TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-let-7b-3p
miRNA Sequence: CUAUACAACCUACUGCCUUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000138chr1561886 933 707 592 210 141 11045 --1121
NM_000176chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_000214chr2061418 1109 690 625 494 228 --2588 385 11517
NM_000216chrX83941 3039 2970 1303 1269 1144 949 271 2527 40 13968 --
NM_000242chr1062598 2503 2196 1811 1757 809 1751 42276 2103 760 729 11073
NM_000264chr952581 2314 1027 590 150 1200 12440 33149 385 372
NM_000314chr1083233 3188 1311 351 325 231 218 96 23144 927 1203 --
NM_000346chr1761890 1513 1331 665 641 95 21799 465 11994 21431 1353
NM_000489chrX52871 2706 2656 2519 584 192 22341 2321 22894 651
NM_000555chrX107854 7210 6581 2940 2818 2635 2554 1790 826 386 27874 7733 26632 5506 --
NM_000724chr1061716 1302 766 556 549 125 11807 --149
NM_000793chr1485131 4667 4294 3551 1689 1209 998 987 --13223 11911
NM_000809chr4118204 8068 7430 6841 6677 6616 2968 2939 1920 1912 1236 26732 108 --1658
NM_000813chr565005 4004 3432 3424 1832 1284 25611 3959 24519 1388 --
NM_000814chr1583337 2804 1034 753 409 228 188 176 --2992 132 --
NM_000950chrX93436 3311 2477 2220 1173 747 296 276 266 13518 11315 1415
NM_000959chr163383 2963 2910 2719 906 722 33946 1393 1305 22940 466 11203
NM_001001395chr1282566 776 412 372 353 341 255 157 11009 22572 292 1944
NM_001001419chr595068 4975 4913 3224 1160 950 485 172 144 --24645 4540 --
NM_001001420chr595068 4975 4913 3224 1160 950 485 172 144 --24645 4540 --
NM_001001484chr1062162 2062 1702 1604 990 838 ----22248 673
NM_001001664chr272991 2935 1384 1229 925 718 446 24008 855 43866 2963 865 625 11595
NM_001002860chr1454297 4136 4130 1716 1613 --24720 134 23925 1356
NM_001003652chr18158617 8603 8099 7892 6669 5324 3444 2772 2730 1702 1691 1237 468 306 64 --17434 22297 911
NM_001003674chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_001003675chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_001003679chr162092 1929 1779 672 574 471 32047 1690 178 21935 1541 12166
NM_001003681chr2231937 1931 588 --154 22103 1962
NM_001003712chr1283849 3443 2820 2648 1231 688 323 278 23398 3138 13536 --
NM_001004317chr6104340 4266 3735 3574 2982 1671 1554 891 495 263 1725 1330 13911
NM_001005473chr5156629 6597 6566 6394 5477 2576 2401 2362 2176 2001 1985 1934 735 405 49 14501 24485 441 24463 4403
NM_001007023chr1485131 4667 4294 3551 1689 1209 998 987 --13223 11911
NM_001007278chr13115274 5147 5135 5028 4308 4272 1568 1249 535 296 247 ------
NM_001007466chr634448 4059 3556 13429 35046 3955 3534 24535 1448
NM_001008220chr581553 1433 1391 1350 1254 1221 1195 1102 13359 21308 1293 23916 1406
NM_001009899chr3116407 6210 5991 4868 4612 4533 1453 1207 1173 802 95 46329 5335 1188 111 46503 5749 5483 1064 --
NM_001010888chrX63361 1826 1081 1009 583 90 32983 1020 978 34671 4319 4270 13061
NM_001010891chr5156650 6156 6120 6104 5756 5252 4804 4482 2272 1846 1695 1560 772 257 167 26089 2412 14252 --
NM_001010922chr154167 3741 3188 1710 656 --24220 2701 11702
NM_001010942chr1231104 343 318 2933 301 11076 21303 1218
NM_001011666chr7106432 6326 6302 5921 5632 4704 4168 3994 3984 283 16231 12103 --
NM_001012755chrX64984 4333 3646 3416 1566 1353 24994 4936 24946 1622 14844
NM_001013620chr12168008 7653 7502 6124 5955 5893 5883 2695 2405 2168 2149 1531 1145 1092 744 693 22644 673 45870 1765 1292 295 37453 5555 1479
NM_001014380chr13155795 5612 5334 4955 4448 4374 4154 3891 3737 1962 1384 807 772 420 389 14277 55005 4695 4404 3940 2171 14342
NM_001018065chr965670 5018 4230 2288 914 889 15949 35310 1472 899 --
NM_001018066chr965670 5018 4230 2288 914 889 15949 35310 1472 899 --
NM_001018067chr1125161 5030 4946 4798 3738 2077 2039 1456 363 334 279 205 24444 912 34902 3859 3328 24877 4504
NM_001018068chr1125161 5030 4946 4798 3738 2077 2039 1456 363 334 279 205 24444 912 34902 3859 3328 24877 4504
NM_001018069chr1125161 5030 4946 4798 3738 2077 2039 1456 363 334 279 205 24444 912 34902 3859 3328 24877 4504
NM_001018074chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_001018075chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_001018076chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_001018077chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_001024094chr583807 3617 3301 3015 2778 1247 474 415 23675 3505 23574 785 31473 1022 59
NM_001024647chr12137674 7552 7315 6950 6123 4745 4739 2420 1460 1315 1240 1118 287 --37690 7308 7204 --
NM_001025076chr10105062 4504 3973 3899 3890 2405 1786 1030 970 669 16120 --34054 1316 1180
NM_001025077chr1096420 5862 5331 5257 5248 2388 2328 2027 1063 27478 1373 --35412 2674 2538
NM_001025079chr373313 3269 3186 2567 1314 1073 63 --11276 21522 561
NM_001025108chr253657 3637 3175 3045 190 1199 23555 162 13698
NM_001025266chr364737 3885 3188 1894 1752 208 --33076 1965 1267 11108
NM_001029884chr6112710 2553 2483 2460 2407 2157 1993 1736 869 583 82 22369 2145 ----
NM_001030055chr14104584 4493 4113 3643 3554 3371 1592 1570 1394 1102 23187 3151 21325 741 --
NM_001031695chr2265340 4748 4650 4627 3782 297 15358 45226 4397 2095 1854 15056
NM_001037165chr798804 8439 8155 7705 7690 7151 6528 5845 2030 --18902 1220
NM_001039580chr4124936 4560 4544 3966 3434 3137 2002 1897 1690 1012 884 307 13891 --13984
NM_001039585chr163640 3220 3167 2976 1163 979 34203 1650 1562 23197 723 11460
NM_001039590chrX63793 3636 3231 3068 243 191 32751 1332 227 13248 --
NM_001039591chrX63793 3636 3231 3068 243 191 32751 1332 227 13248 --
NM_001039618chr1195049 4821 4775 4540 4272 3868 3667 1005 364 11037 44968 3795 1994 1980 24000 1241
NM_001039840chrX125382 5284 4861 4333 3828 1861 1819 1736 1381 630 192 139 35500 2227 2072 --12351
NM_001040020chr731476 1025 459 3465 294 77 21427 1160 11262
NM_001040142chr2112225 2069 826 810 798 790 782 529 481 122 67 ----1536
NM_001040143chr2112225 2069 826 810 798 790 782 529 481 122 67 ----1536
NM_001040284chr1695964 4408 2390 2004 1546 1263 923 723 498 11420 14597 1827
NM_001040402chr483241 2946 2667 2585 1231 255 204 76 32255 641 287 1278 12936
NM_001040665chr744832 958 793 682 24869 1257 15016 44215 3443 1208 549
NM_001042555chr1254014 3723 3245 1398 1110 13259 44112 3913 3771 924 23835 3751
NM_001042599chr2117467 7192 7005 6470 6375 5104 5098 5078 4814 4756 1904 26800 3009 27331 4796 --
NM_001042603chr12105104 4961 4353 4291 4282 3860 1593 1557 1509 1436 24952 1994 25345 2079 --
NM_001044385chr2123885 3750 3722 3430 3156 2846 2720 546 278 158 87 79 --22907 951 --
NM_001099678chr3126121 5260 5052 4434 2316 2275 1257 1245 810 504 412 143 14700 35542 4610 1631 11540
NM_001100108chr1158350 8156 8052 7832 7686 7668 7252 5245 5227 3100 3030 2929 1042 979 267 --17166 13086
NM_001106chr389550 7602 6832 3544 2880 2683 1509 64 --59785 9183 9005 6379 6194 --
NM_001167chrX156586 5989 5905 5775 5650 5214 2298 1414 1366 704 678 491 423 372 274 16714 12504 --
NM_001173chr14104584 4493 4113 3643 3554 3371 1592 1570 1394 1102 23187 3151 21325 741 --
NM_001177chr1242301 2275 684 234 --1258 2454 352
NM_001198chr661543 1506 898 287 271 220 1503 1723 --
NM_001201chr483931 3699 3554 3530 3198 1290 667 558 43913 3476 3084 2602 --13340
NM_001204chr2127694 7585 7534 7148 5969 5552 2794 2295 1980 1315 496 272 17527 47112 5636 2584 1834 27498 5722
NM_001304chr1762895 2567 2554 1470 311 135 33851 3463 3024 12753 --
NM_001310chr1242569 869 837 299 12151 42520 1904 855 371 --
NM_001364chr1184653 4388 4094 4070 807 732 591 536 1150 --14615
NM_001412chrX73449 2904 2811 2451 1161 1096 782 1735 32702 391 378 12337
NM_001432chr473793 3779 3720 3540 2660 1543 1087 1179 23819 768 --
NM_001438chr1103507 3282 3181 3157 3133 3060 2421 2361 2255 1162 13626 23567 3492 13544
NM_001609chr1084463 4327 4257 3737 1373 437 261 60 1928 13519 13107
NM_001621chr752346 2306 1122 652 586 11071 23052 2646 --
NM_001621chr752346 2306 1122 652 586 11071 23052 2646 --
NM_001656chr561981 1952 1820 1762 1581 1501 11746 --1632
NM_001695chr892846 2754 2626 1563 1391 653 221 42 36 1553 24257 1556 --
NM_001730chr1351571 1528 217 162 126 171 2391 135 --
NM_001730chr1351571 1528 217 162 126 171 2391 135 --
NM_001777chr373313 3269 3186 2567 1314 1073 63 --11276 21522 561
NM_001858chr6134936 4865 4803 4797 4436 4330 4283 1911 1695 1536 1089 1031 918 1675 14291 23893 755
NM_001918chr1109194 9179 8494 8290 8149 2212 1367 805 256 107 18807 22680 1228 1746
NM_002006chr4105826 5716 4946 4662 4318 1352 748 607 191 90 25547 507 15756 24340 2301
NM_002015chr1372625 2367 1114 1059 905 364 358 --22157 335 13255
NM_002025chrX109171 8172 7977 7909 6909 6107 2958 2934 1642 980 19080 28096 470 27201 1796
NM_002092chr474557 4321 4164 3917 1142 1121 973 24997 967 24939 3096 --
NM_002137chr732230 1497 463 135 --2607 524
NM_002158chr263750 3246 3059 2495 1329 893 33519 3509 3276 22920 1433 21279 1014
NM_002210chr273406 3329 3259 2728 889 261 208 11193 32920 2745 425 2753 679
NM_002214chr764563 1333 867 695 577 370 34005 1824 1680 15221 25042 2292
NM_002270chr5105637 4799 4767 4750 3800 3700 1728 1675 1146 985 25192 1155 14496 25651 5370
NM_002285chr253657 3637 3175 3045 190 1199 23555 162 13698
NM_002310chr585484 4789 3991 2480 1822 1553 1354 366 44826 2227 1627 606 25256 2437 16419
NM_002336chr1254552 4425 3243 1681 1572 15001 --25016 229
NM_002577chr353568 2887 2658 934 701 --13256 1544
NM_002594chr2041930 1905 1877 1867 22089 1819 1772 11898
NM_002645chr1133142 2257 1050 63073 2779 2550 1090 782 398 1103 12817
NM_002655chr8105096 5059 5021 4846 4751 3420 3352 786 181 35 25104 4346 34958 3758 1045 35067 408 112
NM_002687chr1461266 1104 1079 848 830 300 --1911 31287 1018 420
NM_002731chr153006 2904 1953 1219 709 11202 12030 12493
NM_002737chr17106399 5190 4849 4431 4351 1852 1756 1544 781 98 36687 6582 6504 --16616
NM_002843chr1173232 1387 1281 1174 1048 1038 369 12633 --12395
NM_002959chr164419 3898 3873 1513 1211 820 ----24374 2716
NM_003054chr10------3282 202 41
NM_003112chr743059 2556 2451 616 12962 22885 2136 12006
NM_003274chr2162966 2432 2269 2199 1890 450 21093 840 22636 1176 --
NM_003410chrX72097 894 841 753 709 111 94 12703 22983 2897 --
NM_003468chr283939 3764 3755 2784 1416 923 724 634 13084 44226 4166 3780 3302 --
NM_003489chr21102937 2907 2853 2805 2709 2277 1337 1089 716 231 22865 66 ----
NM_003566chr1243268 3126 2993 708 23418 2592 23164 1390 23091 844
NM_003574chr18125685 5577 4989 3969 3532 1663 1579 1536 1441 882 627 112 14204 25699 204 --
NM_003620chr172226 163 ----2382 218
NM_003663chr393386 3353 3312 2365 1060 612 127 80 65 22642 330 32701 2454 540 --
NM_003672chr161837 1779 1769 1752 1693 447 --11578 11474
NM_003677chr12121891 1820 1707 604 240 220 198 172 158 144 122 104 --11983 --
NM_003759chr4114307 3766 3467 3340 3114 3018 1705 1322 1286 1226 989 --31690 1295 995 13743
NM_003799chr1834551 2859 184 --12908 34538 3298 947
NM_003913chr6114263 4181 4106 4083 3225 1705 1244 510 250 180 75 --1948 --
NM_003948chr472160 2056 2019 630 437 417 304 2430 356 22242 326 --
NM_004093chr1352608 2496 2253 2222 653 12266 12875 22926 2698
NM_004100chr652721 2200 980 863 678 21083 454 --2900 487
NM_004114chrX4938 913 883 447 1920 31234 959 811 1845
NM_004171chr11109327 8139 8115 7969 3720 3452 2933 2113 1025 225 28979 661 69654 9298 8069 8015 6692 6660 --
NM_004232chr1863746 3728 3555 869 730 351 23901 121 23256 2468 13866
NM_004279chr762296 1901 825 682 157 77 --21555 1475 11815
NM_004293chr973874 3770 3073 1074 769 559 478 --23276 778 13806
NM_004338chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_004432chr962396 2135 1603 426 381 358 11681 --31816 1627 847
NM_004457chr261611 1598 1518 1251 361 177 31482 511 324 21604 526 --
NM_004612chr984377 4229 4058 3053 1244 939 570 233 --34223 3902 578 --
NM_004650chrX41860 246 121 100 --21280 495 21837 1754
NM_004726chrX115608 5549 5450 5230 5205 4456 4408 3927 2000 1390 1022 15784 34804 414 161 --
NM_004744chr463706 3640 2962 305 36 27 1158 13329 13890
NM_004745chr8107013 6662 5930 2709 1295 1096 903 815 578 363 12094 15694 --
NM_004904chr7106432 6326 6302 5921 5632 4704 4168 3994 3984 283 16231 12103 --
NM_004999chr6104518 4456 3516 3357 1458 1194 1068 1015 863 467 13458 21750 1635 --
NM_005056chr12115348 5205 4597 4535 4526 4104 1837 1801 1753 1680 93 35196 2238 140 15589 --
NM_005065chr1454051 3909 3667 1605 1323 25095 1701 35306 3630 1594 13958
NM_005095chr112263 31654 1624 83 11563 42112 1851 1818 318
NM_005156chr964457 3925 3730 1030 552 162 --25315 5111 11578
NM_005160chr22106615 5407 5355 2253 1390 1291 1013 966 860 648 --35653 5348 5207 --
NM_005235chr2117467 7192 7005 6470 6375 5104 5098 5078 4814 4756 1904 26800 3009 27331 4796 --
NM_005359chr18126476 4512 4131 1667 1491 1265 1114 1082 853 765 653 344 1265 31482 1206 426 --
NM_005477chr1581699 581 573 562 556 550 538 354 --12594 --
NM_005477chr1581699 581 573 562 556 550 538 354 --12594 --
NM_005487chr2231937 1931 588 --154 22103 1962
NM_005497chr1785841 4865 4668 2282 1043 755 348 237 24567 532 1298 --
NM_005504chr12176652 6548 6258 6185 5595 5514 5345 4129 2239 1992 1652 1573 936 837 691 373 47 --16523 --
NM_005613chr1102060 1955 1748 623 539 527 515 501 456 441 11907 ----
NM_005639chr1251578 1338 346 263 232 11455 3321 313 277 --
NM_005668chr5104349 4083 4069 4045 4033 3907 2841 1528 1144 829 21661 246 64579 4395 3811 3558 3542 3019 --
NM_005746chr762037 703 542 365 72 26 --22708 1042 1389
NM_005759chr294761 4702 4532 3039 2924 1811 341 275 248 14393 --34084 1128 462
NM_005798chr13115274 5147 5135 5028 4308 4272 1568 1249 535 296 247 ------
NM_005840chrX87086 6151 4870 3017 2946 2791 2000 813 57009 6938 4855 3031 1693 37124 2185 1002 --
NM_005885chr52287 123 1213 2651 206 1583
NM_005901chr18158617 8603 8099 7892 6669 5324 3444 2772 2730 1702 1691 1237 468 306 64 --17434 22297 911
NM_005902chr1594575 4484 3989 3678 3159 1809 1611 1338 764 ----21509 1345
NM_005903chr595068 4975 4913 3224 1160 950 485 172 144 --24645 4540 --
NM_005955chr195402 5038 4730 3737 3630 2013 1279 1261 253 ----25453 3506
NM_005966chr251916 1775 1760 730 414 1809 12198 1320
NM_006007chr983818 3427 3167 1461 1398 1203 727 201 11194 13255 --
NM_006037chr264790 4759 4242 3985 2968 1822 31852 1145 454 13706 11540
NM_006047chr2063117 2819 2625 547 497 189 12668 53229 2588 2393 2298 512 --
NM_006095chr453220 2939 811 503 150 23674 3338 22978 1049 13550
NM_006154chr1582709 2394 2196 2186 2060 1079 943 887 1297 1339 --
NM_006251chr563308 2786 1301 1234 820 215 12759 22308 1349 --
NM_006252chr197114 7052 7037 5953 3011 2239 1605 1498 1369 11353 25263 1805 --
NM_006306chrX85898 3927 3663 1736 1617 1406 337 331 25168 1870 1539 15345
NM_006315chr464162 3953 3856 2983 626 565 33866 1763 1739 12775 24058 134
NM_006379chr722159 2087 22264 1701 21991 389 2500 167
NM_006526chr2071967 1854 1564 859 558 524 453 11914 --2845 172
NM_006544chr1485597 4317 4099 3820 3796 2319 2259 761 15841 --12402
NM_006561chr10105062 4504 3973 3899 3890 2405 1786 1030 970 669 16120 --34054 1316 1180
NM_006572chr1793431 3193 3178 2674 2345 1379 1130 943 37 --1551 11141
NM_006599chr16117256 7079 6850 6838 6125 5851 2883 1971 1290 1259 560 15348 28245 8092 27149 6948
NM_006628chr1574665 4419 4068 3135 492 377 157 --31218 346 240 1854
NM_006650chr581553 1433 1391 1350 1254 1221 1195 1102 13359 21308 1293 23916 1406
NM_006654chr1254014 3723 3245 1398 1110 13259 44112 3913 3771 924 23835 3751
NM_006717chr9103287 3184 3149 2750 2560 2362 1326 979 418 386 22516 1109 1915 1184
NM_006729chrX85513 4905 1826 1415 1117 1099 257 241 31568 1108 351 ----
NM_006738chr1574490 4440 1633 1625 1619 1096 419 24511 690 ----
NM_006750chr1697965 7938 7366 6181 5692 2608 2118 543 386 18051 17262 --
NM_006785chr1861703 1405 576 335 258 244 --42247 1395 653 96 --
NM_006827chr1462655 2255 691 656 402 314 33235 1361 954 11260 23386 863
NM_006885chr1641497 1443 396 252 --42643 951 933 333 11432
NM_006924chr1763393 3286 2889 1667 280 183 13068 24245 39 1256
NM_006956chr751905 938 609 238 122 1821 32294 2284 575 1440
NM_007005chr941521 1136 469 371 1487 --11310
NM_007006chr1673389 3274 3188 1086 1054 508 420 13468 32963 2247 839 --
NM_007007chr12144823 4706 4441 3547 3390 3289 3105 1793 1784 1760 1640 1164 1096 489 3847 786 442 23828 3260 --
NM_007038chr21105762 5384 5229 5009 4377 4110 2374 1091 1040 839 44397 4371 3994 945 14191 15530
NM_007054chr593927 3909 3847 3709 3332 2811 1139 797 331 23920 300 23958 3943 --
NM_007068chr225296 236 220 213 207 11022 1187 --
NM_007125chrY61409 1126 913 474 432 324 1932 2964 225 --
NM_007146chr1762698 2521 1817 1054 753 175 --32778 2389 1018 22363 2335
NM_007200chr1574490 4440 1633 1625 1619 1096 419 24511 690 ----
NM_007212chr141946 1827 782 243 --21645 432 22212 1891
NM_007231chrX62444 1789 1571 773 377 74 22272 221 --132
NM_007249chr13159338 9075 9068 9059 8388 8309 8114 8005 7953 7711 7284 3629 3278 2382 1948 17447 29393 6972 19349
NM_007345chr1852075 1979 1789 1490 333 22292 1695 31955 1598 1591 --
NM_012081chr593449 1356 1343 1045 763 569 541 301 218 --52802 2499 1502 659 363 --
NM_012082chr84969 661 619 321 --4651 390 298 287 --
NM_012115chr63507 489 481 3602 559 457 --1573
NM_012120chr652348 2299 2002 496 311 22574 1066 12960 12458
NM_012129chr72678 360 --31992 1673 333 21745 504
NM_012214chr2106389 6042 5782 4959 4885 3881 2541 768 759 166 35265 4729 806 16203 23944 1006
NM_012223chr241255 1230 1154 273 21315 930 183 21047 993
NM_012252chr764786 4702 4671 4530 1974 753 24084 516 --14422
NM_012262chr185150 2047 1517 1069 455 432 111 98 23824 3590 14200 --
NM_012287chr394425 3729 3230 3178 3044 1090 739 621 50 24381 630 54539 3506 3365 3304 1049 --
NM_012399chr2251592 769 218 194 184 --21663 263 11972
NM_013255chr7148701 8352 8010 7337 7049 5531 3468 2583 2475 1450 1182 582 543 519 16369 48837 7105 3054 1673 11285
NM_013381chr1272105 2012 708 681 671 640 408 12200 --1936
NM_013943chr1103303 2856 2777 2587 2518 1326 1178 324 310 92 --22361 1128 --
NM_013989chr1485131 4667 4294 3551 1689 1209 998 987 --13223 11911
NM_014023chr1092835 2739 2701 2524 2461 859 464 318 207 --2201 121 --
NM_014155chr1167304 7286 7060 6930 2054 1937 15843 17293 21826 708
NM_014243chr441969 487 422 259 --11562 2477 454
NM_014250chr2231937 1931 588 --154 22103 1962
NM_014309chr2265330 4738 4640 4617 3772 287 15348 45216 4387 2085 1844 15046
NM_014319chr1281359 723 709 699 693 683 553 290 31906 585 542 41393 576 392 90 --
NM_014423chr5105496 5425 3987 3860 3683 3534 2225 1796 1196 648 13543 35001 2241 1322 --
NM_014683chr1741574 1449 746 619 11404 22025 682 11541
NM_014701chr1543368 3140 2545 2102 13067 21226 484 1814
NM_014702chr652705 2679 1171 417 399 --33083 464 253 12780
NM_014707chr742233 1541 769 112 --32254 1847 544 21975 668
NM_014721chr676969 6903 4738 2679 1334 1189 1166 37097 6617 5771 27277 4842 27008 2275
NM_014729chr81731 21986 782 --21816 745
NM_014739chr6114124 3879 3695 3637 3606 3098 1529 1314 1198 436 173 --13015 13127
NM_014746chr2134340 4271 4192 4136 3706 3664 3565 3283 2891 1496 854 678 629 24239 3757 --14104
NM_014827chr151698 1628 1417 358 143 --31567 1155 491 11463
NM_014877chr17127161 7071 6567 6074 2959 2819 2808 2285 1731 1691 444 48 56491 1872 1767 880 583 46904 5671 652 247 12648
NM_014888chr731476 1025 459 3465 294 77 21427 1160 11262
NM_014904chr1043807 3409 3077 1627 13419 33939 2879 501 23999 3983
NM_014923chr1362336 2214 2186 1698 1663 818 1825 --12088
NM_014936chr692848 2363 2263 1083 798 788 493 310 151 22878 2531 22616 440 --
NM_014946chr242628 2376 610 320 --1314 11176
NM_014953chr1384173 4113 3304 1584 1491 1170 775 619 21349 796 23755 1642 --
NM_014962chr2042333 2233 928 499 12896 11089 1915
NM_014992chr146258 235 172 154 148 136 --1653 --
NM_015000chr1232631 1055 733 ----22961 2568
NM_015026chr1274073 3996 3846 3481 1117 499 313 2527 505 23178 2983 23806 1566
NM_015032chr1362696 2027 1808 1067 421 415 22531 2458 42319 884 525 305 --
NM_015049chr252873 2386 2168 702 666 11251 32617 2230 936 12397
NM_015076chr694130 4036 3471 2907 1454 1167 1091 935 405 --24245 1532 13892
NM_015097chr372138 1815 1715 1649 819 528 143 11674 11567 1324
NM_015115chr483241 2946 2667 2585 1231 255 204 76 32255 641 287 1278 12936
NM_015137chr852381 2313 1689 653 84 1351 31843 994 918 --
NM_015200chr442428 2397 2376 1636 22453 537 --22546 2139
NM_015230chr431461 226 161 2238 62 2408 46 1339
NM_015265chr262538 1859 628 418 412 404 ------
NM_015271chr484297 4066 3731 2802 1124 1038 679 645 33976 3765 1690 14194 --
NM_015310chr898384 8209 8049 7672 6307 2170 2155 1026 958 36268 3219 2933 38135 5242 136 18244
NM_015317chr2102861 2181 1796 1759 1021 827 535 430 260 57 12805 32795 690 165 22842 1822
NM_015335chr1261659 1649 1615 416 362 253 12150 12368 11772
NM_015375chr1114996 4910 4786 4511 4065 3789 1348 1021 1010 995 321 35033 1849 247 23195 3086 --
NM_015455chr533479 2629 520 13979 23794 459 11063
NM_015458chr8105026 4967 4945 4835 1698 1338 937 920 472 283 35244 5092 153 11842 --
NM_015560chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_015569chr1174538 4244 4205 4148 3960 3508 3291 3271 3265 3245 3155 3113 3080 1589 1497 1333 997 13937 44226 3232 1471 244 11700
NM_015571chr642219 2043 1878 545 1834 32433 2295 2068 2501 121
NM_015575chr243552 3513 3318 152 1908 --33671 1031 918
NM_015578chr1972003 1676 1289 442 407 341 256 22107 663 21476 654 --
NM_015640chr1125161 5030 4946 4798 3738 2077 2039 1456 363 334 279 205 24444 912 34902 3859 3328 24877 4504
NM_015646chr1231104 343 318 2933 301 11076 21303 1218
NM_015678chr1351473 1361 1255 330 166 --11218 2616 487
NM_015878chr852172 1989 866 632 358 1459 1557 1537
NM_015886chr8105744 5672 5426 4887 4015 3605 3503 364 342 54 25692 4915 1233 31616 1308 136
NM_015906chr184785 4072 4036 4008 3800 3292 1045 313 24688 946 33753 1812 1509 --
NM_016075chr1362565 2288 2241 1171 928 670 --21994 1984 159
NM_016083chr693688 3588 3414 3267 1507 1092 958 914 451 13757 13768 23276 2970
NM_016131chr232283 267 201 ----22205 336
NM_016206chr3129012 8776 8675 7880 7558 6814 6401 6119 5884 2075 1286 721 38325 7328 5787 --15512
NM_016248chr13103571 2782 1377 1359 1223 1180 314 226 163 147 43818 3086 1390 724 ----
NM_016260chr297619 7440 7434 7387 7374 7328 6987 5986 2547 37398 5569 5107 67408 7144 5122 5095 4752 2796 25766 1448
NM_016271chr1892242 2026 1981 933 910 891 821 527 92 ----11437
NM_016315chr251857 1619 1414 319 283 1482 145 11565
NM_016374chr161265 1133 1084 360 345 226 --11165 31102 1048 484
NM_016374chr161265 1133 1084 360 345 226 --11165 31102 1048 484
NM_016396chr1552950 2890 2799 2710 2586 11063 1630 13019
NM_016531chr494129 4075 3088 3011 3005 2570 1158 1072 666 14149 --13474
NM_016545chr13891 239 222 --1229 2905 839
NM_016651chr1421027 29 --1988 31096 972 90
NM_016946chr183277 3102 2263 1134 1118 1066 1040 1011 --21052 408 13063
NM_016953chr275757 5745 4898 4836 4495 2071 473 15613 46016 5642 4792 374 --
NM_017415chr584459 4328 3322 3084 1763 1543 1458 321 14287 33713 2935 1752 12925
NM_017420chr14113754 3640 3563 3442 3209 3198 3118 3062 2676 697 338 --13501 --
NM_017423chr482241 2126 1789 1662 622 430 242 102 --2754 690 12146
NM_017444chr82759 380 ----21809 720
NM_017447chr21144389 4367 4245 4132 4025 3486 3356 3132 3026 2791 1003 955 484 466 13480 13248 --
NM_017633chr662981 2917 2808 1077 1043 1014 23260 1025 --1971
NM_017637chr9119440 9328 9222 8634 8104 7411 2963 2480 1568 567 127 1849 38196 6991 1368 1928
NM_017644chr395213 5166 5070 4349 3835 3584 2051 352 340 --11559 24600 1292
NM_017650chr785558 5342 5140 4722 2184 1805 1603 282 --55729 4932 4861 4770 2289 --
NM_017719chr372309 2303 2292 2030 1955 1884 777 22262 811 12116 12511
NM_017769chr1483059 2781 2373 2207 1160 913 891 488 11086 32414 1006 275 --
NM_017813chr8145517 5461 5103 4751 4102 2276 2231 2113 1344 1265 1215 646 508 191 14305 43903 1504 999 385 25637 3834
NM_017848chrX91872 1038 1026 1018 938 924 911 888 134 --13111 --
NM_017925chr951567 1222 763 753 743 --31344 1330 737 1728
NM_018017chr1052669 2657 2163 262 169 22103 497 22378 211 1823
NM_018036chr1474320 4121 3471 2920 643 615 589 13224 44129 3570 1220 336 24184 661
NM_018155chr363278 3256 2310 2221 2176 2156 22347 1314 32390 1249 552 11080
NM_018181chr1861746 1731 1277 1270 1251 246 11442 31342 370 201 --
NM_018227chr442765 2553 944 272 23188 312 1260 13144
NM_018247chr682651 2339 2161 1181 1044 368 362 303 2494 404 --12924
NM_018287chr103830 821 459 --1836 11228
NM_018351chr1284680 3888 3055 2941 2904 879 504 296 ----183
NM_018364chr193997 3920 3892 3414 1626 1620 610 407 184 11544 11504 --
NM_018429chr562812 2464 1865 737 638 366 1331 11989 12359
NM_018557chr21671 236 28 31267 186 59 --
NM_018638chr1284614 4544 4439 4318 3991 2258 1652 1342 11888 35220 1280 282 --
NM_018640chr1282566 776 412 372 353 341 255 157 11009 22572 292 1944
NM_018718chr762111 2025 1748 597 274 117 ----21633 1425
NM_018976chr12102881 2599 2452 1964 1122 1110 1047 949 819 190 --42784 2567 2417 2026 --
NM_018979chr1242396 2114 817 806 12338 --1850
NM_019072chr531663 939 654 33965 3821 2629 43879 3063 297 143 --
NM_019114chr961989 1750 1604 493 287 69 --21634 945 1361
NM_020122chr2106057 5950 5551 2303 2221 2170 1954 740 546 317 11143 25529 122 --
NM_020245chr634354 3965 3462 13335 34952 3861 3440 24441 1354
NM_020337chr492996 2117 2077 1136 465 450 378 220 211 ----12972
NM_020342chr282607 2163 1607 1042 701 660 404 72 --2653 598 --
NM_020357chr351452 1383 1185 1177 433 --21191 1155 --
NM_020651chr231749 1617 397 ----21401 322
NM_020673chr2097538 6282 6137 5207 4907 2826 1910 1545 431 --46745 5826 1691 270 11052
NM_020727chr2163983 3859 3287 3187 1459 269 23280 1304 --1574
NM_020734chr12123195 2969 2779 2703 2343 2285 1120 1096 740 448 391 273 12719 22751 1306 12672
NM_020772chr17137818 7775 7389 7212 6759 6651 6457 3225 3134 2131 1825 1452 1334 23195 1926 37799 6104 1308 32938 2256 872
NM_020774chr1896214 6074 5330 4554 2159 1961 1213 1112 181 14748 25980 5203 --
NM_020809chr1122202 660 12278 --32155 2062 82
NM_020841chr1283849 3443 2820 2648 1231 688 323 278 23398 3138 13536 --
NM_020844chr887427 6986 6941 6707 5961 2176 1853 306 --12777 12633
NM_020856chr191589 1454 1598 31465 239 144
NM_020935chr284650 4053 3995 3756 3315 515 285 277 14656 24544 3621 --
NM_020940chr10102586 2578 2563 2338 1982 1079 776 549 395 42 --11974 1176
NM_020951chr19132392 1801 878 831 750 735 717 686 675 666 649 283 135 --12448 1455
NM_021005chr1541133 1088 1041 920 --1902 1260
NM_021007chr2112225 2069 826 810 798 790 782 529 481 122 67 ----1536
NM_021061chr844115 3653 1402 809 24525 1804 2641 473 1580
NM_021072chr552478 2369 945 512 322 22573 2362 1921 1759
NM_021148chr742106 1834 1749 330 --153 1141
NM_021629chr385009 4496 4373 1676 441 433 321 256 11482 2358 283 13881
NM_021911chr565005 4004 3432 3424 1832 1284 25611 3959 24519 1388 --
NM_021912chr1583337 2804 1034 753 409 228 188 176 --2992 132 --
NM_021961chr11187470 7371 7232 7115 6876 6263 6190 5374 5247 5241 4873 2833 2697 1208 1198 892 782 33 26887 6572 15572 --
NM_021964chr3144967 4800 4707 4603 4478 2592 1990 1981 1845 1403 998 887 861 346 172 15143 --
NM_022114chr194734 4253 4113 3893 1877 1847 1719 1557 1412 --14663 1677
NM_022351chr883842 3732 2716 1481 1474 1125 668 100 33791 2636 1519 11336 --
NM_022456chr12137674 7552 7315 6950 6123 4745 4739 2420 1460 1315 1240 1118 287 --37690 7308 7204 --
NM_022459chr1386383 4789 2419 2382 1946 1901 844 138 ----21567 788
NM_022893chr263081 2595 2305 844 372 273 11042 32433 1210 341 --
NM_024345chr996094 5722 4851 4672 4404 4266 2137 1138 351 ----1713
NM_024408chr163263 2624 2522 1055 868 693 12977 33688 3649 3053 13091
NM_024511chr4103255 3197 3162 2621 2260 1353 1022 736 633 488 2980 63 ----
NM_024665chr364678 4196 3149 1084 147 40 --1419 24516 2884
NM_024744chr262693 2619 1997 395 381 372 11844 1389 1204
NM_024881chr1973797 3602 3106 2825 1531 947 345 12459 12724 11487
NM_024947chr399364 9124 8222 7471 3711 2908 1825 1671 538 59339 9219 6577 3675 3002 68595 6985 2991 1846 1742 1373 --
NM_024989chr2148151 7973 7940 7478 6649 6574 6436 6423 5719 5360 2687 2665 2348 1290 27965 975 27495 5053 --
NM_025090chr178981 375 298 273 131 120 82 76 3260 231 114 --11456
NM_025134chr1662461 2379 1676 1665 1592 972 --32469 957 294 12257
NM_030647chr776225 6173 1739 1713 1214 592 97 21385 789 25908 1182 16306
NM_030664chr1062162 2062 1702 1604 990 838 ----22248 673
NM_030755chr1473074 2241 1178 659 511 456 256 12997 11024 12130
NM_031243chr732230 1497 463 135 --2607 524
NM_031371chr161265 1133 1084 360 345 226 --11165 31102 1048 484
NM_031371chr161265 1133 1084 360 345 226 --11165 31102 1048 484
NM_031435chr1273467 3320 1262 972 741 425 237 ----12925
NM_031461chr821595 758 --2877 315 165
NM_032102chr1163097 3014 2592 2386 566 115 21073 874 --23000 507
NM_032116chr13155795 5612 5334 4955 4448 4374 4154 3891 3737 1962 1384 807 772 420 389 14277 55005 4695 4404 3940 2171 14342
NM_032121chrX92624 2555 2506 1844 812 471 462 154 97 --189 12448
NM_032228chr1183308 2919 2739 2577 2208 1244 1092 883 32528 1020 70 ----
NM_032410chr8----21217 1029 2277 252
NM_032457chr483235 3166 3021 2758 2542 1476 936 831 139 --12550
NM_032505chr352732 2537 2459 2038 1832 21744 747 32134 1970 493 12217
NM_032833chr172105 2073 1766 935 793 755 552 --22654 521 12546
NM_032859chr1353896 3610 1269 523 29 13645 13528 11411
NM_032968chrX124216 4070 3934 3501 3109 2957 2804 1388 567 342 195 40 42798 1637 1603 654 54176 3179 1415 872 627 13260
NM_032969chrX124216 4070 3934 3501 3109 2957 2804 1388 567 342 195 40 42798 1637 1603 654 54176 3179 1415 872 627 13260
NM_032973chrY114208 4062 3926 3497 3104 2952 2799 567 342 195 40 32793 1602 654 54168 3174 1415 872 627 13255
NM_033020chr184785 4072 4036 4008 3800 3292 1045 313 24688 946 33753 1812 1509 --
NM_033181chr693688 3588 3414 3267 1507 1092 958 914 451 13757 13768 23276 2970
NM_033224chr777472 6570 6485 6067 1800 1639 1259 27485 7435 48079 2379 2080 1873 --
NM_033285chr8124409 4007 3136 3056 1775 1073 561 445 360 168 61 51 13991 23828 2842 13866
NM_033290chrX52382 2294 548 213 174 13612 1387 11121
NM_033427chr76612 339 331 323 315 308 ------
NM_033430chr4113951 3871 3583 3259 1678 1600 1104 502 350 289 82 24094 3755 23592 190 12563
NM_033437chr4113951 3871 3583 3259 1678 1600 1104 502 350 289 82 24094 3755 23592 190 12563
NM_033642chrX4938 913 883 447 1920 31234 959 811 1845
NM_052811chr13115274 5147 5135 5028 4308 4272 1568 1249 535 296 247 ------
NM_052885chr1264671 4611 4104 4073 944 859 2377 246 14843 11294
NM_080546chr9122295 2274 1595 836 778 123 117 107 101 95 85 70 1420 --12284
NM_080737chrX71505 1285 1269 133 107 99 91 21384 252 ----
NM_080867chr1413732 34900 4721 4043 33077 356 244 14976
NM_130831chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130832chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130833chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130834chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130835chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130836chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_130837chr382814 2597 2577 2380 2184 2045 1157 141 --42897 733 467 434 --
NM_138270chrX52871 2706 2656 2519 584 192 22341 2321 22894 651
NM_138473chr1255059 3476 3454 3387 2061 25014 1729 33360 1828 1377 11031
NM_138713chr16117256 7079 6850 6838 6125 5851 2883 1971 1290 1259 560 15348 28245 8092 27149 6948
NM_138714chr16117256 7079 6850 6838 6125 5851 2883 1971 1290 1259 560 15348 28245 8092 27149 6948
NM_138731chr1474157 4079 4054 3478 684 515 493 32770 571 71 13181 --
NM_138771chr731328 1142 289 --1596 21039 278
NM_139182chr431461 226 161 2238 62 2408 46 1339
NM_144571chr4116982 6946 6455 6006 4333 2578 2520 2128 1534 1354 254 12466 46398 5312 2432 2318 25094 2286
NM_144578chr1464713 4646 1034 699 179 50 --14873 13488
NM_144599chr1595516 4136 2122 1253 1133 1019 862 705 444 2778 467 14244 15341
NM_144767chr1574490 4440 1633 1625 1619 1096 419 24511 690 ----
NM_145259chr267034 6837 6630 6086 5147 2547 15033 24311 2753 12804
NM_145307chr1054570 3584 2847 1612 1460 21278 79 14656 13747
NM_147175chrX51989 1840 1705 866 173 --22057 1831 12173
NM_148174chr852172 1989 866 632 358 1459 1557 1537
NM_152374chr1141095 563 471 427 410 400 350 326 302 265 198 141 113 37 21706 166 ----
NM_152388chr2123885 3750 3722 3430 3156 2846 2720 546 278 158 87 79 --22907 951 --
NM_152409chr533495 2377 197 13032 32577 659 499 12564
NM_152624chr5117423 5994 5865 5507 2886 1667 1575 1384 1062 853 281 32896 2635 1289 --1844
NM_152737chr661972 1770 1627 1547 1354 406 11949 --22036 206
NM_152754chr763846 3834 3319 2752 1179 1143 2798 332 164 --
NM_152756chr544295 3265 2969 1641 --54211 1372 1245 1188 258 24289 4148
NM_152774chr792673 2643 2635 2260 2209 2000 1056 756 728 ----1951
NM_152838chr2063117 2819 2625 547 497 189 12668 53229 2588 2393 2298 512 --
NM_152999chr744832 958 793 682 24869 1257 15016 44215 3443 1208 549
NM_153188chr5105637 4799 4767 4750 3800 3700 1728 1675 1146 985 25192 1155 14496 25651 5370
NM_153207chr12114072 3868 3337 3284 2933 1172 1048 893 588 547 215 33877 2864 1032 --12839
NM_153235chr682354 2272 2160 1840 548 498 482 467 ------
NM_153262chr1123211 3129 3057 2770 2463 2457 2418 2408 2249 1238 790 183 ------
NM_153607chr542635 789 745 608 2994 986 1448 2797 645
NM_170606chr731555 1446 659 21786 1689 21660 1617 11401
NM_170665chr1293994 3975 3551 1393 1108 1098 1006 986 403 11260 11164 1296
NM_172071chr187262 7253 5690 5611 2476 1995 1801 380 35843 2711 406 12109 46540 5950 415 354
NM_172103chr652721 2200 980 863 678 21083 454 --2900 487
NM_172105chr652721 2200 980 863 678 21083 454 --2900 487
NM_173214chr16117256 7079 6850 6838 6125 5851 2883 1971 1290 1259 560 15348 28245 8092 27149 6948
NM_173468chr4105994 5468 5014 4844 2212 2204 1969 1851 897 277 1932 36006 5296 4675 14358
NM_173531chr1973188 3172 2606 2501 2372 615 587 32953 2378 1192 1934 --
NM_173582chr1196273 6147 6037 4726 2190 2035 922 621 78 22220 2099 36079 2307 351 --
NM_173602chr1253798 3549 3157 2317 293 23692 3682 1610 21490 678
NM_173642chr189025 8067 8018 7197 6927 5850 3211 1427 21760 1641 33162 3106 926 1957
NM_175623chr12137674 7552 7315 6950 6123 4745 4739 2420 1460 1315 1240 1118 287 --37690 7308 7204 --
NM_175624chr12137769 7647 7410 7045 6218 4840 4834 2515 1555 1410 1335 1213 382 --37785 7403 7299 --
NM_175625chr12137769 7647 7410 7045 6218 4840 4834 2515 1555 1410 1335 1213 382 --37785 7403 7299 --
NM_175854chr1392778 2741 2647 2108 1907 1878 812 700 541 --2346 285 --
NM_178151chrX107854 7210 6581 2940 2818 2635 2554 1790 826 386 27874 7733 26632 5506 --
NM_178152chrX107854 7210 6581 2940 2818 2635 2554 1790 826 386 27874 7733 26632 5506 --
NM_178153chrX107854 7210 6581 2940 2818 2635 2554 1790 826 386 27874 7733 26632 5506 --
NM_181358chr1124213 3949 3167 3042 2806 2710 2673 1457 1420 1371 1338 398 --31360 1112 1077 24156 2753
NM_181443chr2042333 2233 928 499 12896 11089 1915
NM_181481chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_181482chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_181483chr1876171 5071 4995 1839 639 557 506 --36678 5895 1345 14731
NM_181504chr5144181 3953 3887 3873 3859 3841 3793 3484 3254 3155 3035 3027 753 583 1186 ----
NM_181521chr16127263 7051 5935 5128 4814 4617 2383 2297 1340 1176 865 301 11453 37216 5794 5693 --
NM_181523chr5144181 3953 3887 3873 3859 3841 3793 3484 3254 3155 3035 3027 753 583 1186 ----
NM_181524chr5144181 3953 3887 3873 3859 3841 3793 3484 3254 3155 3035 3027 753 583 1186 ----
NM_182485chr4103400 3275 2698 2675 2667 2447 924 755 473 242 1622 12812 12965
NM_182493chr16105317 5124 4942 4576 4096 2027 1875 1474 1428 457 --35353 4385 2019 --
NM_182646chr4103400 3275 2698 2675 2667 2447 924 755 473 242 1622 12812 12965
NM_182765chr1042330 2178 1835 647 32283 1990 1759 21871 774 1793
NM_182767chr1262100 1922 1586 1580 646 552 11857 11302 1656
NM_182898chr7106432 6326 6302 5921 5632 4704 4168 3994 3984 283 16231 12103 --
NM_182899chr7106432 6326 6302 5921 5632 4704 4168 3994 3984 283 16231 12103 --
NM_182907chr661543 1506 898 287 271 220 1503 1723 --
NM_182920chr361122 189 137 122 103 84 1128 1115 1446
NM_182948chr153006 2904 1953 1219 709 11202 12030 12493
NM_182972chr162193 2034 1953 804 646 153 1126 2339 60 11946
NM_194282chr472149 2124 1941 1114 974 467 328 12003 --1339
NM_194314chr195635 5616 5378 4443 4017 2049 1787 1451 968 45508 4897 1457 1146 15343 --
NM_194434chr18125685 5577 4989 3969 3532 1663 1579 1536 1441 882 627 112 14204 25699 204 --
NM_198128chr1892242 2026 1981 933 910 891 821 527 92 ----11437
NM_198268chr1124213 3949 3167 3042 2806 2710 2673 1457 1420 1371 1338 398 --31360 1112 1077 24156 2753
NM_198269chr1124213 3949 3167 3042 2806 2710 2673 1457 1420 1371 1338 398 --31360 1112 1077 24156 2753
NM_198273chr553098 3028 2349 2009 1218 --12428 23053 2304
NM_198400chr1582709 2394 2196 2186 2060 1079 943 887 1297 1339 --
NM_198581chr2147530 7265 6369 6357 5899 5307 5011 1889 1555 1281 1129 1108 825 756 13023 47084 6916 1142 609 1563
NM_198793chr373309 3265 3182 2563 1310 1069 59 --11272 21518 557
NM_199324chr463431 2734 2605 2516 1108 458 33701 3458 1413 42659 1038 983 643 --
NM_199421chr1413732 34900 4721 4043 33077 356 244 14976
NM_199436chr242628 2376 610 320 --1314 11176
NM_199454chr194734 4253 4113 3893 1877 1847 1719 1557 1412 --14663 1677
NM_199462chr1114996 4910 4786 4511 4065 3789 1348 1021 1010 995 321 35033 1849 247 23195 3086 --
NM_201570chr1061716 1302 766 556 549 125 11807 --149
NM_201571chr1061716 1302 766 556 549 125 11807 --149
NM_201572chr1061716 1302 766 556 549 125 11807 --149
NM_201590chr1061716 1302 766 556 549 125 11807 --149
NM_201593chr1061716 1302 766 556 549 125 11807 --149
NM_201596chr1061716 1302 766 556 549 125 11807 --149
NM_201597chr1061716 1302 766 556 549 125 11807 --149
NM_203372chr261611 1598 1518 1251 361 177 31482 511 324 21604 526 --
NM_203390chr841794 754 643 317 1390 --1651
NM_203406chr532822 1018 879 --21814 679 22940 548
NM_206594chr1103507 3282 3181 3157 3133 3060 2421 2361 2255 1162 13626 23567 3492 13544
NM_206595chr1103507 3282 3181 3157 3133 3060 2421 2361 2255 1162 13626 23567 3492 13544
NM_206853chr6104097 3800 3777 2923 2897 2573 1633 1625 1250 207 23988 1318 --13070
NM_206854chr6115358 5061 5038 4184 4158 3834 3681 3569 1468 450 307 25249 3399 2718 129 24331 398
NM_206855chr6166323 6026 6003 5149 5123 4799 4646 4534 3859 3851 2433 1415 1272 721 696 428 26214 4364 31683 1094 220 35296 1363 359
NM_206907chr563308 2786 1301 1234 820 215 12759 22308 1349 --
NM_206909chr898384 8209 8049 7672 6307 2170 2155 1026 958 36268 3219 2933 38135 5242 136 18244
NM_207406chr496261 5790 5285 5194 4784 4388 1533 1469 391 25549 4256 35462 2551 905 11011
NM_213589chr2125316 3788 3507 1903 667 515 404 199 187 177 142 130 13977 33481 1163 426 13939
NM_213590chr13115274 5147 5135 5028 4308 4272 1568 1249 535 296 247 ------