TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-let-7b-5p
miRNA Sequence: UGAGGUAGUAGGUUGUGUGGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr1--1587 ----
NM_000037chr842410 877 807 566 --1237 --
NM_000038chr552003 1854 1807 1499 689 --12071 --
NM_000052chrX63474 2347 2279 1088 967 65 --1749 11117
NM_000053chr1341597 573 200 38 1465 21548 205 12037
NM_000061chrX----130 --
NM_000074chrX2896 90 --1794 --
NM_000081chr141853 1294 1234 531 11799 11869 --
NM_000084chrX66763 6161 6079 1666 1437 1092 56719 5791 4586 2501 1841 45376 5361 5219 4812 36769 4217 2396
NM_000089chr71117 ------
NM_000092chr234017 1183 735 23576 358 ----
NM_000103chr1521130 130 --11283 21113 352
NM_000108chr771677 1566 1451 1391 1183 250 227 --1764 --
NM_000109chrX31805 823 800 12669 --11941
NM_000110chr121043 447 ------
NM_000111chr7----1286 --
NM_000125chr662702 1595 1147 726 373 336 --23747 688 --
NM_000134chr411420 11785 --2577 428
NM_000138chr1532358 1957 1889 2551 510 1223 --
NM_000142chr43567 370 196 --11382 --
NM_000161chr1431848 1536 187 21839 333 21477 614 --
NM_000163chr552195 2091 1883 1833 719 22252 1618 ----
NM_000165chr621303 414 ------
NM_000168chr732702 859 764 11101 23297 779 --
NM_000202chrX43602 3312 570 304 11323 12690 --
NM_000208chr1964373 4324 1380 1336 1320 1104 ------
NM_000210chr212080 ------
NM_000212chr174845 598 533 274 1342 1539 --
NM_000217chr1285039 4582 4440 3344 3283 1693 1269 1140 ------
NM_000222chr421459 340 11823 ----
NM_000232chr463003 2527 1130 976 669 416 11147 22373 1135 12400
NM_000233chr25651 640 605 138 59 ----1786
NM_000245chr732201 2172 58 ------
NM_000248chr33489 203 69 --22660 2380 --
NM_000253chr42240 104 1823 ----
NM_000259chr1586036 5482 5031 4902 4027 1344 1314 111 16179 ----
NM_000264chr913106 ------
NM_000267chr1773473 2649 2350 2293 371 211 185 ------
NM_000276chrX31708 859 378 --21851 1810 --
NM_000282chr131212 ------
NM_000284chrX51841 1528 1449 523 27 ------
NM_000293chr16--1629 ----
NM_000297chr422058 1619 1650 ----
NM_000314chr1073254 3013 2912 2904 2104 1041 224 13203 ----
NM_000319chr121948 ----1135
NM_000321chr1341313 1220 447 342 1692 ----
NM_000332chr686708 5468 5041 2599 1654 1376 1111 285 35732 5005 1186 1439 1450
NM_000337chr576579 6342 4961 4917 1459 796 695 35606 4798 1951 55811 5273 4838 1298 603 --
NM_000345chr421047 116 ------
NM_000346chr1771960 1826 1610 1503 1291 734 364 ------
NM_000362chr2263211 2616 1368 1288 775 749 12791 22905 829 13026
NM_000367chr631823 1514 295 --1456 1483
NM_000368chr984169 3792 3759 3123 3052 1416 228 185 11057 1726 --
NM_000390chrX43181 2076 1261 61 12601 13049 --
NM_000391chr1181661 1492 1444 1340 429 251 205 123 1692 11609 --
NM_000393chr241716 1677 1517 668 --11762 --
NM_000408chr252294 1351 1330 482 107 --1543 12599
NM_000430chr1731124 773 360 ------
NM_000441chr752202 1985 1587 605 297 ----11570
NM_000449chr131310 229 147 --2992 166 --
NM_000452chr1322071 1757 11605 --21401 701
NM_000458chr174714 221 127 21 ------
NM_000459chr93873 347 78 ------
NM_000461chr343418 1678 1524 1476 43190 1422 1123 770 31467 1310 1189 --
NM_000462chr152464 164 --11759 --
NM_000480chr1161518 1393 1317 463 418 109 ------
NM_000484chr211368 --1198 --
NM_000488chr1----173 --
NM_000489chrX33263 3009 2558 --13302 --
NM_000492chr731463 402 96 21012 229 --2534 104
NM_000495chrX1801 21086 171 ----
NM_000503chr82476 145 ----21624 613
NM_000525chr1141498 1427 1028 422 ----11532
NM_000531chrX1341 1275 ----
NM_000533chrX51785 1242 544 346 189 ------
NM_000555chrX75688 5510 5291 4820 2697 2049 64 --35499 2762 841 15026
NM_000572chr13781 135 113 1146 ----
NM_000575chr23912 862 411 ------
NM_000586chr4194 ------
NM_000596chr72474 115 ------
NM_000599chr233236 619 124 13212 11154 --
NM_000601chr71409 ------
NM_000610chr1142216 2041 1919 683 ------
NM_000612chr1143585 3438 3167 2938 --13484 --
NM_000615chr1142888 2246 1036 784 ------
NM_000618chr12116355 6103 5854 5809 5659 5079 4149 2567 2155 1312 67 26280 1271 1294 35405 5204 1318
NM_000618chr12116355 6103 5854 5809 5659 5079 4149 2567 2155 1312 67 26280 1271 1294 35405 5204 1318
NM_000633chr1885039 4908 4140 3394 1970 1914 988 558 1782 ----
NM_000684chr1011104 --21245 1056 --
NM_000685chr33818 644 96 ------
NM_000685chr33818 644 96 ------
NM_000686chrX31257 1201 38 1249 ----
NM_000693chr152661 218 11519 --1725
NM_000701chr1--176 ----
NM_000702chr122224 1645 ------
NM_000719chr1256413 4174 2504 2031 1746 173 --15940
NM_000723chr1731632 482 202 --11402 --
NM_000724chr1062030 1813 1634 1442 1431 457 11643 ----
NM_000726chr221327 408 ------
NM_000788chr431359 552 361 144 --1560
NM_000800chr551629 1197 1071 379 264 11313 ----
NM_000806chr531882 1544 90 1708 ----
NM_000810chr15299 37 ------
NM_000813chr525363 1403 21307 116 ----
NM_000814chr1563936 3838 3317 1114 643 60 21667 515 --13994
NM_000817chr22318 236 ------
NM_000826chr422013 405 12437 ----
NM_000827chr542164 1846 625 435 --11696 --
NM_000829chr1132274 2137 2050 ------
NM_000831chr1105898 5524 5263 5028 4026 3860 2286 261 145 116 15393 35781 5110 1259 --
NM_000838chr642752 1682 1012 155 ------
NM_000839chr31473 ------
NM_000840chr71105 ------
NM_000842chr111710 ----1154
NM_000844chr32425 351 ------
NM_000859chr521529 677 1514 ----
NM_000861chr332185 1766 634 1859 22234 1821 --
NM_000865chr6----1196 --
NM_000868chrX32499 1792 961 ------
NM_000872chr101122 --11413 --
NM_000875chr1576465 6261 6021 4357 1420 581 501 1105 26667 856 12626
NM_000880chr83811 301 60 ------
NM_000885chr24855 755 656 351 1370 ----
NM_000891chr1773480 3264 2981 2827 785 705 372 1685 --13291
NM_000901chr441975 1952 1770 865 --1537 --
NM_000902chr342894 2511 2384 2100 --22666 696 --
NM_000914chr6----1405 --
NM_000944chr451981 1874 926 758 100 1644 11691 --
NM_000945chr231605 1480 785 1588 1656 --
NM_000950chrX53374 3202 3134 735 349 11011 23342 1164 32878 2380 516
NM_000963chr141875 1703 1535 515 22445 1570 1903 --
NM_000965chr341269 452 177 38 --11056 --
NM_000983chr121426 79 --11166 --
NM_000990chr1132982 1485 38 --23192 2504 1542
NM_001001132chr212576 132 2180 170 ----
NM_001001323chr1232355 1069 901 1598 1240 --
NM_001001389chr1142216 2041 1919 683 ------
NM_001001390chr1142216 2041 1919 683 ------
NM_001001391chr1142216 2041 1919 683 ------
NM_001001392chr1142262 2087 1965 729 ------
NM_001001394chr22679 579 ------
NM_001001481chr843145 2607 2228 924 --1122 --
NM_001001484chr105859 582 320 174 92 ------
NM_001001522chr112371 95 ----174
NM_001001556chr1521074 31 ------
NM_001001557chr83763 617 185 --1874 12101
NM_001001664chr264143 3921 3673 2852 507 468 ----1415
NM_001001665chr253390 3172 2734 804 473 ------
NM_001001701chr431846 1759 623 1777 11492 --
NM_001001890chr2193651 3206 3109 2835 2810 2771 1723 1520 1378 11389 13683 --
NM_001001924chr841769 1480 1426 187 11695 ----
NM_001001925chr841769 1480 1426 187 11695 ----
NM_001001928chr2298047 7756 7613 6683 6198 5786 3289 1727 177 37033 6905 1410 27481 5653 --
NM_001001931chr841769 1480 1426 187 11695 ----
NM_001001933chr11403 ------
NM_001001971chr1021247 967 --21317 508 --
NM_001001974chr1032325 864 24 32257 2152 221 2115 29 --
NM_001001995chrX21389 146 ------
NM_001002032chr171543 1708 ----
NM_001002762chr1062587 2385 2136 1123 1009 464 --32337 1031 50 --
NM_001002814chr863940 3778 3742 3668 669 398 23297 1553 --13178
NM_001002838chrX71896 1878 1716 1672 1592 520 385 ----1699
NM_001002843chr1531192 376 131 ------
NM_001002860chr1454548 1427 1227 1004 397 14317 ----
NM_001002909chr1731921 1837 1814 --12108 --
NM_001002919chr2174 ------
NM_001003407chr1055041 4028 3486 1872 1662 1260 ----
NM_001003408chr1055041 4028 3486 1872 1662 1260 ----
NM_001003652chr18138650 8635 7641 7300 3489 3252 2708 2272 2220 1828 1344 1000 552 13308 13215 --
NM_001003674chr1886931 2689 2634 2519 2512 1957 1135 589 45696 4930 4855 1048 26923 5466 12525
NM_001003675chr1886931 2689 2634 2519 2512 1957 1135 589 45696 4930 4855 1048 26923 5466 12525
NM_001003681chr2251975 1759 413 279 174 ------
NM_001003698chr631965 1360 231 158 ----
NM_001003699chr631965 1360 231 158 ----
NM_001003712chr1273872 3436 3359 2957 2932 1549 306 1974 ----
NM_001003792chr31435 1144 ----
NM_001003793chr31435 1144 ----
NM_001003800chr943396 2505 1274 1136 13511 ----
NM_001003810chr41582 ------
NM_001003940chr1573154 2943 2516 1233 1170 1026 563 --13740 --
NM_001003942chr1573154 2943 2516 1233 1170 1026 563 --13740 --
NM_001003943chr1573158 2947 2520 1237 1174 1030 567 --13744 --
NM_001004023chr11173 ------
NM_001004125chr92780 112 --1237 --
NM_001004196chr33494 200 42 1349 ----
NM_001004317chr653418 3226 661 587 488 44283 1715 647 513 24098 1636 151
NM_001004323chr7144 ------
NM_001004342chr1176050 5072 5029 5017 4930 4798 4502 4190 3890 2208 1868 1841 1650 1610 1233 605 453 14575 34617 1990 806 11706
NM_001004354chr92989 56 --2781 71 --
NM_001004360chr22691 432 ------
NM_001004419chr1273695 3262 635 563 551 264 240 ------
NM_001004722chr2----1151 --
NM_001005207chr171225 ------
NM_001005266chr15--1105 ----
NM_001005267chr15--1105 ----
NM_001005268chr15--1105 ----
NM_001005269chr15--1105 ----
NM_001005353chr12491 181 ------
NM_001005353chr12491 181 ------
NM_001005366chr121899 ------
NM_001005375chrY31834 1305 104 1552 ----
NM_001005386chr242284 2230 702 691 42479 1697 1656 504 ----
NM_001005404chr1774284 4211 3593 3358 2796 755 331 43999 2782 723 527 --14070
NM_001005463chr1062355 2186 2028 1647 444 395 11769 1190 --
NM_001005473chr575439 5421 5413 4940 4685 1472 64 11558 36302 5460 220 --
NM_001005609chrX53557 3000 2444 1131 918 22460 1461 1851 13541
NM_001005611chrX1488 --1211 --
NM_001005746chr221327 408 ------
NM_001005747chr221327 408 ------
NM_001005781chr22591 520 ------
NM_001005782chr221040 969 1362 ----
NM_001005845chr8--11794 --2762 111
NM_001005849chr171406 ------
NM_001006118chrY184 ----1244
NM_001006120chrY184 ----1244
NM_001006600chr532146 2096 441 --1376 --
NM_001006612chrX2126 90 ------
NM_001006613chrX2126 90 ------
NM_001006614chrX2126 90 ------
NM_001006623chr252038 1962 1033 723 136 --1242 --
NM_001006636chr2176 ------
NM_001006684chrX1586 ------
NM_001006938chrX2787 47 ------
NM_001006945chr13470 216 201 151 ----
NM_001006946chr281826 1305 1291 1207 767 564 191 55 ------
NM_001007027chr11162 ------
NM_001007097chr91320 1944 --11762
NM_001007098chr13824 127 71 2881 87 1241 --
NM_001007156chr1541668 1553 1492 257 11828 1670 --
NM_001007226chr1731134 1108 299 11310 11347 --
NM_001007227chr1731134 1108 299 11310 11347 --
NM_001007228chr1731134 1108 299 11310 11347 --
NM_001007229chr1731134 1108 299 11310 11347 --
NM_001007230chr1731134 1108 299 11310 11347 --
NM_001007237chr132149 1931 716 --1166 --
NM_001007246chr2111438 11742 11270 11771
NM_001007257chr1--1291 1974 --
NM_001007269chr19------1222
NM_001007270chr19------1222
NM_001007277chr11131 --158 --
NM_001007471chr91547 1856 ----
NM_001007526chrY184 ----1244
NM_001007527chr51228 1609 ----
NM_001007553chr13410 392 75 --1379 --
NM_001007794chr11517 ------
NM_001008222chrX1557 ------
NM_001008239chr1863380 3127 2423 562 404 296 12394 21190 1015 --
NM_001008391chr11--1275 1151 --
NM_001008392chr353222 2817 2637 140 63 --13326 --
NM_001008393chr472867 2857 2742 2607 856 219 47 1738 12759 --
NM_001008401chr1921502 538 ------
NM_001008405chr711164 1625 ----
NM_001008408chr744696 4640 4076 2198 14679 26225 1271 11722
NM_001008410chr222154 1858 12173 1431 12087
NM_001008495chr832237 365 43 --1617 --
NM_001008539chr833868 1267 452 ----13817
NM_001008566chr224452 366 323 173 --1188 --
NM_001008660chr1151575 1544 1080 351 64 ------
NM_001008711chr821462 1091 --131 --
NM_001008723chr10--1540 ----
NM_001008738chr542460 2405 1796 772 --22805 2049 11915
NM_001008777chr17162 --2482 229 --
NM_001008783chr62905 226 ------
NM_001008801chr1921681 1436 ----11573
NM_001008895chr1311303 ------
NM_001009554chr483801 3554 3146 2971 1252 910 773 149 44487 3928 550 278 ----
NM_001009554chr483801 3554 3146 2971 1252 910 773 149 44487 3928 550 278 ----
NM_001009555chr431775 1697 1435 ------
NM_001009881chr11623 181 ----
NM_001009882chr11623 181 ----
NM_001009899chr376111 5248 5235 2377 2342 1830 461 --34837 2060 1574 11441
NM_001009923chr201576 ------
NM_001009955chr1----1156 --
NM_001009955chr1----1156 --
NM_001009958chr73558 183 78 --1408 --
NM_001009960chr722835 2581 1294 1377 --
NM_001009993chr273747 3212 3080 1795 797 333 219 ------
NM_001010000chr18----11413 12806
NM_001010853chr642981 2971 1041 114 23128 158 2755 594 1621
NM_001010861chr122498 145 22715 803 ----
NM_001010867chr185655 4882 4869 1727 1694 713 359 154 --35871 2601 2067 25251 2094
NM_001010877chr62166 129 --140 --
NM_001010888chrX94099 4010 3795 3322 3262 1863 1250 1223 1013 --1476 14573
NM_001010891chr566687 6502 2283 1529 444 270 11511 46421 2747 2584 1189 15194
NM_001010895chr91165 1729 ----
NM_001010908chr101137 ------
NM_001010922chr194224 4095 4005 3378 3353 3255 3192 2719 244 33311 2868 1714 11155 23767 597
NM_001010927chr61507 1450 ----
NM_001010932chr71409 ------
NM_001010934chr73927 269 225 1293 ----
NM_001010942chr1211162 ------
NM_001010986chrX52247 2214 2136 560 348 ------
NM_001010989chr162419 74 ------
NM_001010990chr162419 74 ------
NM_001011515chr43952 712 39 ------
NM_001011516chr43952 712 39 ------
NM_001011537chr311897 190 ----
NM_001011551chrX2432 377 ------
NM_001011553chr72859 220 ------
NM_001011666chr765586 4123 2406 1716 1034 498 --24443 1570 36030 1625 1325
NM_001011708chr242901 2828 2790 2311 1281 12803 --
NM_001011713chr142630 115 1495 21501 1434 --
NM_001012264chr143704 665 178 ------
NM_001012337chr3--151 ----
NM_001012393chr1165107 4160 3965 3546 1011 807 1858 1266 11953
NM_001012398chr164914 335 187 81 ------
NM_001012420chr1532695 1167 925 22325 89 ----
NM_001012423chr1542695 1167 925 88 12325 ----
NM_001012751chr1051866 1581 1192 526 143 --11575 --
NM_001012754chr1351890 1797 1583 799 622 12044 ----
NM_001012755chrX64752 4442 1579 804 521 70 13156 23402 481 11296
NM_001012756chr1942205 575 264 218 1992 --22449 2423
NM_001012761chr532732 2128 398 --21765 472 --
NM_001012977chrX21336 451 --1280 --
NM_001013031chr1083502 3491 2785 2401 1324 1099 1080 681 13328 23199 2978 --
NM_001013438chr3--1106 1747 --
NM_001013439chr3----1593 --
NM_001013615chr13931 797 165 ------
NM_001013620chr1297972 7926 7270 7222 5690 2708 1958 1515 1038 58039 7628 7574 5753 244 57871 3072 1599 1254 999 36417 5981 2937
NM_001013635chr123938 400 366 --2891 24 --
NM_001013690chr1242458 1571 576 342 11970 11804 32498 2423 2246
NM_001013693chr162092 902 785 615 392 231 --11828 --
NM_001013693chr162092 902 785 615 392 231 --11828 --
NM_001013843chr152360 68 ------
NM_001014283chr131735 1682 11858 11435
NM_001014286chr13171 ------
NM_001014380chr1355835 5820 4890 544 382 --43683 2358 2332 846 25150 579
NM_001014435chr162564 424 --1239 --
NM_001014449chr161239 ------
NM_001014451chr161239 ------
NM_001014797chr1087863 7509 6288 2845 2785 1961 1630 285 ------
NM_001015508chr81189 ----1555
NM_001015877chrX62041 2010 1209 1147 1018 136 12855 ----
NM_001015880chr1041547 1279 1159 45 1510 ----
NM_001015881chrX147 ------
NM_001015887chr321267 617 ------
NM_001017369chr42166 142 ------
NM_001017371chr2------11346
NM_001017395chr3103278 2950 2853 2635 2484 2412 2327 1406 395 73 13059 12452 --
NM_001017396chr251466 1436 1373 877 465 1816 --11632
NM_001017405chr41686 ------
NM_001017424chr13597 456 371 ------
NM_001017425chr13597 456 371 ------
NM_001017440chr7157212 6527 6408 6269 5580 2313 1937 1925 1912 1637 1471 1263 1068 1057 616 27969 5273 35114 2348 1483 --
NM_001017916chr1711536 11465 --11617
NM_001017917chr1711536 11465 --11617
NM_001017923chr1411609 21317 282 31696 1663 620 21615 444
NM_001017963chr143938 122 25 1171 ----
NM_001017969chr91266 ------
NM_001017992chr531040 561 457 ------
NM_001017995chr5144591 3791 3674 3210 3169 3045 1775 1426 1024 876 793 658 259 135 23914 3176 1645 --
NM_001017999chr131833 1564 832 ------
NM_001017999chr131833 1564 832 ------
NM_001018000chr131833 1564 832 ------
NM_001018000chr131833 1564 832 ------
NM_001018001chr131833 1564 832 ------
NM_001018056chr91122 ----1196
NM_001018064chr94729 440 207 164 ------
NM_001018089chr1553573 3496 1030 658 507 23594 2484 2664 561 1895
NM_001018100chr151808 ------
NM_001018108chr1532147 1616 580 --31927 1838 1505 12186
NM_001020658chr111454 ------
NM_001020658chr111454 ------
NM_001023567chr1532082 954 184 189 ----
NM_001023587chr32952 806 --1469 --
NM_001024226chr11987 --193 --
NM_001024227chr11987 --193 --
NM_001024228chr11987 --193 --
NM_001024380chr832474 1614 178 ----11638
NM_001024381chr832474 1614 178 ----11638
NM_001024401chr1612879 12330 11875 --
NM_001024463chr152800 39 ------
NM_001024596chr19103605 3522 3409 2876 2856 2766 694 687 584 259 1931 22984 2445 33145 3011 542
NM_001024649chr542476 2151 1043 887 22433 1915 11880 --
NM_001024680chr231726 1277 1162 ------
NM_001024688chr862179 2067 1589 760 549 323 --11951 2801 54
NM_001024847chr351851 815 788 601 368 --12519 --
NM_001024947chr52190 145 1847 --1897
NM_001024948chr162972 2921 2167 915 521 274 1342 12637 --
NM_001025068chr351713 1624 1590 590 161 --11416 --
NM_001025069chr351713 1624 1590 590 161 --11416 --
NM_001025076chr10135253 4914 4207 2153 1966 1841 1656 1647 1567 1456 1105 727 661 --24841 460 --
NM_001025077chr10136611 6272 5565 3014 3005 2925 2814 2463 2085 2019 424 277 199 --26199 1818 1886
NM_001025079chr353442 3215 1593 1253 366 --11122 --
NM_001025105chr51579 ----1958
NM_001025233chr1252698 1816 899 323 241 --11709 11049
NM_001025252chr872873 2731 2630 2056 1107 1053 475 ------
NM_001025253chr872873 2731 2630 2056 1107 1053 475 ------
NM_001025266chr384917 4018 3870 3684 3289 1484 546 52 --43799 1666 1339 536 23826 1693
NM_001025366chr61399 ------
NM_001025366chr61399 ------
NM_001025367chr61399 ------
NM_001025367chr61399 ------
NM_001025368chr61399 ------
NM_001025368chr61399 ------
NM_001025369chr61415 ------
NM_001025369chr61415 ------
NM_001025370chr61399 ------
NM_001025370chr61399 ------
NM_001025389chr1161518 1393 1317 463 418 109 ------
NM_001025390chr1161518 1393 1317 463 418 109 ------
NM_001025580chrX64299 4084 4013 3856 3666 3476 --3799 389 82 1739
NM_001025595chr431648 1613 558 ------
NM_001025603chr131310 229 147 --2992 166 --
NM_001025777chr21395 2387 205 ----
NM_001025780chr921252 637 --1999 11026
NM_001029839chr331295 594 279 1499 ----
NM_001029840chr331295 594 279 1499 ----
NM_001029858chr662364 2149 995 867 617 546 --12129 11305
NM_001029863chr692856 2839 2507 2099 1133 806 645 103 76 32457 2317 150 ----
NM_001029875chr532331 2217 665 12044 22025 135 --
NM_001029955chr421100 665 13459 1854 --
NM_001029989chr152796 362 --1690 --
NM_001030007chr1642859 1005 528 221 12705 ----
NM_001030055chr1473446 3207 2918 1508 872 577 565 183 ----
NM_001031623chr631702 673 471 --1444 --
NM_001031695chr2255020 4863 3931 3715 203 21059 161 11732 15416
NM_001031711chr53526 203 52 --1165 --
NM_001031716chr231141 321 47 ------
NM_001031723chr4123 ------
NM_001031740chr161582 1192 1107 1065 259 177 ----1265
NM_001031803chr171326 --1291 --
NM_001031804chr1643467 2998 2914 905 23802 1097 13164 --
NM_001031812chr521760 1452 21532 137 ----
NM_001032221chr92485 95 21731 557 ----
NM_001032280chr6--1466 ----
NM_001032296chr1332798 2720 1961 2807 689 --12427
NM_001032730chr12658 547 ------
NM_001032999chr2075355 5278 4737 1604 1447 919 686 --44999 4742 1320 230 21475 426
NM_001033044chr111660 --21201 596 --
NM_001033045chr231779 1624 1385 14377 24149 3659 1627
NM_001033047chr421931 1680 22020 1648 ----
NM_001033056chr111660 --21201 596 --
NM_001033057chr321312 84 ------
NM_001033059chr631605 1419 455 ----1509
NM_001033081chr11279 1539 11501 --
NM_001033082chr11279 1539 11501 --
NM_001033085chr21119 ------
NM_001033117chr353807 3167 1475 1424 487 24105 520 --14810
NM_001033503chr51407 ------
NM_001033506chr112328 47 ------
NM_001033521chr201157 ------
NM_001033522chr201157 ------
NM_001033551chr1783810 3717 2981 2961 2883 2626 1391 383 --12888 1945
NM_001033578chr841927 847 765 382 1101 ----
NM_001033723chr862606 2542 2514 1052 800 334 ------
NM_001033756chr61333 ------
NM_001033756chr61333 ------
NM_001034025chr123961 176 154 --159 --
NM_001034841chr1654641 3632 3528 1565 869 --24646 4129 --
NM_001034954chr1042375 2239 806 333 22396 2246 12761 --
NM_001034955chr1042375 2239 806 333 22396 2246 12761 --
NM_001034956chr1042375 2239 806 333 22396 2246 12761 --
NM_001034957chr1042375 2239 806 333 22396 2246 12761 --
NM_001035260chr1041263 477 343 321 ------
NM_001035511chr172116 1852 1741 1728 1473 1442 313 --22132 1868 --
NM_001035512chr182223 1959 1848 1835 1580 1549 420 75 --22239 1975 --
NM_001035513chr182223 1959 1848 1835 1580 1549 420 75 --22239 1975 --
NM_001035521chr24819 693 629 523 --1129 --
NM_001037132chr741670 1404 679 610 ------
NM_001037133chr741670 1404 679 610 ------
NM_001037164chr741917 1614 1318 326 --1606 --
NM_001037165chr7118851 8147 7382 6199 5437 2248 2201 1127 1047 662 166 ----27093 5786
NM_001037174chr2155 1479 22046 1500 --
NM_001037317chr122498 145 22715 803 ----
NM_001037334chr1851777 908 598 371 322 ------
NM_001037535chrX41360 1013 439 112 --1166 --
NM_001037536chrX41360 1013 439 112 --1166 --
NM_001037540chrX41360 1013 439 112 --1166 --
NM_001037582chr41292 1150 11328 2621 316
NM_001037872chr2----1527 --
NM_001038640chr1511000 ------
NM_001038707chr151768 709 569 529 123 22077 139 22239 438 --
NM_001038707chr151768 709 569 529 123 22077 139 22239 438 --
NM_001039111chr3------1179
NM_001039199chr20124737 4389 4082 3635 3214 3198 1958 1040 959 943 841 402 14941 --11535
NM_001039348chr21258 157 ----
NM_001039349chr21258 157 ----
NM_001039395chr942011 1854 1714 1703 22354 1790 ----
NM_001039479chr1431520 467 420 1167 1569 --
NM_001039538chr252924 2586 840 815 296 22842 1153 --13470
NM_001039547chr397627 7209 7160 6777 5829 5810 3079 733 612 26958 209 12981 12726
NM_001039570chr2244243 4110 3848 3366 1665 44128 4071 3948 112 --
NM_001039571chr2244243 4110 3848 3366 1665 44128 4071 3948 112 --
NM_001039580chr464537 4236 3558 3537 3279 1975 13152 11288 2683 193
NM_001039590chrX33509 1087 755 --13405 1378
NM_001039591chrX33509 1087 755 --13405 1378
NM_001039618chr1174815 4499 4455 1900 773 478 339 55262 5006 4245 4184 70 15027 --
NM_001039649chr131278 ------
NM_001039709chr2075355 5278 4737 1604 1447 919 686 --44999 4742 1320 230 21475 426
NM_001039711chr12359 106 ----1244
NM_001039712chr12359 106 ----1244
NM_001039762chr10------11980
NM_001039771chr1441168 997 297 245 --2944 879 --
NM_001039840chrX95564 5251 3870 2357 1690 568 372 319 31 46060 4597 1958 806 15998 14641
NM_001039938chr1341527 1513 1402 1355 ------
NM_001039960chr1241725 1065 620 511 143 --11573
NM_001040020chr741497 1093 1080 500 11172 ----
NM_001040057chr721028 470 11285 1511 --
NM_001040110chr731598 1329 1309 --1573 21868 40
NM_001040135chr71781 ------
NM_001040142chr242401 2300 2250 619 ------
NM_001040143chr242401 2300 2250 619 ------
NM_001040152chr744337 3723 1467 860 33409 916 56 ----
NM_001040153chr13159 ------
NM_001040159chr41568 ------
NM_001040179chr64883 663 634 44 ------
NM_001040214chr621577 453 ------
NM_001040260chr421087 190 ------
NM_001040261chr421087 190 ------
NM_001040284chr1685414 5199 5058 4399 3973 2070 1437 1287 --14688 --
NM_001040402chr432898 2325 1146 12683 ----
NM_001040429chr1362893 2723 2202 566 405 305 11234 ----
NM_001040432chr3------1136
NM_001040441chr144258 318 291 59 --11181 --
NM_001040446chr552585 2109 959 879 732 22725 1058 12042 --
NM_001040450chr1542816 2302 2186 555 --2891 875 --
NM_001040451chr51458 --1349 --
NM_001040452chr51458 --1349 --
NM_001040453chr1542816 2302 2186 555 --2891 875 --
NM_001040458chr541909 1811 631 32 1264 ----
NM_001040665chr7124954 4807 3953 3496 3490 3366 3313 3057 1854 1482 1365 806 1657 74584 4576 4336 3845 2017 1822 763 --
NM_001040666chr72656 509 --3286 278 38 --
NM_001040697chr114526 99 63 36 ------
NM_001040709chr152234 895 814 798 561 12264 22485 879 12223
NM_001040712chr963526 3463 3015 2828 1139 115 1260 --12274
NM_001040876chr451653 1454 1221 374 259 ----11829
NM_001042403chr124790 384 234 180 1220 ----
NM_001042404chr121248 31 ------
NM_001042413chr993812 2978 2851 1626 928 794 748 357 283 ----1414
NM_001042414chr13265 24 ------
NM_001042424chr452233 1223 1205 760 56 --1744 12846
NM_001042425chr6--1466 ----
NM_001042453chrX41162 633 472 297 ------
NM_001042454chr161358 ------
NM_001042465chr102702 53 ------
NM_001042466chr102702 53 ------
NM_001042478chr1122 ------
NM_001042481chr1422501 976 11912 --12187
NM_001042486chr2021090 333 11519 --11567
NM_001042492chr1773473 2649 2350 2293 371 211 185 ------
NM_001042493chr652041 1972 1274 387 228 21522 181 ----
NM_001042494chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_001042495chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_001042496chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_001042497chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_001042506chrX1451 --1280 --
NM_001042510chr821586 543 21874 1818 ----
NM_001042511chr821586 543 21874 1818 ----
NM_001042517chr131983 1929 ----
NM_001042533chr3112848 2816 2601 2387 1296 1259 1084 896 495 424 99 ------
NM_001042537chrX82477 1963 1873 1712 1548 466 318 68 --11829 --
NM_001042539chr162778 728 ------
NM_001042555chr1263508 3371 3188 3030 1156 310 23155 3076 13550 --
NM_001042599chr2197821 7157 7103 6368 6136 5411 4992 4786 2655 2293 2159 1339 1057 911 792 413 403 289 155 17774 --15257
NM_001042601chr32188 137 22677 2066 --12447
NM_001042603chr12145368 5021 4655 3967 3937 3611 3504 3446 3388 3330 1965 1086 854 472 14822 ----
NM_001042604chr353987 1725 1010 868 541 31783 1629 226 23172 47 --
NM_001042635chr14147 ------
NM_001042749chrX31737 1354 1263 ------
NM_001042750chrX31737 1354 1263 ------
NM_001042751chrX31737 1354 1263 ------
NM_001043351chr12452 295 --2782 172 21644 1507
NM_001044305chr61347 21499 1338 1618 --
NM_001044385chr253871 3580 3353 1509 584 33009 940 295 ----
NM_001044722chr521760 1452 21532 137 ----
NM_001044723chr521760 1452 21532 137 ----
NM_001046chr552291 2265 750 664 262 2199 40 11889 --
NM_001048183chr163715 3483 3353 545 368 333 13706 33430 3021 488 12704
NM_001071775chr1321706 1482 ------
NM_001076chr41122 ------
NM_001076chr41122 ------
NM_001083620chr422011 404 12435 ----
NM_001092chr1772345 1903 1809 777 664 503 228 ------
NM_001095chr1241936 1854 1626 305 1431 41202 274 170 71 --
NM_001099678chr3135686 5552 5189 4483 4273 1966 1856 1795 1709 1485 1177 1069 287 --35570 2473 2066 15013
NM_001100108chr1187032 6833 6813 6772 6438 6349 6045 6021 3057 2760 1560 1093 767 753 590 581 410 302 22993 127 ----
NM_001106chr3138995 7263 6058 3835 3175 2898 2621 2153 1475 832 458 419 123 38486 7362 1462 68876 7989 7291 1105 727 505 --
NM_001107chr141142 ------
NM_001109977chr44697 604 543 96 ------
NM_001113490chrX83654 3126 2703 2231 1206 1022 200 148 13239 21284 1171 --
NM_001116chr1632518 1950 1886 22549 2370 21235 215 --
NM_001117chr182828 456 ------
NM_001121chr1021809 273 1288 ----
NM_001126chr11775 ------
NM_001128chr1642859 1005 528 221 12705 ----
NM_001140chr171219 ------
NM_001144chr1631347 1008 303 --127 1331
NM_001146chr821580 190 ------
NM_001149chr1011031 1296 1553 --
NM_001153chr21281 187 1125 --
NM_001156chr102590 533 ------
NM_001160chr1232304 255 183 2941 383 1659 31120 984 686
NM_001167chrX96355 5846 4188 1809 1484 1445 1223 957 837 11965 35851 5594 4849 --
NM_001172chr142260 101 ----1746
NM_001173chr1473446 3207 2918 1508 872 577 565 183 ----
NM_001177chr1232348 1548 476 174 11853 --
NM_001186chr2142166 2086 537 193 22668 841 --12288
NM_001191chr2021024 299 ----1952
NM_001198chr632367 1594 329 --12254 --
NM_001200chr202950 908 1958 ----
NM_001201chr441518 1442 952 859 43899 3238 1386 364 --12918
NM_001204chr256264 1765 1730 1416 665 25950 5924 23119 1270 --
NM_001206chr952779 2346 2135 2081 491 --11975 --
NM_001217chr19198 ------
NM_001219chr722280 577 ------
NM_001222chr101569 --21502 1305 --
NM_001233chr72425 44 11949 ----
NM_001237chr411192 ------
NM_001237chr411192 ------
NM_001241chr232369 1728 280 1403 11712 --
NM_001241chr232369 1728 280 1403 11712 --
NM_001256chr1742120 1016 741 545 22677 530 ----
NM_001257chr1621181 284 1166 1559 --
NM_001259chr7185803 5211 5088 4839 4630 4580 4224 4173 2199 2081 1988 1904 1652 1444 1336 1316 1095 100 35343 4567 860 26245 1125 --
NM_001260chr13----1240 --
NM_001270chr52463 126 ------
NM_001273chr12----1436 --
NM_001277chr112904 826 ------
NM_001284chr51523 ------
NM_001304chr1762549 1386 972 776 583 21 11016 23508 640 --
NM_001310chr1262252 1960 1139 981 97 78 ------
NM_001315chr63894 460 87 ------
NM_001324chr201157 ------
NM_001329chr1021334 1234 ------
NM_001331chr1182718 2699 2209 2061 1129 1066 973 144 --21763 116 --
NM_001332chr511038 ------
NM_001343chr541390 317 154 146 --1284 --
NM_001346chr352707 2450 2248 722 399 --12015 --
NM_001351chr321813 1279 --11660 --
NM_001356chrX31570 870 75 ------
NM_001364chr11124298 4064 4004 3888 3589 3094 3008 1871 1438 1213 929 70 --13136 --
NM_001378chr21497 ------
NM_001385chr81434 ------
NM_001386chr822120 395 ------
NM_001387chr532708 2590 2496 22762 1941 1809 --
NM_001395chrX1730 1133 1191 --
NM_001396chr2141866 1750 1730 648 --11911 --
NM_001397chr132304 2006 981 --32282 2102 722 2967 579
NM_001399chrX53557 3000 2444 1131 918 22460 1461 1851 13541
NM_001407chr33639 230 131 --11503 --
NM_001412chrX43614 3170 2781 405 --12842 --
NM_001415chrX31497 1235 704 1117 11331 1401
NM_001417chr1221904 123 --21787 397 --
NM_001418chr111692 --1485 --
NM_001418chr111692 --1485 --
NM_001419chr1953184 3005 1235 1100 1022 11321 --13627
NM_001429chr2221092 309 ------
NM_001430chr231905 212 122 ------
NM_001431chr62954 312 --1978 --
NM_001438chr193311 2380 2356 1392 1331 1212 351 329 190 22905 1419 ----
NM_001448chrX21426 1163 1659 ----
NM_001449chrX31137 1116 359 21252 369 ----
NM_001451chr161968 ------
NM_001465chr582181 1882 1711 1646 814 516 446 280 ----11321
NM_001482chr15--1688 1309 --
NM_001494chr10--1660 1722 --
NM_001498chr63952 384 56 ------
NM_001518chr74347 146 126 102 11109 1354 --
NM_001521chr24819 693 629 523 --1129 --
NM_001527chr664587 3985 3201 1762 875 99 34283 3942 3263 --13011
NM_001530chr143841 146 50 ------
NM_001542chr132149 1931 716 --1166 --
NM_001543chr554205 3779 3439 1566 658 --34120 1824 564 12939
NM_001553chr42166 59 ------
NM_001554chr12661 479 ------
NM_001584chr1111018 ------
NM_001587chrX31708 859 378 --21851 1810 --
NM_001613chr101111 ------
NM_001616chr273316 2863 2802 2626 2347 1163 885 23257 595 ----
NM_001621chr752333 946 933 709 566 2551 467 ----
NM_001621chr752333 946 933 709 566 2551 467 ----
NM_001634chr631605 1419 455 ----1509
NM_001647chr32140 41 ------
NM_001649chrX42366 2193 1992 888 ------
NM_001650chr1843691 2995 551 260 --1508 --
NM_001655chr1131918 761 297 --1306 1466
NM_001656chr521517 427 ------
NM_001658chr11987 --193 --
NM_001659chr1292203 2178 2159 2074 1813 1066 822 782 143 --1152 12216
NM_001660chr31234 ------
NM_001661chr172606 198 --1268 --
NM_001663chr1421096 995 ------
NM_001664chr33354 333 102 1789 ----
NM_001668chr14897 635 486 162 ------
NM_001677chr12401 316 ------
NM_001682chr1232069 783 615 1312 ----
NM_001690chr312541 11787 22566 1825 1733
NM_001693chr83328 289 196 --1972 --
NM_001695chr833686 3456 525 23520 151 13303 11413
NM_001699chr1951822 1721 523 396 123 --11456 --
NM_001701chr91553 ----11288
NM_001704chr6297 80 ------
NM_001707chr72679 192 --3701 575 35 --
NM_001722chr82496 47 1522 1552 --
NM_001730chr1321125 315 ------
NM_001730chr1321125 315 ------
NM_001731chr121185 ------
NM_001742chr741392 1213 1203 345 ------
NM_001746chr542476 2151 1043 887 22433 1915 11880 --
NM_001753chr771546 1506 1430 1380 560 368 232 ------
NM_001754chr2193651 3206 3109 2835 2810 2771 1723 1520 1378 11389 13683 --
NM_001755chr1641895 772 451 293 --12132 --
NM_001759chr12115202 4715 4506 4299 3502 3432 3279 1596 1259 751 629 34919 2056 1989 33870 3491 3475 13786
NM_001761chr1621108 571 ----21793 1349
NM_001777chr353442 3215 1593 1253 366 --11122 --
NM_001788chr72859 220 ------
NM_001789chr311671 11476 2558 142 --
NM_001797chr162569 183 ------
NM_001802chr1641018 889 793 290 1111 ----
NM_001806chr1932231 1805 723 --12864 --
NM_001830chrX43646 2905 1573 969 11597 ----
NM_001839chr11567 --1162 --
NM_001845chr131171 21400 94 141 --
NM_001846chr131680 155 ----
NM_001851chr63147 121 96 ------
NM_001854chr131549 1140 43 ------
NM_001855chr9--1150 1701 --
NM_001858chr665012 4702 3754 3387 540 496 15019 --15161
NM_001859chr921359 1092 --33392 2520 1167 --
NM_001861chr161124 ------
NM_001863chr191108 ------
NM_001873chr43631 216 33 ------
NM_001892chr51579 ----1958
NM_001893chr171358 ------
NM_001895chr203767 414 238 --21098 994 --
NM_001901chr62985 388 ------
NM_001903chr5--1797 1201 --
NM_001915chr1711536 11465 --11617
NM_001918chr1119126 6545 6409 3126 2207 1792 1756 1428 1271 766 465 28919 3574 25963 1081 --
NM_001920chr121661 --1652 --
NM_001924chr1156 ------
NM_001935chr21129 2197 61 ----
NM_001938chr121546 1209 11601 ----
NM_001939chrX83401 2915 1541 1472 1450 578 321 261 22503 541 13511 --
NM_001945chr511259 --142 --
NM_001946chr122937 813 ------
NM_001949chr61783 12109 22125 90 --
NM_001951chr8--1148 133 --
NM_001956chr12600 85 ------
NM_001964chr521035 222 ------
NM_001966chr321538 183 31301 479 24 ----
NM_001968chr42317 167 ------
NM_001969chr1432414 1143 513 11193 ----
NM_001977chr431179 501 280 1229 ----
NM_001981chr182137 1550 862 704 510 314 271 83 --11575 --
NM_001995chr441357 1084 375 173 --1358 --
NM_002009chr1552169 1980 823 521 358 1736 ----
NM_002010chr132435 204 1407 ----
NM_002015chr1353132 2348 969 831 476 135 --12293
NM_002017chr111177 1865 ----
NM_002024chrX31585 834 229 1199 11378 --
NM_002025chrX159094 8730 7880 6601 6255 5820 5785 3534 3189 2737 2516 2334 1532 1124 1023 27400 2285 2913 45 --
NM_002028chr1441309 1107 860 501 --21268 507 --
NM_002031chr61219 1652 ----
NM_002035chr1883999 3956 3057 2823 1603 1428 1353 903 13812 ----
NM_002039chr41369 1327 ----
NM_002040chr2142848 954 347 66 42972 2500 2301 808 ----
NM_002044chr1521074 31 ------
NM_002056chr22776 171 1355 ----
NM_002061chr151870 1394 164 80 24 11529 ----
NM_002062chr631266 1058 186 21671 1095 ----
NM_002065chr111660 --21201 596 --
NM_002069chr73680 633 384 ------
NM_002071chr182567 45 --1144 --
NM_002077chr931607 1514 621 --21782 425 --
NM_002086chr1741660 797 527 197 --21874 76 --
NM_002089chr42611 234 ------
NM_002090chr41159 1491 ----
NM_002092chr441523 1364 1001 678 24263 1416 24397 4048 14637
NM_002094chr16------161
NM_002095chr8189 ------
NM_002106chr4184 127 ----
NM_002112chr15--138 ----
NM_002126chr1773191 3147 3130 795 758 632 370 33573 1325 1212 42796 2695 1006 340 --
NM_002130chr531082 324 263 11134 ----
NM_002131chr621059 822 --1966 --
NM_002137chr71686 2212 115 ----
NM_002138chr41582 ------
NM_002140chr91779 ------
NM_002141chr72276 37 ------
NM_002146chr1731411 1175 200 1391 ----
NM_002156chr2122 ------
NM_002158chr252963 2820 1082 780 431 33303 3118 697 12393 --
NM_002188chr51748 ----1574
NM_002196chr201946 ------
NM_002196chr201946 ------
NM_002202chr51711 ------
NM_002203chr5113946 3467 3364 3334 2986 2856 2629 1515 679 546 440 ------
NM_002207chr31301 ------
NM_002210chr283430 2592 2575 2184 1169 1136 308 290 ------
NM_002214chr744823 4770 4164 877 11923 21612 1248 55263 4963 4904 1275 953
NM_002223chr1233483 612 46 --11351 13766
NM_002228chr13957 800 501 ------
NM_002232chr121007 62 ------
NM_002234chr122788 740 ------
NM_002235chr123385 318 125 11608 --11659
NM_002240chr211160 ------
NM_002246chr23887 391 80 ------
NM_002247chr1022237 904 21621 948 11993 --
NM_002250chr19130 ------
NM_002252chr21109 ------
NM_002254chr262391 1960 1908 894 865 148 --1332 --
NM_002264chr353765 3332 1293 507 423 34881 1712 462 14794 14753
NM_002265chr172482 301 ------
NM_002266chr171209 ------
NM_002267chr1332092 801 107 ----2644 609
NM_002268chr311704 11521 ----
NM_002269chr61401 ------
NM_002270chr5114549 4540 4061 3971 3504 2182 1614 1396 1202 966 696 34268 3783 814 ----
NM_002293chr112022 12486 --1235
NM_002294chrX158 ------
NM_002312chr1311056 ----1939
NM_002313chr1055041 4028 3486 1872 1662 1260 ----
NM_002334chr114795 636 175 24 ------
NM_002336chr1295010 3547 3430 3402 1554 1305 1054 734 697 --43520 743 682 28 --
NM_002355chr122494 162 ------
NM_002356chr662823 2566 2387 2363 1941 261 21910 683 --11757
NM_002360chr752641 2470 2364 2140 574 --1937 --
NM_002374chr252924 2586 840 815 296 22842 1153 --13470
NM_002375chr372325 2269 2240 1805 1548 717 551 --21998 620 --
NM_002382chr1431005 846 448 ------
NM_002384chr18----1956 --
NM_002390chr1761815 1717 1431 1332 688 397 --11975 --
NM_002395chr651462 1190 453 383 232 ------
NM_002399chr1511356 11237 ----
NM_002401chr1742291 976 623 593 21992 1539 1642 --
NM_002444chrX21877 1432 --2573 267 --
NM_002445chr841545 1332 1148 207 21556 474 --11605
NM_002449chr531254 1198 957 1370 ----
NM_002479chr1----2207 63 --
NM_002481chr1117628 7375 6289 5458 2635 2467 1677 1558 1525 850 319 --23003 1939 1975
NM_002485chr862179 2067 1589 760 549 323 --11951 2801 54
NM_002499chr1542354 1762 407 171 12076 12007 --
NM_002500chr23419 412 152 ------
NM_002505chr631506 501 304 11435 ----
NM_002506chr1159 ------
NM_002508chr1152 ------
NM_002514chr811189 ------
NM_002515chr1441994 1474 1270 438 --21846 1429 --
NM_002519chr112618 430 ------
NM_002522chr1733565 3044 2756 23757 378 ----
NM_002524chr12932 902 --2192 130 --
NM_002537chr152886 280 --1916 --
NM_002545chr1165107 4160 3965 3546 1011 807 1858 1266 11953
NM_002546chr8--1751 ----
NM_002547chrX123918 3773 3331 3236 2975 2646 1648 945 456 417 304 191 --23679 1448 --
NM_002553chr7168 ------
NM_002572chr111393 ------
NM_002576chr113873 836 795 --31209 1183 1095 --
NM_002577chr353190 3099 3026 801 630 22872 2599 1890 --
NM_002581chr985087 4902 4652 4272 929 843 801 131 35327 2192 2169 1603 24330 3499
NM_002591chr204581 476 221 22 --1615 --
NM_002594chr2012191 ------
NM_002595chr121775 ------
NM_002607chr741254 1244 1180 849 ------
NM_002613chr1674975 4560 3715 3650 1707 1694 737 --11495 --
NM_002616chr171570 --1167 --
NM_002628chr341046 219 100 21 ------
NM_002641chrX11900 21839 659 1122 --
NM_002643chr21165 ------
NM_002645chr1173091 3022 2737 2154 2001 1220 772 ------
NM_002646chr192172 2146 1631 1358 803 678 632 558 263 --11477 11504
NM_002648chr651100 845 524 501 493 --1169 --
NM_002649chr751308 1236 1124 306 133 ------
NM_002655chr873207 1668 1426 1285 758 197 79 --1358 --
NM_002670chr311238 31305 240 46 ----
NM_002687chr14291 67 ------
NM_002709chr253587 3339 827 521 430 22945 50 13532 --
NM_002711chr72611 302 ------
NM_002713chr111041 --1270 --
NM_002714chr62829 718 2899 760 ----
NM_002716chr1183568 2284 1095 995 859 755 719 395 ----12258
NM_002718chr351855 1847 566 540 329 2947 193 ----
NM_002719chr1441703 1680 1511 69 --1748 --
NM_002731chr153178 3078 2736 235 95 11173 --12175
NM_002734chr175697 687 619 505 79 --21745 759 --
NM_002740chr332801 2178 447 12005 12320 --
NM_002745chr2283503 1825 1658 1600 1458 1309 532 441 24558 250 --1948
NM_002748chr152909 785 ----1494
NM_002750chr101196 ------
NM_002752chr52542 427 ------
NM_002753chr43608 540 145 ------
NM_002776chr1941250 777 520 198 --1410 --
NM_002778chr102702 53 ------
NM_002811chr161523 --1129 --
NM_002815chr17198 ------
NM_002822chr1231514 334 268 ------
NM_002828chr181341 ----11001
NM_002829chr921232 1159 ----1844
NM_002834chr1221243 981 --32762 1147 138 --
NM_002835chr72270 145 1119 ----
NM_002836chr202488 132 ------
NM_002837chr1284359 3591 3154 2925 2837 947 801 376 ----13951
NM_002839chr963526 3463 3015 2828 1139 115 1260 --12274
NM_002840chr121538 1394 ------
NM_002841chr32247 216 ------
NM_002843chr1132907 2686 411 23196 2167 12132 --
NM_002847chr731566 1511 1502 ------
NM_002849chr123857 816 292 ------
NM_002851chr72715 656 ------
NM_002858chr131014 351 260 ------
NM_002863chr141110 ------
NM_002868chr1242260 2230 1842 246 11623 22242 127 --
NM_002869chr1151703 434 378 372 135 1306 ----
NM_002871chr181976 1673 1637 1510 410 257 186 91 ------
NM_002874chr952177 1847 1739 938 388 1760 ----
NM_002886chr321331 781 35205 5023 1759 1159 11990
NM_002890chr55967 919 888 301 188 ------
NM_002892chr1411222 11685 ----
NM_002906chr1151919 1732 1628 708 235 1637 ----
NM_002907chr122332 137 ------
NM_002912chr62388 303 ------
NM_002918chr191760 --11118 --
NM_002922chr11647 ------
NM_002940chr451653 1454 1221 374 259 ----11829
NM_002945chr173772 720 258 ------
NM_002955chr631965 1360 231 158 ----
NM_002959chr174466 4169 3855 3092 1263 1010 49 --13047 --
NM_002971chr31346 ------
NM_002977chr242972 2367 687 304 21306 1239 --12724
NM_002997chr281826 1305 1291 1207 767 564 191 55 ------
NM_002998chr842066 1494 687 606 ------
NM_002999chr2041325 706 128 113 1319 ----
NM_003001chr182223 1959 1848 1835 1580 1549 420 75 --22239 1975 --
NM_003002chr114675 234 48 40 ------
NM_003010chr1741883 1813 1796 1784 11802 ----
NM_003011chr961625 1197 1164 1049 468 176 ------
NM_003013chr46859 765 742 589 539 134 ------
NM_003016chr1721469 778 ------
NM_003017chr61566 142 ----
NM_003027chr151416 ------
NM_003032chr352551 2121 1930 1081 956 --1297 11838
NM_003042chr32391 82 --22053 99 11897
NM_003043chr343996 3620 1563 509 1605 11695 --
NM_003046chr833868 1267 452 ----13817
NM_003051chr141957 1944 1303 660 ------
NM_003060chr53467 351 210 11245 ----
NM_003069chrX1303 ------
NM_003074chr351909 1864 1674 672 135 --11869 --
NM_003076chr1241660 1522 78 60 --1183 21050 66
NM_003099chr1586519 5931 5028 2143 572 192 94 40 26041 4922 25989 949 1565
NM_003107chr652605 2582 2413 2224 2148 11830 ----
NM_003108chr2117040 6952 6565 6499 5751 5734 5701 5359 2588 862 825 24854 1316 11870 --
NM_003111chr2------11346
NM_003112chr712631 ------
NM_003113chr22756 50 ------
NM_003128chr282871 2603 1907 1067 1049 413 181 35 ------
NM_003130chr741261 1117 1038 535 ------
NM_003131chr631585 589 172 --32203 1504 177 --
NM_003140chrY135 ------
NM_003144chr651900 1491 399 280 110 ------
NM_003150chr1792386 2242 1921 1885 493 395 369 144 48 22306 1771 21722 136 --
NM_003155chr822028 1924 --1222 1880
NM_003156chr1141320 1241 1185 200 1450 1210 --
NM_003161chr1753513 1409 1389 1114 794 13387 23249 1140 --
NM_003173chrX61249 1190 1153 1088 358 131 --1106 --
NM_003174chr102677 283 ----1670
NM_003178chr342233 1763 268 172 ------
NM_003183chr2----1893 1642
NM_003185chr201354 ------
NM_003186chr112371 95 ----174
NM_003189chr163296 2644 2580 2573 643 385 --12078 --
NM_003199chr1875632 5293 5131 4508 4397 1169 437 --11379 --
NM_003201chr102937 259 ------
NM_003202chr531746 464 364 --2566 513 --
NM_003203chr242060 878 158 77 12341 21918 385 --
NM_003206chr61423 ------
NM_003215chr421092 496 --11282 --
NM_003216chr2273174 2888 2451 2061 964 51 32 --22497 374 11320
NM_003217chr1221893 1853 --11617 --
NM_003220chr6--1466 ----
NM_003221chr664114 4065 3414 3184 2743 604 13741 ----
NM_003222chr2041198 457 404 111 --1195 1117
NM_003234chr372344 2072 1906 1778 1699 1673 1558 1181 2271 236 --
NM_003236chr232903 1363 111 33538 2218 877 ----
NM_003238chr11233 ------
NM_003240chr11667 ------
NM_003242chr351851 815 788 601 368 --12519 --
NM_003243chr121307 1192 ------
NM_003246chr1541970 1831 303 268 21784 1524 --1159
NM_003247chr621271 424 11728 ----
NM_003250chr17146 1354 ----
NM_003253chr2151499 711 383 220 40 ------
NM_003257chr1531070 1009 83 --11050 --
NM_003262chr375182 3800 3633 3532 3452 2057 108 --24656 2024 24521 1607
NM_003269chr61303 --1297 --
NM_003281chr155194 4488 3867 3327 77 14732 21670 1059 11824
NM_003289chr91182 ------
NM_003298chr3136226 5864 5802 4791 4462 4267 3958 2185 2163 1628 1042 972 743 ------
NM_003304chr321012 417 ------
NM_003305chr42298 289 --1109 --
NM_003314chr51175 --1431 --
NM_003318chr61230 ------
NM_003320chr1174306 3357 1735 1285 166 76 54 --34099 4078 3267 --
NM_003334chrX2151 130 --1159 --
NM_003337chr541505 1447 604 51 ------
NM_003339chr551489 254 206 189 129 ------
NM_003340chr41132 ------
NM_003341chr32655 531 1585 ----
NM_003342chr1763104 2603 1280 915 579 573 12671 1990 12105
NM_003344chr711680 ------
NM_003347chr2221920 415 ----1249
NM_003348chr1221241 685 ------
NM_003350chr82863 787 ------
NM_003352chr221040 969 1362 ----
NM_003359chr4168 149 ----
NM_003373chr103515 493 449 1655 21946 1255 1753
NM_003374chr5----153 --
NM_003376chr61399 ------
NM_003376chr61399 ------
NM_003379chr62847 753 ------
NM_003383chr91122 ----1196
NM_003385chr23658 347 126 11039 ----
NM_003392chr321622 1164 31474 1408 1334 --11718
NM_003400chr21856 1250 ----
NM_003403chr144804 570 203 72 ------
NM_003404chr2021884 764 --11630 --
NM_003406chr881721 1693 1676 1479 1429 615 340 117 1739 --127
NM_003407chr19--1657 ----
NM_003409chr18--1444 ----
NM_003410chrX82283 2262 2065 2016 618 314 305 130 ------
NM_003412chr31418 33025 2876 991 11060 --
NM_003413chrX61897 1307 1296 1284 1229 239 ------
NM_003439chr752413 413 393 300 156 --1593 --
NM_003455chr111133 --1256 21471 263
NM_003458chr353777 3237 972 367 204 23991 908 --23702 2668
NM_003462chr141759 1595 1239 566 ----21336 412
NM_003463chr632490 2416 2169 23167 613 ----
NM_003468chr263159 1206 1028 300 220 88 34211 2830 1637 11381 --
NM_003469chr2125 ------
NM_003471chr321455 653 21591 489 1302 --
NM_003473chr103857 213 72 ------
NM_003474chr1042164 1458 175 48 ------
NM_003478chr1143016 2520 2199 124 1131 ----
NM_003482chr1242377 975 626 468 ----1681
NM_003483chr1222233 535 32547 1136 1113 22527 793 128
NM_003489chr21103442 3190 2969 2619 2271 1360 1163 727 643 340 ------
NM_003496chr72835 735 --180 --
NM_003506chr821271 947 ------
NM_003551chr53471 58 37 ------
NM_003557chr151582 1384 1314 284 96 21265 207 --1430
NM_003559chr1783221 3188 3104 1374 1024 887 311 291 --1857 --
NM_003563chr1731134 1108 299 11310 11347 --
NM_003566chr1263282 2636 2169 555 495 354 --12615 --
NM_003574chr18135737 5143 4856 4713 3881 2209 1840 1375 1009 482 453 372 67 24284 1831 ----
NM_003575chr711111 --2632 441 --
NM_003576chr1332798 2720 1961 2807 689 --12427
NM_003582chr11173 ------
NM_003583chr1231550 1474 959 33144 533 296 --13951
NM_003589chr1311303 ------
NM_003590chr211606 23654 3408 ----
NM_003595chr224452 366 323 173 --1188 --
NM_003603chr4--22109 1634 21803 223 --
NM_003613chr15--1270 ----
NM_003615chr374036 3953 3788 1029 968 821 288 ------
NM_003618chr2------11063
NM_003621chr11--1491 ----
NM_003629chr143468 2808 820 724 11175 ----
NM_003633chr512203 --174 --
NM_003635chr101412 ----1110
NM_003637chr11422 1182 21205 111 --
NM_003642chr21119 ------
NM_003660chr191269 ------
NM_003663chr363308 3248 2495 993 579 563 ------
NM_003672chr131316 631 102 1117 ----
NM_003681chr2165449 4902 4049 2421 1238 79 --24476 1406 --
NM_003688chrX1104 ------
NM_003692chr91691 ----1286
NM_003701chr131943 ------
NM_003702chr82843 525 ------
NM_003704chr43631 623 126 ------
NM_003714chr552642 2357 1140 920 257 11021 ----
NM_003718chr7----1451 --
NM_003728chr41222 ------
NM_003743chr242211 1758 614 560 189 21526 1520 --
NM_003749chr133811 802 734 22162 862 1183 1460
NM_003754chr11----1138 --
NM_003758chr1531121 371 262 1510 --1385
NM_003758chr1531121 371 262 1510 --1385
NM_003759chr473958 3672 3529 3007 2984 2709 433 169 23140 952 --
NM_003766chr171452 ------
NM_003768chr121816 1495 --1307 --
NM_003774chr1242980 2183 1025 832 22569 708 ----
NM_003779chr11423 ----122
NM_003787chr1861394 596 272 202 117 81 ------
NM_003794chr32848 81 ------
NM_003799chr1873800 3606 3562 2917 2903 716 257 13025 14361 13000
NM_003816chr8--11408 --1376
NM_003821chr8151 ------
NM_003822chr143034 2893 2067 2012 ----12545
NM_003825chr1531359 188 64 31211 416 276 ----
NM_003831chr1821415 1291 --1196 --
NM_003840chr831814 587 40 --11962 --
NM_003842chr83708 700 42 12079 11807 --
NM_003845chr12--177 ----
NM_003861chr1442869 2638 2507 2182 ------
NM_003872chr222739 23 ------
NM_003877chr123951 192 41 ------
NM_003884chr31666 11474 ----
NM_003885chr1742114 884 855 351 ------
NM_003888chr1521671 274 ------
NM_003895chr211500 ------
NM_003902chr11643 ------
NM_003913chr674358 3755 3242 3060 2664 1102 477 --12671 13546
NM_003916chrX61475 1277 968 595 535 226 11437 ----
NM_003921chr13617 295 165 11470 ----
NM_003927chr181985 ------
NM_003939chr1073803 3601 3300 2801 1488 626 243 11094 ----
NM_003941chr741718 621 360 54 1155 ----
NM_003947chr32402 302 11149 ----
NM_003955chr1741265 1146 1029 645 --1305 11442
NM_003958chr6153812 3783 3646 3539 3355 3276 3177 3096 2710 1144 714 507 422 328 236 13914 33877 2936 386 2446 251
NM_003971chr171246 ------
NM_003972chr101308 ------
NM_004006chrX31805 823 800 12669 --11941
NM_004007chrX31805 823 800 12669 --11941
NM_004009chrX31805 823 800 12669 --11941
NM_004010chrX31805 823 800 12669 --11941
NM_004011chrX31805 823 800 12669 --11941
NM_004012chrX31805 823 800 12669 --11941
NM_004013chrX31805 823 800 12669 --11941
NM_004014chrX31805 823 800 12669 --11941
NM_004015chrX31805 823 800 12669 --11941
NM_004016chrX31719 737 714 12583 --11855
NM_004017chrX31805 823 800 12669 --11941
NM_004018chrX31719 737 714 12583 --11855
NM_004019chrX--1369 --1435
NM_004020chrX31805 823 800 12669 --11941
NM_004021chrX31719 737 714 12583 --11855
NM_004022chrX31719 737 714 12583 --11855
NM_004023chrX31719 737 714 12583 --11855
NM_004028chr1843691 2995 551 260 --1508 --
NM_004034chr102590 533 ------
NM_004035chr1764947 4642 1542 1312 1288 542 21677 1220 24975 4391 14417
NM_004040chr221239 114 --1956 --
NM_004041chr112658 543 ------
NM_004052chr102790 42 ------
NM_004056chr81873 ------
NM_004067chr741471 573 506 230 ------
NM_004077chr1231247 1075 202 --31180 841 291 11063
NM_004081chrY31834 1305 104 1552 ----
NM_004089chrX147 ------
NM_004090chr1783307 3016 2817 2679 2510 2493 2394 1013 1753 ----
NM_004093chr1342010 401 163 57 --1774 --
NM_004096chr1041685 1606 556 376 1833 ----
NM_004098chr1021258 1047 ------
NM_004099chr931976 1385 424 --1705 1552
NM_004100chr642066 2028 413 73 ------
NM_004105chr21258 157 ----
NM_004109chr1152274 2251 768 311 38 22193 1562 11535 --
NM_004112chr17--11429 31654 458 451 11199
NM_004114chrX3475 140 42 ------
NM_004116chr22393 306 ----1120
NM_004124chr1442738 961 350 227 ------
NM_004134chr5----1609 --
NM_004136chr1552960 2672 2377 2135 23 33095 2289 113 12301 --
NM_004170chr91506 11397 ----
NM_004171chr11149662 9247 8957 8888 8458 6674 6511 6342 3438 2882 2480 1724 1037 649 13303 ----
NM_004186chr33589 294 223 --1660 1159
NM_004200chr1111069 12615 1760 12624
NM_004202chrY4616 564 546 62 ------
NM_004215chr82426 157 ------
NM_004225chr841381 1286 1207 258 1947 ----
NM_004232chr1842927 2461 1315 876 ----11482
NM_004235chr91626 ------
NM_004237chr5--2898 833 ----
NM_004253chr91949 1282 ----
NM_004255chr15263 45 ------
NM_004261chr12985 756 2360 38 ----
NM_004263chr241632 1554 1260 287 ----11789
NM_004272chr521729 230 ------
NM_004273chr1035047 3619 3333 14402 1922 11038
NM_004274chr1482925 2885 2819 2610 1298 1127 491 326 --22780 285 --
NM_004277chr611535 --190 --
NM_004279chr732383 2371 316 11998 ----
NM_004293chr963665 3643 3456 1180 219 95 22816 1449 13085 --
NM_004295chr174526 409 156 105 ------
NM_004301chr31340 1355 125 --
NM_004302chr1262859 2798 2711 720 651 199 --22170 83 --
NM_004304chr21284 ------
NM_004316chr1221095 828 1936 ----
NM_004323chr932290 186 76 --32317 2044 1983 --
NM_004326chr12266 166 ------
NM_004329chr101408 11094 1438 --
NM_004330chr1531203 1174 984 ------
NM_004338chr1886931 2689 2634 2519 2512 1957 1135 589 45696 4930 4855 1048 26923 5466 12525
NM_004342chr721697 200 11546 ----
NM_004349chr8--1130 ----
NM_004354chr43283 255 192 --1121 --
NM_004356chr112438 168 ------
NM_004359chr192528 423 133 --175
NM_004362chr41500 1184 ----
NM_004370chr622162 745 --11838 --
NM_004374chr8138 ------
NM_004380chr1622655 586 --11698 --
NM_004384chr521760 1452 21532 137 ----
NM_004385chr52260 234 ----1577
NM_004386chr1932289 1848 41 ------
NM_004391chr352021 1566 801 295 138 --31415 582 128 1609
NM_004392chr1311632 ------
NM_004393chr321952 514 --11703 11749
NM_004397chr1193704 3609 3459 3112 3035 1695 1265 884 185 14318 11417 --
NM_004411chr74750 273 262 207 ------
NM_004419chr104963 850 760 239 ------
NM_004423chr392604 2377 2138 2063 2006 1855 1693 594 529 12467 1199 22750 538
NM_004426chr122775 207 1251 ----
NM_004430chr841753 871 733 42 12535 ----
NM_004432chr94611 326 230 124 ------
NM_004438chr272238 2073 1277 838 738 541 85 145 1292 --
NM_004440chr641430 734 521 243 ------
NM_004441chr311135 21283 1217 ----
NM_004450chr141296 ------
NM_004457chr21116 ------
NM_004458chrX21861 370 21868 533 12279 --
NM_004459chr1711974 ------
NM_004464chr463996 3752 2657 993 901 441 23889 614 ----
NM_004480chr141264 ------
NM_004481chr1--1108 --12373
NM_004482chr21735 ------
NM_004483chr162534 452 ------
NM_004487chr321140 923 --11075 --
NM_004496chr141419 ------
NM_004499chr51434 ------
NM_004500chr1431900 249 45 31416 1378 718 ----
NM_004501chr123840 973 --13508 --
NM_004502chr171227 ------
NM_004504chr253049 2876 2333 2097 1919 11146 ----
NM_004505chr1732011 1639 1500 --1418 1763
NM_004515chr12352 55 ------
NM_004516chr19----1378 --
NM_004520chr51553 ------
NM_004521chr101390 1328 ----
NM_004524chr171298 --1263 --
NM_004528chr1194 ------
NM_004532chr3--2362 161 --128
NM_004537chr121524 --2224 46 1534
NM_004538chrX1194 --1754 --
NM_004540chr21--1913 1701 --
NM_004543chr2298 81 ------
NM_004569chr143669 548 214 ------
NM_004573chr154713 585 550 120 --1236 1495
NM_004575chr4--21385 1249 167 --
NM_004578chr13901 767 737 ------
NM_004586chrX65213 5075 3728 1394 1374 650 11458 34438 4431 3660 --
NM_004588chr1173657 3616 3377 1190 831 149 70 --24072 2969 --
NM_004592chr121172 ------
NM_004593chr31136 ------
NM_004594chr161947 ------
NM_004598chr563031 1096 1059 925 705 631 32888 2532 2452 12117 --
NM_004612chr964469 4100 3867 3237 1792 1564 24771 3895 1242 182
NM_004622chr232106 297 69 ------
NM_004637chr341093 543 253 162 ------
NM_004643chr14----1658 --
NM_004646chr192734 443 11119 ----
NM_004651chrX1356 ------
NM_004654chrY1567 ------
NM_004655chr1731304 349 264 --11118 --
NM_004656chr341066 380 314 289 --11194 --
NM_004660chrY1336 ------
NM_004661chr541087 212 149 54 ------
NM_004663chr1521524 1113 1104 ----
NM_004664chr12121 ------
NM_004670chr1041547 1279 1159 45 1510 ----
NM_004686chr851638 305 285 274 114 1669 ----
NM_004687chr1741899 1845 1468 468 ------
NM_004703chr1762257 2185 2178 895 584 133 ----12198
NM_004705chr113309 181 135 ----1757
NM_004709chrX21307 640 ------
NM_004711chr2293390 3185 3033 2991 2424 1145 1024 998 108 --23302 2765 --
NM_004715chr181195 ------
NM_004717chr761569 1501 1374 983 428 126 ------
NM_004726chrX65279 1690 816 775 251 78 32214 1942 188 15676 --
NM_004734chr1332258 1263 202 ------
NM_004736chr16862 746 537 520 366 80 1228 ----
NM_004737chr221120 ----1951
NM_004738chr202977 335 ------
NM_004744chr41730 ----13770
NM_004745chr8166750 6597 6308 6164 5885 5731 5723 5676 5661 4271 2576 2501 2212 1971 1881 311 25976 1057 15457 11673
NM_004748chr1553261 732 612 581 233 1528 ----
NM_004755chr143877 847 357 --1114 --
NM_004756chr1911277 --11335 --
NM_004760chr742428 1792 849 423 ------
NM_004762chr1731597 616 326 --1590 --
NM_004766chr3122 1254 ----
NM_004768chr16962 949 829 799 780 462 ------
NM_004774chr1732438 2296 860 --11033 --
NM_004775chr1872170 1728 1496 826 669 418 233 41999 1755 1714 852 ----
NM_004776chr2052709 2401 2280 985 522 ------
NM_004779chr53909 344 254 ------
NM_004781chr161727 1717 486 409 95 84 ------
NM_004781chr161727 1717 486 409 95 84 ------
NM_004787chr4144 ------
NM_004788chr1132705 1677 534 1826 21841 1042 --
NM_004792chr2122 ------
NM_004798chr2053415 2395 1103 924 596 --13545 13208
NM_004801chr221592 382 1161 11051 --
NM_004805chr251441 1221 901 414 239 1997 --2562 288
NM_004808chr1033338 2841 2327 13242 23182 3017 --
NM_004815chr154850 3850 3221 3022 936 34048 3358 198 24268 3422 --
NM_004821chr52690 640 ----1751
NM_004822chr1763478 2782 1493 879 758 673 ----23367 270
NM_004824chr621329 557 1507 11379 11039
NM_004834chr2----12156 2968 849
NM_004835chr33818 644 96 ------
NM_004835chr33818 644 96 ------
NM_004836chr24793 615 212 123 --152 --
NM_004841chr151147 1123 424 287 66 --153 1100
NM_004845chrX41315 960 806 411 1737 33375 1657 381 13076
NM_004846chr2175 ------
NM_004850chr211678 ------
NM_004857chr1474086 4042 3753 3361 1197 804 471 13915 --21592 1033
NM_004862chr1621603 1080 11419 1250 --
NM_004863chr14164591 4525 4302 4127 3967 3722 3552 3354 3264 1686 1327 1192 668 447 407 278 1117 ----
NM_004865chr6------1289
NM_004866chr574270 3966 3528 1717 170 41 27 23770 3489 ----
NM_004867chrX1607 ------
NM_004869chr1821733 1515 ------
NM_004872chr1--1332 ----
NM_004874chr8--1441 ----
NM_004883chr5142 ------
NM_004884chr1521294 248 --1129 3692 541 459
NM_004896chr1041178 392 258 236 ------
NM_004897chr102647 269 1348 ----
NM_004898chr452455 2012 623 363 159 12334 12724 --
NM_004902chr202222 129 1769 ----
NM_004904chr765586 4123 2406 1716 1034 498 --24443 1570 36030 1625 1325
NM_004906chr62664 192 ------
NM_004915chr211564 ------
NM_004926chr142409 27 ------
NM_004938chr93458 300 258 --1163 --
NM_004947chr332435 1677 786 --31997 994 843 --
NM_004952chr12634 300 ------
NM_004969chr102448 208 ------
NM_004972chr91399 --1788 --
NM_004976chr1135012 4742 1726 --23306 1100 24096 1020
NM_004978chr141668 1480 282 104 --31280 1216 189 --
NM_004985chr1284254 3757 3356 3272 3151 2809 290 93 33836 3185 135 ----
NM_004992chrX43194 1364 1237 1097 12105 15196 --
NM_004992chrX43194 1364 1237 1097 12105 15196 --
NM_004999chr643999 3131 2886 102 11315 12979 1292
NM_005006chr22747 354 ------
NM_005009chr162106 87 --150 --
NM_005010chr741670 1404 679 610 ------
NM_005011chr731598 1329 1309 --1573 21868 40
NM_005012chr11121 ------
NM_005014chr9--1641 --1705
NM_005017chr3145 ------
NM_005028chr1052164 1675 907 823 173 11695 ----
NM_005036chr2298047 7756 7613 6683 6198 5786 3289 1727 177 37033 6905 1410 27481 5653 --
NM_005044chrX53735 1825 1545 641 47 --1617 --
NM_005045chr73884 679 116 --1705 --
NM_005051chr3------124
NM_005056chr12155612 5265 4899 4211 4181 3855 3748 3690 3632 3574 2209 1330 1098 716 104 15066 ----
NM_005057chr151790 1639 769 494 109 --1368 11573
NM_005058chrY184 ----1244
NM_005063chr1041505 629 277 170 13424 --13469
NM_005065chr1474787 3315 1598 687 493 307 186 --15139 --
NM_005066chr12261 92 ------
NM_005068chr621360 1241 ------
NM_005069chr211674 11546 11717 --
NM_005077chr92335 135 ------
NM_005079chr872873 2731 2630 2056 1107 1053 475 ------
NM_005087chr3----1593 --
NM_005093chr2075355 5278 4737 1604 1447 919 686 --44999 4742 1320 230 21475 426
NM_005095chr131709 1587 390 11465 ----
NM_005096chrX31002 412 139 --2854 811 --
NM_005099chr111332 --11164 2885 82
NM_005105chr161907 1665 1375 717 468 239 ----1376
NM_005109chr382109 1985 1860 979 972 416 373 51 21819 230 ----
NM_005112chr43854 398 347 ------
NM_005114chr43513 174 121 ------
NM_005116chr2034351 3898 2912 --1186 --
NM_005121chr1743013 2921 2733 527 1124 ----
NM_005126chr321543 600 11839 1129 --
NM_005135chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_005151chr1851777 908 598 371 322 ------
NM_005156chr985340 4804 3438 3342 851 840 637 91 ------
NM_005161chr1162187 2167 2124 1517 493 427 ------
NM_005164chr1242562 1799 974 758 ------
NM_005171chr1221006 378 ------
NM_005180chr1021541 541 ------
NM_005181chr82695 65 --1765 --
NM_005182chr162564 424 --1239 --
NM_005187chr161220 --31492 1314 770 21665 213
NM_005188chr11217885 7550 6965 6868 6794 6634 6131 6077 5808 5349 5151 3059 3027 2978 2864 2774 2681 2272 1006 382 275 --47268 6799 5205 1304 --
NM_005189chr1762264 842 798 688 203 46 32372 1784 262 22166 230 12342
NM_005197chr1495642 5211 4913 4736 4116 3874 2449 2158 1679 --45383 4918 3818 2058 --
NM_005207chr2252824 1170 1037 942 40 12531 1166 33406 2721 686
NM_005229chrX21228 166 ----1249
NM_005230chr12169 ------
NM_005233chr33967 882 474 1466 --1493
NM_005235chr2197821 7157 7103 6368 6136 5411 4992 4786 2655 2293 2159 1339 1057 911 792 413 403 289 155 17774 --15257
NM_005238chr1153103 3006 2534 501 118 12327 --13200
NM_005249chr14----1288 --
NM_005252chr141193 --1703 --
NM_005254chr1521342 1080 11214 ----
NM_005257chr1841314 1305 980 389 ------
NM_005259chr221430 1087 ----11367
NM_005261chr821018 992 ------
NM_005263chr13192 161 87 11016 ----
NM_005264chr103771 751 377 1713 ----
NM_005271chr1011204 ------
NM_005274chr11131 --1155 --
NM_005277chr41757 ------
NM_005324chr1731861 683 230 ------
NM_005328chr8--1290 1710 --
NM_005329chr1642398 2308 2043 239 ------
NM_005339chr463858 3633 3254 1161 280 36 21078 1008 --1403
NM_005348chr143938 122 25 1171 ----
NM_005349chr41431 ------
NM_005358chr1341860 512 228 130 ------
NM_005359chr18124827 4396 4347 4179 2525 2461 2394 1717 1392 1275 887 137 25253 453 25324 2165 12192
NM_005373chr131503 1468 625 --2493 482 1313
NM_005374chr1752134 1825 1524 249 200 --22126 1915 --
NM_005375chr641191 1157 1092 214 ------
NM_005381chr2165 ------
NM_005385chr352336 2165 2095 989 311 2606 555 --1742
NM_005387chr111440 --1605 --
NM_005399chr194214 4028 3997 3208 2859 1730 440 270 74 --31574 1322 397 1453
NM_005400chr252865 2490 2137 1881 901 --193 --
NM_005402chr731318 541 395 ------
NM_005406chr1841308 1108 277 43 21570 420 ----
NM_005415chr21271 --1765 --
NM_005430chr124879 346 156 101 --3665 376 233 --
NM_005436chr1053939 3580 2770 729 653 1876 ----
NM_005437chr1031177 943 123 --11161 --
NM_005439chr122513 422 --1177 --
NM_005445chr10----1294 --
NM_005455chr12445 34 11589 11610 --
NM_005458chr912270 --1419 --
NM_005460chr52583 524 1177 ----
NM_005465chr112059 1215 --123
NM_005475chr1252878 2825 1264 1195 696 1579 11200 --
NM_005479chr101413 ------
NM_005487chr2251975 1759 413 279 174 ------
NM_005493chr64858 560 305 282 ------
NM_005497chr1755632 2288 1124 1039 501 24189 2085 11697 15875
NM_005502chr932394 2241 248 ------
NM_005504chr1286022 4365 4307 4139 776 429 285 99 65884 4248 848 298 223 218 25714 1065 26431 5872
NM_005506chr431965 1144 959 --12064 12091
NM_005509chr521214 33 ------
NM_005512chr1122049 1690 11533 ----
NM_005513chr311551 --1336 1363
NM_005517chr1131 --11175 --
NM_005522chr721369 123 ------
NM_005529chr11411 ------
NM_005539chr101873 1181 ----
NM_005542chr711261 ------
NM_005544chr2----1720 --
NM_005563chr11787 1648 --1255
NM_005569chr2251232 618 392 183 141 --11104 --
NM_005570chr1831138 1027 367 2918 23 ----
NM_005573chr52597 49 ------
NM_005575chr51261 ------
NM_005576chr15--1189 ----
NM_005578chr354841 4829 4726 1275 820 34386 4097 796 --13933
NM_005581chr192327 168 --2435 173 --
NM_005584chr132525 321 --1249 --
NM_005585chr151122 ------
NM_005587chr154872 378 285 194 ------
NM_005593chr122484 134 ------
NM_005596chr985496 4910 4583 2564 2156 1676 1405 790 21683 509 13964 12580
NM_005599chr141524 1307 421 147 11544 ----
NM_005604chr61733 ----12351
NM_005607chr8------1367
NM_005610chr11712 ------
NM_005613chr131620 323 125 1845 ----
NM_005614chr73969 426 42 ------
NM_005627chr6----1232 --
NM_005638chrX51709 1537 1432 334 148 ------
NM_005660chrX----1214 --
NM_005665chr144778 3857 475 164 --1797 1608
NM_005668chr554202 3828 3499 3051 3023 ----1770
NM_005688chr3153 ----21147 854
NM_005698chr1132 ------
NM_005700chr11------1123
NM_005715chr6102730 2573 2329 2138 1863 1789 800 742 426 31 32527 2467 356 1695 11976
NM_005717chr12869 845 --127 --
NM_005721chr2161 ------
NM_005722chr242284 2230 702 691 42479 1697 1656 504 ----
NM_005724chr153309 165 154 ------
NM_005725chr141922 1831 1824 1688 21735 978 ----
NM_005730chr1283101 2720 2688 2336 1442 679 616 196 196 23531 1242 --
NM_005731chr21431 ------
NM_005734chr111585 ------
NM_005738chr741917 1614 1318 326 --1606 --
NM_005746chr712567 --12143 --
NM_005748chr1232425 1284 369 22643 2417 --12443
NM_005752chr164998 958 491 357 ------
NM_005754chr5----1487 --
NM_005756chrX41293 1281 440 59 11316 1304 --
NM_005760chr2135 ------
NM_005762chr191134 ------
NM_005765chrX1820 ------
NM_005766chr1321115 511 11413 ----
NM_005768chr123656 539 132 --1675 1281
NM_005776chr141242 ------
NM_005778chr31498 ------
NM_005779chr542298 1262 1197 95 11306 --1398
NM_005780chr13----176 --
NM_005786chr182971 245 ------
NM_005789chr1762132 1924 1911 1833 730 170 22051 568 12145 --
NM_005795chr242969 2846 2400 2013 --1703 --
NM_005797chr1121448 296 ------
NM_005808chr353222 2817 2637 140 63 --13326 --
NM_005828chr1754234 3877 3125 1851 649 --150 14935
NM_005832chr341291 1267 972 548 ------
NM_005833chr93176 114 23 ------
NM_005834chrX----257 30 --
NM_005840chrX107685 7092 6452 6216 3012 2458 1643 667 625 340 --26864 5069 1639
NM_005841chr43843 454 23 ------
NM_005843chr211796 21743 395 --11349
NM_005857chr141434 1211 1143 1039 --1953 --
NM_005859chr51306 ------
NM_005860chr1921572 1425 --11222 21657 1312
NM_005862chr311016 ------
NM_005871chr102298 47 ------
NM_005877chr2252325 1601 885 375 40 1770 ----
NM_005880chr1611587 --11511 --
NM_005882chr41686 ------
NM_005895chr1293468 3203 2732 2670 1420 995 940 897 458 13245 13231 22972 661
NM_005896chr22800 616 ------
NM_005898chr1193162 2697 2619 2021 1228 1027 821 764 169 12331 ----
NM_005899chr1721372 28 ------
NM_005901chr18138650 8635 7641 7300 3489 3252 2708 2272 2220 1828 1344 1000 552 13308 13215 --
NM_005904chr1821081 54 ------
NM_005907chr631364 1308 248 2550 50 ----
NM_005909chr5103590 2930 2826 1704 1657 1624 1588 1288 231 114 ------
NM_005910chr1773663 2805 2666 2526 1482 1194 1030 --13448 --
NM_005911chr21252 --11506 --
NM_005920chr123384 1057 --43504 3290 1498 1230 12846
NM_005924chr741126 883 841 819 ------
NM_005926chr151366 ----1373
NM_005933chr112794 671 21871 660 22951 2076 11930
NM_005934chr1962444 2125 1740 1609 459 101 ------
NM_005935chr475103 5050 4355 4348 3918 3411 1721 ----15056
NM_005941chr864127 4114 4076 3298 2984 1463 12685 ----
NM_005944chr33494 200 42 1349 ----
NM_005955chr195353 4859 4253 3721 1706 1682 1335 1314 882 24414 1236 11473 11956
NM_005966chr242053 742 452 409 42431 2279 1849 93 ----
NM_006011chr1584181 4154 3770 3688 3408 3272 2911 596 11061 22970 339 --
NM_006016chr621880 68 42207 2197 1751 1713 ----
NM_006023chr101174 ------
NM_006024chr73643 210 137 ------
NM_006029chr14146 ------
NM_006036chr282584 2389 2377 1810 1698 888 500 57 --2787 337 --
NM_006037chr274620 4510 4103 4039 3914 3400 1680 --13041 --
NM_006041chr173405 396 132 123 1346 1427
NM_006047chr2053491 2510 2210 518 206 ------
NM_006048chr121088 445 ------
NM_006054chr114483 448 276 204 1255 ----
NM_006080chr712677 ------
NM_006085chr11187 --1900 --
NM_006089chrX----1219 11369
NM_006090chr11517 ------
NM_006091chr15----11791 21172 519
NM_006095chr4104149 4134 3922 3805 3780 2839 1773 1692 600 33 ------
NM_006106chr1163438 3350 2854 2241 2163 1331 12541 ----
NM_006107chr172461 426 ------
NM_006133chr115762 739 687 679 357 --3751 699 345 1162
NM_006135chr141438 1256 1054 185 1412 11261 --
NM_006136chr7----1460 --
NM_006147chr12432 413 ------
NM_006148chr1732759 2645 1935 1865 42586 819 549 499 --
NM_006154chr1572362 629 588 551 534 331 235 11866 ----
NM_006159chr121651 --1209 --
NM_006160chr1731571 1320 158 ------
NM_006166chr1231865 892 468 ------
NM_006167chr831801 243 40 11702 ----
NM_006180chr94729 440 207 164 ------
NM_006191chr122918 221 ----138
NM_006194chr1421129 110 ------
NM_006195chr9----1919 --
NM_006201chrX51088 443 431 141 96 --11025 1458
NM_006203chr594910 4592 4540 3724 3653 1966 1888 1121 1113 --11702 13717
NM_006206chr472706 2477 2051 550 446 402 197 1210 ----
NM_006216chr22269 39 ------
NM_006224chr1742479 2439 2292 355 ------
NM_006226chr221200 444 ------
NM_006237chr1392157 2140 2086 1937 867 387 168 109 77 11557 ----
NM_006241chr322276 1753 --2859 776 --
NM_006245chr65881 372 290 269 197 ------
NM_006251chr533023 2954 1083 --11132 --
NM_006252chr1117192 6897 6297 2189 1886 1570 1465 1414 808 558 383 37246 2096 1946 46425 6266 788 507 16624
NM_006254chr31156 ------
NM_006255chr144872 764 734 111 ------
NM_006256chr131709 773 162 1190 ----
NM_006258chr1051490 1358 590 349 26 ------
NM_006264chr42184 124 1567 ----
NM_006267chr21576 11210 --1707
NM_006275chr2032442 573 46 ------
NM_006278chr11----1484 --
NM_006282chr2084268 2967 1897 1891 1648 1531 769 453 34738 211 67 --13147
NM_006283chr864426 4160 1126 999 457 139 --21494 899 --
NM_006289chr92450 369 ------
NM_006306chrX85893 1949 1880 1557 1153 939 520 510 22278 901 22331 90 24587 945
NM_006309chr3145 ------
NM_006312chr122692 232 --1359 --
NM_006313chr1231320 1272 606 ------
NM_006315chr473433 3157 3044 3011 1776 1695 79 ----11786
NM_006317chr53658 649 263 --3112 87 75 --
NM_006320chr421009 283 ------
NM_006321chr37898 858 737 621 615 450 83 ------
NM_006327chr10190 ------
NM_006328chr112177 93 --1246 --
NM_006330chr821538 150 ------
NM_006335chr11334 1436 ----
NM_006338chr13569 193 44 ------
NM_006345chr451298 916 523 389 182 ------
NM_006348chr73377 144 88 ------
NM_006357chr22440 433 ------
NM_006359chrX82477 1963 1873 1712 1548 466 318 68 --11829 --
NM_006361chr1721629 322 --21699 1280 --
NM_006364chr1411028 --1285 --
NM_006366chr621145 397 ------
NM_006367chr11133 1155 2816 88 --
NM_006369chr13407 306 93 ------
NM_006371chr385142 4214 4113 611 456 208 176 167 35067 1104 89 15207 14441
NM_006372chr61491 ------
NM_006378chr941415 1396 1058 29 ------
NM_006380chr1744022 3659 148 27 23400 1356 1529 13553
NM_006389chr112489 185 --1851 11167
NM_006393chr1054068 3622 3521 3312 1614 13819 ----
NM_006410chr11----1493 1228
NM_006415chr91988 1825 ----
NM_006420chr2033242 2304 678 ------
NM_006421chr83813 499 76 ------
NM_006430chr21408 ------
NM_006434chr1042375 2239 806 333 22396 2246 12761 --
NM_006449chr232123 197 141 22086 1561 ----
NM_006451chr53896 320 153 1683 ----
NM_006454chr493111 2894 2708 1991 844 459 179 139 29 --12856 --
NM_006459chr1031894 1687 275 --11998 11291
NM_006465chr1522306 388 42258 1660 939 74 12348 --
NM_006476chr11178 --1642 --
NM_006482chr1231550 1474 959 33144 533 296 --13951
NM_006489chr1441994 1474 1270 438 --21846 1429 --
NM_006496chr121886 543 ------
NM_006497chr17----1779 --
NM_006520chrX41691 1675 1274 1048 11182 ----
NM_006526chr20--21951 73 ----
NM_006534chr2072910 2710 2549 2482 1199 1016 326 1604 12602 --
NM_006538chr273891 3414 2717 838 675 547 469 --1163 --
NM_006540chr81595 11338 1184 --
NM_006544chr14105674 5399 5308 5279 4248 1669 1088 661 507 157 34601 98 60 25569 4028 24556 753
NM_006546chr1785671 4333 2631 2223 2056 1100 451 429 11657 15574 34930 4276 1639
NM_006547chr742119 716 485 112 ----21583 567
NM_006548chr3--11326 --11311
NM_006555chr741953 1821 1526 599 --11713 --
NM_006557chr921563 374 --1495 --
NM_006558chr81138 ------
NM_006559chr131179 286 61 ------
NM_006561chr10135253 4914 4207 2153 1966 1841 1656 1647 1567 1456 1105 727 661 --24841 460 --
NM_006572chr1752777 1366 961 490 306 ----1896
NM_006575chr1411347 11309 1181 --
NM_006578chr152213 70 --11466 --
NM_006591chr1131660 736 204 11336 --11846
NM_006595chr1171465 1383 639 543 205 187 156 ------
NM_006599chr16138189 8048 7840 7160 6501 5636 5515 5490 2818 2571 2529 1580 1221 --15710 --
NM_006601chr121118 ------
NM_006602chr201572 1648 ----
NM_006603chrX31737 1354 1263 ------
NM_006608chr1148 ------
NM_006609chr252562 2317 2216 2077 25 ------
NM_006614chr353540 2251 842 808 347 23477 2782 --13693
NM_006618chr151451 1168 1078 330 28 --11307 --
NM_006621chr11331 1306 ----
NM_006624chr10----2798 413 --
NM_006626chr942699 2652 2248 416 1212 1753 --
NM_006628chr15104688 4010 3095 1094 650 495 398 248 225 68 34282 3803 325 13520 23547 3045
NM_006633chr51719 1709 --1607
NM_006640chr1721853 1383 1639 ----
NM_006646chr132591 353 ------
NM_006654chr1263508 3371 3188 3030 1156 310 23155 3076 13550 --
NM_006660chr15197 ------
NM_006662chr16178 ------
NM_006667chrX1250 11155 1448 --
NM_006668chr14----1403 --
NM_006675chr1253274 2383 1111 549 76 22282 495 --1143
NM_006677chr3261 37 --1242 --
NM_006690chr2022203 247 ------
NM_006699chr172639 2616 2343 2304 1873 1078 560 12089 12169 --
NM_006704chr132119 112 ------
NM_006706chr51739 ------
NM_006717chr953379 2898 2542 1146 401 --1782 --
NM_006720chr1055041 4028 3486 1872 1662 1260 ----
NM_006722chr33489 203 69 --22660 2380 --
NM_006726chr41977 ------
NM_006727chr52499 125 ------
NM_006729chrX95648 5334 4311 3495 1623 1593 1586 1035 763 21190 569 55602 5404 4924 4918 1131 --
NM_006731chr9155779 5768 4942 4802 4663 4555 4480 4189 2236 1901 1456 1232 1067 1021 455 44589 3610 2338 2261 1240 24831 1147
NM_006734chr6------11330
NM_006738chr1594397 4290 4060 3921 3339 3223 3096 1267 948 1762 24233 31 --
NM_006742chr1651506 1455 1275 601 406 --32007 1247 777 --
NM_006745chr42166 142 ------
NM_006746chrX41360 1013 439 112 --1166 --
NM_006749chr8--11271 1128 --
NM_006750chr1668088 7659 7336 7053 2193 1257 --42925 678 179 165 1587
NM_006761chr171619 --1719 --
NM_006764chr31383 ------
NM_006766chr842644 2584 2446 1044 ----1474
NM_006769chr11525 --1678 --
NM_006775chr632792 2052 58 ------
NM_006777chrX62895 2510 2484 2314 1931 676 ------
NM_006791chr15----163 --
NM_006802chr151201 1160 1092 922 283 ------
NM_006805chr521627 448 ------
NM_006807chr17169 ------
NM_006815chr1211227 --1220 --
NM_006823chr81398 --1187 --
NM_006826chr221102 1081 ------
NM_006827chr1452726 2397 1319 530 272 136 --32732 2597 2549
NM_006832chr14----1424 --
NM_006837chr8125 ------
NM_006838chr1231834 1374 1240 11869 ----
NM_006846chr52323 266 --161 --
NM_006851chr1242947 2746 1888 84 22595 782 42576 1951 866 403 --
NM_006856chr122391 86 1725 --11090
NM_006874chr41150 --21248 208 --
NM_006885chr1652735 1286 1144 440 168 13327 ----
NM_006888chr1451259 1242 556 144 63 1478 22582 2321 1245
NM_006889chr331524 370 290 --1441 --
NM_006892chr2011029 21426 122 ----
NM_006892chr2011029 21426 122 ----
NM_006896chr73460 345 308 --1238 --
NM_006902chr143141 1229 557 31 ------
NM_006908chr731255 999 322 ------
NM_006913chr6----1432 --
NM_006914chr951534 1512 615 596 399 ------
NM_006915chrX21001 401 --1643 11823
NM_006920chr211974 ------
NM_006922chr241835 632 573 254 11667 12358 --
NM_006924chr1731376 318 266 --12883 --
NM_006930chr521448 639 ------
NM_006937chr171406 ------
NM_006939chr143889 838 447 ------
NM_006940chr1231282 576 550 ----11860
NM_006943chr202829 693 --32619 2113 817 --
NM_006948chr214870 817 107 66 11819 ----
NM_006950chrX2581 151 --2647 249 --
NM_006951chr101704 168 --1641
NM_006965chr185964 465 284 265 188 ------
NM_006980chr72600 224 ------
NM_006981chr932223 2149 555 --129 --
NM_006990chr172423 2299 1787 720 656 535 45 --11756 1502
NM_006991chr3133 --1859 1958
NM_006996chr13358 138 53 1308 1455 --
NM_007002chr20196 ------
NM_007005chr931537 1061 216 ------
NM_007006chr1631151 453 103 23053 2733 ----
NM_007008chr23585 249 164 ------
NM_007011chr1546909 6759 4314 1500 26042 1809 45784 4555 4362 2059 --
NM_007013chr82363 172 ------
NM_007014chr1661759 1552 629 532 455 58 --21473 537 --
NM_007018chr9------151
NM_007027chr32435 203 ------
NM_007033chr131421 884 860 ----122
NM_007034chr12978 333 ------
NM_007039chr1431753 656 363 ------
NM_007040chr192987 445 --5918 272 142 124 60 --
NM_007042chr322522 839 1396 42106 1760 1666 284 --
NM_007043chr1221668 561 --132 --
NM_007050chr2097399 6664 6218 5827 5316 5243 2860 978 108 36577 5310 2670 12340 --
NM_007051chr11164 --1122 --
NM_007054chr524001 1337 --23514 2726 12753
NM_007067chr1721381 1243 21072 1004 ----
NM_007076chr121112 ------
NM_007078chr1043056 2697 1986 1888 22172 246 1542 --
NM_007099chr21666 3622 599 136 1367 --
NM_007106chr1362554 2523 2418 2380 1718 102 ------
NM_007107chr341934 1741 1690 1664 ------
NM_007114chr352831 2485 1165 868 669 ------
NM_007124chr641838 1810 1251 677 1442 --11607
NM_007125chrY--1194 1156 --
NM_007137chrX73674 3506 1833 1632 878 787 441 --11938 1133
NM_007144chr1721295 84 --1507 --
NM_007146chr1742844 2138 2120 526 ------
NM_007157chrX62792 2532 1949 704 575 207 1692 ----
NM_007158chr13410 392 75 --1379 --
NM_007159chr321589 94 ------
NM_007166chr1151575 1544 1080 351 64 ------
NM_007172chr2242790 2288 697 203 ----12831
NM_007173chr1132308 688 138 1617 ----
NM_007174chr1242331 2122 1516 365 ------
NM_007175chr883560 3316 3177 3048 1360 856 834 337 --33352 397 88 --
NM_007176chr1431153 558 281 ----1428
NM_007191chr121665 ------
NM_007195chr1863459 3410 3154 3143 2731 202 1387 12736 11278
NM_007200chr1594397 4290 4060 3921 3339 3223 3096 1267 948 1762 24233 31 --
NM_007212chr122231 2030 1553 --12056
NM_007217chr3251 28 ------
NM_007218chr82179 167 ------
NM_007219chr202882 90 2242 120 1961 2974 812
NM_007220chrX94876 4458 3127 2989 1883 1291 555 417 330 11732 --23324 1341
NM_007236chr1571874 655 626 593 515 370 159 --41721 1560 795 434 --
NM_007242chr161239 ------
NM_007249chr1397949 6976 6617 6477 6378 3374 3087 2693 530 1334 16599 12204
NM_007271chr631631 1556 635 1547 ----
NM_007282chr32764 396 1179 ----
NM_007286chr542077 1932 1822 743 --32130 2070 450 --
NM_007287chr342894 2511 2384 2100 --22666 696 --
NM_007288chr342894 2511 2384 2100 --22666 696 --
NM_007289chr342894 2511 2384 2100 --22666 696 --
NM_007292chr1764947 4642 1542 1312 1288 542 21677 1220 24975 4391 14417
NM_007308chr41116 1564 ----
NM_007345chr1842132 2028 1570 563 ----12336
NM_007347chr1542559 868 813 89 23046 1246 12312 12339
NM_007358chr141634 1625 432 86 ------
NM_007361chr142575 498 1171 ----
NM_007372chr17------1732
NM_007373chr1011846 ------
NM_007375chr132251 2238 1716 ------
NM_009585chr33818 644 96 ------
NM_009585chr33818 644 96 ------
NM_012081chr543391 3341 1111 913 --12971 --
NM_012082chr8----1924 --
NM_012089chr121400 423 11136 ----
NM_012090chr12194 130 21231 1098 --1391
NM_012092chr241819 1259 631 181 --21448 425 --
NM_012097chr2155 1479 22046 1500 --
NM_012100chr21746 1522 ----
NM_012104chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_012104chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_012120chr642408 2045 1073 423 22992 2835 ----
NM_012129chr752512 2302 911 629 383 ----1557
NM_012137chr162312 2235 2202 2026 1169 453 --2593 552 --
NM_012153chr1132057 185 89 --21781 133 --
NM_012157chr34979 774 390 289 ------
NM_012158chr1331645 1444 212 ------
NM_012164chr997451 6584 6433 6331 6025 6018 2902 2452 1154 17349 24820 1892 32572 2319 2073
NM_012166chr961267 1061 1045 366 136 68 ------
NM_012175chr111272 ------
NM_012189chr181159 ------
NM_012193chr1194686 4627 3433 2025 1561 1247 1186 872 297 --34091 4012 143 15035
NM_012197chr911507 ------
NM_012199chr194560 3951 3308 3030 2998 1457 1066 822 667 --11091 --
NM_012214chr266146 5458 5004 2280 1428 83 15180 21713 95 --
NM_012223chr21831 11234 ----
NM_012234chr353128 3103 2948 2462 265 11118 ----
NM_012238chr1031477 1215 695 ------
NM_012242chr103816 277 227 ------
NM_012249chr273146 2901 2588 2325 1389 1351 382 13173 --12751
NM_012250chr114945 427 371 84 ------
NM_012257chr721095 770 ------
NM_012262chr174672 4449 4282 885 392 384 239 34695 1278 693 2869 663 24103 1327
NM_012266chr92294 178 ------
NM_012281chr7----22148 1853 11948
NM_012286chrX1484 ------
NM_012287chr394351 4265 4114 3606 3520 2958 584 410 92 13548 --21347 416
NM_012288chr685275 5254 4869 4788 3947 945 354 91 14407 21008 78 14170
NM_012290chr231720 609 246 --11325 --
NM_012296chr1163633 3109 2994 2959 392 241 --32843 416 267 --
NM_012297chr452043 1688 760 357 253 ------
NM_012300chr53910 742 587 12529 ----
NM_012301chr722083 1960 --1614 --
NM_012308chr1152117 1994 857 819 184 11907 32484 954 906 --
NM_012309chr1154074 3615 1913 1429 376 24277 3525 23548 913 --
NM_012316chr194781 4410 3868 3550 1761 1707 1132 1073 645 --34419 2252 1564 --
NM_012317chrX4784 569 192 115 ------
NM_012319chr183935 833 185 ------
NM_012325chr2041639 1056 191 124 11244 ----
NM_012328chr731494 314 257 ------
NM_012329chr1741546 1040 606 433 ----1172
NM_012330chr1031531 213 64 ----11635
NM_012333chr131559 1476 1318 1250 --11101
NM_012338chr72504 364 ------
NM_012343chr53884 849 310 --11045 --
NM_012412chr72793 180 ------
NM_012417chr172628 601 ------
NM_012419chr62575 241 ------
NM_012420chr1022341 292 11544 ----
NM_012426chr162375 312 ------
NM_012431chr773566 3205 3158 3002 2872 1300 1208 1970 ----
NM_012433chr2------139
NM_012434chr641447 323 233 214 --125 --
NM_012443chr103624 608 117 ------
NM_012444chr202325 198 ------
NM_012448chr1722155 1795 --21865 1681 12479
NM_012454chr61507 1450 ----
NM_012463chr1231783 145 109 --1741 --
NM_012464chr422466 763 2294 247 ----
NM_012465chr1073446 2857 2826 2475 2446 2170 2160 ------
NM_012482chr12606 506 --1566 --
NM_013229chr1232304 255 183 2941 383 1659 31120 984 686
NM_013231chr1474389 4001 3202 2929 1451 472 178 ------
NM_013233chr2--11290 1454 --
NM_013236chr223923 787 475 ------
NM_013248chr201242 ------
NM_013255chr7118779 8076 7099 3312 3099 2589 2488 1625 675 451 425 46707 2688 1732 502 22836 926 --
NM_013257chr841927 847 765 382 1101 ----
NM_013261chr423580 105 144 ----
NM_013262chr621347 330 ------
NM_013269chr1273622 3189 562 490 478 191 167 ------
NM_013277chr125673 398 163 94 22 ------
NM_013286chr3123680 3633 3450 3220 2983 2770 2606 1474 821 628 480 99 43027 2520 2443 874 22665 2552 --
NM_013293chr72644 283 ------
NM_013300chr121213 ------
NM_013302chr1614598 --34246 4083 1070 33943 537 402
NM_013309chr1542656 2249 1982 27 31943 282 255 1958 12354
NM_013341chr242901 2828 2790 2311 1281 12803 --
NM_013346chrX129 ------
NM_013354chr851295 1107 132 96 63 ----1163
NM_013357chr83711 548 118 1135 ----
NM_013358chr131728 529 345 --2670 435 --
NM_013372chr1533267 1283 1034 12762 21128 119 --
NM_013381chr1252446 2400 768 369 84 22224 818 1879 --
NM_013386chr121497 1189 1476 11362 --
NM_013392chr21437 ------
NM_013399chr1661799 1386 748 638 310 150 ------
NM_013410chr12491 181 ------
NM_013433chr1921623 1282 --11359 --
NM_013436chr2153 179 ----
NM_013437chr8--1363 ----
NM_013438chr921530 705 11705 ----
NM_013444chrX2977 842 --2207 169 --
NM_013445chr21144 ------
NM_013958chr81142 --198 --
NM_013959chr81142 --198 --
NM_013960chr81566 --1191 --
NM_013961chr81142 --198 --
NM_013962chr81142 --198 --
NM_013981chr5142 ------
NM_013982chr5142 ------
NM_013983chr5142 ------
NM_013995chrX62468 2450 2415 2295 1752 491 ------
NM_014000chr103515 493 449 1655 21946 1255 1753
NM_014002chr14264 247 161 151 --1113 --
NM_014007chr92456 86 ------
NM_014010chr92563 209 --1551 --
NM_014011chr242058 949 477 140 ------
NM_014016chr331325 1308 169 11261 --1603
NM_014021chr173069 2641 2312 1314 835 449 88 12382 --12647
NM_014023chr103470 422 396 ----1915
NM_014028chr673345 2979 2900 2586 2244 2059 797 1338 --13043
NM_014034chr611454 1388 ----
NM_014039chr1131309 440 256 1250 ----
NM_014043chr321106 602 1288 ----
NM_014048chr1684512 4243 3384 3297 3283 855 456 285 15284 ----
NM_014055chr121394 1448 ----
NM_014057chr941491 1352 1324 1051 21517 106 ----
NM_014106chr1532625 1072 952 ----1682
NM_014109chr821098 462 11081 ----
NM_014110chr111041 --1270 --
NM_014112chr841795 1612 643 110 24807 98 ----
NM_014117chr1631817 1739 172 --1746 --
NM_014139chr31195 ----124
NM_014141chr794608 4338 4286 4209 3570 3487 2105 1709 284 11322 --24292 3935
NM_014145chr201576 ------
NM_014154chr331434 560 308 11032 ----
NM_014155chr11107362 6606 6216 6208 6111 5176 5123 1023 875 781 36009 2383 2233 16141 11360
NM_014159chr32540 187 ------
NM_014171chr22776 48 ------
NM_014176chr1----165 --
NM_014181chr242584 2557 2122 46 ------
NM_014182chr121758 ------
NM_014208chr4--1298 ----
NM_014212chr122713 175 ------
NM_014217chr13597 456 371 ------
NM_014220chr31117 ------
NM_014231chr1252156 1899 1365 454 241 ------
NM_014240chr374001 3843 3231 2697 2676 1239 172 22605 1176 21595 177 --
NM_014241chr10148 ------
NM_014243chr442051 1846 1827 755 ------
NM_014245chr3--11124 1231 1817
NM_014248chr22167 ------
NM_014250chr2251975 1759 413 279 174 ------
NM_014253chrX62484 2355 2080 1673 129 38 --21772 336 --
NM_014263chr102980 69 11196 ----
NM_014267chr111805 ------
NM_014271chrX----1619 --
NM_014280chr11258 1297 142 --
NM_014283chr111266 --1133 --
NM_014289chrX91435 1346 1179 1137 1000 352 225 190 148 ------
NM_014293chr2274106 3838 3027 2781 875 559 123 ----1362
NM_014294chr821083 208 --11360 --
NM_014296chr32642 183 21210 1137 --21014 595
NM_014309chr2255010 4853 3921 3705 193 21049 151 11722 15406
NM_014317chr10131 ------
NM_014319chr1221850 1496 ------
NM_014329chr162286 90 ------
NM_014331chr4146900 6584 6519 6173 6108 5790 5581 5549 5481 5100 2792 1075 854 251 165 ----
NM_014332chrX1150 --1325 --
NM_014333chr1111019 ------
NM_014335chr1551168 1114 970 59 32 11283 ----
NM_014342chr1131468 1435 141 1518 11473 --
NM_014344chr111835 ------
NM_014345chr62158 22 187 1943 --
NM_014352chr1121393 485 --11012 11166
NM_014363chr13--166 ----
NM_014368chr922104 1888 --1397 --
NM_014372chr111843 ------
NM_014382chr351521 1146 1125 1117 325 11632 ----
NM_014393chr862073 1923 416 332 209 190 2504 166 1298 1629
NM_014394chr1041120 1000 304 161 1152 ----
NM_014399chr73672 283 101 1115 ----
NM_014405chr1741500 392 335 293 21493 244 12023 1727
NM_014411chr721999 326 21596 634 ----
NM_014423chr5144964 4718 4675 4131 2212 1970 1433 1334 1149 525 443 427 364 23 11890 ----
NM_014431chr1031631 1258 280 --11409 21637 1589
NM_014437chr11155 ------
NM_014445chr321997 260 1873 1638 1107
NM_014447chr431647 1612 558 ------
NM_014452chr621089 480 ------
NM_014456chr1011601 21276 1248 1253 --
NM_014458chr11946 2149 115 11101 --
NM_014469chr112673 111 ------
NM_014491chr73934 792 767 ------
NM_014494chr1612005 --1865 1519
NM_014498chr32322 69 ------
NM_014504chr71186 21975 1336 ----
NM_014505chr121336 ------
NM_014517chr351693 1243 638 371 260 ----11477
NM_014547chr151194 ------
NM_014547chr151194 ------
NM_014548chr1521499 154 --1387 --
NM_014554chr1232012 1618 159 1175 21691 802 --
NM_014570chr221111 ------
NM_014572chr1311785 1123 134 --
NM_014584chr1411610 11488 ----
NM_014587chr1661516 1401 1374 1365 518 208 ----11292
NM_014607chr21335 21863 668 1259 --
NM_014612chr921333 1252 ------
NM_014613chr562707 2689 2289 2068 1075 407 --1441 --
NM_014615chr16103494 3386 3323 2787 2746 2351 1150 1132 610 59 22655 399 --12641
NM_014630chr15113969 3146 2830 2799 2562 1088 1017 747 489 426 366 --12682 --
NM_014636chr933455 3356 3037 14275 13435 1444
NM_014637chr831171 999 94 ------
NM_014655chr121479 129 --21560 921 --
NM_014659chr152800 39 ------
NM_014661chr1093548 3335 3278 2827 2521 2398 1283 750 154 --22770 291 --
NM_014663chr131054 388 305 ------
NM_014666chr511254 ------
NM_014667chr342329 2199 891 249 ----1257
NM_014670chr221198 1160 --2257 90 --
NM_014671chr731182 504 242 ----1624
NM_014674chr353501 2808 2738 860 442 43414 2602 707 313 1523 1467
NM_014675chr11461 ------
NM_014676chr111454 ------
NM_014677chr821147 1027 ------
NM_014679chr1121392 70 144 ----
NM_014682chr842118 1618 1471 1432 11899 ----
NM_014683chr1752125 1759 1654 782 185 31862 1391 279 11480 --
NM_014685chr162419 74 ------
NM_014686chr1962175 2080 1900 570 508 22 ------
NM_014689chr21122 ------
NM_014691chr15--1301 ----
NM_014701chr1542677 2214 1202 55 1735 126 --
NM_014702chr683354 3232 3202 3005 2885 2442 1097 468 ------
NM_014705chr731343 565 266 ------
NM_014707chr742112 612 278 94 11985 ----
NM_014709chr22193 23 ------
NM_014717chr19126 ------
NM_014720chr1041325 574 361 280 ----1107
NM_014721chr657383 5304 2575 1011 887 37117 5873 921 ----
NM_014726chr1741420 450 293 118 --1910 11024
NM_014729chr841636 1537 801 288 1549 ----
NM_014730chr12104846 4335 4265 3384 3318 3246 1976 1901 921 388 --23435 2105 11238
NM_014730chr12104846 4335 4265 3384 3318 3246 1976 1901 921 388 --23435 2105 11238
NM_014731chr2041763 1332 561 542 --11249 --
NM_014733chr522212 318 --21476 531 --
NM_014735chrX42037 1733 1535 375 --1707 --
NM_014736chr152821 387 --1715 --
NM_014739chr644089 3771 2879 57 13279 ----
NM_014747chr163828 3793 3577 1659 381 210 13717 43974 3964 1942 1289 15082
NM_014748chr24408 292 269 114 --1153 --
NM_014751chr821868 1498 1377 1826 --
NM_014752chr1121595 541 --11274 --
NM_014755chr243825 3303 1562 427 --13694 11467
NM_014757chr5177 --21641 941 --
NM_014759chr841585 1388 1355 298 11117 2392 315 --
NM_014760chr371974 1829 1466 752 387 253 229 --1491 --
NM_014765chr131058 933 612 12688 ----
NM_014766chr721302 141 11009 --11465
NM_014767chr1083628 3550 3444 3085 2722 2509 1031 778 --23609 1059 --
NM_014773chr531392 324 30 ----11062
NM_014774chr183145 2615 2527 2271 1276 1045 48 33 22465 966 23110 2149 --
NM_014776chr1262747 2715 2555 1137 483 329 1624 22575 636 1459
NM_014779chr33886 789 263 11076 ----
NM_014781chr81288 2514 123 --1267
NM_014783chr1561764 1541 1107 536 259 182 ----1346
NM_014787chr122704 287 12059 ----
NM_014795chr22312 53 ------
NM_014803chr1022375 230 2820 42 --191
NM_014810chr162907 2743 2325 1380 1299 299 --32559 1267 58 13168
NM_014812chr121248 31 ------
NM_014813chr11388 --1376 162
NM_014822chr41642 ------
NM_014827chr141520 394 128 76 1674 ----
NM_014828chr1431840 1680 670 196 1998 --
NM_014829chr55822 758 658 105 25 ------
NM_014830chr1223801 204 --12659 11362
NM_014835chr2032188 1820 611 ------
NM_014839chr152270 2011 548 314 57 12236 ----
NM_014840chr1252747 2177 1103 849 78 --11034 --
NM_014841chr621310 428 ----1183
NM_014844chr1454101 3177 2738 1343 764 33394 1099 676 --190
NM_014850chr353807 3167 1475 1424 487 24105 520 --14810
NM_014857chr12208 85 ------
NM_014860chr232387 956 555 --1344 1621
NM_014871chr122672 88 ------
NM_014872chr972214 2015 1974 1877 876 542 363 --22078 2039 --
NM_014873chr133227 895 299 34650 1951 1587 11287 11314
NM_014875chr121077 770 ------
NM_014877chr17137652 7191 6520 5682 5249 5038 5002 3022 2443 2405 1685 1367 1347 27498 979 26398 1704 26016 4947
NM_014885chr4173 ------
NM_014888chr741497 1093 1080 500 11172 ----
NM_014892chr6128 ------
NM_014897chr1722759 2158 --1170 12575
NM_014898chr1942042 654 270 259 12320 21883 1765 11611
NM_014900chr211048 --11140 1409
NM_014902chr2021090 333 11519 --11567
NM_014904chr1083331 3189 2817 2721 2705 1488 568 140 22696 523 ----
NM_014905chr271585 1302 787 705 217 80 34 --1710 --
NM_014906chr1753726 3467 3072 3062 992 ------
NM_014912chr1033098 2600 2400 42197 1037 587 259 --169
NM_014913chr1821486 1291 1134 ----
NM_014918chr1511150 --1399 --
NM_014920chr653071 2688 2681 2369 74 32780 1257 503 11500 --
NM_014923chr1322240 691 12008 1471 --
NM_014924chr1452517 2328 976 861 752 ------
NM_014932chr311666 ------
NM_014933chr4----1379 --
NM_014934chr1393934 3899 3699 3252 2807 2706 552 93 71 1930 12425 13259
NM_014935chr153483 3309 1131 1018 402 33650 2864 188 21059 443 1515
NM_014936chr662793 2117 1847 724 478 298 1497 ----
NM_014938chr1222511 430 --22012 1859 --
NM_014939chr1831565 1222 958 11435 ----
NM_014942chr682406 2298 2054 1954 1877 1790 828 778 11965 ----
NM_014946chr272762 2634 2344 1133 639 621 423 ------
NM_014947chr163030 2574 2065 1154 568 38 --1842 21160 1025
NM_014950chr1411762 1703 ----
NM_014952chr1532059 809 233 1424 ----
NM_014956chr113859 313 69 ----2893 188
NM_014961chr421747 784 --1753 --
NM_014962chr2051799 1070 1035 708 192 12826 12179 --
NM_014964chr1732117 1528 599 ------
NM_014969chr1--1376 ----
NM_014982chr1474859 4748 4510 4335 3831 3360 412 34763 1989 729 13621 --
NM_014988chr442767 644 583 104 --1502 --
NM_014989chr631809 778 38 ------
NM_014991chr483166 2619 2434 1146 859 659 514 469 12605 --12571
NM_014992chr142702 76 1850 1328 --
NM_014994chr151457 1192 2910 213 12330
NM_014997chr722704 849 1288 12587 --
NM_014999chr1221106 615 11213 --1346
NM_015000chr1273013 2454 2291 2198 2072 305 278 ------
NM_015001chr12914 351 --1187 --
NM_015002chr1261962 1802 813 514 137 41 ----1842
NM_015008chr3103278 2950 2853 2635 2484 2412 2327 1406 395 73 13059 12452 --
NM_015009chr32254 196 --163 --
NM_015011chr1351099 449 390 72 38 ------
NM_015020chr1663503 3356 2877 2767 2395 638 23643 741 31129 360 74 --
NM_015025chr242158 1721 895 44 22649 468 ----
NM_015026chr1233999 268 134 33969 1261 845 24581 4243 --
NM_015032chr1332856 605 533 ------
NM_015039chr143863 972 586 110 13374 21519 69 --
NM_015040chr283440 3378 3327 2950 2522 2279 1241 390 ------
NM_015042chr1584001 3974 3759 2847 1499 908 695 181 --54293 4258 3632 2802 192 1156
NM_015044chr1623048 494 --22605 2280 21130 331
NM_015045chr1022279 1421 11856 ----
NM_015046chr922432 701 12201 ----
NM_015049chr243284 2458 1153 347 12696 ----
NM_015051chr912216 1406 22979 234 --
NM_015052chr771210 910 502 348 279 269 166 11323 ----
NM_015060chr71218 ------
NM_015064chr1263273 1344 1148 1019 771 540 23313 2407 ----
NM_015068chr753189 2575 1590 1468 319 1987 21502 1069 --
NM_015069chr161424 ------
NM_015071chr5116183 5633 4915 4834 4632 4206 2158 2020 1424 866 121 --21115 1038 --
NM_015074chr154936 4557 4011 1908 54 --23825 117 11349
NM_015075chrX31642 492 259 12277 42089 1984 334 177 --
NM_015076chr6104235 4076 3641 3627 3588 3483 3122 1582 907 627 1418 --33603 2849 790
NM_015082chr531028 871 683 22461 2406 --11815
NM_015085chr1764225 2706 2675 2654 1013 589 --23509 184 1377
NM_015087chr1362668 2245 2216 2027 585 572 32718 1709 758 ----
NM_015090chr185217 5184 2002 1548 960 872 740 594 --45131 2394 1419 619 --
NM_015091chr141544 ------
NM_015092chr1694631 4526 4116 3297 3289 1052 749 685 613 14405 ----
NM_015093chr631841 315 239 1166 ----
NM_015094chr2224385 1671 --41164 835 549 217 24161 845
NM_015097chr342254 1529 726 432 ------
NM_015100chr131991 1819 444 1373 ----
NM_015107chrX61761 733 634 293 200 83 --31628 1563 1508 --
NM_015115chr432898 2325 1146 12683 ----
NM_015116chr1331650 562 116 --166 --
NM_015132chr741882 1772 1538 1394 ------
NM_015137chr862468 2426 1644 1031 363 96 ------
NM_015141chr331860 501 36 11733 --22470 479
NM_015149chr132178 2022 641 ------
NM_015155chr1053143 2505 1017 912 412 22785 1140 --12632
NM_015156chr1463531 3522 722 397 155 133 ------
NM_015161chr1651540 1506 1465 1300 70 11433 ----
NM_015163chr1461428 1285 504 478 38 28 ------
NM_015170chr831579 1443 896 21940 804 ----
NM_015172chr121280 1086 ------
NM_015176chr12419 401 11523 ----
NM_015185chrX52370 2188 1898 1026 400 --21185 1007 --
NM_015191chr1121695 911 ------
NM_015192chr2032580 1998 1002 ----12918
NM_015197chr14113100 2985 2915 2574 2530 2307 2295 2248 2131 514 312 ----12580
NM_015198chr741301 1071 400 226 ------
NM_015199chr332872 1898 513 ----12119
NM_015200chr482431 1814 1779 1740 549 309 152 127 ------
NM_015209chr131833 1564 832 ------
NM_015210chr1821137 862 --128 1132
NM_015215chr112124 1992 12850 --
NM_015216chr511532 ------
NM_015225chr972094 1198 764 324 108 88 63 32971 266 212 ----
NM_015231chr112892 40 ------
NM_015250chr921698 807 11813 ----
NM_015251chr1632014 905 520 ------
NM_015252chr22983 120 ------
NM_015263chr15--1178 ----
NM_015265chr272614 2477 2020 1029 670 424 310 ------
NM_015269chr11623 181 ----
NM_015270chr1232077 1924 188 21971 1713 ----
NM_015271chr454301 4150 3290 891 697 23343 413 1758 --
NM_015272chr161242 12096 ----
NM_015275chr1221805 179 12117 ----
NM_015277chr1861854 1353 1341 536 268 187 ------
NM_015278chr662680 2226 1367 1219 826 653 --1297 --
NM_015282chr252610 2321 947 333 49 --22501 2408 --
NM_015294chr172328 117 --2730 36 --
NM_015299chr1453689 2799 1450 691 584 --21590 1342 14009
NM_015305chr1471972 1760 748 726 392 369 179 11471 1498 --
NM_015313chr1184400 3813 3720 3523 1914 1677 1366 112 ------
NM_015317chr262893 2682 2606 2406 2235 315 ------
NM_015321chr19104905 4731 4269 3922 3503 1762 1193 1020 793 433 11128 --1706
NM_015326chr132157 2009 779 --22782 868 --
NM_015328chr792712 2381 2258 2167 2069 776 659 502 107 22338 1920 12681 22554 832
NM_015335chr1242628 2129 721 431 1931 ----
NM_015336chr1232594 2443 912 ------
NM_015345chr632658 245 190 1172 12663 22719 983
NM_015346chr1451640 571 516 470 142 ----1246
NM_015347chr1252792 2223 2072 1854 984 12155 1524 2531 71
NM_015349chr632873 2703 425 ------
NM_015355chr1741789 1596 1568 355 ----1160
NM_015358chr2131096 861 414 ------
NM_015365chrX64299 4084 4013 3856 3666 3476 --3799 389 82 1739
NM_015367chr2211590 --1644 --
NM_015375chr1114865 3849 3177 1904 1773 1435 1146 1122 1043 569 327 23525 519 --12012
NM_015381chr2241758 1596 808 497 ------
NM_015385chr1042375 2239 806 333 22396 2246 12761 --
NM_015387chr241578 743 448 398 1828 ----
NM_015396chr311071 1408 11480 --
NM_015397chr93730 504 220 1340 ----
NM_015423chr1151589 1384 465 308 186 ------
NM_015429chr321071 419 ------
NM_015435chr831239 1162 73 ------
NM_015442chr3127 ------
NM_015443chr171136 ------
NM_015449chr12567 510 ------
NM_015453chr32835 25 1740 ----
NM_015455chr54972 946 759 654 24071 4064 1932 --
NM_015463chr2148 ------
NM_015472chr31385 ------
NM_015472chr31385 ------
NM_015477chr151173 1194 1700 1717
NM_015483chr73784 135 106 ------
NM_015488chr241530 1521 1462 1249 --11613 2628 225
NM_015497chr151398 --1456 --
NM_015503chr161735 ------
NM_015508chr311041 11029 ----
NM_015509chr1241409 1146 384 207 ------
NM_015514chr142505 97 1415 1198 --
NM_015520chr322010 782 ----11867
NM_015525chr62854 437 ------
NM_015541chr311283 ----1959
NM_015548chr61915 1351 ----
NM_015553chr684843 4717 4260 4016 3708 3439 1860 1562 14488 54271 4265 4120 1283 731 24147 3623
NM_015554chr1552271 2158 1987 821 349 12105 --12476
NM_015555chr631702 673 471 --1444 --
NM_015564chr533551 565 415 1243 ----
NM_015568chr2033673 3647 2997 --33218 1653 1174 --
NM_015570chr731469 504 228 ------
NM_015571chr641746 760 540 28 ----12367
NM_015575chr243633 3473 3024 1394 23389 822 11269 12724
NM_015576chr342655 2197 860 200 1177 11982 --
NM_015578chr1922119 1737 1278 ----
NM_015609chr162631 2426 1826 1192 731 590 --31056 1033 915 --
NM_015626chr1721173 928 ------
NM_015630chr2----1181 --
NM_015635chr931896 1821 738 12096 --11616
NM_015646chr1211162 ------
NM_015649chr191102 ------
NM_015651chr952017 1916 1619 860 137 ----1630
NM_015684chr141224 ------
NM_015691chrX52967 2375 2349 1971 1846 --12368 12119
NM_015695chr622118 337 --21819 36 --
NM_015719chr19191 ----1554
NM_015726chr151683 1317 1210 741 50 --11134 --
NM_015844chr18----1956 --
NM_015846chr18----1956 --
NM_015847chr18----1956 --
NM_015850chr882293 1881 1715 820 457 289 148 120 11939 12305 --
NM_015859chr141171 ------
NM_015866chr1--1291 1974 --
NM_015872chr121714 1374 ------
NM_015874chr41431 ------
NM_015878chr822232 1454 1889 11775 --
NM_015879chr1897015 6675 6505 5870 3324 1724 1708 693 461 37739 2238 451 46902 474 466 298 18583
NM_015886chr8115641 5616 5037 4377 4308 3670 1884 1806 1687 1279 880 --11244 --
NM_015888chr142164 532 499 71 --1538 --
NM_015902chr82887 326 1117 ----
NM_015904chr21256 --1757 --
NM_015906chr184736 4091 3772 1502 1131 759 494 105 13196 ----
NM_015912chr821027 226 12312 1715 --
NM_015916chr10138 ------
NM_015927chr161358 ------
NM_015955chr21500 ------
NM_015975chrX31739 373 274 21685 93 --11745
NM_015982chr171295 --1360 --
NM_015984chr12419 166 ------
NM_015995chr1574598 4414 4008 3540 1287 669 458 --24968 4563 23779 675
NM_016009chr154541 4251 947 519 258 44576 3267 3232 711 23762 3119 --
NM_016023chr841520 1478 848 340 ----1105
NM_016025chr1622028 1233 ------
NM_016032chrX1557 ------
NM_016037chr121090 768 ----1892
NM_016039chr14131 ------
NM_016040chr132027 969 440 11770 11983 --
NM_016059chr61246 ------
NM_016061chr221641 60 11383 11251 --
NM_016072chr1242425 2079 702 430 --11825 11644
NM_016075chr1373178 3139 2554 1018 832 556 506 21066 791 1942 --
NM_016076chr152960 2441 2140 1290 382 --23173 928 --
NM_016083chr673950 3836 3519 3392 3102 3071 621 1674 12940 --
NM_016096chr821586 543 21874 1818 ----
NM_016097chr181837 --1329 1996
NM_016098chr63437 196 172 ------
NM_016103chr51407 ------
NM_016106chr14131 ------
NM_016107chr521364 1169 ------
NM_016120chrX31191 1121 308 ------
NM_016125chr171395 ------
NM_016131chr232361 1592 915 11796 22140 1483 --
NM_016132chr1562378 2343 2251 2199 873 766 22266 2101 ----
NM_016147chr1141183 1138 853 262 --1956 1415
NM_016152chr341269 452 177 38 --11056 --
NM_016156chr1122246 501 32100 2057 248 12123 --
NM_016194chr152213 70 --11466 --
NM_016206chr3108817 8761 7775 7626 3049 2617 1912 1850 1651 544 38845 2143 590 13054 27499 6110
NM_016211chr4----1379 --
NM_016213chr152178 58 ------
NM_016217chr623418 2844 23197 1122 --1469
NM_016226chr121373 ------
NM_016227chr111266 --1133 --
NM_016230chr61398 ------
NM_016231chr1721152 131 --11122 --
NM_016248chr1323198 2815 --23682 200 --
NM_016252chr22881 163 ----1289
NM_016260chr2117139 6586 5665 5590 2395 2357 1319 850 562 167 99 37197 5898 5303 ----
NM_016272chr2242445 2195 1931 120 --21765 474 --
NM_016275chr352771 1812 974 301 141 12429 ----
NM_016281chr1231088 976 878 ------
NM_016289chr21858 1913 ----
NM_016303chrX2126 90 ------
NM_016315chr231187 1175 278 21487 370 ----
NM_016316chr2----1527 --
NM_016320chr1121110 61 ----1992
NM_016322chr952924 2794 1113 955 444 --12550 173
NM_016351chr7188 143 ----
NM_016352chr731444 1078 83 --11340 1317
NM_016357chr1231230 803 486 ------
NM_016376chr1744316 3914 3288 1617 ----12910
NM_016395chr152123 62 11345 --1269
NM_016396chr1562335 2003 1024 946 654 618 1872 --22497 174
NM_016422chr1132328 2193 458 22368 440 ----
NM_016424chr1741966 1931 466 249 1630 ----
NM_016436chr2042515 2471 2318 1070 1877 ----
NM_016448chr151903 1853 1525 698 121 11618 1454 --
NM_016467chr221156 177 11324 11364 --
NM_016468chr142176 75 ------
NM_016485chr641531 1510 905 63 1656 11729 --
NM_016505chr12655 182 ----1693
NM_016507chr1711086 1227 --1238
NM_016513chr653071 2688 2681 2369 74 32780 1257 503 11500 --
NM_016519chr4267 23 ------
NM_016526chr1172442 2153 1896 1884 325 251 223 --31698 1539 147 --
NM_016530chr1563765 3097 2791 666 476 258 43689 2917 2764 607 ----
NM_016531chr454098 4069 3625 1266 412 13800 2897 63 --
NM_016542chrX41162 633 472 297 ------
NM_016548chr931068 618 444 ------
NM_016562chrX51588 1031 632 203 26 ------
NM_016603chr51723 21534 250 ----
NM_016604chr521152 855 ----1157
NM_016607chrX41609 226 219 187 ------
NM_016620chr121452 532 21418 486 ----
NM_016623chr8------191
NM_016628chr102729 634 ------
NM_016641chr1621344 141 11240 ----
NM_016654chr1521342 1080 11214 ----
NM_016733chr2251232 618 392 183 141 --11104 --
NM_016818chr211564 ------
NM_016824chr1021809 273 1288 ----
NM_016830chr121518 ------
NM_016831chr141504 947 841 178 ------
NM_016834chr1773663 2805 2666 2526 1482 1194 1030 --13448 --
NM_016835chr1773663 2805 2666 2526 1482 1194 1030 --13448 --
NM_016841chr1773663 2805 2666 2526 1482 1194 1030 --13448 --
NM_016929chr683651 3565 1662 1501 1132 334 154 89 14142 21667 542 --
NM_016930chr441061 672 308 69 ------
NM_016940chr211444 ------
NM_016946chr143422 2796 2576 2336 43219 2707 1325 1254 1128 12205
NM_016950chr41568 ------
NM_017409chr121528 ------
NM_017412chr81428 11383 ----
NM_017415chr574261 3795 1590 1565 940 913 47 11837 23512 1665 --
NM_017420chr1442922 2511 1064 994 23056 2566 ----
NM_017423chr43772 545 29 1209 1809 --
NM_017440chr122631 105 ------
NM_017447chr2164074 4029 892 639 576 253 13059 ----
NM_017456chr1731597 616 326 --1590 --
NM_017491chr43854 398 347 ------
NM_017519chr61951 ------
NM_017526chr13635 113 50 ------
NM_017544chrX1640 ------
NM_017545chr202577 505 ------
NM_017548chr321755 1688 ----1338
NM_017563chr345153 4038 765 457 36377 2125 803 41587 1220 387 43 13904
NM_017577chr331413 1193 665 11573 ----
NM_017582chr161432 1284 518 329 128 52 --184 --
NM_017594chr942873 1070 603 382 12527 ----
NM_017596chr194588 4302 3780 3204 1257 448 396 163 141 11215 21018 760 --
NM_017599chr1261804 1776 1702 1392 771 167 11369 --1323
NM_017610chr1542062 1899 1659 83 11767 --11304
NM_017613chr211350 ------
NM_017626chr1041425 1223 541 360 --11175 --
NM_017628chr474499 4421 3263 1897 1431 1382 229 23894 550 11202 12022
NM_017629chr131680 1236 565 1246 --1434
NM_017632chr41313 ------
NM_017633chr633707 1522 1475 12689 --23138 901
NM_017634chr861712 1270 723 497 269 243 ------
NM_017635chr1121332 35 ------
NM_017637chr9129427 9348 9228 8430 7958 7390 6043 5956 5735 3120 3102 723 49137 3130 2139 892 28764 6360 --
NM_017640chr62312 151 ------
NM_017641chr122968 271 ------
NM_017643chr1722061 856 ------
NM_017644chr395136 4859 4737 4029 3414 1165 301 246 83 14540 --33775 3635 1196
NM_017650chr795895 5795 5230 3800 1469 965 869 700 574 25465 1143 ----
NM_017658chr1454524 4509 3503 1345 717 --13932 --
NM_017661chr1531192 376 131 ------
NM_017662chr932076 1794 39 1275 11515 --
NM_017664chr132671 369 1115 ----
NM_017666chrX42028 1839 1751 610 ----11414
NM_017686chr121022 61 --1853 11028
NM_017693chr1311664 21614 537 ----
NM_017709chr174037 3856 2947 2872 1690 850 366 ------
NM_017719chr362345 2331 2190 968 765 121 ------
NM_017721chr191331 ------
NM_017724chr34810 714 243 45 ----1291
NM_017736chr1632507 382 307 2942 649 1707 --
NM_017737chr151681 1630 876 418 386 ------
NM_017739chr11203 --1110 --
NM_017741chr442237 678 551 26 ------
NM_017742chr1831861 756 22 ------
NM_017744chr141773 1639 577 263 12194 1909 183
NM_017745chrX1111 ------
NM_017748chr172627 318 ----1346
NM_017752chrX42032 608 591 466 22109 232 ----
NM_017753chr9--2762 56 1380 --
NM_017754chr684513 4299 3459 3078 1673 1246 1018 569 24217 3499 24316 1762 --
NM_017763chr174367 259 123 57 ------
NM_017769chr1423134 1183 22596 238 ----
NM_017779chr152639 2572 2067 1854 401 --12454 --
NM_017780chr81737 1793 ----
NM_017789chr2151 ----174
NM_017798chr2021204 1116 ------
NM_017799chr1421479 1374 11861 ----
NM_017801chr372594 1945 1767 1712 1024 389 25 1223 --11977
NM_017811chr942336 2291 2053 1933 --23158 1967 --
NM_017812chr71623 1733 ----
NM_017813chr885660 5441 5239 5201 5167 3717 941 448 24393 417 --24894 2053
NM_017824chr1052659 2565 2076 347 213 22242 669 --12717
NM_017830chr4166 ------
NM_017847chr12529 164 ------
NM_017848chrX44480 514 277 157 14599 44396 4186 709 490 --
NM_017851chr152911 65 175 --131
NM_017866chr81801 ------
NM_017869chr161587 --1134 --
NM_017887chr11387 ------
NM_017893chr10143 --166 11156
NM_017902chr10135586 4494 4463 4399 4390 3998 1824 1647 1256 1059 1014 990 206 1434 55379 4197 1888 524 415 15692
NM_017911chr22------2515 249
NM_017913chr91434 ------
NM_017919chr975194 3915 3762 3538 2210 1168 1103 15000 21557 622 21296 1076
NM_017925chr961915 1805 1658 1622 255 160 21470 398 1240 --
NM_017934chr6--124 ----
NM_017938chrX3618 541 407 11947 21442 1391 --
NM_017943chr1421025 259 ------
NM_017944chr1122993 787 2991 443 ----
NM_017946chr721048 896 ------
NM_017958chr272613 2584 1969 1156 1127 608 483 1258 ----
NM_017966chr1141296 1014 362 318 ------
NM_017969chr21198 ------
NM_017974chr221167 976 1287 ----
NM_017987chr1051467 1460 644 502 36 ------
NM_017988chr122959 93 --1813 1675
NM_017990chr16124186 3857 3772 3294 3174 3132 2770 1568 535 151 122 108 ----1561
NM_017994chr73941 516 257 1549 ----
NM_017998chr921379 341 ----11465
NM_018010chr381643 1565 1190 583 472 449 359 232 1457 ----
NM_018014chr241332 1308 487 312 ------
NM_018015chrX1233 3823 739 244 ----
NM_018017chr1082834 2427 2284 2219 2006 1986 1058 592 ------
NM_018028chr191260 --4383 338 313 265 --
NM_018030chr1821099 85 ------
NM_018045chr162515 2240 2225 2061 901 332 --1641 22482 934
NM_018048chr1242051 1846 1313 1254 ------
NM_018053chr12777 565 --2345 284 1785
NM_018061chr121444 580 11627 --1667
NM_018062chr2--1366 ----
NM_018063chr10--1353 ----
NM_018070chr1----1156 --
NM_018078chr42933 378 1674 ----
NM_018084chr242295 1285 1060 258 ------
NM_018085chr148081 6998 771 399 25210 2222 12038 36765 6378 2495
NM_018086chr211558 3743 656 384 --11409
NM_018090chr111183 ------
NM_018092chr161609 1501 1307 11689
NM_018098chr32226 167 ------
NM_018107chr145868 820 383 281 34 --124 --
NM_018112chr93999 706 50 ------
NM_018115chr44804 745 712 693 ------
NM_018117chr101507 ------
NM_018121chr1012209 12024 12613 --
NM_018126chr42602 57 ------
NM_018128chr1741042 597 436 182 ------
NM_018133chr321796 427 ------
NM_018144chr10----1261 --
NM_018145chr151498 1422 ----
NM_018151chr21785 ------
NM_018155chr332955 1221 871 ------
NM_018157chr1232533 2109 1228 12378 ----
NM_018171chr121857 --148 --
NM_018179chr121231 ------
NM_018181chr1821303 133 ------
NM_018182chr1741837 1634 402 244 ----1823
NM_018184chr331544 632 372 21357 522 ----
NM_018192chr32980 167 1151 --1702
NM_018195chr11----21580 1456 --
NM_018199chr1431248 382 372 ------
NM_018203chr12560 22 --2287 90 --
NM_018206chr161122 ------
NM_018208chr14960 926 870 414 141 1476 --
NM_018211chr161757 1567 740 627 64 46 ------
NM_018214chr621086 23 ------
NM_018221chr2166 ----157
NM_018227chr41556 12343 13138 --
NM_018234chr222154 1858 12173 1431 12087
NM_018241chr441022 903 723 48 --1383 1410
NM_018243chr483861 2878 2742 959 913 644 331 59 11229 ----
NM_018247chr61595 1899 12883 1823
NM_018250chr8----121 --
NM_018254chr132303 1860 857 --1343 --
NM_018257chr2052098 1765 1025 736 63 12029 ----
NM_018263chr252371 2244 2051 770 336 1549 --12510
NM_018286chr172915 355 --1205 --
NM_018287chr1011204 ------
NM_018293chr332190 2069 883 ------
NM_018299chr843145 2607 2228 924 --1122 --
NM_018302chr432267 1602 411 1476 ----
NM_018312chr1142108 1722 875 849 11713 ----
NM_018314chr114678 251 215 188 ------
NM_018325chr961115 1023 560 424 385 258 --11493 --
NM_018330chr1021490 512 ------
NM_018332chr161121 ----1127
NM_018339chr931659 746 362 ------
NM_018348chr162337 283 ------
NM_018361chr843787 3687 914 767 14078 ----
NM_018362chr1133957 2613 947 14018 --13281
NM_018364chr143633 2984 1273 229 ------
NM_018367chr1162301 1824 1744 1640 567 369 22171 263 ----
NM_018369chr53647 620 286 --1769 --
NM_018372chr13470 216 201 151 ----
NM_018373chr1496135 5063 2533 2450 1411 1182 1150 578 319 11042 35231 4660 1222 15529
NM_018387chr92392 134 1215 ----
NM_018388chrX--1396 ----
NM_018403chr353503 2918 2650 1601 709 ------
NM_018406chr3--2362 161 --128
NM_018416chr1252412 2322 596 583 384 ----1183
NM_018424chr961921 1831 1744 1338 1317 705 ------
NM_018429chr522818 649 12556 ----
NM_018440chr8157889 7688 6984 6854 6645 6223 5717 5436 3189 3099 2514 2115 1309 828 208 48213 7739 6737 91 --28264 3032
NM_018448chr1211135 11185 ----
NM_018452chr6_random52561 2476 1359 1075 572 --12926 --
NM_018462chr34591 323 253 226 ------
NM_018471chr21420 1442 ----
NM_018476chrX2190 92 ------
NM_018477chr14--1916 11076 --
NM_018482chr882574 2261 2203 827 816 511 171 52 1682 ----
NM_018490chr112423 104 --11475 --
NM_018509chr1731223 231 99 --125 --
NM_018553chr1721358 185 --1137 --
NM_018557chr221511 99 ------
NM_018566chr185020 4565 3236 2066 1949 1729 1568 219 21511 1447 11390 136
NM_018571chr21607 ------
NM_018590chr1041418 271 83 62 --168 --
NM_018638chr1275365 5270 4830 1936 958 834 130 35314 2019 1559 22251 1688 12001
NM_018650chr141783 845 396 90 ------
NM_018686chr121139 ------
NM_018689chr1581974 1861 1649 984 278 271 194 106 --1553 --
NM_018695chr532146 2096 441 --1376 --
NM_018700chr531275 1178 179 ------
NM_018710chr821372 928 ------
NM_018712chr1131535 1461 1106 --11111 143
NM_018715chr131989 676 580 --1172 11646
NM_018717chr452255 1981 1097 920 903 --1825 --
NM_018834chr51261 ------
NM_018836chr151152 944 251 135 22 ------
NM_018841chr163945 3320 1078 1023 557 73 33929 3854 2880 11191 --
NM_018847chr941459 541 393 49 ------
NM_018890chr731255 999 322 ------
NM_018898chr532043 1498 91 ------
NM_018899chr532043 1498 91 ------
NM_018900chr532043 1498 91 ------
NM_018901chr532043 1498 91 ------
NM_018902chr532043 1498 91 ------
NM_018903chr532043 1498 91 ------
NM_018904chr532043 1498 91 ------
NM_018905chr532043 1498 91 ------
NM_018906chr532043 1498 91 ------
NM_018907chr532043 1498 91 ------
NM_018908chr532043 1498 91 ------
NM_018909chr532043 1498 91 ------
NM_018910chr532043 1498 91 ------
NM_018911chr532043 1498 91 ------
NM_018945chr651035 855 479 378 146 13541 43647 2631 2250 151 --
NM_018951chr731200 889 460 ------
NM_018962chr2131434 1249 357 1266 ----
NM_018976chr1212182 --12192 --
NM_018979chr1242607 1789 1705 871 ------
NM_018993chr2041377 1370 408 259 ------
NM_018999chr1024038 1819 1928 13263 --
NM_019001chr353987 1725 1010 868 541 31783 1629 226 23172 47 --
NM_019005chr71102 178 ----
NM_019008chr2273514 3291 2790 436 341 100 70 183 32841 1506 327 --
NM_019022chr1893189 3122 2681 2338 2204 1086 374 277 228 12048 ----
NM_019024chr2180 ------
NM_019027chr432355 870 375 ------
NM_019035chr441946 1830 751 509 1211 --1618
NM_019050chr462229 1979 1566 852 796 122 ------
NM_019058chr101534 1280 ----
NM_019060chr1----1318 --
NM_019063chr241635 865 625 414 ------
NM_019072chr583707 3645 3574 3518 3310 2950 2895 853 --11578 11605
NM_019083chr121453 1230 21247 159 --11299
NM_019084chr101734 31867 910 382 1791 11979
NM_019087chr511551 ------
NM_019096chr62449 415 ------
NM_019098chr821868 743 ------
NM_019102chr71447 ------
NM_019102chr71447 ------
NM_019106chr2263005 2527 1366 898 834 717 1320 22353 876 --
NM_019114chr942533 1947 1861 966 21716 556 ----
NM_019116chr1673340 3073 1318 1284 1125 757 666 1619 13103 --
NM_019555chr32143 42 ------
NM_019556chrX51376 1096 435 69 61 ------
NM_019557chr13883 58 46 --183 --
NM_019558chr2195 1287 1112 --
NM_019590chr1031283 1177 188 --11194 --
NM_019592chr91136 --2118 69 1643
NM_019593chr2043044 2248 2114 924 1428 --12796
NM_019596chr2162948 2876 2316 814 323 25 ----1988
NM_019600chr151526 ----1569
NM_019604chr1141105 960 755 452 ----2308 243
NM_019610chr161549 1361 809 388 300 111 ------
NM_019842chr61138 ------
NM_019845chr22617 271 ------
NM_019857chrX51117 427 169 79 35 1551 --11336
NM_019859chr101153 --11444 --
NM_019903chr1021809 273 1288 ----
NM_020039chr1241936 1854 1626 305 1431 41202 274 170 71 --
NM_020116chr421667 1234 ------
NM_020120chr21395 2387 205 ----
NM_020122chr2105996 5897 4262 1899 1453 551 527 237 184 68 22207 362 --15434
NM_020131chr131495 1304 236 --31625 273 25 --
NM_020144chr722008 1945 2735 28 ----
NM_020147chr152205 64 ------
NM_020148chr1832363 826 705 11168 21027 278 --
NM_020150chr1041856 1473 575 34 21890 462 --12198
NM_020155chr11----188 --
NM_020157chr2021034 650 1117 1821 --
NM_020159chr441683 1570 1170 597 11596 31517 670 336 --
NM_020168chr1551263 1221 1031 970 845 1985 21117 83 --
NM_020177chr532784 1182 413 ----12929
NM_020189chr8--1176 ----
NM_020193chr1111029 ------
NM_020198chr1721597 1286 1324 ----
NM_020199chr52938 295 1225 ----
NM_020235chr33371 304 35 ------
NM_020239chr151768 709 569 529 123 22077 139 22239 438 --
NM_020244chr12----126 --
NM_020246chr7------1300
NM_020251chr112658 543 ------
NM_020307chr3146 ------
NM_020309chr193692 356 167 ----2250 103
NM_020336chr20103751 3367 2927 2886 2634 2558 1150 1139 1131 175 1379 ----
NM_020337chr432358 884 169 31952 845 135 ----
NM_020338chr1033259 2667 1324 13726 1403 --
NM_020340chr632206 1872 649 ----11521
NM_020341chr2021650 558 ------
NM_020342chr221848 110 ------
NM_020346chr1151358 1223 677 471 352 21649 1616 ----
NM_020357chr351569 650 382 270 84 ------
NM_020381chr621458 1422 --21389 777 1644
NM_020382chr1211447 1111 1430 --
NM_020390chr334706 1736 1082 34856 3163 1666 11004 31655 1168 1031
NM_020403chr131642 ------
NM_020420chrY31834 1305 104 1552 ----
NM_020423chr11491 164 ----
NM_020425chr652041 1972 1274 387 228 21522 181 ----
NM_020432chr732172 2036 61 11906 ----
NM_020440chr153067 2978 2246 1150 1113 ------
NM_020443chr1107027 5281 2543 2305 1908 1445 1036 816 167 54 --32589 1859 1464 --
NM_020444chr551531 1411 560 273 60 ------
NM_020445chr71781 ------
NM_020449chrX2286 133 ------
NM_020452chr151667 1329 661 389 320 11611 ----
NM_020456chr13170 31743 634 619 12233 --
NM_020463chr22955 442 ------
NM_020466chr674731 4582 4539 4304 4198 1881 468 33555 1407 1123 11800 --
NM_020473chrX11900 21839 659 1122 --
NM_020474chr181329 1606 11792 151
NM_020475chr842347 814 744 503 --1174 --
NM_020476chr842347 814 744 503 --1174 --
NM_020477chr842347 814 744 503 --1174 --
NM_020478chr842410 877 807 566 --1237 --
NM_020480chr842347 814 744 503 --1174 --
NM_020526chr121241 646 1673 21790 299 11848
NM_020532chr23585 249 164 ------
NM_020638chr1241922 1485 547 317 11887 ----
NM_020640chr32835 633 21421 701 ----
NM_020644chr115935 759 286 260 90 ------
NM_020647chr842253 1816 1452 414 --11570 1528
NM_020651chr211446 21543 438 ----
NM_020654chr321356 336 ------
NM_020655chr1621374 1169 11015 11410 1974
NM_020682chr10------1878
NM_020696chr3128 ------
NM_020699chr174708 4497 3859 3819 831 637 269 --11561 --
NM_020703chr1----1387 --
NM_020704chr742100 1804 1704 62 ------
NM_020708chr2052342 1985 1893 1573 131 ----12385
NM_020713chr2043006 2746 2720 2291 --42874 2593 604 505 --
NM_020715chr1452289 1873 749 258 40 --21780 1678 1430
NM_020717chrX64588 3965 1899 611 452 391 --14792 --
NM_020718chr16146159 5899 5878 5561 4256 4139 2544 2173 2065 1977 1651 1620 1148 717 ------
NM_020724chr432645 2216 963 32547 1070 568 ----
NM_020727chr2143957 1258 1029 473 23528 2451 11115 --
NM_020728chr712306 1120 22457 2258 11154
NM_020732chr61951 ------
NM_020734chr1222156 2122 12604 1880 --
NM_020739chr1553261 732 612 581 233 1528 ----
NM_020742chrX22537 1885 12087 ----
NM_020747chr52937 373 ------
NM_020748chr172817 202 ----11619
NM_020749chr841769 1480 1426 187 11695 ----
NM_020752chr1062755 2080 1026 909 659 429 ------
NM_020760chr231478 574 51 ------
NM_020766chrX84279 4180 3008 1574 884 818 534 519 13160 ----
NM_020768chr542793 263 243 142 --1356 --
NM_020769chrX1143 1322 1930 --
NM_020772chr17138305 8013 7590 7249 6348 6224 5770 5248 1996 1961 1696 1555 1139 ----15993
NM_020774chr18105729 4123 2195 1978 1564 1293 1230 1065 843 242 34008 2399 1479 24318 2317 --
NM_020778chr1574849 4457 4236 1946 1673 727 519 --44627 3207 1789 1663 --
NM_020781chr721099 585 --23056 506 13162
NM_020783chr183789 747 230 --1100 --
NM_020792chr362778 945 852 606 316 108 ------
NM_020794chr111100 ----1365
NM_020795chr1731796 1727 713 --21753 556 11245
NM_020801chr54820 750 531 48 ------
NM_020805chr181361 ----1488
NM_020809chr1141986 1584 775 162 --21661 1589 --
NM_020819chr641237 1207 250 109 136 ----
NM_020825chr1663686 2746 2497 1014 940 603 --23554 300 11338
NM_020830chr242872 2845 2664 2070 1234 32851 1290 899 --
NM_020834chr143449 432 91 --11251 1769
NM_020841chr1273872 3436 3359 2957 2932 1549 306 1974 ----
NM_020845chr1252282 1893 1754 1712 661 1977 1789 1164
NM_020850chr16112908 2579 2360 1135 1070 971 908 870 843 340 122 12412 12248 13101
NM_020854chr1821449 993 --11533 --
NM_020858chr1522348 412 2448 75 --1274
NM_020861chr6147 1506 ----
NM_020866chr131124 ------
NM_020868chr22691 432 ------
NM_020870chr432022 1981 423 ------
NM_020872chr351710 1295 648 605 274 1228 --1117
NM_020886chr1131227 1054 41 1925 21059 46 --
NM_020899chr1742507 1938 910 753 --1827 --
NM_020909chr2124027 3970 3699 3369 2965 2802 2636 1375 703 615 453 421 1797 21669 349 --
NM_020918chr1031435 1342 831 11470 1858 --
NM_020919chr221207 478 1919 ----
NM_020920chr141376 ------
NM_020922chrX71896 1878 1716 1672 1592 520 385 ----1699
NM_020927chr1652249 1733 1492 435 206 ------
NM_020935chr231859 1225 95 13808 --14257
NM_020940chr1042939 2933 2193 1875 12682 ----
NM_020946chr93649 526 246 11148 11704 --
NM_020948chr152916 949 326 242 154 175 1248 --
NM_020951chr1941519 928 541 91 1329 11874 11746
NM_020952chr91547 1856 ----
NM_020956chr1984020 3790 3644 3166 3007 1140 1099 412 --44027 779 570 208 --
NM_020962chr1542127 1778 1546 808 --2924 768 1851
NM_020964chr1894733 4385 4148 3963 3892 1860 1440 1270 656 13902 23089 755 13480
NM_020973chr43535 150 91 ------
NM_020975chr1031367 343 168 ------
NM_020981chr22749 663 1243 ----
NM_020983chr1232077 1924 188 21971 1713 ----
NM_020987chr1011031 1296 1553 --
NM_020988chr1631072 889 486 --11316 --
NM_021003chr142541 29 ------
NM_021005chr152409 245 ------
NM_021007chr242401 2300 2250 619 ------
NM_021020chr852536 2501 2185 1040 912 --12766 12415
NM_021033chr1342359 1163 825 157 ------
NM_021035chr2061212 1009 495 422 273 21 11266 ----
NM_021061chr894508 4366 4136 4057 3975 3784 3458 1161 185 33347 3281 751 43980 1554 1548 1270 --
NM_021069chr4--22109 1634 21803 223 --
NM_021072chr552008 1822 1697 556 297 --177 --
NM_021081chr20127 ------
NM_021083chrX2842 338 12975 1801 13009
NM_021088chr251466 1436 1373 877 465 1816 --11632
NM_021090chr2253532 3492 3478 309 214 --24925 193 --
NM_021097chr242427 758 571 101 --1600 13064
NM_021101chr332119 917 380 12199 2949 663 --
NM_021109chrX162 ------
NM_021109chrX162 ------
NM_021110chr82711 89 --1484 --
NM_021111chr931161 433 47 ------
NM_021116chr7118924 8008 7969 7611 7367 7043 3559 3232 2351 1846 1405 17256 1627 36868 5584 1648
NM_021127chr1821315 480 11376 ----
NM_021132chr102901 181 ------
NM_021133chr131430 454 33 11530 ----
NM_021140chrX1719 1208 185 --
NM_021145chr72757 158 ------
NM_021155chr1953020 2394 1072 937 136 12934 22049 655 1682
NM_021158chr201840 --173 --
NM_021177chr61242 --1255 --
NM_021183chrX52479 572 452 440 374 ------
NM_021190chr111069 ----1548
NM_021202chr2072860 2715 2184 2106 1131 897 590 --2320 172 --
NM_021204chr42752 297 ------
NM_021215chr2021636 326 12166 ----
NM_021224chr9--1418 ----
NM_021229chr1241022 361 309 148 ------
NM_021237chr31226 ------
NM_021238chr1221573 818 --21914 1502 1190
NM_021239chr1431258 1157 266 ------
NM_021249chr1431216 335 35 11385 --21666 1631
NM_021252chr1031414 295 231 21358 622 ----
NM_021253chr631390 957 444 ------
NM_021255chr1453514 3401 3017 717 74 23532 3026 ----
NM_021619chr921277 266 --11166 --
NM_021622chr1032325 864 24 32257 2152 221 2115 29 --
NM_021633chr141120 1016 866 251 21201 330 ----
NM_021643chr231815 1473 749 21452 1233 --1348
NM_021647chr483801 3554 3146 2971 1252 910 773 149 44487 3928 550 278 ----
NM_021648chr691956 1685 1079 811 683 551 321 295 168 ----1798
NM_021705chr631506 501 304 11435 ----
NM_021722chr7--255 43 ----
NM_021723chr7188 143 ----
NM_021728chr141746 ------
NM_021738chr102677 283 ----1670
NM_021813chr685702 5475 5456 4472 4104 4071 1460 186 1500 24109 2220 1346
NM_021814chr621726 1316 11534 ----
NM_021818chr1431309 1081 336 ------
NM_021911chr525363 1403 21307 116 ----
NM_021912chr1563936 3838 3317 1114 643 60 21667 515 --13994
NM_021913chr1951822 1721 523 396 123 --11456 --
NM_021914chr1442087 609 451 261 22453 590 ----
NM_021935chr34826 785 420 44 ------
NM_021940chr61347 21499 1338 1618 --
NM_021942chr4--2844 155 ----
NM_021943chr621900 604 ------
NM_021945chr653542 1072 874 858 424 --11243 1101
NM_021949chrX22786 207 --1237 --
NM_021951chr93908 312 95 ------
NM_021954chr1342756 2567 2324 1246 --21292 452 --
NM_021959chr65836 828 707 279 93 --163 --
NM_021960chr152585 2212 2162 2114 515 ------
NM_021961chr1197148 6973 6641 6623 6441 5876 2995 2529 1413 24672 1305 26278 1418 14554
NM_021962chr1772345 1903 1809 777 664 503 228 ------
NM_021964chr356621 4145 2559 2479 188 14785 ----
NM_021965chr93905 87 76 --1546 --
NM_021970chr4--128 ----
NM_021977chr643685 3187 3169 3089 --12856 --
NM_021979chr141367 ------
NM_021980chr1031037 963 531 1103 ----
NM_021992chrX140 ------
NM_021998chrX150 11273 ----
NM_021999chr131125 1161 ----
NM_022037chr21217 1708 ----
NM_022048chr15146188 6120 5826 4455 4176 2378 2258 1606 1410 1370 1300 834 257 198 12018 16202 --
NM_022060chr1441369 1288 1040 49 ------
NM_022062chr1131990 1908 1471 ------
NM_022068chr184633 603 495 226 --1163 --
NM_022073chr1441230 532 345 263 1153 1114 21191 627
NM_022075chr1----2654 610 --
NM_022085chr651420 614 571 532 392 --21254 1180 --
NM_022091chr642298 2120 1733 900 2958 398 ----
NM_022114chr133501 3315 596 11403 3991 660 278 --
NM_022118chr132254 40 1194 1151 --
NM_022124chr10----1200 --
NM_022129chr103305 103 76 11201 1953 --
NM_022130chr551450 375 295 277 255 ------
NM_022132chr5--1424 --1135
NM_022133chr861339 748 723 584 414 388 ------
NM_022166chr16126363 6120 6035 5538 5522 4795 4657 4386 1671 490 478 182 35485 4599 1655 35609 4961 2350 24633 4590
NM_022170chr721600 195 ------
NM_022173chr21217 1708 ----
NM_022343chr951329 845 411 317 219 ------
NM_022351chr8103500 3285 3271 2541 1486 1330 1022 1004 988 513 1371 12974 --
NM_022373chr71766 1900 ----
NM_022374chr2128 1333 ----
NM_022444chr7124 ----11534
NM_022458chr712612 1806 12133 --
NM_022459chr1356199 6061 4654 1512 1478 15122 ----
NM_022462chr1973497 3322 3242 2984 1268 165 24 1285 1304 41131 996 697 147
NM_022465chr1272696 2442 1212 1120 1080 560 524 ----1504
NM_022475chr42567 251 ------
NM_022476chr164914 335 187 81 ------
NM_022477chr2031752 156 94 ----21342 1207
NM_022482chr2072326 1728 432 418 394 296 213 ------
NM_022484chr761381 1313 1298 1108 894 100 --1108 --
NM_022494chr102445 353 ------
NM_022552chr21408 ------
NM_022553chr61131 --1418 --
NM_022566chr151593 --1416 --
NM_022572chr241530 1521 1462 1249 --11613 2628 225
NM_022650chr55967 919 888 301 188 ------
NM_022652chr122937 813 ------
NM_022658chr1251108 1010 870 166 134 ------
NM_022659chr8134 ------
NM_022726chr621780 1755 11474 ----
NM_022728chr7196 1652 ----
NM_022731chr12222 75 ------
NM_022737chr192977 283 11147 1470 --
NM_022753chr182761 2495 2227 1954 877 742 629 356 1368 1281 --
NM_022754chr53716 225 148 ----11303
NM_022756chr111083 --21467 1088 --
NM_022758chr652985 2903 2540 1172 924 --33073 2563 2060 --
NM_022763chr352843 1245 894 636 287 33001 1257 1021 1813 --
NM_022771chr121181 ------
NM_022776chr331257 593 243 ----11295
NM_022781chr922891 462 13051 --1371
NM_022782chr12--1150 ----
NM_022802chr1021334 1234 ------
NM_022826chr221115 1029 --1960 --
NM_022828chr511389 1717 ----
NM_022831chr131851 1660 489 ------
NM_022836chr141626 1343 107 99 11817 31430 628 571 --
NM_022838chrX1259 ------
NM_022845chr1641849 726 405 247 --12086 --
NM_022893chr262683 2348 1164 958 865 767 ------
NM_022898chr1474513 4005 3948 3871 3513 963 76 --11284 11314
NM_022901chr921636 1585 --11792 --
NM_022902chr51297 ------
NM_022912chr232283 2015 110 137 ----
NM_022918chr1132116 1885 1403 1562 12125 --
NM_022965chr43567 370 196 --11382 --
NM_022977chrX21861 370 21868 533 12279 --
NM_023000chr1411222 11685 ----
NM_023001chr1411222 11685 ----
NM_023012chr122494 249 ------
NM_023037chr132324 120 ------
NM_023039chr52454 39 187 ----
NM_023079chr1771426 1294 1167 634 507 248 89 ------
NM_023105chr882293 1881 1715 820 457 289 148 120 11939 12305 --
NM_023106chr882293 1881 1715 820 457 289 148 120 11939 12305 --
NM_023110chr882293 1881 1715 820 457 289 148 120 11939 12305 --
NM_023111chr882293 1881 1715 820 457 289 148 120 11939 12305 --
NM_023923chr163715 3483 3353 545 368 333 13706 33430 3021 488 12704
NM_023927chr521308 1043 134 1361 --
NM_023929chr872581 2546 2535 2165 1797 882 332 1910 --1700
NM_024007chr553181 999 736 630 215 12255 11062 --
NM_024015chr172443 114 --11118 --
NM_024017chr171173 --11466 --
NM_024045chr103182 167 46 ------
NM_024052chr1732462 2247 1990 ----2556 253
NM_024061chr73558 183 78 --1408 --
NM_024089chr131139 ------
NM_024111chr154645 618 188 143 --1734 --
NM_024294chr652985 2903 2540 1172 924 --33073 2563 2060 --
NM_024345chr954751 4744 4676 1198 1095 35701 4940 1947 ----
NM_024348chr92282 82 ------
NM_024411chr20----1142 --
NM_024416chr941491 1352 1324 1051 21517 106 ----
NM_024422chr183618 388 252 ------
NM_024423chr1844254 4147 4123 1224 --12792 --
NM_024501chr22272 64 1280 1531 --
NM_024511chr473463 2528 2176 1175 823 788 284 --23558 401 22204 428
NM_024524chr363019 2041 910 679 640 355 1955 ----
NM_024529chr1------11069
NM_024539chrX1475 --1378 --
NM_024541chr1031251 552 482 --21501 1188 1668
NM_024546chr133497 316 65 ------
NM_024548chr31110 1348 ----
NM_024551chr1232563 949 688 1189 ----
NM_024551chr1232563 949 688 1189 ----
NM_024561chr1331194 1096 188 ------
NM_024563chr521216 675 --156 11838
NM_024574chr41309 ------
NM_024582chr421124 309 ------
NM_024586chr12555 468 ----1122
NM_024594chr531944 1453 1396 ----11780
NM_024595chr11920 ------
NM_024607chr893715 3120 3113 3051 1371 1321 1120 811 489 24504 4326 12863 --
NM_024611chr1553573 3496 1030 658 507 23594 2484 2664 561 1895
NM_024612chr1721000 59 ------
NM_024613chr841555 621 168 38 1136 1531 --
NM_024626chr151578 1441 1404 324 202 ----11185
NM_024639chr632500 988 700 12001 12162 12828
NM_024659chr2176 ------
NM_024665chr364373 4069 3432 3225 3203 1616 ----11207
NM_024666chr154551 538 109 55 ----11362
NM_024670chr1061317 1288 510 295 156 100 ------
NM_024674chr123159 971 1113 12173 22200 912
NM_024686chr1--1437 ----
NM_024692chr221445 640 21628 537 ----
NM_024700chr15964 814 315 121 112 1785 ----
NM_024702chr172559 206 ----1601
NM_024704chr2021010 189 1882 198 --
NM_024707chr19------1222
NM_024713chr1511620 --11089 --
NM_024721chr82936 754 --1741 --
NM_024744chr222265 167 11969 --1508
NM_024749chr152241 1884 853 676 286 31590 453 320 ----
NM_024751chr432035 1510 748 ------
NM_024755chr152360 68 ------
NM_024763chr1----11022 --
NM_024770chr296765 6736 6445 5602 5327 4768 4536 2324 1380 15085 14874 --
NM_024785chr2----1520 --
NM_024787chr84825 396 364 267 2857 43 1190 --
NM_024811chr112781 525 1569 21372 583 --
NM_024814chr7194 1311 ----
NM_024824chr144600 574 412 136 ------
NM_024828chr93381 171 139 ------
NM_024852chr1--2489 170 ----
NM_024874chr1----161 --
NM_024877chr1931176 417 174 --2234 69 11018
NM_024884chr1484510 4091 3984 1797 1542 1355 715 468 11035 24407 1008 11171
NM_024887chr14656 284 171 161 12051 2427 41 --
NM_024913chr731719 1098 702 11263 ----
NM_024915chr851150 753 673 624 541 1937 1414 --
NM_024920chr421368 23 11618 ----
NM_024930chr542541 1104 787 67 --11754 --
NM_024939chr162381 169 --1451 --
NM_024944chr2121218 405 ------
NM_024947chr3109482 7546 6930 6594 6544 2815 2806 2280 1810 1131 17413 11294 13278
NM_024949chr453528 3294 3223 1071 174 --13258 11043
NM_024953chr1262794 2723 2146 1060 504 267 ------
NM_024960chr20197 ------
NM_024969chr22898 264 1251 ----
NM_024971chr91547 1856 ----
NM_024989chr2108078 8040 7559 7550 5540 1527 1513 1501 1486 425 11958 12428 12290
NM_024991chr1042375 2239 806 333 22396 2246 12761 --
NM_025054chr8104129 3996 3944 3423 3200 3132 3119 1465 1380 1261 13000 ----
NM_025073chr144491 3719 1029 229 31761 1582 91 23126 1569 13974
NM_025074chr452773 2510 2470 2008 582 22608 2078 22455 638 1158
NM_025076chr21538 ------
NM_025079chr12722 247 ----1205
NM_025090chr1721327 1038 ------
NM_025099chr173807 165 77 ------
NM_025106chr131660 1531 736 --1150 --
NM_025114chr121115 --1108 --
NM_025134chr161581 2922 590 ----
NM_025135chr182438 201 ------
NM_025146chr311973 --11942 12031
NM_025147chr22939 325 ------
NM_025152chr141666 12014 ----
NM_025154chr72962 575 11110 1190 --
NM_025158chr51458 --1349 --
NM_025160chr123794 3606 --13255 13379
NM_025179chr144687 3625 1890 1636 13632 63259 3211 1376 1364 1357 295 1988
NM_025182chr93828 752 304 --1183 1863
NM_025184chrX2627 37 ------
NM_025191chr142728 900 737 469 ----12544
NM_025195chr821690 1556 11524 1241 --
NM_025202chr211052 138 1223 1711
NM_025204chr22------1363
NM_025211chr91224 ------
NM_025222chr342422 2125 1152 877 --12599 --
NM_025224chr2062125 1918 875 637 566 477 --132 --
NM_025234chr15165 ------
NM_025235chr1021848 698 1519 ----
NM_025244chr21276 1248 ----
NM_025246chr3166 ------
NM_025248chr1752694 2496 1215 830 464 --22103 603 --
NM_025263chr651409 601 546 523 256 ------
NM_030576chr1722122 303 --42205 835 534 407 --
NM_030579chr1693640 3449 3307 3234 3181 3151 1221 990 557 13543 --12827
NM_030594chr1511162 ----11295
NM_030621chr1474207 3889 3611 3524 3289 1480 1469 22924 1363 ----
NM_030625chr1032489 867 90 ------
NM_030627chr553874 3211 2764 1588 424 11026 ----
NM_030629chr1611430 11739 ----
NM_030634chr12420 180 1221 22358 2184 --
NM_030640chr121194 1604 1866 1585
NM_030647chr796231 5558 5237 4934 4068 1733 1373 936 83 52531 1948 1073 696 420 11987 --
NM_030648chr485068 4877 4547 4150 3869 3859 1130 859 24320 3713 24651 4637 --
NM_030650chr273955 3870 3036 2894 1673 1255 910 22668 1426 14119 1417
NM_030664chr105859 582 320 174 92 ------
NM_030670chr1262047 1575 1438 492 352 268 11502 --11552
NM_030671chr1262047 1575 1438 492 352 268 11502 --11552
NM_030674chr12135160 4684 4095 4079 3876 3681 2123 2081 1239 899 705 409 402 34951 4465 1118 ----
NM_030759chr101274 1186 ----
NM_030762chr1261986 1742 1700 667 503 336 11395 ----
NM_030763chrX2895 41 --1903 --
NM_030780chr821615 332 11197 1204 1606
NM_030786chr131903 1418 505 21768 661 --11788
NM_030791chr142568 547 --11334 --
NM_030797chr21194 ------
NM_030799chr541887 1469 190 145 1847 ----
NM_030803chr221167 976 1287 ----
NM_030806chr1108617 8391 8319 5944 3528 2788 2638 1876 1076 984 36062 3545 2998 23623 1640 --
NM_030809chr1252249 1736 1667 897 547 1450 2195 22 11831
NM_030810chr651420 614 571 532 392 --21254 1180 --
NM_030816chr153503 3496 3234 711 664 ------
NM_030820chr61107 ----1391
NM_030884chr372325 2269 2240 1805 1548 717 551 --21998 620 --
NM_030885chr331972 549 68 12103 ----
NM_030915chr262362 2308 2186 2010 1718 634 11586 ----
NM_030918chr152129 1903 1397 1280 689 12178 --14682
NM_030923chr2--1498 1158 --
NM_030949chr6--2334 60 ----
NM_030962chr1151512 463 432 315 156 11590 ----
NM_030964chr573158 2805 2501 494 463 429 31 --1645 --
NM_031216chr1842185 1787 1763 1535 ------
NM_031226chr1521130 130 --11283 21113 352
NM_031243chr71686 2212 115 ----
NM_031244chr65970 946 922 390 353 ----1288
NM_031262chr91722 ------
NM_031263chr91779 ------
NM_031266chr51434 ------
NM_031267chr7----1451 --
NM_031268chr1674975 4560 3715 3650 1707 1694 737 --11495 --
NM_031271chr831671 1111 460 ------
NM_031296chr442480 1850 409 152 12334 --1896
NM_031302chr122149 91 ------
NM_031314chr1431900 249 45 31416 1378 718 ----
NM_031369chr41582 ------
NM_031370chr41582 ------
NM_031372chr41192 --11418 --
NM_031411chr532043 1498 91 ------
NM_031412chr1211270 ------
NM_031418chr1152592 2022 1999 285 122 ----1691
NM_031426chr932594 160 41 --22203 2127 --
NM_031427chr1485860 5692 5652 5488 5130 5063 4591 1331 1563 25676 3801 13614
NM_031442chrX33061 2918 669 42986 996 660 322 ----
NM_031445chr263385 3311 2685 172 94 72 1211 1143 1847
NM_031453chr101329 11633 ----
NM_031468chr7157212 6527 6408 6269 5580 2313 1937 1925 1912 1637 1471 1263 1068 1057 616 27969 5273 35114 2348 1483 --
NM_031469chr6114103 3705 3571 3389 2708 1609 1372 1033 586 385 71 1235 14024 11241
NM_031476chr1611979 12281 22703 837 --
NM_031483chr2073447 3326 3275 2997 2510 149 63 13542 ----
NM_031844chr123840 973 --13508 --
NM_031845chr252924 2586 840 815 296 22842 1153 --13470
NM_031847chr252924 2586 840 815 296 22842 1153 --13470
NM_031849chr532043 1498 91 ------
NM_031850chr33818 644 96 ------
NM_031850chr33818 644 96 ------
NM_031857chr532043 1498 91 ------
NM_031858chr1721372 28 ------
NM_031860chr532043 1498 91 ------
NM_031862chr1721372 28 ------
NM_031890chr2242278 2138 593 263 --2784 63 --
NM_031935chr12244 149 1960 ----
NM_031940chr832474 1614 178 ----11638
NM_031953chr41115 ------
NM_031992chr721600 195 ------
NM_032013chr2031752 156 94 ----21342 1207
NM_032017chr121550 1323 11444 2265 177 11557
NM_032042chr542762 2276 2183 272 --12794 --
NM_032047chr332303 2202 610 ----1178
NM_032049chr33818 644 96 ------
NM_032049chr33818 644 96 ------
NM_032052chr222940 180 11383 ----
NM_032102chr1131243 470 99 --22419 131 --
NM_032116chr1355835 5820 4890 544 382 --43683 2358 2332 846 25150 579
NM_032121chrX62388 2191 1115 327 295 102 --1726 --
NM_032128chr421039 818 ------
NM_032143chr21336 ------
NM_032144chr241559 669 283 228 1156 ----
NM_032147chr124790 384 234 180 1220 ----
NM_032174chr121476 469 11244 ----
NM_032182chr1061522 1211 1075 526 367 169 1105 ----
NM_032186chr121452 532 21418 486 ----
NM_032189chr1364587 3754 1921 1496 1324 39 --13678 --
NM_032193chr1151916 1283 818 354 273 11342 2831 823 --
NM_032195chr212499 485 --1205 --
NM_032199chr1033909 3505 556 11001 ----
NM_032208chr253563 1373 1206 1126 382 --1391 --
NM_032217chr42491 456 1203 ----
NM_032221chr2031814 200 66 ------
NM_032229chr13158 21027 447 ----
NM_032236chr11819 ------
NM_032242chr362902 2581 2542 2498 1108 762 ----1146
NM_032246chr15----184 11337
NM_032256chr122710 366 ------
NM_032268chr1672629 2589 2458 2183 1981 1195 511 --11095 --
NM_032271chr1641492 1042 333 93 ------
NM_032288chr311897 190 ----
NM_032291chr131565 543 191 ------
NM_032312chr23937 852 609 ------
NM_032316chr361971 1913 1903 858 530 323 1170 ----
NM_032321chr293193 2905 2818 2786 2749 2716 730 168 95 12449 21073 492 1828
NM_032345chr121112 ------
NM_032352chr1431238 1179 211 2525 32 --11272
NM_032353chr173377 30 24 ------
NM_032373chr1054724 1836 1652 1034 742 11279 1136 14343
NM_032379chr11198 ------
NM_032380chr5------146
NM_032410chr831073 836 48 11127 ----
NM_032424chr1151631 1541 1099 510 414 1222 ----
NM_032434chr211130 11121 11316 --
NM_032435chr142053 1928 577 274 11514 167 --
NM_032436chr132959 188 ------
NM_032440chr1032615 2201 2144 3871 801 252 2726 689 --
NM_032445chr1542605 2289 1958 787 11825 ----
NM_032446chr523802 388 1421 13459 --
NM_032452chr1471469 1439 1336 582 102 61 41 1187 ----
NM_032457chr433737 3638 3257 11481 1136 --
NM_032458chrX52371 2340 1348 466 206 13185 ----
NM_032466chr831464 1269 298 ------
NM_032468chr831464 1269 298 ------
NM_032482chr1942189 1990 1842 1070 --41996 1698 400 377 --
NM_032491chr12190 --1263 --
NM_032499chr1521131 577 --1139 --
NM_032503chr64883 663 634 44 ------
NM_032505chr372783 1765 1062 983 859 824 784 ------
NM_032521chr2042176 1212 650 79 12307 32583 958 730 22639 985
NM_032557chr43659 314 84 1113 1193 --
NM_032558chr93969 566 235 --1441 --
NM_032564chr112957 774 ------
NM_032569chr1621232 344 1376 1105 --
NM_032582chr1711523 11223 1429 --
NM_032590chr1211071 ------
NM_032632chr1421328 241 1508 11619 --
NM_032664chr831407 1301 271 --1545 --
NM_032682chr363495 3483 1336 700 472 198 12717 ----
NM_032717chr4----1130 --
NM_032765chr5----1853 --
NM_032772chr101148 ------
NM_032778chr3112848 2816 2601 2387 1296 1259 1084 896 495 424 99 ------
NM_032782chr53997 834 188 --1780 --
NM_032784chr63927 797 662 ----144
NM_032786chr121595 ------
NM_032796chrX4261 181 154 146 ------
NM_032801chr1132471 2377 48 1474 ----
NM_032804chr1062407 1601 968 699 531 262 32600 2258 840 ----
NM_032810chr1011121 ------
NM_032812chr10168 ------
NM_032828chr1951483 1389 1107 1075 965 34486 4111 3095 43067 1885 1859 808 54787 1747 971 835 246
NM_032833chr15796 683 630 393 44 1977 138 11707
NM_032837chr1742129 2066 1893 342 --1498 --
NM_032842chr721057 352 11703 1466 1493
NM_032846chr1481515 1393 1325 1295 620 522 500 373 --2551 411 --
NM_032858chr11113 ------
NM_032859chr1353594 3453 2913 934 884 ------
NM_032866chr1522811 2067 --23163 602 2763 629
NM_032873chr1174419 3407 3144 1319 1229 1123 432 13930 --13459
NM_032884chr11366 ------
NM_032900chr1053355 2524 989 876 151 ------
NM_032932chr1796378 6000 5918 5528 5104 5035 2527 937 705 21256 1236 45458 5330 710 350 --
NM_032943chr11198 ------
NM_032961chr44910 268 234 21 ------
NM_032968chrX93534 3288 3088 2686 1565 1487 858 410 399 ----1594
NM_032969chrX93534 3288 3088 2686 1565 1487 858 410 399 ----1594
NM_032973chrY93530 3283 3083 2681 1564 1487 858 410 399 ----1594
NM_032982chr772516 2115 944 930 915 410 153 1664 22284 2048 --
NM_032983chr763330 2929 1224 967 789 241 --23098 2862 22117 569
NM_032998chr12359 106 ----1244
NM_032999chr74347 146 126 102 11109 1354 --
NM_033000chr74347 146 126 102 11109 1354 --
NM_033001chr74347 146 126 102 11109 1354 --
NM_033012chr131943 ------
NM_033014chr941491 1352 1324 1051 21517 106 ----
NM_033018chrX51088 443 431 141 96 --11025 1458
NM_033020chr184736 4091 3772 1502 1131 759 494 105 13196 ----
NM_033023chr741230 1220 1156 825 ------
NM_033030chr21615 1128 11235 --
NM_033044chr12194 130 21231 1098 --1391
NM_033087chr931190 1018 973 11148 ----
NM_033089chr202372 338 --1488 --
NM_033103chr192334 88 ----1947
NM_033121chr1241650 1200 545 497 ------
NM_033132chr1332291 748 455 --1912 --
NM_033133chr1793584 3274 3112 3067 2348 958 947 690 119 --33339 2595 301 --
NM_033136chr551810 1378 1252 560 445 11494 ----
NM_033137chr551810 1378 1252 560 445 11494 ----
NM_033138chr721697 200 11546 ----
NM_033139chr721697 200 11546 ----
NM_033140chr721697 200 11546 ----
NM_033143chr474327 4083 2988 1324 1232 772 159 34220 945 52 ----
NM_033157chr721697 200 11546 ----
NM_033161chr921272 23 --31476 1417 1332 --
NM_033181chr673950 3836 3519 3392 3102 3071 621 1674 12940 --
NM_033211chr542054 1880 389 325 1577 ----
NM_033222chr941164 478 354 338 ------
NM_033224chr7107830 7656 6679 5244 2835 2463 2182 1730 1157 1061 46231 5689 5021 1269 --16706
NM_033225chr832493 1001 40 1304 ----
NM_033228chr5187 ------
NM_033259chr31779 ------
NM_033272chr22334 82 ------
NM_033274chr543186 2961 1316 163 --13191 --
NM_033281chr52930 193 ------
NM_033285chr874458 3575 3519 3045 1422 1192 142 --13185 --
NM_033290chrX63139 2745 1452 848 633 405 11148 ----
NM_033315chr171427 --1701 --
NM_033326chr1152296 2043 1732 1710 862 1270 ----
NM_033340chr1041414 1030 972 371 ----1108
NM_033360chr1284375 3878 3477 3393 3272 2930 411 214 33957 3306 256 ----
NM_033380chrX1801 21086 171 ----
NM_033381chrX1801 21086 171 ----
NM_033389chr1734632 1026 413 23374 1506 --14066
NM_033394chr211161 11132 ----
NM_033429chr151717 32404 2212 373 ----
NM_033430chr454079 3882 3481 2668 699 --11411 --
NM_033437chr454079 3882 3481 2668 699 --11411 --
NM_033449chr531444 241 45 --21675 219 11818
NM_033495chrX136 ------
NM_033503chr1573154 2943 2516 1233 1170 1026 563 --13740 --
NM_033505chr275434 4312 4279 2461 1967 1735 834 34905 4647 2014 ----
NM_033512chr8113098 2994 2559 2494 1206 1129 1110 813 303 156 70 --126 --
NM_033624chr1261962 1802 813 514 137 41 ----1842
NM_033631chr153847 3688 1388 879 487 --33373 1300 560 --
NM_033637chr1073803 3601 3300 2801 1488 626 243 11094 ----
NM_033642chrX3475 140 42 ------
NM_033644chr53910 742 587 12529 ----
NM_033645chr53910 742 587 12529 ----
NM_033656chr2185137 5126 4569 4276 4121 3776 2395 532 25689 5557 ----
NM_044472chr11735 ------
NM_048368chr181314 ------
NM_052832chr832606 1154 43 22341 2104 12365 --
NM_052837chr1132 ------
NM_052840chr1541343 1158 470 311 ------
NM_052849chr151199 1661 ----
NM_052850chr19133 ------
NM_052851chr1351703 1672 887 827 366 22368 2351 ----
NM_052877chr12445 54 ------
NM_052885chr1274772 752 685 639 563 536 475 24713 1986 11621 --
NM_052886chr861713 1429 1323 808 791 47 ------
NM_052898chr831680 1355 314 ----11639
NM_052900chr831173 559 472 11335 11484 --
NM_052905chr221526 302 --1581 --
NM_052906chr2254585 4230 3319 1946 1074 --24991 3357 11135
NM_052910chr1321577 608 ------
NM_052911chr181944 ------
NM_052913chr621047 981 --1998 --
NM_052918chr1083701 3690 2984 2600 1298 1279 880 185 13527 23398 3177 --
NM_052934chr122222 26 --1698 2729 511
NM_052937chr831841 1032 593 1454 1640 --
NM_052953chr32232 72 ------
NM_052954chr2131950 1580 59 11864 ----
NM_052965chr11442 21165 79 ----
NM_053016chr9158037 6760 5770 5703 5434 5209 2800 2706 2588 1947 1338 1186 543 416 109 11721 ----
NM_053023chr1123192 2683 12613 --12575
NM_053024chr341368 541 422 343 ------
NM_053043chr744696 4640 4076 2198 14679 26225 1271 11722
NM_053056chr1132263 2020 970 22879 2220 ----
NM_053064chr1462868 2394 1890 955 929 217 1902 ----
NM_053275chr12163 ------
NM_054033chr22522 435 ------
NM_054035chr172825 615 --2702 267 --
NM_054110chr311033 --1704 --
NM_054111chr61110 --1115 --
NM_054114chr6267 38 ------
NM_057169chr1262747 2715 2555 1137 483 329 1624 22575 636 1459
NM_057170chr1262747 2715 2555 1137 483 329 1624 22575 636 1459
NM_057175chr422311 989 32353 380 248 11944 --
NM_057180chr121373 ------
NM_057749chr8------1370
NM_058170chr131237 610 295 11626 ----
NM_058172chr421855 146 21385 638 11146 --
NM_058179chr91274 ------
NM_058191chr211853 ------
NM_058241chr242269 1628 934 180 1303 11612 --
NM_058241chr242269 1628 934 180 1303 11612 --
NM_078473chr832474 1614 178 ----11638
NM_078483chr5113546 2983 1346 917 892 522 289 276 128 57 28 1478 31460 1276 294 --
NM_078485chr63147 121 96 ------
NM_078487chr933332 2045 1214 12879 ----
NM_079837chr161587 --1134 --
NM_080391chr1185 ------
NM_080491chr1163633 3109 2994 2959 392 241 --32843 416 267 --
NM_080552chr20----1679 --
NM_080597chr1821099 85 ------
NM_080629chr131549 1140 43 ------
NM_080630chr131549 1140 43 ------
NM_080645chr622162 745 --11838 --
NM_080654chr1161197 460 416 204 100 79 1950 ----
NM_080661chr112335 286 1929 ----
NM_080671chr232177 456 351 ----11632
NM_080672chr203566 160 100 ------
NM_080679chr64693 686 632 98 ------
NM_080680chr64693 686 632 98 ------
NM_080681chr64693 686 632 98 ------
NM_080683chr42184 124 1567 ----
NM_080684chr42184 124 1567 ----
NM_080685chr42184 124 1567 ----
NM_080738chr121654 452 11627 11535 --
NM_080759chr1311632 ------
NM_080760chr1311632 ------
NM_080764chr2263121 2898 2610 2443 999 791 12021 12615 22797 546
NM_080840chr202488 132 ------
NM_080841chr202488 132 ------
NM_080867chr14115097 4222 4108 3647 1817 1796 1556 1465 1317 1121 906 ----23675 1850
NM_080872chr843564 3320 1518 1082 --1216 --
NM_080874chr441821 1742 274 26 11578 1717 --
NM_080927chr363236 2812 2278 2210 1273 987 ------
NM_100264chr102729 634 ------
NM_100486chr102729 634 ------
NM_130387chr321156 218 ------
NM_130391chr963526 3463 3015 2828 1139 115 1260 --12274
NM_130392chr963526 3463 3015 2828 1139 115 1260 --12274
NM_130393chr963526 3463 3015 2828 1139 115 1260 --12274
NM_130436chr2141866 1750 1730 648 --11911 --
NM_130438chr2162443 2327 2307 2193 1225 354 --12488 --
NM_130440chr121538 1394 ------
NM_130443chr11------1123
NM_130798chr1531359 188 64 31211 416 276 ----
NM_130808chr32143 66 ------
NM_130830chr363847 3836 3472 3207 2716 1106 --2137 69 --
NM_130838chr152464 164 --11759 --
NM_130839chr152464 164 --11759 --
NM_130846chr123857 816 292 ------
NM_130847chr11115763 5063 4397 3599 1626 1613 1536 1243 557 388 296 --12272 --
NM_130901chr15----137 --
NM_133170chr2097399 6664 6218 5827 5316 5243 2860 978 108 36577 5310 2670 12340 --
NM_133171chr2041159 789 446 397 ------
NM_133264chr1753824 3428 2692 1094 285 11286 --1944
NM_133265chrX83654 3126 2703 2231 1206 1022 200 148 13239 21284 1171 --
NM_133266chr112426 364 --11182 --
NM_133330chr452233 1223 1205 760 56 --1744 12846
NM_133331chr452233 1223 1205 760 56 --1744 12846
NM_133335chr452233 1223 1205 760 56 --1744 12846
NM_133367chr673464 3247 3216 2925 2878 870 673 13126 1635 --
NM_133372chr542460 2405 1796 772 --22805 2049 11915
NM_133433chr51603 ------
NM_133445chr973479 3471 3375 2985 2619 2535 2479 12422 32919 2814 786 --
NM_133468chr721880 379 --11960 --
NM_133478chr252514 1956 1728 671 316 12441 ----
NM_133486chrX--1425 ----
NM_133493chr644249 3913 3113 507 ------
NM_133496chr184354 3494 2876 2833 1657 1080 561 195 11712 33787 3647 3148 1788
NM_133499chrX2651 221 --2717 319 --
NM_133503chr121661 --1652 --
NM_133504chr121661 --1652 --
NM_133505chr121661 --1652 --
NM_133506chr121661 --1652 --
NM_133507chr121839 --1830 --
NM_133638chr531274 1230 1184 --1311 --
NM_133642chr221120 ----1951
NM_133646chr243424 1827 1023 159 25144 65 ----
NM_133647chr1573360 3347 3293 3261 2856 2403 1114 33457 1188 644 22592 580 12619
NM_134265chr1721173 928 ------
NM_134325chr141757 563 548 530 --1233 2264 46
NM_134424chr124502 409 235 57 21004 849 11246 1369
NM_134428chr91104 ------
NM_138270chrX33263 3009 2558 --13302 --
NM_138288chr1452203 816 557 505 409 22254 1733 11471 --
NM_138297chr3--2362 161 --128
NM_138316chr1021315 404 11099 ----
NM_138328chr1743253 2773 855 847 12102 22184 1252 --
NM_138353chr19----137 --
NM_138357chr1061840 636 626 548 541 109 1232 ----
NM_138370chr21757 --2523 246 1672
NM_138395chr22430 280 11051 1314 --
NM_138396chr12--1292 --1777
NM_138423chr1542232 1994 773 57 ----1522
NM_138426chr721939 128 1514 ----
NM_138444chr1343418 1526 1182 734 1316 --1288
NM_138459chr61564 --1330 --
NM_138468chr276317 5560 5013 3889 2003 920 730 22163 978 56093 5869 4790 4272 1074 14711
NM_138471chr112448 72 --1389 --
NM_138473chr12124660 4473 4068 3981 3949 3798 3594 1951 1939 773 506 188 --25087 4365 13701
NM_138479chr131949 1521 284 --22075 1526 1559
NM_138494chr722835 2581 1294 1377 --
NM_138554chr942135 2063 1833 441 1273 ----
NM_138558chr111041 --1270 --
NM_138559chr241322 1298 477 302 ------
NM_138569chr62249 205 ------
NM_138576chr1474513 4005 3948 3871 3513 963 76 --11284 11314
NM_138578chr2021024 299 ----1952
NM_138621chr273891 3414 2717 838 675 547 469 --1163 --
NM_138638chr1442087 609 451 261 22453 590 ----
NM_138713chr16138189 8048 7840 7160 6501 5636 5515 5490 2818 2571 2529 1580 1221 --15710 --
NM_138714chr16138189 8048 7840 7160 6501 5636 5515 5490 2818 2571 2529 1580 1221 --15710 --
NM_138727chr141773 1639 577 263 12194 1909 183
NM_138728chr141773 1639 577 263 12194 1909 183
NM_138735chr221574 382 1161 11051 --
NM_138771chr721592 1121 --11458 --
NM_138775chr114810 542 79 38 ------
NM_138782chr532308 2005 667 1824 12241 --
NM_138798chr2133 ------
NM_138799chr231999 1394 665 11614 ----
NM_138967chr15112448 2130 2107 2079 1904 1531 970 927 460 357 116 --32135 985 650 --
NM_138971chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138971chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138972chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138972chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138973chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138973chr11113530 3336 1517 1350 1332 1149 1088 884 530 380 132 ------
NM_138980chr41477 ------
NM_138981chr43608 540 145 ------
NM_138982chr41477 ------
NM_139012chr63894 460 87 ------
NM_139015chr1251440 1425 1246 1080 293 --11572 --
NM_139035chrX1303 ------
NM_139046chr101196 ------
NM_139048chr321264 187 1803 ----
NM_139057chr1542591 2302 551 260 1925 22466 520 12251
NM_139062chr171440 ------
NM_139070chr52542 427 ------
NM_139071chr1241660 1522 78 60 --1183 21050 66
NM_139072chr22817 210 ------
NM_139076chr4186 21170 162 ----
NM_139126chr64871 842 764 743 ------
NM_139131chr111440 --1605 --
NM_139132chr1121110 61 ----1992
NM_139155chr102972 366 1213 11198 --
NM_139168chr511450 21529 509 ----
NM_139207chr1231370 315 160 11619 2898 720 --
NM_139244chr61951 2808 145 ----
NM_139276chr1792386 2242 1921 1885 493 395 369 144 48 22306 1771 21722 136 --
NM_139283chr1242474 2253 953 21 ------
NM_139312chr102980 69 11196 ----
NM_139319chr1211436 ------
NM_139321chr20103790 3674 3333 3147 3106 1701 718 524 506 457 --13679 --
NM_139323chr2021884 764 --11630 --
NM_144498chr2032188 1820 611 ------
NM_144571chr4126986 6831 6266 6188 6134 5884 5660 4801 2104 2046 1316 779 22256 2011 ----
NM_144574chr14--1179 ----
NM_144578chr14125410 5265 5038 4678 4513 4476 4308 3716 1647 1103 742 730 33697 3624 451 21621 146 --
NM_144582chr252531 2156 1952 1014 863 --11680 12058
NM_144595chr13159 ------
NM_144600chr161577 11513 1305 1332
NM_144609chr1741337 1280 1207 471 --1945 --
NM_144610chr171456 --1393 --
NM_144628chr2062215 869 673 582 222 178 1155 11005 --
NM_144632chr251694 1649 918 618 194 ------
NM_144636chr31808 ------
NM_144643chr41408 ------
NM_144664chr1111880 ------
NM_144665chr111231 ------
NM_144723chr52315 157 --1760 1211
NM_144732chr192987 445 --5918 272 142 124 60 --
NM_144767chr1594397 4290 4060 3921 3339 3223 3096 1267 948 1762 24233 31 --
NM_144775chr1763880 3508 3111 1844 1772 655 34142 3805 3480 34041 1156 1018 24503 3341
NM_144778chr1341733 1698 326 231 12678 --1172
NM_144949chr242058 949 477 140 ------
NM_144963chr851092 920 381 223 36 11005 ----
NM_144967chrX----1247 --
NM_144973chr1274972 4558 4075 3742 529 501 233 11382 1898 --
NM_144982chr121775 ------
NM_145025chr63941 56 22 ------
NM_145037chr331088 312 181 --1529 --
NM_145055chr1863380 3127 2423 562 404 296 12394 21190 1015 --
NM_145056chr19----181 1683
NM_145112chr1431005 846 448 ------
NM_145113chr1431277 1118 189 ------
NM_145117chr1183199 2774 2442 2215 876 859 284 180 --1219 12922
NM_145176chr652209 1105 499 433 418 --2862 277 1940
NM_145185chr1931721 746 80 --31828 463 424 --
NM_145206chr1063145 2924 2192 1317 517 252 ------
NM_145235chr101152 ------
NM_145245chr1921219 780 --1809 --
NM_145251chr142585 131 ------
NM_145259chr2117012 5183 4762 1855 1791 1718 1604 1570 1267 775 422 12324 14461 197
NM_145263chr452117 897 844 765 673 42256 2005 1453 755 --184
NM_145284chrX21703 816 1282 21931 1805 --
NM_145285chr102714 537 ------
NM_145296chr19----1618 --
NM_145303chr62475 23 ------
NM_145305chrX31280 1030 106 ------
NM_145307chr1034249 3674 3091 23139 1077 14434 --
NM_145313chr1051566 1543 1315 367 299 ------
NM_145332chr62270 77 ------
NM_145333chr62270 77 ------
NM_145341chr1011601 21276 1248 1253 --
NM_145658chr15129 ------
NM_145686chr2----12156 2968 849
NM_145687chr2----12156 2968 849
NM_145690chr881721 1693 1676 1479 1429 615 340 117 1739 --127
NM_145716chr1----1156 --
NM_145733chr222794 316 --1142 --
NM_145793chr103771 751 377 1713 ----
NM_145808chr772529 1926 960 514 464 82 60 ------
NM_145859chr3251 28 ------
NM_145860chr3251 28 ------
NM_145861chr121654 452 11627 11535 --
NM_145888chr1941250 777 520 198 --1410 --
NM_145891chr1611397 21227 159 ----
NM_145892chr1611397 21227 159 ----
NM_145893chr1611519 21349 281 ----
NM_145899chr621059 822 --1966 --
NM_145901chr621059 822 --1966 --
NM_145902chr621059 822 --1966 --
NM_145903chr621059 822 --1966 --
NM_145904chr621059 822 --1966 --
NM_145905chr621059 822 --1966 --
NM_145912chr2244416 3780 992 487 --13785 1331
NM_147156chr1061487 1084 487 389 135 112 ------
NM_147175chrX21378 28 1697 1662 --
NM_147202chr9102581 2299 2267 1936 988 732 598 254 166 88 11731 12022 --
NM_147223chr252394 1941 797 743 83 1272 21709 1703 --
NM_147233chr242211 1758 614 560 189 21526 1520 --
NM_148174chr822232 1454 1889 11775 --
NM_148898chr73934 792 767 ------
NM_148899chr73934 792 767 ------
NM_148904chr12555 468 ----1122
NM_148905chr12555 468 ----1122
NM_148906chr12555 468 ----1122
NM_148907chr12555 468 ----1122
NM_148908chr12555 468 ----1122
NM_148909chr12555 468 ----1122
NM_148921chr1732117 1528 599 ------
NM_148923chr181211 ----175
NM_148955chr1586519 5931 5028 2143 572 192 94 40 26041 4922 25989 949 1565
NM_148957chr1372676 2521 2492 2184 1697 840 569 1457 ----
NM_148977chr1021315 404 11099 ----
NM_148978chr1021315 404 11099 ----
NM_152133chr6267 38 ------
NM_152233chr1431216 335 35 11385 --21666 1631
NM_152253chr2253614 3395 3154 2865 1238 14337 11434 --
NM_152261chr122940 405 ------
NM_152263chr165911 5092 4724 4178 1419 480 12100 12221 15672
NM_152265chr121245 634 --11141 --
NM_152272chr851225 1197 843 213 141 --11072 --
NM_152275chr231878 886 733 11584 11703 1451
NM_152278chrX2575 397 ------
NM_152280chr163482 2732 1241 854 845 719 ----22957 2897
NM_152289chr1941658 1564 1411 545 --21472 1427 1224
NM_152305chr342053 795 699 91 32063 1833 297 2689 262 --
NM_152330chr1422501 976 11912 --12187
NM_152352chr1863089 1070 633 517 467 141 1936 23094 1173 --
NM_152380chr141294 376 225 164 ------
NM_152388chr253871 3580 3353 1509 584 33009 940 295 ----
NM_152398chr41135 ------
NM_152407chr552769 2194 2176 805 485 2858 95 11200 11102
NM_152409chr573293 2744 2513 2468 2223 2201 286 ------
NM_152417chr821265 905 1473 --11090
NM_152424chrX104712 4691 3625 3309 3142 3114 2939 932 536 161 11169 --13658
NM_152446chr142989 815 ------
NM_152450chr1531965 152 62 ------
NM_152451chr151808 ------
NM_152470chr18