579 --
NM_014765chr111894 12095 12241 --
NM_014770chr1211182 ------
NM_014783chr1521259 1234 ------
NM_014787chr1155 --139 --
NM_014803chr1022767 2305 1498 --21986 681
NM_014810chr142766 2277 491 255 --133 --
NM_014819chr511847 21718 549 11586 --
NM_014824chr1131844 1675 648 ------
NM_014829chr512305 ------
NM_014830chr1272411 1339 1228 1103 688 663 347 --11095 --
NM_014832chr132744 168 --1622 --
NM_014835chr2042214 1662 1530 191 1171 11651 --
NM_014836chr1021443 661 11864 ----
NM_014838chr2221028 230 ------
NM_014839chr142483 2301 1549 777 --1327 22539 2080
NM_014840chr1292880 2824 2506 2207 902 782 512 195 186 33288 3027 2786 ----
NM_014850chr344420 4275 1194 1110 --23562 206 --
NM_014864chr124278 2776 43488 1553 867 283 14010 --
NM_014873chr144017 846 195 21 ------
NM_014877chr1786972 6328 5514 5362 3019 2150 1712 931 32988 1902 1085 17103 1200
NM_014888chr71154 11458 ----
NM_014893chrY42279 573 262 105 1845 ----
NM_014903chr1282104 1944 1915 1838 1591 438 101 82 1170 22349 587 --
NM_014906chr1784115 3185 3179 3082 1281 789 766 574 12775 23278 3229 --
NM_014912chr1033354 3186 636 23088 807 ----
NM_014913chr181298 ------
NM_014920chr653793 3266 3115 865 144 --23564 2912 12847
NM_014923chr1331847 1765 459 11559 11856 --
NM_014924chr1432127 284 166 ----12787
NM_014946chr212418 1468 --1518
NM_014947chr173093 2625 1266 820 271 211 96 13113 --1297
NM_014978chr1011265 --1213 --
NM_014982chr1454539 4162 850 735 227 21893 368 ----
NM_014989chr631317 548 527 11849 ----
NM_014991chr432978 2554 2058 ------
NM_014997chr742755 2404 1927 80 22440 694 1669 --
NM_015002chr1232259 511 232 ------
NM_015008chr323588 3114 ------
NM_015009chr31151 ------
NM_015017chr121060 808 11176 ----
NM_015025chr242403 2228 2059 1763 --11701 --
NM_015026chr1254801 4729 3738 3633 1202 --13484 --
NM_015027chr1631477 802 79 22005 1590 11700 --
NM_015032chr1332473 2224 471 ----1575
NM_015039chr153316 2752 1549 1180 1117 13985 13089 --
NM_015040chr233177 2935 110 ------
NM_015046chr912429 22251 857 ----
NM_015051chr963268 3259 1229 1141 1069 1034 23141 292 11018 22678 1091
NM_015055chr1162898 2805 1062 1047 1006 535 ------
NM_015059chr1553152 2808 2511 1387 1255 13999 13527 12647
NM_015068chr763958 3792 1579 1346 258 223 2359 325 11455 179
NM_015090chr1106098 5736 4536 4193 3830 2420 2260 1751 204 131 15999 --14248
NM_015092chr1654339 4190 3793 3425 1752 --14177 11794
NM_015093chr62466 130 199 ----
NM_015107chrX4895 667 622 56 1537 ----
NM_015115chr42825 232 32891 529 455 ----
NM_015116chr1341647 1488 1469 283 11266 2359 272 --
NM_015130chr41353 11351 ----
NM_015143chr42574 43 ------
NM_015144chr1663911 3812 2628 2434 1083 202 43202 2867 1360 178 ----
NM_015150chr32773 204 2673 40 --122
NM_015155chr1033315 2708 2695 11194 ----
NM_015156chr1463694 3493 3415 2935 2658 550 1524 12903 --
NM_015158chr92782 47 1690 ----
NM_015163chr1431903 1748 391 1417 12004 --
NM_015180chr14245 24 1715 ----
NM_015186chr9--1473 ----
NM_015187chr43895 136 108 ------
NM_015191chr1172047 1767 1107 724 696 690 379 --11723 --
NM_015192chr202537 182 ------
NM_015200chr421951 985 12581 ----
NM_015208chr1824043 290 12989 12658 --
NM_015209chr142135 1774 1632 242 ------
NM_015215chr122137 1958 11078 12804 --
NM_015219chr1732424 886 43 ------
NM_015225chr942469 976 200 115 1614 32759 1136 776 --
NM_015236chr421505 37 2579 194 ----
NM_015247chr1674500 3813 3367 1969 1684 1470 1361 ------
NM_015256chr51295 2483 219 ----
NM_015260chr1911333 1494 11059 2304 190
NM_015264chr2264763 4193 3879 3223 288 57 21743 794 ----
NM_015265chr232330 2297 2205 32385 1729 729 ----
NM_015267chr1231538 1527 717 ----1613
NM_015269chr1------1491
NM_015270chr1232162 2084 110 1946 12208 3835 802 613
NM_015271chr412795 199 21111 977 --
NM_015272chr1631832 1339 529 ------
NM_015277chr1821363 490 ------
NM_015286chr151909 62468 2194 2150 1798 523 348 2404 48 --
NM_015288chr583847 3507 3205 2565 754 719 663 234 23213 1375 13061 --
NM_015308chr11--179 ----
NM_015313chr1143567 2959 1508 1003 --13560 11170
NM_015315chr523301 2701 23060 2568 --12885
NM_015318chr1951860 1691 1570 1439 143 --11270 --
NM_015322chr15------138
NM_015328chr732589 2137 552 --12448 --
NM_015332chr733553 1353 1267 --11018 21026 803
NM_015335chr1221695 153 --1566 --
NM_015336chr1221840 735 12671 22577 575 --
NM_015339chr20--1747 ----
NM_015347chr1231108 981 855 12548 ----
NM_015355chr172541 437 11614 ----
NM_015382chr142162 95 ------
NM_015387chr221513 584 21685 278 ----
NM_015393chr453699 3676 3575 3296 1349 43718 2730 2630 1373 11442 --
NM_015394chr1222193 2063 12467 1573 --
NM_015397chr971935 1677 1429 772 704 492 259 11371 ----
NM_015423chr1151657 1444 1253 614 252 11204 ----
NM_015429chr3--1734 ----
NM_015436chr443015 513 241 121 12157 ----
NM_015446chr111496 ------
NM_015455chr541455 1409 1173 161 13998 ----
NM_015458chr835184 575 233 --15349 --
NM_015460chr382119 2106 1565 1497 1486 1389 367 22 21371 590 11977 11878
NM_015461chr18--1596 ----
NM_015464chr71664 11000 ----
NM_015475chr221046 915 ------
NM_015483chr7--158 ----
NM_015488chr221626 672 ----11283
NM_015497chr153872 153 62 ------
NM_015520chr342563 1767 1131 194 1942 --1734
NM_015532chr1542699 2535 1139 79 ------
NM_015535chr241614 1038 1024 116 174 22726 84 --
NM_015541chr331217 1115 891 --11108 --
NM_015555chr62726 564 21518 609 1170 --
NM_015560chr312322 1457 ----
NM_015568chr2094294 3935 3639 2684 1284 701 523 492 85 13077 --23861 802
NM_015569chr131616 1583 197 1168 21338 935 --
NM_015570chr731851 1466 517 ------
NM_015576chr321203 731 --22572 2122 --
NM_015599chr6159 ------
NM_015640chr121945 1744 33665 608 493 32080 1706 832 --
NM_015657chr25790 749 680 394 237 ------
NM_015684chr14--2232 218 ----
NM_015691chrX52917 2691 1894 1855 888 12602 --1497
NM_015833chr211425 12344 ----
NM_015834chr21--1955 ----
NM_015840chr142301 836 587 34 ------
NM_015841chr142301 836 587 34 ------
NM_015850chr842370 2151 1633 230 22466 2003 1495 --
NM_015852chr713051 --2595 511 1744
NM_015866chr141470 1269 1017 570 ------
NM_015878chr811460 22051 1815 11435 --
NM_015879chr18128235 8140 7005 6553 5783 5527 3213 3002 2250 2067 1497 247 28389 5670 23345 3049 --
NM_015885chr11--1740 ----
NM_015886chr835455 1000 643 14075 25391 104 24023 4009
NM_015902chr81960 ------
NM_015906chr164256 3075 931 369 317 187 13423 ----
NM_015908chr7196 ------
NM_015912chr842461 2305 488 235 1358 ----
NM_015913chr13715 238 158 ------
NM_015941chr81130 ------
NM_015955chr21516 ------
NM_015981chr582696 2596 2389 2098 1253 1106 232 34 23006 2527 --12612
NM_015995chr1584950 4836 4085 4031 3927 1925 801 736 45258 3847 1634 1160 13859 1133
NM_016002chr13618 560 528 1112 ----
NM_016009chr174882 4553 4370 3363 1596 198 142 --14831 --
NM_016018chr831961 235 128 --1714 11783
NM_016019chr71274 ------
NM_016023chr831984 1671 1408 32194 1526 656 ----
NM_016025chr1631928 1643 485 --11967 --
NM_016040chr142533 2073 848 833 22332 938 ----
NM_016045chr2011141 ------
NM_016066chr1134 ------
NM_016072chr1221851 465 ----11725
NM_016081chr431981 1408 385 22062 475 ----
NM_016083chr643086 1395 468 151 --1545 --
NM_016090chr111235 ------
NM_016124chr121438 1270 11282 ----
NM_016131chr21854 11872 ----
NM_016132chr1542980 2546 1370 318 1701 ----
NM_016144chr53777 565 71 ----1710
NM_016200chr73549 323 89 ------
NM_016205chr41944 ------
NM_016206chr369004 7534 6105 5971 228 124 28600 8538 38870 6307 966 26994 755
NM_016217chr673541 3223 2989 829 819 571 132 22418 1315 ----
NM_016227chr131526 953 543 --1160 --
NM_016248chr1341542 746 661 652 1190 1235 --
NM_016252chr22690 60 ------
NM_016255chr623141 2251 21177 161 --12341
NM_016257chr122729 1351 12417 32515 1300 538 --
NM_016260chr267157 5223 2071 1185 1000 155 --16759 --
NM_016271chr1841908 1860 1812 41 ----1457
NM_016279chr51130 ------
NM_016284chr16129 ------
NM_016289chr262006 1912 1498 243 219 98 ------
NM_016300chr3--1334 ----
NM_016311chr1190 ------
NM_016312chr121216 ------
NM_016315chr221476 405 1412 196 --
NM_016322chr923075 2169 1162 1998 12467
NM_016333chr16--1524 ----
NM_016353chr821945 83 11844 --22142 1675
NM_016356chr612763 ------
NM_016357chr12--165 ----
NM_016374chr121357 1350 ------
NM_016374chr121357 1350 ------
NM_016399chr124750 722 589 63 1774 --1217
NM_016403chr111506 ------
NM_016418chr2263445 3172 1256 752 731 455 23729 3551 22554 1056 --
NM_016422chr11--1278 ----
NM_016427chr181141 ------
NM_016436chr2031887 402 295 ------
NM_016441chr21238 ------
NM_016448chr131601 630 384 ----11821
NM_016454chr15--1305 ----
NM_016507chr1713047 42306 1193 1148 87 --12998
NM_016513chr653793 3266 3115 865 144 --23564 2912 12847
NM_016516chr22621 567 ------
NM_016519chr4--176 1202 --
NM_016525chr91940 ------
NM_016526chr1132452 651 420 --21919 199 12291
NM_016530chr1543710 1441 894 144 13523 13735 11400
NM_016531chr472806 2681 1494 1387 1188 543 247 43683 3257 2949 399 --11141
NM_016542chrX11423 11301 ----
NM_016569chr1231228 1192 155 --1386 --
NM_016603chr522085 135 11924 ----
NM_016605chr541995 768 303 166 12597 32610 1968 1907 --
NM_016621chr11103323 3268 1395 1354 1187 1151 406 258 247 166 14166 2229 146 --
NM_016623chr8------1173
NM_016626chr1831583 1365 442 1260 ----
NM_016654chr1521109 486 ------
NM_016823chr17--21171 90 ----
NM_016824chr1031909 1803 326 1590 ----
NM_016950chr41259 ------
NM_017415chr544173 3782 1377 643 ------
NM_017420chr14--23847 1219 11033 --
NM_017447chr2163360 3340 2909 959 762 274 3305 146 116 --11209
NM_017519chr61379 ------
NM_017551chr1032578 1971 1041 --12280 1299
NM_017593chr41190 ------
NM_017610chr1521705 1464 --11929 --
NM_017628chr464956 4268 4146 4129 741 63 14227 1770 14340
NM_017633chr643883 3658 1527 556 11493 23575 2717 --
NM_017635chr1121119 425 ------
NM_017637chr948516 7692 994 27 77725 7470 6759 2848 2083 1896 963 18522 47296 1485 1116 741
NM_017644chr374502 4169 3810 3478 3248 1605 93 24791 3424 13987 --
NM_017645chr912519 32777 2724 695 ----
NM_017650chr756049 5855 5100 4118 4030 25315 1716 ----
NM_017658chr1484572 4239 3911 1765 1633 1177 540 240 1571 1930 --
NM_017661chr15156 11070 ----
NM_017667chr7197 1508 ----
NM_017686chr12914 412 ------
NM_017709chr154257 3556 3352 1522 210 13243 1359 --
NM_017730chr31231 ------
NM_017737chr111797 4847 559 515 305 ----
NM_017745chrX159 ------
NM_017748chr172856 261 1104 1325 --
NM_017754chr684905 4895 4867 4445 4209 3429 1660 799 1109 127 14754
NM_017761chr141302 579 421 47 11047 21198 952 1945
NM_017762chr1572337 1973 1580 862 378 67 39 1873 ----
NM_017769chr1433175 2257 1010 23237 2267 11260 12792
NM_017780chr81921 1634 --1157
NM_017787chr1062715 2296 2189 997 509 499 21906 594 ----
NM_017794chr91321 1298 ----
NM_017798chr2011181 --1505 --
NM_017801chr342562 1758 710 155 ------
NM_017811chr931926 872 492 12154 22320 609 --
NM_017813chr814957 45820 1836 1794 1395 13599 --
NM_017842chr122687 187 ------
NM_017843chr20----1635 --
NM_017848chrX43983 3873 3742 3552 ------
NM_017880chr22457 317 ------
NM_017902chr1045226 1339 315 28 21637 1321 12035 --
NM_017905chr131568 ------
NM_017913chr9130 1445 ----
NM_017919chr984923 4694 4682 2016 1741 1471 377 246 11005 21239 29 14571
NM_017922chr141158 ------
NM_017944chr1152798 2267 1108 892 74 11195 12489 --
NM_017953chr1191 ------
NM_017954chr721221 164 1591 1477 --
NM_017958chr263046 2511 2462 985 343 182 12208 ----
NM_017993chr131281 ------
NM_017994chr712206 ----12300
NM_018000chr251603 512 442 410 306 12128 ----
NM_018027chr1043301 3052 2990 1290 1698 ----
NM_018047chr51637 ------
NM_018061chr131560 1399 477 21424 424 ----
NM_018084chr223147 409 32349 943 225 ----
NM_018085chr187910 5387 2734 2389 2306 2078 1606 170 36931 5197 3212 12234 22419 2251
NM_018086chr221642 348 11485 1409 --
NM_018092chr163357 256 236 --1553 1531
NM_018094chrX1359 ------
NM_018098chr321146 1064 ----1333
NM_018103chr1--1324 ----
NM_018112chr9----165 --
NM_018120chr82518 72 --11197 --
NM_018121chr1043196 1175 121 98 1702 --12377
NM_018133chr332107 1487 130 --1379 --
NM_018155chr3----11177 12911
NM_018159chrX2425 73 ------
NM_018169chr12--1427 ----
NM_018195chr1152049 1452 444 116 69 11354 11725 --
NM_018214chr641171 900 871 814 --11257 --
NM_018230chr12473 212 ------
NM_018241chr451047 999 916 710 102 ------
NM_018243chr411023 11259 24063 3069 --
NM_018247chr633135 562 421 12045 ----
NM_018263chr232493 2276 679 12196 12134 --
NM_018287chr10--21183 1031 --1506
NM_018293chr352461 2011 669 554 27 12082 1745 --
NM_018299chr833487 624 230 22751 242 ----
NM_018307chr171842 ------
NM_018315chr43577 571 561 ------
NM_018317chr41288 1236 ----
NM_018323chr42349 197 197 ----
NM_018327chr2011718 ----1560
NM_018328chr2------1137
NM_018330chr101345 ------
NM_018334chr7------170
NM_018354chr20282 41 1255 ----
NM_018361chr843967 782 492 34 33484 2549 1593 32749 2587 1187 --
NM_018362chr1143786 3316 499 81 1681 ----
NM_018369chr5126 ------
NM_018374chr734789 4772 1636 1775 ----
NM_018375chr141747 41937 1494 1468 516 --11333
NM_018398chr3--152 ----
NM_018403chr353748 3583 3127 2723 795 ------
NM_018409chr4136 ----12487
NM_018413chr12--158 ----
NM_018416chr1242546 602 409 314 1159 1545 --
NM_018425chr1072601 2231 2186 2162 1045 574 497 ------
NM_018429chr512066 1864 1284 --
NM_018433chr21555 ------
NM_018434chr51131 1138 ----
NM_018439chr1862661 2181 2079 2049 726 310 32272 1631 163 ----
NM_018440chr8118540 8339 7379 6529 5933 5792 5749 5697 1705 1532 1462 35813 3169 214 --11114
NM_018469chr1751030 1007 163 139 94 11529 ----
NM_018489chr142232 2119 1548 1511 1714 ----
NM_018490chr1141845 1496 415 111 ----11290
NM_018509chr1721707 1278 11204 ----
NM_018566chr144989 4658 3893 1084 24250 1422 14315 --
NM_018584chr1--2952 310 --1935
NM_018638chr1255234 4004 883 491 173 1758 ----
NM_018640chr1232551 720 257 12206 ----
NM_018650chr121494 764 ------
NM_018657chr3126 1725 ----
NM_018660chr832489 2230 67 ----1333
NM_018685chr7--2843 226 1116 --
NM_018834chr51346 ------
NM_018841chr153534 3521 3178 2898 99 1352 1419 13060
NM_018847chr931861 426 374 11333 ----
NM_018890chr731469 1337 121 21213 315 1349 --
NM_018898chr522387 2362 --11702 1441
NM_018899chr522387 2362 --11702 1441
NM_018900chr522387 2362 --11702 1441
NM_018901chr522387 2362 --11702 1441
NM_018902chr522387 2362 --11702 1441
NM_018903chr522387 2362 --11702 1441
NM_018904chr522387 2362 --11702 1441
NM_018905chr522387 2362 --11702 1441
NM_018906chr522387 2362 --11702 1441
NM_018907chr522387 2362 --11702 1441
NM_018908chr522387 2362 --11702 1441
NM_018909chr522387 2362 --11702 1441
NM_018910chr522387 2362 --11702 1441
NM_018911chr522387 2362 --11702 1441
NM_018939chr5----2607 542 --
NM_018945chr643591 3263 3152 1252 2827 207 ----
NM_018951chr711137 1239 1273 --
NM_018979chr1242370 1699 1601 226 21027 125 ----
NM_018999chr1041669 1550 1300 746 1972 --13539
NM_019001chr364701 4011 3981 960 594 216 ------
NM_019004chr731696 706 681 11511 --1611
NM_019022chr1822778 118 ------
NM_019024chr2135 ------
NM_019028chr111360 ------
NM_019040chr11158 1250 ----
NM_019050chr42463 312 21651 508 ----
NM_019063chr231894 1440 531 ------
NM_019071chr72632 210 ------
NM_019072chr583638 3481 2980 1698 1640 1367 1064 510 1752 23393 247 --
NM_019073chr1----137 --
NM_019084chr1032591 1842 993 32065 399 197 --12561
NM_019091chr22933 403 ------
NM_019098chr821817 1756 ------
NM_019114chr932347 2212 995 --11676 --
NM_019117chrX21054 790 53445 2421 637 609 282 ----
NM_019590chr10--3526 491 119 --1130
NM_019593chr2052315 839 817 477 191 12154 ----
NM_019595chr22550 256 ------
NM_019610chr121474 521 ----1650
NM_019842chr62441 283 ------
NM_019857chrX41763 1612 1355 175 ------
NM_019860chr101247 1598 ----
NM_019885chr22301 291 21950 1055 ----
NM_019891chr13912 478 415 1322 ----
NM_019903chr1031909 1803 326 1590 ----
NM_020066chr1--1307 ----
NM_020119chr763915 1414 1221 873 518 205 ------
NM_020122chr255821 4109 1990 1041 46 11931 ----
NM_020123chr1011109 1373 ----
NM_020133chr634423 4162 1187 35603 4389 387 35789 4609 2009 11153
NM_020141chr13627 493 31 ----1827
NM_020147chr153778 159 30 ------
NM_020148chr1852884 2049 801 373 30 22920 2175 ----
NM_020159chr421338 295 ------
NM_020177chr543321 3243 2777 1072 1250 --1778
NM_020178chr1721236 971 ------
NM_020182chr2043548 2988 2441 2374 11103 23067 532 --
NM_020193chr111403 ------
NM_020199chr511089 ------
NM_020200chr102958 73 ------
NM_020225chr43381 323 132 ------
NM_020228chr1122539 160 12441 1366 --
NM_020240chr562617 2325 1041 1003 286 232 22082 488 22434 2100 --
NM_020309chr19--1143 174 --
NM_020336chr2063812 3648 2407 1217 1115 1097 ------
NM_020338chr1043318 2897 2725 1312 --33050 2993 342 --
NM_020341chr2011562 11580 ----
NM_020342chr232596 2583 1823 12491 11055 --
NM_020346chr1111541 ------
NM_020354chr10--2909 323 1226 --
NM_020357chr31204 11679 ----
NM_020381chr6--1133 1392 --
NM_020390chr334235 3854 3404 13426 --13296
NM_020403chr1331767 1570 44 ------
NM_020405chr1764050 3863 2834 1620 1197 782 13781 ----
NM_020425chr641737 532 243 105 --11963 --
NM_020443chr176203 6153 2203 1160 703 639 476 46897 6032 5348 4667 ----
NM_020455chr622625 217 ------
NM_020463chr2--31493 1173 224 --1965
NM_020466chr653931 3812 1256 991 536 --11888 --
NM_020474chr1831612 1558 1388 --11374 --
NM_020630chr10--1713 --1632
NM_020640chr31453 ------
NM_020651chr21477 ------
NM_020653chr17169 ------
NM_020673chr2077473 6381 5545 5414 5242 818 654 17740 --11830
NM_020676chr31826 ------
NM_020686chr1662771 2741 2022 1932 761 402 151 23021 386 11095
NM_020699chr144623 3475 1837 533 24509 1583 24087 1176 --
NM_020715chr1442273 882 386 310 ------
NM_020717chrX43106 1682 1427 258 33327 3089 1844 23364 1012 --
NM_020718chr16106447 6052 6032 1697 1461 1444 1395 1248 651 634 11060 14653 --
NM_020727chr2131571 295 66 --13009 --
NM_020732chr61379 ------
NM_020740chr171385 ------
NM_020752chr102453 93 12299 ----
NM_020766chrX54201 4189 4028 3764 580 24285 314 ----
NM_020768chr532830 1237 585 22146 895 2501 257 --
NM_020769chrX1353 ------
NM_020771chr641142 1022 235 72 11181 ----
NM_020772chr17108516 7216 7074 6370 6035 3412 3238 1753 783 601 68461 7846 7142 2006 1457 1320 15404 --
NM_020774chr1834641 2132 1146 --13942 12021
NM_020776chr1842971 2740 2563 1915 42019 1888 1037 240 ----
NM_020791chr17--144 --11426
NM_020794chr121591 83 ----1115
NM_020795chr1711304 ----11646
NM_020805chr1821713 1371 1104 ----
NM_020809chr1132230 1581 121 1182 ----
NM_020810chr1443026 2521 917 364 43451 3338 2735 2675 ----
NM_020813chr1962067 1037 988 675 559 364 11925 ----
NM_020824chr102746 65 ------
NM_020832chr11566 ------
NM_020841chr1234048 3059 1274 33899 3775 3116 1218 --
NM_020854chr18--11543 ----
NM_020858chr152868 656 3805 486 428 ----
NM_020859chr422651 1241 11006 1520 --
NM_020860chr411093 ------
NM_020868chr2192 ------
NM_020871chrX--2972 793 --22078 543
NM_020872chr31563 ------
NM_020905chr22322 123 ------
NM_020918chr1052699 1044 771 488 86 12274 ----
NM_020927chr1631746 1740 454 21528 963 1170 --
NM_020940chr1011170 1769 1944 12787
NM_020946chr911495 ------
NM_020948chr143607 3287 1390 824 ----11409
NM_020951chr1921755 1693 1197 12337 --
NM_020956chr19124074 1885 1861 1822 1744 1705 1666 1627 1495 1019 932 732 11854 23450 3326 41902 1809 1731 1653
NM_020962chr1511681 ------
NM_020963chr11174 ------
NM_020977chr421782 678 21948 1732 1412 --
NM_020983chr1232162 2084 110 1946 12208 3835 802 613
NM_020987chr1041244 950 311 41 ------
NM_021005chr15--3314 178 116 ----
NM_021083chrX63613 3523 3166 3077 2551 1213 13482 13545 11442
NM_021088chr232183 832 670 12174 ----
NM_021090chr22104756 3887 3601 3432 3124 3047 1711 1414 302 284 11987 21780 420 --
NM_021111chr9----11069 --
NM_021116chr7128903 8757 7051 5678 2880 2866 2629 2330 2130 873 679 118 17266 ----
NM_021120chrX63064 2635 2500 1079 1014 1006 1129 ----
NM_021132chr103488 206 178 11320 11181 --
NM_021136chr14--1248 1191 --
NM_021140chrX----1141 --
NM_021145chr711092 ------
NM_021151chr72442 99 1414 ----
NM_021159chr4--2501 195 ----
NM_021176chr231836 1579 30 ------
NM_021184chr61696 ------
NM_021190chr111191 ------
NM_021191chr1232169 1687 775 11579 1302 1278
NM_021198chr231366 206 115 1310 21354 1181 --
NM_021218chr92984 68 148 ----
NM_021227chr4147 ------
NM_021229chr1211154 ----1103
NM_021242chrX2982 688 --1943 --
NM_021255chr1413609 14042 ----
NM_021574chr2252325 1810 1602 351 127 --12040 --
NM_021626chr171507 ------
NM_021630chr81331 ------
NM_021643chr221707 525 --21771 692 --
NM_021648chr652753 733 567 258 178 22692 1027 ----
NM_021809chr2031746 388 148 42488 492 341 99 ----
NM_021813chr674822 3887 3785 1976 1584 747 200 22128 1019 14953 --
NM_021814chr621281 684 11650 ----
NM_021911chr555043 4802 2182 490 169 21688 698 14027 --
NM_021912chr1521570 65 23457 1632 ----
NM_021913chr192560 447 --1379 --
NM_021914chr142569 547 --12339 --
NM_021935chr3--1279 --288 72
NM_021940chr621406 201 --1658 --
NM_021954chr1343648 2251 1099 542 1501 1900 --
NM_021960chr11413 32755 2293 828 12714 11835
NM_021961chr1197373 6878 6053 5795 5583 5269 1680 1460 1268 14638 26506 2809 --
NM_021963chrX1298 ------
NM_021964chr346354 1000 730 452 11910 ----
NM_021967chr5--11321 ----
NM_021988chr202220 201 ------
NM_022037chr21199 --1857 --
NM_022041chr1652432 1839 786 527 429 11818 --12440
NM_022048chr1585937 5061 4263 3951 2321 1185 950 296 23972 1313 ----
NM_022058chr21138 --12016 --
NM_022063chr1011650 11772 ----
NM_022073chr1441611 450 218 167 1202 ----
NM_022075chr12906 606 ------
NM_022080chr2032340 548 507 12252 12122 1652
NM_022090chr51523 ------
NM_022114chr174174 4087 3090 3074 1879 1849 844 ----11593
NM_022118chr13--1210 ----
NM_022121chr62882 236 1130 ----
NM_022130chr5--11301 ----
NM_022133chr81674 21691 1495 ----
NM_022136chr211180 ------
NM_022143chr721538 1141 1268 --1525
NM_022145chr51625 ------
NM_022166chr16115756 5242 4238 4105 2320 2055 2026 1896 1642 1292 520 22378 1020 1618 --
NM_022173chr21199 --1857 --
NM_022336chr262364 2072 1940 1478 921 87 ----177
NM_022351chr853846 2720 2488 1096 670 23670 221 ----
NM_022373chr71777 ------
NM_022442chr202220 201 ------
NM_022456chr1287639 6984 6266 6205 6140 5791 2963 2457 1241 --1730
NM_022459chr1345258 4924 1535 1304 15999 32517 1962 1327 --
NM_022462chr1973647 3533 3445 2445 1031 537 452 ------
NM_022465chr1232661 2064 1983 --12363 --
NM_022474chr1462084 2024 970 886 539 52 ------
NM_022497chr342964 2828 2676 651 2892 188 ----
NM_022572chr221626 672 ----11283
NM_022650chr52852 170 3666 341 87 ----
NM_022719chr2272744 2607 2462 1551 1438 1024 203 --23528 2804 --
NM_022726chr6--11487 --11206
NM_022745chr162812 2788 2228 2085 1032 917 1979 12967 --
NM_022751chr18150 1248 ----
NM_022753chr14964 953 161 91 22235 2022 ----
NM_022755chr962557 2483 2190 1847 999 549 11957 ----
NM_022763chr322177 945 32919 2731 2133 ----
NM_022776chr3--11086 ----
NM_022780chr22743 133 11762 11452 --
NM_022802chr1031553 1262 445 ----11433
NM_022831chr131602 1216 366 11550 --1454
NM_022838chrX--1330 ----
NM_022893chr211173 22764 2208 ----
NM_022898chr1474067 3394 1506 1496 911 83 48 ------
NM_022978chr5--11321 ----
NM_023010chrX3829 285 233 ----1151
NM_023011chr131835 1829 ----
NM_023012chr12--1719 ----
NM_023037chr1311010 ------
NM_023076chr1672751 2472 2268 2217 2120 516 89 21836 532 ----
NM_023105chr842370 2151 1633 230 22466 2003 1495 --
NM_023106chr842370 2151 1633 230 22466 2003 1495 --
NM_023110chr842370 2151 1633 230 22466 2003 1495 --
NM_023111chr842370 2151 1633 230 22466 2003 1495 --
NM_023927chr521205 953 1881 ----
NM_023943chr31141 ------
NM_024019chr4--1233 ----
NM_024052chr1741942 1051 578 58 179 --11208
NM_024077chr91308 1563 ----
NM_024090chr42545 362 1664 11507 --
NM_024091chr51201 ------
NM_024345chr945445 4980 2303 243 25606 907 24687 370 --
NM_024415chr5--1171 ----
NM_024423chr1834192 538 227 11535 12814 --
NM_024424chr111419 ------
NM_024425chr111419 ------
NM_024426chr111419 ------
NM_024524chr342198 721 535 80 23144 1277 ----
NM_024529chr11470 ------
NM_024545chr23614 494 235 ------
NM_024548chr321438 475 ----11277
NM_024551chr1231831 847 81 12472 ----
NM_024551chr1231831 847 81 12472 ----
NM_024567chr81593 --1584 --
NM_024581chr6--190 ----
NM_024582chr411135 ------
NM_024590chr461198 466 398 356 193 129 --1186 --
NM_024612chr1731160 430 65 2879 184 ----
NM_024613chr821846 1766 1745 ----
NM_024639chr62641 385 --12813 --
NM_024652chr1531088 776 133 1930 ----
NM_024665chr363917 3764 3320 1383 850 707 13392 ----
NM_024674chr162896 2124 1257 1220 922 660 42971 2912 2407 357 ----
NM_024683chr17------123
NM_024689chrX1563 21691 1235 ----
NM_024692chr231717 409 270 1614 ----
NM_024713chr1521159 1082 ------
NM_024721chr82864 695 1221 1732 --
NM_024744chr232284 751 151 31924 951 478 ----
NM_024755chr15--1580 ----
NM_024770chr254940 1492 1232 296 42 16066 --12341
NM_024783chr111386 ----1411
NM_024812chr831378 1343 375 11826 22183 1450 --
NM_024824chr1421320 571 21231 82 --11082
NM_024834chr102688 675 --11578 --
NM_024909chr621497 1159 11128 21279 372 --
NM_024911chr11529 3861 677 73 ----
NM_024915chr842323 2300 2194 827 1535 12317 12818
NM_024920chr42997 254 11471 --1475
NM_024930chr522742 809 12780 --12100
NM_024944chr211511 1219 1188 --
NM_024946chr1631518 667 570 1320 11506 1154
NM_024949chr484800 4701 3888 3619 1784 1284 270 115 44624 4341 3500 990 1403 --
NM_024989chr233226 3171 1783 57139 4997 3206 2576 838 15556 --
NM_024993chr221437 1152 ------
NM_025040chr1972492 2158 1650 1562 785 238 31 ----1485
NM_025054chr834075 3709 896 --34111 1055 378 1421
NM_025073chr154498 3897 3474 3189 1220 22888 1212 23248 527 --
NM_025074chr463016 2504 2140 2005 1940 487 --1227 12203
NM_025126chr123726 569 481 ----1663
NM_025134chr162759 678 ------
NM_025137chr15--189 ----
NM_025138chr1321270 1113 ------
NM_025146chr342718 1086 1010 660 1293 ----
NM_025160chr144239 4064 3645 257 21648 584 ----
NM_025211chr9--187 ----
NM_025238chr15--31472 1312 546 --153
NM_025250chr752222 2000 1141 464 228 1585 3104 53 34 1743
NM_030579chr1663442 2627 2352 1437 780 98 23322 653 ----
NM_030594chr1511202 ----11190
NM_030627chr524060 175 --11345 --
NM_030634chr132254 952 353 11983 ----
NM_030637chr14----167 --
NM_030639chrX31781 1700 1360 1691 21524 1427 --
NM_030640chr123908 574 345 ------
NM_030647chr755675 1663 1402 657 158 21958 1913 ----
NM_030648chr475049 4848 4624 4147 1213 903 417 33979 1096 300 14349 --
NM_030650chr233309 3200 2901 33568 2723 863 23297 1203 --
NM_030660chr1411523 11080 --188
NM_030667chr1211228 21188 1035 1807 --
NM_030668chr1211228 21188 1035 1807 --
NM_030669chr1211228 21188 1035 1807 --
NM_030670chr1212260 22220 2067 11839 --
NM_030671chr1212260 22220 2067 11839 --
NM_030674chr1234241 1320 780 --12240 --
NM_030751chr10--1455 21807 554 --
NM_030751chr10--1455 21807 554 --
NM_030762chr1221259 775 --11518 --
NM_030780chr81143 31359 1116 311 11068 --
NM_030786chr12463 197 --21686 556 1105
NM_030791chr141742 11854 ----
NM_030799chr511849 32092 1515 863 ----
NM_030802chr171302 ----1137
NM_030806chr1128399 8372 6780 6600 6387 3300 2818 2470 1939 1693 1545 524 77614 7506 7195 3510 2043 1560 183 19119 --
NM_030816chr173575 2639 1336 1030 947 698 187 12478 ----
NM_030914chr91269 ----1160
NM_030918chr155055 4892 4693 3317 167 35175 3627 1078 1335 --
NM_030934chr131433 1291 118 11578 ----
NM_030938chr171354 1859 1176 --
NM_030939chr6------1993
NM_030948chr6124 ------
NM_030949chr6--1415 11022 --
NM_030964chr52950 882 ----21426 235
NM_031262chr91925 ------
NM_031263chr91982 ------
NM_031266chr51346 ------
NM_031268chr1683563 1615 1198 708 695 331 92 34 --11570 --
NM_031291chr41114 ------
NM_031305chr431872 1285 197 1723 1527 --
NM_031314chr1421820 1803 1521 ----
NM_031362chr211737 22321 2240 12233 12532
NM_031365chr211873 22457 2376 12369 12668
NM_031366chr211873 22457 2376 12369 12668
NM_031369chr43552 306 92 ------
NM_031370chr43552 306 92 ------
NM_031371chr121357 1350 ------
NM_031371chr121357 1350 ------
NM_031407chrX--192 ----
NM_031411chr522387 2362 --11702 1441
NM_031418chr1141822 1749 749 555 21122 482 ----
NM_031427chr1445686 4962 621 188 34784 1280 861 15543 14681
NM_031431chr131564 31740 398 205 ----
NM_031435chr1233173 1291 227 2375 76 13107 --
NM_031442chrX22253 149 1764 11041 --
NM_031445chr222120 134 11364 ----
NM_031453chr102976 30 12154 ----
NM_031469chr652873 2538 1538 1183 414 43919 2493 1509 1328 ----
NM_031483chr2032636 1438 593 ----1301
NM_031845chr223452 2708 22367 1252 --23333 1019
NM_031847chr223452 2708 22367 1252 --23333 1019
NM_031849chr522387 2362 --11702 1441
NM_031857chr522387 2362 --11702 1441
NM_031860chr522387 2362 --11702 1441
NM_031892chrX------2241 85
NM_031916chr5--129 ----
NM_031922chr61550 ------
NM_031935chr13920 791 117 ------
NM_031990chr1911276 ------
NM_031991chr1911276 ------
NM_032012chr945022 3900 3407 855 23285 670 12091 --
NM_032025chr351800 1568 272 205 104 1630 ----
NM_032028chr51644 ------
NM_032102chr115741 391 182 139 117 12808 ----
NM_032121chrX3798 675 516 1182 11999 --
NM_032124chr182245 183 --178 1469
NM_032139chr19------21103 356
NM_032144chr21729 11792 ----
NM_032146chr33463 456 163 ------
NM_032153chr332591 2426 1079 11953 ----
NM_032181chr23642 623 95 ------
NM_032195chr211356 1409 --1364
NM_032208chr253283 3179 2634 2496 134 21294 186 ----
NM_032221chr2011442 ------
NM_032228chr1153007 2210 934 198 90 ------
NM_032229chr13187 1465 ----
NM_032231chr15------1297
NM_032246chr1531332 425 211 1994 ----
NM_032272chr81457 ------
NM_032290chr5--1129 ----
NM_032291chr12441 392 ----1529
NM_032312chr2------1299
NM_032321chr243059 479 305 38 22899 2015 ----
NM_032352chr1421317 57 21378 1283 ----
NM_032373chr1065509 1486 1092 555 270 188 15550 13767 12236
NM_032410chr841229 384 332 112 ----1218
NM_032438chr631512 518 492 ------
NM_032440chr1012566 --1929 --
NM_032441chrX2411 111 ------
NM_032446chr543371 3295 1095 1054 --1699 --
NM_032457chr433399 2582 420 ------
NM_032458chrX32190 2104 1109 4964 867 842 238 1593 --
NM_032499chr1511721 21487 249 ----
NM_032505chr332420 1754 723 --1665 12164
NM_032507chr62234 223 ------
NM_032521chr2032961 2194 2019 ------
NM_032539chrX1657 ------
NM_032547chr41461 11217 ----
NM_032550chr10133 ------
NM_032557chr41671 --1844 --
NM_032564chr11175 1122 ----
NM_032574chr2--1273 ----
NM_032578chr101416 --11442 1599
NM_032622chr421018 346 ------
NM_032679chr19--11071 --1295
NM_032682chr33963 346 158 43124 1424 908 302 --13645
NM_032689chr19--2649 281 149 --
NM_032701chr192567 556 ------
NM_032711chr1743569 1233 1153 679 14211 11322 --
NM_032727chr10--1416 21409 1105 1302
NM_032731chr1721489 133 11218 ----
NM_032765chr51294 ------
NM_032777chr811449 11035 --11517
NM_032801chr1142317 762 654 67 ------
NM_032802chr15128 ------
NM_032810chr1011327 ----21015 531
NM_032826chr7105148 4925 4425 4123 3411 2090 1428 983 745 87 --15163 13804
NM_032828chr1984747 3474 3321 3130 3033 1917 1782 94 24961 1031 ----
NM_032837chr1772076 1974 1692 1481 678 327 248 11863 1827 --
NM_032859chr1313669 33577 1564 287 23901 1362 --
NM_032870chr61548 ------
NM_032873chr1164262 2816 1707 1397 827 591 14430 11024 --
NM_032900chr1043550 3069 1576 356 2935 119 22591 865 23669 2616
NM_032918chr12----1181 --
NM_032932chr1776101 6058 5984 4949 4671 4276 1781 ----12137
NM_032936chr7170 ------
NM_032949chr132543 460 1357 ----
NM_032961chr411386 ------
NM_032968chrX23252 3111 --13771 --
NM_032969chrX23252 3111 --13771 --
NM_032973chrY23247 3106 --13763 --
NM_032982chr742575 2507 1882 234 ----12602
NM_032991chr441426 1055 294 41 1390 ----
NM_033012chr134930 885 741 351 1852 ----
NM_033020chr164256 3075 931 369 317 187 13423 ----
NM_033027chr341134 1048 1004 115 --11088 --
NM_033030chr221374 1056 11622 1239 --
NM_033056chr101559 ------
NM_033083chr362837 2181 1180 593 565 185 ------
NM_033088chr11671 ------
NM_033121chr1221678 1456 11225 21797 64 --
NM_033138chr72845 748 ------
NM_033139chr72845 748 ------
NM_033140chr72845 748 ------
NM_033143chr454573 4277 1426 1037 176 ------
NM_033150chr122368 331 ----1380
NM_033157chr72845 748 ------
NM_033181chr643086 1395 468 151 --1545 --
NM_033224chr787289 7224 6741 6560 5057 2648 1430 723 --16027 --
NM_033225chr852430 2031 1163 166 71 13138 ----
NM_033227chr52504 382 1203 ----
NM_033228chr52544 422 1243 ----
NM_033285chr823645 964 14379 11353 --
NM_033290chrX43737 2568 2557 1321 21442 539 12510 --
NM_033305chr921234 952 2513 123 ----
NM_033326chr113963 783 393 12488 --1565
NM_033331chr942403 1254 1106 789 11144 --1417
NM_033360chr1221799 979 13898 54335 2878 1852 1392 307 --
NM_033380chrX2394 113 ------
NM_033381chrX2394 113 ------
NM_033394chr221276 1158 1197 ----
NM_033425chr1121131 602 32511 1286 614 --1112
NM_033426chr1412348 --1142 12133
NM_033429chr1521079 498 53111 2066 1092 1064 757 21114 1049 1561
NM_033495chrX149 2709 430 ----
NM_033503chr1521097 793 1216 11393 --
NM_033505chr296537 6506 5603 5250 4451 2709 2357 2164 473 1502 15504 --
NM_033512chr872834 2542 1923 1036 998 733 188 1892 ----
NM_033551chr523301 2701 23060 2568 --12885
NM_033624chr1232259 511 232 ------
NM_033632chr43577 571 561 ------
NM_033644chr552469 2459 2319 2227 1609 ----1428
NM_033645chr552469 2459 2319 2227 1609 ----1428
NM_033656chr2185905 5800 4711 4138 4015 2346 1866 336 44452 3898 1893 362 --1203
NM_052811chr1355255 3212 1768 1570 511 --14497 14284
NM_052867chr1321353 1091 1494 1355 --
NM_052875chr1142099 1789 1420 391 ------
NM_052879chr1224094 300 23993 2943 ----
NM_052885chr1244945 3828 3624 1768 14043 24109 353 34953 845 427
NM_052886chr841787 1474 743 642 ----11354
NM_052900chr821285 676 21223 74 ----
NM_052903chr151501 ------
NM_052904chr621115 190 --1234 --
NM_052917chr243221 2692 2562 2178 ------
NM_052954chr2142095 1585 802 123 --31819 1416 29 --
NM_053016chr915480 17030 17407 11674
NM_053056chr1142668 2528 1229 278 12742 11193 --
NM_053064chr1422734 253 ------
NM_053279chr872780 1928 1899 877 330 187 58 12090 ----
NM_053281chrX--1416 ----
NM_054016chr131295 470 374 ------
NM_054016chr131295 470 374 ------
NM_054016chr131295 470 374 ------
NM_054026chr81906 ------
NM_054033chr2176 --1236 --
NM_054114chr6135 ------
NM_057158chr83849 666 261 1636 ----
NM_057175chr442465 2246 1717 1010 21688 222 ----
NM_057178chr17--1475 --12358
NM_057749chr81365 ----1957
NM_058237chr142815 790 ------
NM_058241chr232000 1681 1638 --12207 --
NM_058241chr232000 1681 1638 --12207 --
NM_080546chr922299 1540 21647 204 ----
NM_080629chr1268 50 11150 ----
NM_080630chr1268 50 11150 ----
NM_080632chrX3829 285 233 ----1151
NM_080645chr61201 ------
NM_080655chr91222 ------
NM_080672chr201382 ------
NM_080676chr2053237 2523 1198 1156 1054 13152 ----
NM_080677chr172113 21 ------
NM_080717chr1231518 1102 1017 --11566 --
NM_080759chr1311023 --11949 --
NM_080760chr1311023 --11949 --
NM_080867chr1423709 3234 ----1857
NM_080874chr4--185 11759 --
NM_130385chr1183201 3180 3015 2331 2176 1976 910 767 ------
NM_130391chr942818 2400 1388 886 21116 350 --12387
NM_130392chr942818 2400 1388 886 21116 350 --12387
NM_130393chr942818 2400 1388 886 21116 350 --12387
NM_130435chr1042865 2587 862 230 12505 12448 --
NM_130436chr2142158 1917 1021 336 11779 ----
NM_130438chr2152735 2494 913 459 348 12356 ----
NM_130439chr1052165 2058 1904 1809 653 ------
NM_130439chr1052165 2058 1904 1809 653 ------
NM_130797chr751646 1351 1253 1158 434 --11295 --
NM_130808chr3146 1321 ----
NM_130831chr312322 1457 ----
NM_130832chr312322 1457 ----
NM_130833chr312322 1457 ----
NM_130834chr312322 1457 ----
NM_130835chr312322 1457 ----
NM_130836chr312322 1457 ----
NM_130837chr312322 1457 ----
NM_130838chr151461 11626 ----
NM_130839chr151461 11626 ----
NM_133170chr2067892 6747 5480 1625 1325 1307 36929 4990 944 ----
NM_133264chr1742570 1254 775 486 13470 ----
NM_133265chrX53382 1332 1306 956 825 22512 1048 ----
NM_133328chr191671 ------
NM_133330chr453199 2982 1162 674 279 22907 871 ----
NM_133331chr453199 2982 1162 674 279 22907 871 ----
NM_133334chr4106194 6094 5971 5798 4224 1953 1926 1806 828 453 25450 4316 26373 4668 --
NM_133335chr453199 2982 1162 674 279 22907 871 ----
NM_133367chr612437 --22171 760 11333
NM_133433chr5------1881
NM_133496chr184049 3277 2771 1426 1048 823 628 497 ------
NM_133503chr121290 2777 59 ----
NM_133504chr121290 2777 59 ----
NM_133505chr121290 2777 59 ----
NM_133506chr121290 2777 59 ----
NM_133509chr1411139 ------
NM_133625chr32914 305 --21192 384 --
NM_133631chr331358 456 361 ------
NM_133646chr255535 3941 3933 3745 1422 25398 1334 33721 1933 1622 --
NM_133647chr1553510 2654 1365 1234 632 --33409 1086 66 --
NM_134428chr91262 196 ----
NM_134447chr191220 ------
NM_134470chr3--1645 ----
NM_138270chrX1117 12248 2846 840 --
NM_138285chr21544 ------
NM_138286chr1943038 1636 1256 393 24071 267 ----
NM_138316chr101981 ------
NM_138333chr941936 435 252 77 1978 ----
NM_138340chr18------1494
NM_138375chr1821027 946 --1453 1442
NM_138391chr11259 ------
NM_138401chr19------1275
NM_138423chr1512152 ------
NM_138426chr71211 ------
NM_138437chrX1256 1126 ----
NM_138448chr21133 ------
NM_138459chr6--23139 3035 --12552
NM_138468chr242546 2075 697 316 35167 2175 290 ----
NM_138473chr1285020 4338 3591 3174 1326 1258 793 229 21997 1040 13553 --
NM_138565chr113957 875 205 2981 285 ----
NM_138569chr6----158 --
NM_138576chr1474067 3394 1506 1496 911 83 48 ------
NM_138638chr142569 547 --12339 --
NM_138713chr1697878 6119 6068 5737 3088 2943 2930 1840 1458 --13253 26698 5532
NM_138714chr1697878 6119 6068 5737 3088 2943 2930 1840 1458 --13253 26698 5532
NM_138717chr61542 ------
NM_138729chr1----137 --
NM_138730chr61112 ------
NM_138731chr1433148 2869 1392 12922 1556 --
NM_138766chr52437 200 1458 ----
NM_138782chr531876 1811 500 11804 ----
NM_138821chr52437 200 1458 ----
NM_138822chr52437 200 1458 ----
NM_138931chr3--2421 285 ----
NM_138959chr176479 6145 4851 1979 1938 1612 1049 21030 69 ----
NM_138969chr811406 11448 ----
NM_138970chr14------11546
NM_139046chr10260 40 ------
NM_139062chr17--1471 ----
NM_139168chr521378 280 ------
NM_139242chr1521001 348 1441 11511 --
NM_139276chr1722062 1904 ------
NM_139279chr232584 1383 204 1901 13475 --
NM_139312chr1041351 495 264 131 ------
NM_139321chr2062580 1245 1074 1043 607 475 23482 1446 ----
NM_139323chr20133 ------
NM_144498chr2042214 1662 1530 191 1171 11651 --
NM_144570chr1622749 724 22542 464 12294 --
NM_144571chr476516 5688 5173 4648 4600 2721 1678 35643 5507 1118 26108 862 --
NM_144578chr14105407 4217 4111 4092 3894 3784 3713 1598 1579 1231 45009 2120 1839 1589 13842 --
NM_144583chr221741 1472 1551 11352 --
NM_144599chr1535402 3736 1608 15323 --15127
NM_144654chr91295 ------
NM_144664chr112378 239 32605 1859 943 ----
NM_144665chr11------1110
NM_144726chr521013 204 ------
NM_144767chr1533067 1110 1000 24035 463 --14446
NM_144778chr132857 26 32400 819 114 ----
NM_144949chr212577 ----12409
NM_144963chr822682 69 12185 ----
NM_144967chrX4954 243 222 162 ----127
NM_144973chr1235061 5025 344 24395 3732 ----
NM_144984chr1041167 996 990 577 11287 ----
NM_145021chr103730 304 64 1844 ----
NM_145037chr31269 1319 ----
NM_145049chr5--1180 1884 --
NM_145053chr111594 ------
NM_145117chr1153239 2738 2576 2322 486 --1529 --
NM_145175chr211103 ------
NM_145176chr622317 101 ----136
NM_145206chr1023263 261 1831 1318 13177
NM_145247chr10--1438 ----
NM_145251chr141413 1424 ----
NM_145284chrX12263 11919 ----
NM_145287chr182173 150 ----130
NM_145307chr1031447 1186 606 --34022 2941 740 --
NM_145341chr1021669 265 1400 ----
NM_145686chr243251 2758 2375 260 13267 23364 2905 --
NM_145687chr243251 2758 2375 260 13267 23364 2905 --
NM_145728chr151909 62468 2194 2150 1798 523 348 2404 48 --
NM_145735chr1352309 2212 2023 435 159 12606 --1381
NM_145753chr331535 1172 658 11124 ----
NM_145800chrX21059 1031 ------
NM_145802chrX21008 980 ------
NM_145808chr733164 1116 87 13104 ----
NM_145859chr31264 ------
NM_145860chr31264 ------
NM_145893chr1641731 690 431 28 ------
NM_147147chr654152 4011 3329 3223 1224 22931 2608 --21343 1328
NM_147156chr1011257 --144 --
NM_147175chrX11439 1587 ----
NM_147189chr81140 21623 210 ----
NM_147223chr212180 22442 1863 1911 --
NM_147233chr211997 22259 1680 1728 --
NM_148170chr1185464 5424 5128 5086 4567 3485 1966 1229 11300 2858 764 --
NM_148174chr811460 22051 1815 11435 --
NM_148571chr1741858 1541 741 663 1140 1438 --
NM_148894chr42977 405 11096 ----
NM_148955chr15106163 5985 5709 5701 5561 5400 5159 4000 1031 352 25763 2435 --15832
NM_148977chr101981 ------
NM_148978chr101981 ------
NM_152133chr6135 ------
NM_152227chr201753 ------
NM_152253chr2273972 3548 3328 2886 2618 556 498 --23221 1628 --
NM_152265chr1----11441 --
NM_152277chr541869 1836 1545 1333 ------
NM_152278chrX3494 456 142 1417 ----
NM_152280chr132401 1332 653 12911 --13533
NM_152282chr32291 36 1261 11303 --
NM_152283chr5----1179 --
NM_152291chr421092 929 1911 ----
NM_152298chr11296 1748 ----
NM_152309chr101499 22078 247 ----
NM_152330chr1432298 650 86 ------
NM_152334chr151819 1502 ----
NM_152342chr162425 92 ------
NM_152352chr1852909 2483 2395 1235 906 1101 ----
NM_152388chr243838 2924 1428 1397 23409 1192 ----
NM_152400chr4--1275 1711 --
NM_152402chr4--1225 ----
NM_152409chr543058 2822 2535 1134 23465 2361 ----
NM_152414chr811176 ------
NM_152417chr821245 826 1256 --1183
NM_152422chr92699 222 31486 1479 713 ----
NM_152424chrX84727 3918 3294 3234 3076 1525 796 311 --13316 12971
NM_152437chr1241959 1927 159 44 12034 ----
NM_152450chr1551869 1480 1360 606 39 11461 1119 --
NM_152493chr11374 ------
NM_152520chr21834 ------
NM_152522chr21377 ------
NM_152523chr21180 1750 ----
NM_152538chr331649 1330 1196 --1247 1358
NM_152556chr742494 2012 927 278 32273 1582 682 ----
NM_152570chr9134 ------
NM_152581chrX21105 970 1579 ----
NM_152588chr1231186 729 77 --1546 --
NM_152594chr1512312 --12059 --
NM_152609chr12449 332 ------
NM_152621chr4------1271
NM_152622chr542219 1244 833 746 --12248 --
NM_152624chr565925 5212 4598 1529 974 317 36960 2921 2660 11544 --
NM_152629chr93597 543 294 13744 1994 1960
NM_152641chr122731 238 ------
NM_152660chr11770 ------
NM_152666chr11834 ------
NM_152678chr322376 2290 12157 ----
NM_152682chr421583 322 1677 ----
NM_152688chr61700 2678 397 ----
NM_152695chrX2752 491 1475 11792 --
NM_152696chr1------132
NM_152699chr343562 3233 1485 1057 --13626 --
NM_152733chr6106297 5858 5346 4261 2554 2383 1800 1689 834 689 15514 --23972 1355
NM_152734chr665201 4372 4197 1282 608 240 --25278 4906 34621 3423 944
NM_152738chr63424 381 326 --138 --
NM_152745chr72439 121 ------
NM_152753chr62523 343 31503 790 493 ----
NM_152754chr753700 2656 971 389 108 12793 ----
NM_152756chr534308 3529 482 13828 13257 --
NM_152758chr812005 --11205 --
NM_152774chr711965 --11681 --
NM_152787chrX43033 2427 1030 864 21172 887 12662 --
NM_152789chr721260 1033 11153 11419 --
NM_152793chr764592 3947 3571 1224 855 676 25065 4357 --13404
NM_152826chr15106163 5985 5709 5701 5561 5400 5159 4000 1031 352 25763 2435 --15832
NM_152835chr112668 12870 12627 --
NM_152836chr81674 21691 1495 ----
NM_152837chr81674 21691 1495 ----
NM_152838chr2063479 3459 2424 1341 665 371 23561 3006 12417 --
NM_152902chr1--11985 ----
NM_152903chr1342487 2275 2236 1043 --1220 --
NM_152945chr2--1192 ----
NM_152989chr1251826 1712 1701 412 251 --1375 1722
NM_152994chr21621 1406 ----
NM_152996chr131854 1358 73 1451 11822 21414 778
NM_152999chr7104783 4230 3696 3274 3138 1787 1183 930 846 183 190 ----
NM_153013chr511978 --1522 --
NM_153035chr142698 306 124 106 ------
NM_153050chr22104756 3887 3601 3432 3124 3047 1711 1414 302 284 11987 21780 420 --
NM_153051chr22104756 3887 3601 3432 3124 3047 1711 1414 302 284 11987 21780 420 --
NM_153184chr3--31581 1283 1225 ----
NM_153186chr92782 47 1690 ----
NM_153188chr514879 24076 677 15506 --
NM_153235chr631687 624 174 197 1938 --
NM_153261chr162355 216 ----11181
NM_153262chr122371 2076 23062 234 ----
NM_153273chr372411 2336 2159 1104 1045 812 479 22807 2141 ----
NM_153341chr1--1309 --1272
NM_153365chr452632 2396 911 888 60 41789 610 460 77 ----
NM_153367chr1063757 3564 2841 910 898 66 --11097 --
NM_153456chr1366358 5726 5360 1969 1287 767 25907 4406 --14157
NM_153499chr1252821 2782 2581 2165 1137 2885 395 ----
NM_153500chr1252821 2782 2581 2165 1137 2885 395 ----
NM_153616chr152868 656 3805 486 428 ----
NM_153617chr152868 656 3805 486 428 ----
NM_153618chr152868 656 3805 486 428 ----
NM_153619chr1562571 1253 1175 498 243 193 1164 12608 --
NM_153620chr71711 1726 31776 1130 606 --
NM_153634chr12125 ----11288
NM_153645chr2242066 1134 741 32 12766 1171 --
NM_153646chr142430 263 --32576 870 280 --
NM_153647chr142430 263 --32576 870 280 --
NM_153648chr142430 263 --32576 870 280 --
NM_153694chr121255 ------
NM_153712chr233268 2481 1321 13108 ----
NM_153715chr711137 1239 1273 --
NM_153810chr1074738 4438 3404 1418 836 718 543 1643 ----
NM_170665chr1244501 3617 1671 784 24495 1650 ----
NM_170675chr15--11047 ----
NM_170676chr15--11047 ----
NM_170695chr18--1115 ----
NM_170706chr153316 2752 1549 1180 1117 13985 13089 --
NM_170709chr821526 1502 12325 ----
NM_170710chr443149 2748 2432 369 13127 --191
NM_170719chr1321270 1113 ------
NM_170720chr1921118 862 11030 ----
NM_170731chr1142335 965 494 258 ------
NM_170732chr1142335 965 494 258 ------
NM_170733chr1142335 965 494 258 ------
NM_170734chr1142335 965 494 258 ------
NM_170735chr1142335 965 494 258 ------
NM_170750chrX2837 814 ------
NM_171825chr582696 2596 2389 2098 1253 1106 232 34 23006 2527 --12612
NM_172058chr811271 ------
NM_172059chr811271 ------
NM_172060chr811271 ------
NM_172070chr221718 398 12012 ----
NM_172103chr632293 1870 177 ------
NM_172105chr632293 1870 177 ------
NM_172127chr431778 351 59 145 ----
NM_172164chr11296 1748 ----
NM_172216chr1252723 2684 2483 2067 1039 2787 297 ----
NM_172217chr1541261 986 346 265 --32523 1061 919 --
NM_172226chr1252821 2782 2581 2165 1137 2885 395 ----
NM_172350chr13745 373 22 11710 ----
NM_172373chr132939 459 ----1947
NM_173075chr411389 21506 1437 ----
NM_173076chr25790 749 680 394 237 ------
NM_173078chrX----1152 --
NM_173079chr1741856 1454 217 54 ------
NM_173084chr312275 32226 161 49 ----
NM_173156chr121421 117 ------
NM_173167chr1742643 2488 1857 1021 11732 ----
NM_173171chr2152 ------
NM_173173chr2152 ------
NM_173198chr922035 279 11846 --12608
NM_173200chr922035 279 11846 --12608
NM_173207chr18--1115 ----
NM_173208chr18--1115 ----
NM_173209chr18--1115 ----
NM_173210chr18--1115 ----
NM_173211chr18--1115 ----
NM_173214chr1697878 6119 6068 5737 3088 2943 2930 1840 1458 --13253 26698 5532
NM_173216chr322695 1770 32719 1684 316 ----
NM_173217chr322695 1770 32719 1684 316 ----
NM_173355chr2--1112 ----
NM_173454chr1531156 323 183 11081 --1785
NM_173468chr465874 5600 5107 3855 1315 311 1838 15702 12141
NM_173470chrX32500 637 521 22492 2270 ----
NM_173472chr3--162 ----
NM_173495chrX32547 2323 401 22276 120 ----
NM_173505chr181292 ----1440
NM_173510chr223647 501 182 129 12545 --
NM_173511chr293387 3287 3112 2744 1335 1208 1096 971 359 1709 --12751
NM_173514chr51584 ------
NM_173517chr71177 ------
NM_173552chr362103 1716 715 678 539 398 21905 901 ----
NM_173554chr10--129 ----
NM_173576chr1042310 2063 1778 319 11763 ----
NM_173595chr1265007 1708 1004 382 318 240 1262 25090 4266 14559
NM_173602chr1233641 3077 3068 21449 1207 --13660
NM_173609chr151553 1540 ----
NM_173642chr1129166 9027 7844 7830 7809 6960 6942 5680 5580 3424 3268 1878 46521 6384 3353 2254 36361 6036 1344 16717
NM_173647chr21980 ------
NM_173666chr521163 22 198 ----
NM_173694chrX2586 406 1616 ----
NM_173698chrX2508 33 21541 566 21393 97 --
NM_173797chr51329 41346 1267 1063 414 ----
NM_173814chr15167 ------
NM_173822chr221382 1336 22085 1917 ----
NM_173829chr524739 795 --25135 4783 25495 1085
NM_174886chr18--1115 ----
NM_174890chr101803 1104 ----
NM_174909chr53913 812 683 ------
NM_174911chr833960 960 773 23151 3082 ----
NM_174916chr153597 535 223 21839 1584 ----
NM_174938chr9194 ------
NM_175061chr722161 1353 1548 123 1233
NM_175623chr1287639 6984 6266 6205 6140 5791 2963 2457 1241 --1730
NM_175624chr1287734 7079 6361 6300 6235 5886 3058 2552 1336 --1825
NM_175625chr1287734 7079 6361 6300 6235 5886 3058 2552 1336 --1825
NM_175634chr82398 373 ------
NM_175635chr82398 373 ------
NM_175636chr82398 373 ------
NM_175733chr1121574 239 1680 128 1437
NM_175736chr1267591 6018 1917 586 437 152 --31484 658 491 --
NM_175847chr1911276 ------
NM_175854chr1322684 2285 ------
NM_175859chrX41763 1612 1355 175 ------
NM_175861chr1221672 553 34790 4741 1392 34357 2098 1915 --
NM_175863chr61379 ------
NM_175873chr521241 930 1553 ----
NM_175876chr151988 1077 898 662 237 22608 1720 --11768
NM_175884chr7177 ------
NM_176787chr1841085 1065 568 423 ------
NM_177452chr1432121 1937 1584 --11995 --
NM_177524chr71253 --1363 1775
NM_177525chr71253 --1363 1775
NM_177538chr2138504 8419 7041 6929 6498 6245 6132 5937 5586 3251 3139 2298 2087 --17254 --
NM_177974chr1512152 ------
NM_177976chr33463 456 163 ------
NM_177985chr21588 12244 ----
NM_177990chr2011562 11580 ----
NM_177995chr92699 222 31486 1479 713 ----
NM_177999chr983438 2881 2839 2379 2282 1329 982 436 21233 1200 1863 --
NM_178010chr1251826 1712 1701 412 251 --1375 1722
NM_178123chr2151 --1313 --
NM_178151chrX67061 6715 6206 1491 560 264 36565 6499 1114 ----
NM_178152chrX67061 6715 6206 1491 560 264 36565 6499 1114 ----
NM_178153chrX67061 6715 6206 1491 560 264 36565 6499 1114 ----
NM_178171chr171701 ------
NM_178190chr12271 198 ------
NM_178191chr151612 1539 1132 646 64 11509 ----
NM_178313chr251974 1771 1465 643 363 ----1861
NM_178314chr121847 ------
NM_178423chr7--11148 --11295
NM_178424chr51418 1482 ----
NM_178425chr7--11148 --11295
NM_178505chr1073523 3264 3230 1049 906 810 651 12366 ----
NM_178509chr1764085 3697 3106 3037 2917 2628 33987 3465 1577 --12600
NM_178578chr202374 326 --1851 --
NM_178585chr432978 2554 2058 ------
NM_178586chr14177 --12147 --
NM_178815chr1022113 74 12037 ----
NM_180976chr63992 843 816 ------
NM_180977chr63992 843 816 ------
NM_181077chr1542197 2171 1830 410 --1706 --
NM_181265chr443149 2748 2432 369 13127 --191
NM_181351chr1142646 2251 707 558 22261 617 ----
NM_181354chr831461 1321 1062 1495 ----
NM_181358chr142820 2771 1308 1116 23783 2588 ----
NM_181442chr20--1747 ----
NM_181453chr231527 1076 697 2241 85 ----
NM_181458chr211200 ------
NM_181459chr23966 438 412 ------
NM_181460chr231013 485 459 ------
NM_181481chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_181482chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_181483chr1866671 5538 5491 4669 4574 4424 --1511 --
NM_181486chr1231518 1102 1017 --11566 --
NM_181489chr3186549 6482 6456 6329 6292 5604 5338 5317 5205 5051 4973 4249 2568 2559 2191 1858 1455 1287 46667 6373 1614 723 14170 --
NM_181504chr51969 23600 635 11509 1616
NM_181523chr51969 23600 635 11509 1616
NM_181524chr51969 23600 635 11509 1616
NM_181571chr101279 ------
NM_181645chr11--1199 --1616
NM_181656chr173959 366 126 ------
NM_181659chr2053053 2907 849 700 313 ------
NM_181659chr2053053 2907 849 700 313 ------
NM_181702chr82790 406 ------
NM_181714chr641674 1413 267 181 31687 791 90 --21515 359
NM_181746chr12906 606 ------
NM_181782chr632301 1546 592 ----1559
NM_181809chr1103353 3336 3193 2973 2749 1598 1545 1292 1184 102 ------
NM_181828chr2263445 3172 1256 752 731 455 23729 3551 22554 1056 --
NM_181829chr2263445 3172 1256 752 731 455 23729 3551 22554 1056 --
NM_181830chr2263445 3172 1256 752 731 455 23729 3551 22554 1056 --
NM_181836chr532363 2111 928 ------
NM_181886chr41565 ------
NM_181887chr41565 ------
NM_181888chr41565 ------
NM_181889chr41565 ------
NM_181890chr41565 ------
NM_181891chr41565 ------
NM_181893chr41565 ------
NM_181897chr312496 42722 2422 572 485 ----
NM_182314chrX31514 1362 233 1272 ----
NM_182485chr443699 3153 3042 1194 13317 ----
NM_182487chr963255 1661 1485 1082 831 781 --32974 1053 198 13739
NM_182493chr1675109 4810 4427 3627 3325 2129 553 1544 ----
NM_182641chr172716 213 ------
NM_182646chr443699 3153 3042 1194 13317 ----
NM_182666chr31524 --1680 --
NM_182697chr721383 282 ------
NM_182715chr731247 105 56 ------
NM_182718chr101279 ------
NM_182719chr101279 ------
NM_182724chr101279 ------
NM_182725chr101279 ------
NM_182728chr1441542 1214 268 71 ----1728
NM_182756chr24634 609 406 175 148 --171
NM_182757chr662978 2861 2357 2267 140 96 23253 2385 ----
NM_182765chr1021887 594 ------
NM_182769chr101279 ------
NM_182770chr101279 ------
NM_182771chr101279 ------
NM_182772chr101279 ------
NM_182789chr511017 2905 159 ----
NM_182797chr2021819 531 ----1623
NM_182800chr7196 ------
NM_182830chr142872 419 1346 ----
NM_182850chr101279 ------
NM_182898chr765541 4918 1121 594 459 383 16016 11744 --
NM_182899chr765541 4918 1121 594 459 383 16016 11744 --
NM_182910chr14245 24 1715 ----
NM_182913chr14245 24 1715 ----
NM_182914chr14245 24 1715 ----
NM_182918chr21--2945 201 --1292
NM_182920chr341267 896 587 432 ------
NM_182943chr3------11220
NM_182948chr142841 2281 405 205 1487 ----
NM_182964chr1153239 2738 2576 2322 486 --1529 --
NM_182972chr152717 2649 1098 1007 492 ------
NM_182976chr1------1796
NM_183057chr81219 ------
NM_183060chr101279 ------
NM_183244chr201382 ------
NM_183246chr201382 ------
NM_183323chr511017 2905 159 ----
NM_183353chrX2862 277 ------
NM_183381chr34961 788 347 167 1802 ----
NM_183383chr34961 788 347 167 1802 ----
NM_183384chr34961 788 347 167 1802 ----
NM_183397chr2075053 4925 4110 4048 3189 1589 1425 ----13904
NM_183416chr131919 1662 805 --11768 --
NM_183422chr1331074 1048 63 ------
NM_194247chr244280 3247 1686 1612 23760 519 1247 --
NM_194271chr123726 569 481 ----1663
NM_194278chr1433109 1548 1313 ----13547
NM_194286chr12105826 4913 3935 1803 1101 986 937 923 622 45 --15398 --
NM_194292chr121169 65 --11621 --
NM_194314chr143701 3477 1708 44 15301 1238 34470 3670 992
NM_194317chr232703 2665 1840 22182 984 11828 --
NM_194434chr1844582 489 425 401 24445 1725 ----
NM_194449chr18--1369 ----
NM_194454chr721504 1266 ------
NM_194455chr721504 1266 ------
NM_194456chr721504 1266 ------
NM_197962chr1134 ------
NM_197968chr132600 289 ------
NM_197970chr221374 1056 11622 1239 --
NM_198081chr632931 2596 614 42829 2073 927 215 ----
NM_198123chr821285 676 21223 74 ----
NM_198124chr821285 676 21223 74 ----
NM_198128chr1841908 1860 1812 41 ----1457
NM_198150chr531514 1169 462 ------
NM_198158chr312867 32703 2644 2486 ----
NM_198159chr312867 32703 2644 2486 ----
NM_198177chr312867 32703 2644 2486 ----
NM_198178chr312867 32703 2644 2486 ----
NM_198188chr9125 ------
NM_198195chr33622 587 56 ------
NM_198215chr102239 74 ------
NM_198217chr1321065 995 ----11014
NM_198218chr1321065 995 ----11014
NM_198219chr1321065 995 ----11014
NM_198225chr1021443 661 11864 ----
NM_198261chr12--1719 ----
NM_198262chr12--1719 ----
NM_198268chr142820 2771 1308 1116 23783 2588 ----
NM_198269chr142820 2771 1308 1116 23783 2588 ----
NM_198336chr721699 280 ------
NM_198353chr4155 ------
NM_198391chr20--11072 ----
NM_198400chr1541818 501 407 350 21967 1930 12063 --
NM_198404chr131786 ------
NM_198465chrX42945 2262 992 578 12139 ----
NM_198467chr71397 ------
NM_198485chr331699 603 504 1695 ----
NM_198503chr12709 399 ------
NM_198521chr12--1149 ----
NM_198569chr622492 84 ------
NM_198570chr72352 231 ------
NM_198581chr266333 5284 4987 760 456 294 36925 1947 655 11892 11500
NM_198597chr102405 231 ------
NM_198715chr176158 5384 5329 1953 1816 1397 667 45892 5458 4778 1430 36243 4680 4180 1164
NM_198793chr353901 3760 3311 1019 429 11601 ----
NM_198799chr20----1562 --
NM_198829chr731469 1337 121 21213 315 1349 --
NM_198859chr384789 4216 4112 3889 2057 919 819 797 25074 1744 15023 --
NM_198880chr31231 ------
NM_198896chr111877 12230 ----
NM_198900chr1267591 6018 1917 586 437 152 --31484 658 491 --
NM_198935chr2072874 2535 2244 2137 2071 431 114 ------
NM_198990chr733341 3176 1108 22797 235 ----
NM_198991chr181658 1226 ----
NM_199054chr1922087 555 ------
NM_199136chr7--1177 ----
NM_199144chr202220 201 ------
NM_199160chr951672 1399 782 490 283 ------
NM_199169chr2043548 2988 2441 2374 11103 23067 532 --
NM_199170chr2043548 2988 2441 2374 11103 23067 532 --
NM_199171chr2043548 2988 2441 2374 11103 23067 532 --
NM_199188chr1224094 300 23993 2943 ----
NM_199189chr51346 ------
NM_199190chr1224094 300 23993 2943 ----
NM_199191chr2154 ------
NM_199194chr2154 ------
NM_199203chr202220 201 ------
NM_199320chr432034 840 236 12546 ----
NM_199320chr432034 840 236 12546 ----
NM_199421chr1423709 3234 ----1857
NM_199436chr212418 1468 --1518
NM_199437chr1122539 160 12441 1366 --
NM_199438chr1122539 160 12441 1366 --
NM_199439chr1122539 160 12441 1366 --
NM_199454chr174174 4087 3090 3074 1879 1849 844 ----11593
NM_199461chr1023255 1350 11025 1757 12556
NM_199482chr221513 584 21685 278 ----
NM_201266chr242697 2145 2078 574 23007 2499 ----
NM_201279chr242697 2145 2078 574 23007 2499 ----
NM_201428chr1131511 1451 93 ------
NM_201429chr1131511 1451 93 ------
NM_201432chr17126006 5521 4709 4513 1880 1571 779 725 455 427 298 71 16285 12223 --
NM_201433chr17126006 5521 4709 4513 1880 1571 779 725 455 427 298 71 16285 12223 --
NM_201434chr171778 ------
NM_201568chr121421 117 ------
NM_201569chr121421 117 ------
NM_201570chr102659 193 ------
NM_201571chr102659 193 ------
NM_201572chr102659 193 ------
NM_201590chr102659 193 ------
NM_201591chr41712 1288 11880 --
NM_201592chr41712 1288 11880 --
NM_201593chr102659 193 ------
NM_201596chr102659 193 ------
NM_201597chr102659 193 ------
NM_201613chr12--1898 ----
NM_201624chr121060 808 11176 ----
NM_201628chr163238 1358 1191 651 479 355 ------
NM_201999chr43842 468 451 ------
NM_203350chr11524 ----192
NM_203364chr11--1274 ----
NM_203382chr511374 ----198
NM_203390chr81529 11389 ----
NM_203394chr1232490 653 214 --1703 --
NM_203403chr9--1338 ----
NM_203406chr5156 32698 1156 217 12555 --
NM_203417chr2121321 1129 --1324 --
NM_203418chr2121321 1129 --1324 --
NM_203451chr1332338 1799 787 1529 ----
NM_203458chr122489 1545 11480 1648 --
NM_203459chr12600 85 22349 2316 ----
NM_203463chr234088 1516 387 44096 3554 3284 1914 ----
NM_203464chr111049 ------
NM_203487chr1331767 1570 44 ------
NM_203499chr171345 1679 ----
NM_203504chr412070 ------
NM_203505chr412070 ------
NM_205768chr11304 --12080 1734
NM_205864chr6137 ------
NM_206852chr14--1248 1191 --
NM_206853chr632512 1339 226 31487 1453 1147 ----
NM_206854chr633773 3500 1487 ------
NM_206855chr644738 4465 2452 939 ------
NM_206857chr14--1248 1191 --
NM_206876chr232372 1086 171 23464 1445 ----
NM_206900chr191122 ------
NM_206901chr191122 ------
NM_206907chr531020 641 520 12773 12578 --
NM_207032chr20--11594 ----
NM_207033chr20--11502 ----
NM_207034chr20--11502 ----
NM_207123chr4----1842 --
NM_207313chr171427 ------
NM_207317chr5------1433
NM_207325chr1951917 1907 1270 617 523 ----11961
NM_207334chr111010 ------
NM_207337chr122951 201 ------
NM_207359chr32581 146 3685 405 196 ----
NM_207361chr1336247 3974 2126 25211 4657 1320 --
NM_207371chr1021016 303 1349 ----
NM_207372chr1032458 860 204 ----1340
NM_207404chr332121 1519 570 12284 21914 225 --
NM_207445chr1532133 2047 605 ----1187
NM_207468chr11514 ------
NM_207577chr11112802 2359 2059 1878 1812 1159 1145 1040 535 441 376 12933 22048 981 --
NM_207645chr112448 309 ------
NM_207647chr9----12027 --
NM_207660chr1421320 571 21231 82 --11082
NM_207661chr1421320 571 21231 82 --11082
NM_207662chr1421320 571 21231 82 --11082
NM_212460chr711497 1528 1406 --
NM_212467chr1532502 325 243 ------
NM_212471chr173607 550 278 11824 12245 1802
NM_212472chr173607 550 278 11824 12245 1802
NM_212554chr1011582 1365 ----
NM_212558chr963997 3727 3177 1053 1007 301 24075 1723 ----
NM_213589chr265490 1991 1660 1147 805 460 --25005 4487 --
NM_213590chr1355255 3212 1768 1570 511 --14497 14284
NM_213619chr81130 ------
NM_213620chr81130 ------
NM_213654chr31179 ------