TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-let-7d-3p
miRNA Sequence: CUAUACGACCUGCUGCCUUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000138chr1551886 707 594 259 141 11045 --1121
NM_000176chr52474 415 --23574 785 21022 59
NM_000214chr2051515 1418 627 494 65 --2588 385 --
NM_000264chr952314 2092 1027 826 150 --12440 33149 385 372
NM_000346chr1741896 1331 641 338 11799 11994 21431 1353
NM_000489chrX22706 2656 192 22341 2321 1651
NM_000685chr33808 802 721 ----1606
NM_000685chr33808 802 721 ----1606
NM_000724chr1031716 556 125 11807 --149
NM_000793chr1475131 4296 1889 1689 1632 1209 998 --13223 --
NM_000813chr544004 3434 3424 1284 --24519 1388 --
NM_000814chr1573932 1662 1034 991 409 194 174 --2868 132 --
NM_000859chr521383 250 --11697 11357
NM_001001331chr351706 838 654 636 621 12246 1508 --
NM_001001395chr122412 372 --1292 1944
NM_001001419chr595068 4975 4913 4539 3224 1160 950 172 144 ------
NM_001001420chr595068 4975 4913 4539 3224 1160 950 172 144 ------
NM_001001484chr1052370 2162 2069 1702 838 ----22248 673
NM_001001549chr772371 2309 2144 2116 2038 426 384 22696 1998 ----
NM_001001550chr772371 2309 2144 2116 2038 426 384 22696 1998 ----
NM_001001555chr772371 2309 2144 2116 2038 426 384 22696 1998 ----
NM_001001556chr1531084 372 96 ----1570
NM_001001664chr242922 864 624 446 14008 13866 11595
NM_001003674chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_001003675chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_001003679chr172164 2044 1929 1779 1540 574 471 11690 11935 --
NM_001003681chr2241937 1931 588 56 ----22103 1962
NM_001003712chr1252648 686 323 278 148 33398 3138 1057 13536 --
NM_001003760chr631171 313 114 ----12944
NM_001005473chr5126629 6566 5053 4484 4461 4454 2576 2362 2006 1987 1483 49 ------
NM_001007023chr1475131 4296 1889 1689 1632 1209 998 --13223 --
NM_001007278chr1375274 5147 5135 1249 535 296 247 ------
NM_001009899chr376407 6210 5751 5559 5482 4612 802 26329 111 26503 1064 --
NM_001010891chr5106120 6085 5756 5252 4804 1846 1695 772 257 167 12412 26460 4252 --
NM_001012398chr1611024 --1368 11064
NM_001012755chrX44333 1621 1566 1353 14936 14946 14844
NM_001013620chr1287653 7451 5895 2695 1531 1145 744 294 1300 35870 1765 1292 17645
NM_001017368chr17------22700 215
NM_001017415chr16761 671 639 326 232 25 --1788 --
NM_001017416chr16761 671 639 326 232 25 --1788 --
NM_001018067chr1105161 4946 4875 4798 3327 2039 1456 829 279 205 14444 24902 3859 --
NM_001018068chr1105161 4946 4875 4798 3327 2039 1456 829 279 205 14444 24902 3859 --
NM_001018069chr1105161 4946 4875 4798 3327 2039 1456 829 279 205 14444 24902 3859 --
NM_001018074chr52474 415 --23574 785 21022 59
NM_001018075chr52474 415 --23574 785 21022 59
NM_001018076chr52474 415 --23574 785 21022 59
NM_001018077chr52474 415 --23574 785 21022 59
NM_001024094chr52474 415 --23574 785 21022 59
NM_001024649chr542932 2913 1009 610 ----22519 2362
NM_001025076chr1055062 4504 3973 3856 2405 ----21316 1180
NM_001025077chr1066420 5862 5331 5214 1133 1063 ----22674 2538
NM_001025079chr343269 1275 1073 559 21289 572 --13668
NM_001025266chr373885 3188 1964 1752 1266 1106 208 11970 11120 --
NM_001025366chr641900 1609 1585 1574 --11387 --
NM_001025366chr641900 1609 1585 1574 --11387 --
NM_001025367chr641900 1609 1585 1574 --11387 --
NM_001025367chr641900 1609 1585 1574 --11387 --
NM_001025368chr641900 1609 1585 1574 --11387 --
NM_001025368chr641900 1609 1585 1574 --11387 --
NM_001025369chr641916 1625 1601 1590 --11403 --
NM_001025369chr641916 1625 1601 1590 --11403 --
NM_001025370chr641900 1609 1585 1574 --11387 --
NM_001025370chr641900 1609 1585 1574 --11387 --
NM_001029884chr662710 2553 2483 2462 2157 82 12369 ----
NM_001030055chr1454586 4493 3371 1570 1102 13151 1741 --
NM_001033117chr36478 414 390 384 356 344 ------
NM_001033756chr641834 1543 1519 1508 --11321 --
NM_001033756chr641834 1543 1519 1508 --11321 --
NM_001039618chr1155049 4272 3667 1005 528 11078 33795 1994 1980 24000 1241
NM_001039840chrX54861 2349 1861 1819 630 25500 2072 ----
NM_001040142chr292225 826 808 798 790 782 670 529 122 ----1536
NM_001040143chr292225 826 808 798 790 782 670 529 122 ----1536
NM_001040402chr473082 2946 2667 1231 257 204 76 2641 287 1278 12936
NM_001040446chr572721 2673 2559 2401 2368 743 451 12348 ----
NM_001040665chr754832 4213 958 793 547 11257 15016 11208
NM_001042555chr1234014 3770 1398 13259 34112 3913 924 23835 3751
NM_001042604chr31211 23954 1618 1849 11494
NM_001106chr339550 7057 3544 --49785 9183 9005 6379 --
NM_001167chrX116586 5989 5775 5650 5214 2503 2298 1414 1366 678 372 16714 ----
NM_001173chr1454586 4493 3371 1570 1102 13151 1741 --
NM_001198chr641543 1506 898 220 1503 1723 --
NM_001201chr463931 3699 3554 3530 3198 667 23913 2602 --13340
NM_001204chr2107694 7585 7148 7111 6001 5969 5720 2794 2583 2295 17527 25636 1834 17498
NM_001310chr1252569 2519 854 370 299 12151 11904 --
NM_001380chr101988 1410 1763 1974
NM_001412chrX63449 2811 2451 1161 549 393 --22702 378 --
NM_001432chr453779 3720 3540 2660 1087 1179 1768 --
NM_001656chr531981 1820 1581 11746 --1632
NM_001683chr351706 838 654 636 621 12246 1508 --
NM_001709chr1122757 668 1118 156 1984
NM_001730chr1361571 1528 390 217 162 126 --1135 --
NM_001730chr1361571 1528 390 217 162 126 --1135 --
NM_001746chr542932 2913 1009 610 ----22519 2362
NM_001777chr343269 1275 1073 559 21289 572 --13668
NM_001858chr6114936 4865 4290 4283 1913 1841 1695 1089 996 918 753 1675 --13893
NM_002006chr485755 5716 4946 4908 2060 607 191 92 ----12301
NM_002009chr1512109 --1697 1831
NM_002015chr1352686 2625 1059 905 358 --1335 13255
NM_002025chrX67977 7909 6909 6107 2958 980 19080 28096 7936 27201 1796
NM_002044chr1531084 372 96 ----1570
NM_002137chr722230 1497 135 --1607
NM_002158chr273750 3246 3059 2495 1329 1012 517 23519 3509 22920 1433 11279
NM_002270chr575649 5637 5368 4750 3800 3700 1146 15192 14496 --
NM_002310chr575484 4468 3991 1822 1553 1354 368 1606 --26419 6213
NM_002336chr1224425 3243 15001 --25016 229
NM_002356chr612704 12794 1729 1818
NM_002577chr343570 2658 934 701 --13256 1544
NM_002594chr2031905 1879 1869 22089 1819 1772 11898
NM_002595chr1211909 11967 21377 760 11228
NM_002645chr1123142 2257 23073 2550 1103 12817
NM_002655chr865059 5021 4846 4506 734 687 25104 4346 25028 4958 35067 408 112
NM_002687chr1451271 1104 1016 910 300 ----1420
NM_002731chr121953 1219 11202 12030 11932
NM_002737chr1744351 2427 1546 1305 16504 --16616
NM_002833chr1571616 1535 1503 595 577 562 487 ------
NM_002843chr1121281 1176 ----12395
NM_002892chr1431484 138 117 ----1301
NM_002998chr82511 138 --12234 1554
NM_003054chr10------2202 41
NM_003274chr2142966 2432 1890 1175 21093 840 12636 --
NM_003298chr394354 4124 4115 4086 4017 1247 1088 356 252 --26136 3980 --
NM_003342chr1763194 2841 1150 1047 694 535 ----1364
NM_003368chr16761 671 639 326 232 25 --1788 --
NM_003376chr641900 1609 1585 1574 --11387 --
NM_003376chr641900 1609 1585 1574 --11387 --
NM_003403chr142618 585 --2624 83 1612
NM_003412chr32856 57 --2947 737 21139 658
NM_003463chr643294 3156 2306 244 13337 22213 376 --
NM_003468chr274225 4165 3939 3755 3449 1416 195 --23780 3302 --
NM_003489chr2162937 2911 2853 2805 2709 716 22865 66 ----
NM_003566chr1243268 3166 1389 708 23418 2592 --23091 844
NM_003663chr373353 3312 2453 1060 612 129 80 12642 1540 --
NM_003677chr129604 240 220 198 172 164 144 126 104 11986 ----
NM_003759chr484307 3467 3340 3288 1709 1322 1226 989 13833 1995 --
NM_003799chr1834454 2859 186 --12908 14538
NM_003872chr231933 695 306 ----13030
NM_003887chr222219 95 1601 11493 12229
NM_004171chr11119656 9327 9297 8139 8115 8017 7969 2933 2113 225 101 29578 8979 26692 6660 --
NM_004229chrX31758 814 560 --1195 1183
NM_004279chr762296 1901 825 682 157 77 --11475 11815
NM_004338chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_004397chr1134235 3701 979 ----1988
NM_004438chr263334 3009 2872 2829 2188 379 23063 2509 ----
NM_004457chr241611 1598 525 361 1324 21604 1551 --
NM_004586chrX75414 4968 4654 4207 1340 509 453 14763 ----
NM_004612chr964377 4229 4058 3904 3053 570 --24223 578 --
NM_004726chrX75608 5450 4408 2000 1390 413 160 12278 14804 --
NM_004748chr1543892 3114 1394 1122 ----13334
NM_004768chr12100 30 ----2984 313
NM_004835chr33808 802 721 ----1606
NM_004835chr33808 802 721 ----1606
NM_005034chr8--1221 2542 72 1498
NM_005095chr122263 1849 183 --21818 318
NM_005156chr924457 162 --25315 5111 11578
NM_005160chr2266615 5407 5355 1390 1015 966 --25653 5207 --
NM_005311chr772371 2309 2144 2116 2038 426 384 22696 1998 ----
NM_005359chr1886476 4512 4131 1114 853 765 655 344 --11206 --
NM_005487chr2241937 1931 588 56 ----22103 1962
NM_005502chr963215 2763 2489 2197 1015 210 --12814 --
NM_005504chr12106548 6522 6185 4129 2239 1652 1573 936 837 691 15082 ----
NM_005613chr162060 1955 543 517 501 458 ------
NM_005668chr574581 4069 4045 4035 3907 3813 829 21661 246 33558 3542 3019 --
NM_005751chr7179 --2169 126 1440
NM_005798chr1375274 5147 5135 1249 535 296 247 ------
NM_005840chrX67614 2946 2882 2831 2000 1001 37009 3031 1693 27133 2185 --
NM_005871chr1051071 888 851 765 755 ------
NM_005885chr51287 11405 2651 206 1583
NM_005902chr1563989 3366 3159 1611 1338 764 14218 --11509
NM_005903chr595068 4975 4913 4539 3224 1160 950 172 144 ------
NM_005955chr145402 3635 2013 302 ----25453 3506
NM_006154chr1562709 2394 2196 2188 1079 887 --1339 --
NM_006251chr573308 2786 1355 1301 1234 665 215 12759 12308 --
NM_006287chr22472 149 --12560 12350
NM_006379chr732159 2087 165 11701 1389 1500
NM_006403chr631816 264 208 11156 --11708
NM_006526chr2031854 1564 558 11914 --1845
NM_006544chr1445120 4317 2259 761 ----12402
NM_006561chr1055062 4504 3973 3856 2405 ----21316 1180
NM_006572chr1753193 2674 2345 1130 943 --1551 11141
NM_006599chr1688094 7256 6850 6838 6125 5851 1971 1259 --18245 16948
NM_006614chr353614 3596 1257 1096 367 --12602 11072
NM_006628chr1564665 4419 4068 492 377 345 --21218 240 1854
NM_006646chr1322542 1984 --13026 1108
NM_006654chr1234014 3770 1398 13259 34112 3913 924 23835 3751
NM_006785chr1841407 1397 335 258 --32247 653 96 --
NM_007005chr941521 1291 469 371 1487 --11310
NM_007007chr1294823 4441 3827 3289 3259 1784 1760 1164 1096 13838 ----
NM_007038chr2155762 5528 4190 1091 867 24371 3994 15227 --
NM_007054chr593957 3927 3909 3709 3319 2811 1139 795 331 13920 13943 --
NM_007146chr1742698 2388 2361 1817 1629 22005 1018 12335
NM_007249chr1359392 9068 9059 8005 2382 17447 16972 19349
NM_007345chr1841979 1789 1490 333 12292 21955 1598 --
NM_009585chr33808 802 721 ----1606
NM_009585chr33808 802 721 ----1606
NM_012081chr573368 2498 1356 1343 569 547 362 --12802 --
NM_012115chr62507 483 3602 559 457 --1573
NM_012129chr72678 502 11995 1333 11745
NM_012214chr265782 3881 2541 1004 768 166 --16203 13944
NM_012234chr313199 12767 --23465 867
NM_012243chr12941 154 ----1896
NM_012287chr374538 4425 3729 3364 3178 3044 50 34381 3307 630 23506 1088 --
NM_013255chr7108836 8642 8352 6569 3468 2583 2475 1450 1283 519 26369 472 27105 3054 --
NM_013381chr1242105 708 681 642 12200 --1936
NM_013436chr21128 2685 518 --1608
NM_013989chr1475131 4296 1889 1689 1632 1209 998 --13223 --
NM_013995chrX42433 2345 1719 607 12142 --12505
NM_014023chr1042739 2524 211 180 --3500 201 121 --
NM_014155chr1157304 7060 6930 2054 1824 12628 17293 1708
NM_014250chr2241937 1931 588 56 ----22103 1962
NM_014296chr361610 1515 1091 1001 222 168 ----1259
NM_014319chr1281392 1359 723 711 685 553 290 89 21906 585 2576 392 --
NM_014702chr61399 --33083 464 253 12780
NM_014707chr722253 112 --11847 11975
NM_014721chr647276 6903 2679 1189 27097 5771 14842 27008 2275
NM_014733chr53776 435 393 --12007 1511
NM_014746chr254136 3708 3565 3283 854 14239 --14104
NM_014774chr143081 2431 2398 328 13177 --12622
NM_014850chr36478 414 390 384 356 344 ------
NM_014877chr17107161 7071 6903 6074 2959 2819 2808 1691 651 48 --12283 --
NM_014904chr1033077 1627 1597 --33939 2879 501 23999 3983
NM_014912chr1033321 3231 2680 --12616 12977
NM_014923chr1342336 2214 2186 1698 1825 --12088
NM_014936chr652618 2263 1083 493 310 12531 1440 --
NM_014946chr222628 2376 --1314 11176
NM_014962chr2032333 2235 2213 12896 11089 1915
NM_015000chr1232631 1055 733 ----22961 2568
NM_015026chr1244073 3996 3846 3177 2527 505 12983 23806 1566
NM_015032chr1362696 2027 1067 886 421 415 22531 2458 1305 --
NM_015055chr1111898 ----22851 1126
NM_015076chr673471 3286 2907 1091 1085 553 405 --24245 1532 13892
NM_015097chr361815 1715 1649 819 449 143 ----1324
NM_015115chr473082 2946 2667 1231 257 204 76 2641 287 1278 12936
NM_015137chr842313 1937 1842 1689 1351 2994 918 --
NM_015205chr1375151 3680 3436 3279 3229 3187 196 23573 3458 --11684
NM_015230chr441461 226 161 45 --1408 1339
NM_015265chr23418 412 406 ------
NM_015310chr858384 8209 7672 5654 2155 26268 2933 28135 136 --
NM_015317chr282840 1796 1761 827 535 430 260 167 12805 22795 690 11822
NM_015335chr1242367 1649 1615 362 12150 --11772
NM_015358chr2131180 1130 1019 ----1522
NM_015375chr164996 4511 3194 1021 1015 321 25033 1849 13086 --
NM_015387chr271999 1488 804 528 177 121 54 ------
NM_015423chr1121346 1292 --1507 11576
NM_015560chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_015569chr1113960 3508 3291 3265 3247 3231 3115 1729 1589 1470 997 --24226 244 11700
NM_015575chr243616 3552 3513 3318 ----33671 2872 918
NM_015576chr342887 2527 2096 1150 --1553 22271 2213
NM_015578chr1932003 341 256 1663 21476 654 --
NM_015640chr1105161 4946 4875 4798 3327 2039 1456 829 279 205 14444 24902 3859 --
NM_015678chr1331473 1361 614 --11218 1487
NM_015886chr845744 1306 348 54 13779 1233 1136
NM_015888chr153116 2776 902 878 321 --21133 295 --
NM_016023chr821874 759 1702 --12126
NM_016083chr683688 3588 3274 3267 2968 2561 2424 914 13757 13768 --
NM_016131chr22267 201 ----22205 336
NM_016205chr42253 70 --1938 21280 439
NM_016206chr388776 7558 6814 6401 5884 1665 1286 721 15787 18840 15512
NM_016260chr277619 7389 7328 7143 5986 2795 2547 15107 27408 5095 15766
NM_016271chr1862242 915 891 821 527 94 ----11437
NM_016308chr132043 586 317 ----11338
NM_016315chr231857 1619 319 1482 145 11565
NM_016374chr151133 1100 1084 360 345 --11165 21048 484
NM_016374chr151133 1100 1084 360 345 --11165 21048 484
NM_016531chr4104129 4075 3088 3011 3005 2842 2570 1414 1158 1072 14149 --13474
NM_016545chr11891 ----2905 839
NM_016620chr121278 408 --11358 21093 428
NM_016626chr1841610 1522 1461 325 ----11283
NM_016953chr245747 4495 2071 473 15613 35642 4792 374 --
NM_017420chr1473640 3442 3209 3062 2676 697 338 --13501 --
NM_017423chr452241 2190 1662 689 102 ----12146
NM_017633chr632919 1077 1045 11025 --1971
NM_017637chr989440 9328 8104 7411 5923 2965 1367 567 --16991 1928
NM_017643chr1752981 2672 2543 1110 218 ----1878
NM_017650chr755558 4934 2184 1603 1513 --25729 2289 --
NM_017769chr1453059 2781 1005 891 274 11086 12414 --
NM_017813chr8105517 5103 4916 4102 3902 2231 2113 1503 1344 508 --1999 25637 3834
NM_018036chr1434131 4121 3471 --23570 1220 24184 661
NM_018157chr1243239 1169 1155 587 ----1525
NM_018181chr1871746 1731 1344 1277 1270 369 246 --2201 151 --
NM_018243chr453938 3685 1285 292 56 ----13854
NM_018351chr1254680 2904 879 504 296 ----183
NM_018557chr23671 185 58 236 28 11267 --
NM_018638chr1295178 4614 4544 4439 2258 1652 1279 281 199 --15220 --
NM_018640chr122412 372 --1292 1944
NM_018682chr74557 502 132 50 ----1106
NM_018841chr183935 2569 2404 642 575 479 459 427 ------
NM_018979chr1232114 817 806 ----1850
NM_019001chr31211 23954 1618 1849 11494
NM_019590chr10------21093 352
NM_019593chr2042426 2023 1087 959 1680 21041 486 --
NM_020116chr411571 1678 1643 11521
NM_020337chr462998 2970 2077 465 378 220 ------
NM_020357chr351452 1385 1185 1177 433 --11191 --
NM_020648chr1842805 2500 84 77 ----11019
NM_020651chr231749 1617 397 ----21401 322
NM_020673chr2076137 5207 1910 1545 997 431 269 17157 36745 5826 1691 22453 1052
NM_020734chr1262969 2779 2703 1308 740 448 --12751 12672
NM_020739chr1543892 3114 1394 1122 ----13334
NM_020747chr54908 261 212 200 --1649 --
NM_020772chr1777696 7389 6651 6457 3225 1825 1310 23195 1926 16104 1872
NM_020774chr18116214 6074 5979 5395 5330 5202 4827 4554 2159 1213 1114 --14167 --
NM_020809chr1122060 660 ----22155 82
NM_020841chr1252648 686 323 278 148 33398 3138 1057 13536 --
NM_020856chr191589 --1598 21465 144
NM_020940chr1082586 2578 2570 2338 1976 1163 776 395 ----1176
NM_020951chr1991801 831 750 735 719 686 666 649 283 --12448 --
NM_021005chr1521088 920 --1902 1260
NM_021007chr292225 826 808 798 790 782 670 529 122 ----1536
NM_021061chr884410 4115 1607 1402 809 640 578 472 14525 ----
NM_021072chr572474 2369 945 920 757 512 322 ------
NM_021148chr731834 1749 330 --153 1141
NM_021629chr355009 4496 4373 1676 833 --1358 13881
NM_021911chr544004 3434 3424 1284 --24519 1388 --
NM_021912chr1573932 1662 1034 991 409 194 174 --2868 132 --
NM_021961chr1197470 7115 6263 5380 4873 1300 1210 782 33 16887 ----
NM_021964chr385260 4967 4478 2431 1845 1403 887 861 --15143 --
NM_022048chr1566167 4954 4819 2362 2332 1839 25858 5768 ----
NM_022114chr184734 4420 4253 4115 1719 1564 1412 826 ----1677
NM_022459chr1336383 4789 844 25876 4553 11014 11567
NM_022474chr1442121 1028 976 317 --2900 337 --
NM_022476chr1611024 --1368 11064
NM_022763chr343180 3127 3098 2584 1642 1803 --
NM_023000chr1431484 138 117 ----1301
NM_023001chr1431484 138 117 ----1301
NM_024336chr162289 79 1109 --161
NM_024511chr473255 2992 2621 2260 1022 736 488 163 ----
NM_024665chr364678 4196 3149 3021 418 147 ----12884
NM_024744chr232693 401 388 ----1204
NM_024947chr349124 8222 7471 1372 39219 3675 2448 28595 6985 1471
NM_024989chr2107940 6649 6574 6436 5367 5360 2687 2667 2348 1855 1975 27495 5053 --
NM_025054chr843611 890 462 102 13095 13823 --
NM_030647chr766225 6173 2110 1713 592 102 25299 1891 25908 1182 16306
NM_030664chr1052370 2162 2069 1702 838 ----22248 673
NM_031243chr722230 1497 135 --1607
NM_031296chr452330 2024 954 146 139 ------
NM_031371chr151133 1100 1084 360 345 --11165 21048 484
NM_031371chr151133 1100 1084 360 345 --11165 21048 484
NM_031435chr1243467 972 741 425 13217 --12975
NM_031453chr1062525 2467 2168 1943 1000 26 ----12539
NM_031461chr831867 1595 758 --2877 315 165
NM_031483chr2012400 --23426 2336 13379
NM_031850chr33808 802 721 ----1606
NM_031850chr33808 802 721 ----1606
NM_032049chr33808 802 721 ----1606
NM_032049chr33808 802 721 ----1606
NM_032102chr11------23000 507
NM_032121chrX72555 2506 2446 1844 473 97 59 --189 --
NM_032186chr121278 408 --11358 21093 428
NM_032246chr1521265 1121 1984 --11027
NM_032410chr821028 275 --11217 1252
NM_032439chr1021178 568 ----1578
NM_032828chr1994940 4432 4325 4169 3153 1576 1366 443 145 --11068 --
NM_032833chr132656 935 793 ----12546
NM_032859chr1373739 3673 3610 3527 1269 523 29 ------
NM_032968chrX84216 4175 4070 3503 1414 1388 871 40 21603 654 1627 --
NM_032969chrX84216 4175 4070 3503 1414 1388 871 40 21603 654 1627 --
NM_032973chrY74208 4167 4062 3499 1414 871 40 21602 654 1627 --
NM_033181chr683688 3588 3274 3267 2968 2561 2424 914 13757 13768 --
NM_033285chr874007 3136 3056 1073 445 360 63 --13828 --
NM_033290chrX52294 548 386 213 174 ----11121
NM_033427chr75612 343 331 323 315 ------
NM_033430chr483951 3871 3583 3259 1678 1104 502 82 14094 33592 275 190 --
NM_033437chr483951 3871 3583 3259 1678 1104 502 82 14094 33592 275 190 --
NM_052811chr1375274 5147 5135 1249 535 296 247 ------
NM_052851chr1372357 2117 1903 381 362 339 313 ------
NM_052885chr1244671 4611 4073 859 24179 377 14843 --
NM_052907chr1233960 1474 21 13156 --1747
NM_057178chr17------22700 215
NM_080546chr972274 1595 123 117 109 95 87 1420 1709 12284
NM_130831chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130832chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130833chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130834chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130835chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130836chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_130837chr362844 2814 2577 2380 1816 466 --2733 434 --
NM_133468chr731609 196 129 1923 --1263
NM_138270chrX22706 2656 192 22341 2321 1651
NM_138473chr1265059 3454 3387 1858 1827 1376 --13360 11031
NM_138554chr932495 2000 347 --12193 12015
NM_138713chr1688094 7256 6850 6838 6125 5851 1971 1259 --18245 16948
NM_138714chr1688094 7256 6850 6838 6125 5851 1971 1259 --18245 16948
NM_138771chr721328 1142 --1596 21039 278
NM_139182chr441461 226 161 45 --1408 1339
NM_144571chr446946 5394 5311 254 --26398 2318 25094 2286
NM_144599chr1554136 1979 1253 1133 707 2778 467 14244 --
NM_144778chr1352705 2545 1826 1815 1778 22385 976 ----
NM_145259chr256837 6630 5147 2511 1851 15033 12753 16975
NM_147171chr7179 --2169 126 1440
NM_147185chr7179 --2169 126 1440
NM_152407chr531237 357 77 ----1432
NM_152624chr555865 2886 1577 1062 281 22896 2635 ----
NM_152754chr763846 3834 3319 2711 1179 1143 2798 332 164 --
NM_152756chr524297 257 24214 1375 21245 1188 24289 4148
NM_152758chr832960 1167 700 --12522 22879 1192
NM_152774chr762675 2645 2209 1056 756 730 ------
NM_152999chr754832 4213 958 793 547 11257 15016 11208
NM_153188chr575649 5637 5368 4750 3800 3700 1146 15192 14496 --
NM_153207chr1273942 2933 1172 1048 893 588 215 12864 --12839
NM_153607chr542639 745 643 608 --1448 1797
NM_170731chr1122757 668 1118 156 1984
NM_170732chr1122757 668 1118 156 1984
NM_170733chr1122757 668 1118 156 1984
NM_170734chr1122757 668 1118 156 1984
NM_170735chr1122757 668 1118 156 1984
NM_172071chr1117253 6554 6336 5690 5598 2476 2108 1801 625 380 352 22711 406 --1415
NM_173214chr1688094 7256 6850 6838 6125 5851 1971 1259 --18245 16948
NM_173468chr496005 5994 5468 5033 2214 2204 1969 1851 897 --25296 927 14358
NM_173647chr221108 106 --189 1400
NM_174911chr863856 3793 3430 3186 3077 2442 ----13768
NM_174916chr1542418 1908 1632 353 12160 --12381
NM_175854chr1352647 2108 1907 1878 700 --3526 346 285 --
NM_175876chr162660 2114 486 206 75 26 22028 667 ----
NM_178006chr1372357 2117 1903 381 362 339 313 ------
NM_178007chr1372357 2117 1903 381 362 339 313 ------
NM_181358chr154213 3042 1420 1111 1079 ----12753
NM_181443chr2032333 2235 2213 12896 11089 1915
NM_181481chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_181482chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_181483chr1855265 5071 4995 1344 1236 --36678 6396 5895 --
NM_181504chr594181 3887 3873 3861 3843 3795 3035 3027 753 ------
NM_181521chr1667263 7215 4617 2383 2297 298 17305 36003 5794 5693 --
NM_181523chr594181 3887 3873 3861 3843 3795 3035 3027 753 ------
NM_181524chr594181 3887 3873 3861 3843 3795 3035 3027 753 ------
NM_182485chr473400 3275 2675 2667 755 473 242 ----12965
NM_182646chr473400 3275 2675 2667 755 473 242 ----12965
NM_182765chr1022330 2178 21990 1759 11871 1793
NM_182907chr641543 1506 898 220 1503 1723 --
NM_182931chr74557 502 132 50 ----1106
NM_182948chr121953 1219 11202 12030 11932
NM_182972chr11338 1126 160 11946
NM_198128chr1862242 915 891 821 527 94 ----11437
NM_198268chr154213 3042 1420 1111 1079 ----12753
NM_198269chr154213 3042 1420 1111 1079 ----12753
NM_198273chr532972 2427 1218 ----23053 2304
NM_198400chr1562709 2394 2196 2188 1079 887 --1339 --
NM_198581chr2117530 7265 7083 6580 6371 6361 5899 5307 5011 1129 1108 --26916 609 --
NM_198793chr343265 1271 1069 555 21285 568 --13664
NM_198935chr2063034 2384 2029 671 228 219 13225 ----
NM_199436chr222628 2376 --1314 11176
NM_199454chr184734 4420 4253 4115 1719 1564 1412 826 ----1677
NM_199462chr164996 4511 3194 1021 1015 321 25033 1849 13086 --
NM_199482chr271999 1488 804 528 177 121 54 ------
NM_201266chr231933 695 306 ----13030
NM_201269chr121278 408 --11358 21093 428
NM_201279chr231933 695 306 ----13030
NM_201570chr1031716 556 125 11807 --149
NM_201571chr1031716 556 125 11807 --149
NM_201572chr1031716 556 125 11807 --149
NM_201590chr1031716 556 125 11807 --149
NM_201593chr1031716 556 125 11807 --149
NM_201596chr1031716 556 125 11807 --149
NM_201597chr1031716 556 125 11807 --149
NM_203372chr241611 1598 525 361 1324 21604 1551 --
NM_205842chr21128 2685 518 --1608
NM_206853chr654097 3800 3777 1633 207 11318 12559 13070
NM_206854chr655358 5061 5038 3681 1468 --33820 718 129 24331 398
NM_206855chr676323 6026 6003 4646 3859 2433 696 --34785 1683 1094 25296 1363
NM_206907chr573308 2786 1355 1301 1234 665 215 12759 12308 --
NM_206909chr858384 8209 7672 5654 2155 26268 2933 28135 136 --
NM_207303chr1073679 2876 2833 1366 542 269 23 11335 ----
NM_207304chr1352592 2432 1713 1702 1665 22272 863 ----
NM_213589chr243507 211 187 179 --23481 1163 13939
NM_213590chr1375274 5147 5135 1249 535 296 247 ------