TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-let-7g-3p
miRNA Sequence: CUGUACAGGCCACUGCCUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52199 102 ------
NM_000027chr47919 828 746 721 235 227 26 1926 ----
NM_000038chr561960 1744 1367 747 592 235 ------
NM_000052chrX63142 2831 2722 2570 811 427 1472 13210 --
NM_000084chrX46715 5256 2430 1089 11445 22180 2149 --
NM_000093chr922393 2161 ------
NM_000112chr595525 5342 5203 3465 1374 1359 930 269 152 --1332 --
NM_000138chr1552355 1954 707 594 467 31045 827 121 ----
NM_000167chrX11813 1723 ----
NM_000168chr772945 2224 1313 1044 735 316 92 ------
NM_000173chr172432 124 ----1444
NM_000176chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_000188chr101738 ------
NM_000189chr241759 897 864 776 22344 908 --1308
NM_000194chrX2506 140 ------
NM_000217chr1264844 4444 3998 1667 1299 1041 ----14597
NM_000222chr462146 2100 1532 1363 770 672 --2741 200 --
NM_000232chr432680 2002 122 ------
NM_000237chr821810 1753 ------
NM_000245chr732044 1841 812 --11438 --
NM_000248chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_000253chr43862 373 108 ------
NM_000255chr63346 171 104 ------
NM_000259chr15116365 5936 5299 5028 4855 4801 4778 4736 2101 2088 607 11776 14591 --
NM_000264chr993244 3238 2651 2440 649 613 296 191 113 43149 2907 385 372 11027 --
NM_000267chr1743355 3270 2410 1073 ------
NM_000282chr132209 196 --1101 --
NM_000284chrX1160 11748 ----
NM_000297chr431844 1711 632 --11699 --
NM_000298chr12262 38 ------
NM_000314chr1063190 2665 2598 714 327 218 12864 23125 2964 --
NM_000321chr134402 278 138 32 11232 11741 171
NM_000332chr696928 6027 5280 5066 2792 2388 1182 647 61 12780 37158 6463 870 --
NM_000337chr566209 2640 2106 1261 1182 122 ----1212
NM_000340chr321215 542 --11167 --
NM_000345chr421044 152 ----158
NM_000346chr1721994 596 21431 1353 --11799
NM_000362chr2253582 2533 2465 1004 269 1782 --12429
NM_000378chr112774 366 1836 --11173
NM_000408chr253440 2505 1390 1137 175 33448 2754 2261 12282 --
NM_000415chr121936 ----154
NM_000428chr1442656 2627 2511 316 --12397 --
NM_000430chr1793780 3681 3464 3439 2552 1391 1144 904 182 1898 13266 --
NM_000435chr192982 367 ------
NM_000449chr141130 574 242 233 --1122 --
NM_000459chr93879 746 107 --2193 120 --
NM_000461chr3114549 4047 3993 3960 3773 3281 3241 3215 1282 649 547 ----13967
NM_000462chr1561816 1170 501 478 291 161 ----1593
NM_000484chr215839 799 331 266 137 11079 ----
NM_000489chrX52706 2437 2341 2321 448 31309 651 588 12681 192
NM_000492chr731376 1169 970 11203 ----
NM_000503chr841847 1774 718 697 --1467 11819
NM_000527chr1952261 2174 849 839 544 22364 2333 22445 2136 --
NM_000555chrX127856 7633 6913 6727 6632 5648 2818 1783 1699 1547 972 825 --15912 15614
NM_000572chr12855 110 ------
NM_000596chr76505 428 403 200 97 91 ------
NM_000599chr254492 4055 3824 1433 759 --14555 --
NM_000609chr1073154 3121 2966 2457 2394 1042 250 --4895 783 736 329 --
NM_000610chr1143002 2958 1214 680 ----12898
NM_000618chr1256051 4078 1267 603 325 1785 11939 --
NM_000618chr1256051 4078 1267 603 325 1785 11939 --
NM_000621chr1341090 892 522 124 1279 ----
NM_000633chr1894570 4305 4120 3752 3696 2029 1743 799 353 24986 4382 25101 1568 --
NM_000636chr6----2536 513 --
NM_000663chr1622892 1145 ------
NM_000686chrX21318 1156 21529 194 --11331
NM_000719chr12156649 6507 6370 5917 5833 5356 5321 2188 1946 1691 1462 1226 1207 1123 869 --25872 4792 24270 392
NM_000724chr1041716 1605 768 454 31807 1293 49 1556 --
NM_000767chr191522 ----1623
NM_000800chr541659 1505 1235 427 21599 1378 ----
NM_000806chr551960 1438 1397 767 518 --21351 376 --
NM_000809chr498204 8068 6676 3716 3620 2939 2912 1920 1534 48597 8524 1945 1740 37430 6616 1912 16732
NM_000813chr5105004 4519 3912 3673 3434 3424 1799 1388 1341 54 ----14833
NM_000814chr1551205 1034 194 176 132 11560 23322 82 --
NM_000817chr241204 933 256 222 --11009 --
NM_000824chr43207 199 182 122 1660 --
NM_000826chr452411 2271 2010 1947 418 ------
NM_000829chr1152063 1783 934 548 166 1917 --12230
NM_000831chr1146275 5872 4936 4639 4603 4579 2379 2367 2251 2243 2223 2066 1940 1837 --14554 14516
NM_000840chr72480 419 --1147 --
NM_000855chr112351 126 ------
NM_000859chr551697 1541 1217 670 218 31682 1357 1346 ----
NM_000868chrX52587 2469 1692 313 141 --12308 --
NM_000872chr1021230 113 11461 ----
NM_000875chr1597085 6911 5936 2767 2649 2054 1375 728 101 26841 5753 21257 442 124
NM_000877chr253110 3078 3050 3027 2959 ------
NM_000891chr1743660 3639 2873 2465 ------
NM_000899chr1254309 4301 2981 1648 1410 1835 1515 --
NM_000901chr442404 958 718 703 1724 1709 --
NM_000912chr873560 3523 3494 3477 2623 2444 485 13189 ----
NM_000919chr51101 --1122 --
NM_000944chr471960 1584 1529 971 961 627 411 1472 ----
NM_000945chr242077 1872 1816 534 ----1492
NM_000958chr531313 448 85 1932 11188 155
NM_000959chr132963 2940 1061 --22719 178 23946 1305
NM_000965chr331218 369 333 --1443 --
NM_001001323chr1252850 2757 2181 877 833 1415 ----
NM_001001331chr321766 508 --2654 340 --
NM_001001344chrX12314 12603 1659 12259
NM_001001389chr1143002 2958 1214 680 ----12898
NM_001001390chr1143002 2958 1214 680 ----12898
NM_001001391chr1143002 2958 1214 680 ----12898
NM_001001392chr1133048 3004 726 ----12944
NM_001001395chr125428 292 217 156 69 1944 1412 --
NM_001001396chr143993 2823 1743 649 54305 4133 3341 3294 730 14480 --
NM_001001484chr1092397 2226 2162 2120 2069 2053 1723 838 171 22248 673 ----
NM_001001557chr811630 21988 1923 11852 --
NM_001001664chr243866 2974 2965 1243 24008 1595 1775 --
NM_001001701chr41286 1751 11480 --
NM_001001706chr61238 1854 --1108
NM_001001740chr1125 ------
NM_001001740chr1125 ------
NM_001001872chr142178 154 ------
NM_001001890chr2144257 1444 1425 741 33815 3768 1652 23123 1525 --
NM_001001928chr2278311 8099 6901 5981 5661 5476 2541 --27454 2055 --
NM_001002026chr322447 959 ------
NM_001002032chr173704 650 200 1532 ----
NM_001002033chr173804 750 300 1632 178 --
NM_001002243chr24895 733 261 159 --1803 --
NM_001002257chr263411 3059 2625 2212 611 206 13485 12181 --
NM_001002258chr231872 163 105 --11349 --
NM_001002843chr151135 --21274 381 --
NM_001002860chr14174720 4620 4502 4313 4210 4194 3454 2980 1720 1078 692 419 372 321 304 136 24 ------
NM_001003407chr10115026 4730 4448 4025 4014 3738 3109 1864 1608 1167 266 ------
NM_001003408chr10115026 4730 4448 4025 4014 3738 3109 1864 1608 1167 266 ------
NM_001003652chr18118616 8606 7894 7434 5326 3423 3096 1901 1771 1696 308 1911 12639 --
NM_001003674chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_001003675chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_001003681chr2272121 1972 1950 1767 1751 1478 56 32103 1962 150 1588 --
NM_001003688chr421098 272 ------
NM_001003712chr1293931 3536 3265 2498 1625 1613 1029 688 278 33398 3138 713 ----
NM_001003800chr973491 3455 3009 2579 825 704 609 12884 13503 --
NM_001003845chr21405 ------
NM_001004065chr963883 3084 3036 2668 1371 1277 --1867 --
NM_001004196chr311209 --1912 --
NM_001004317chr684339 4012 3044 2748 1671 332 265 227 13774 14435 --
NM_001004419chr1243660 3366 3186 429 --24556 832 23509 3328
NM_001004441chr551574 1446 682 573 147 ------
NM_001005335chr191243 ------
NM_001005354chr12174 ------
NM_001005375chrY21253 602 ----1205
NM_001005404chr1754443 4437 4330 3833 2850 14231 ----
NM_001005417chr11673 ------
NM_001005463chr102826 412 22372 290 22568 783 12593
NM_001005473chr566490 2362 2006 1987 1969 404 --16566 --
NM_001005474chr31552 1591 2519 67 --
NM_001005609chrX73786 3766 2802 1530 1246 756 660 ------
NM_001005743chr1431312 415 244 ------
NM_001005744chr1431312 415 244 ------
NM_001005745chr1431312 415 244 ------
NM_001005781chr22567 242 --1437 --
NM_001005782chr251016 800 734 691 238 --1886 --
NM_001005849chr173479 180 157 ------
NM_001006115chr352409 2103 1879 1755 851 --22761 2368 12497
NM_001006600chr551910 1778 489 275 125 1325 21784 174 --
NM_001006617chr941370 1185 377 311 ------
NM_001006619chr941370 1185 377 311 ------
NM_001006620chr941370 1185 377 311 ------
NM_001006621chr941370 1185 377 311 ------
NM_001006636chr21370 1301 ----
NM_001006657chr243219 2630 2434 652 --166 13106
NM_001006665chr1------1228
NM_001007024chr1774373 4345 3291 2824 1491 505 182 --14388 --
NM_001007025chr1774373 4345 3291 2824 1491 505 182 --14388 --
NM_001007088chrX41232 1084 817 180 1834 ----
NM_001007102chr641645 1632 476 367 ------
NM_001007226chr1731095 972 505 ------
NM_001007227chr1731095 972 505 ------
NM_001007228chr1731095 972 505 ------
NM_001007229chr1731095 972 505 ------
NM_001007230chr1731095 972 505 ------
NM_001007231chr22579 216 ------
NM_001007245chr74636 623 513 427 2206 143 ----
NM_001007466chr695058 4903 4680 4547 4327 4034 3556 3215 472 44524 3537 2054 1448 21645 1356 13429
NM_001007559chr1852064 2020 1789 421 394 ------
NM_001008220chr573972 2963 2941 2537 1556 1524 1147 13937 23304 1391 --
NM_001008239chr1833307 991 487 13657 --2935 373
NM_001008392chr383523 3340 3242 3147 2715 2627 2407 1058 --22344 31 13309
NM_001008405chr751750 673 356 244 198 1466 11432 --
NM_001008495chr822080 223 ------
NM_001008564chr1342090 1786 1692 488 11809 11510 --
NM_001008738chr5102906 2867 2632 2103 2091 1793 1108 568 266 146 12950 22889 2133 --
NM_001008925chr453471 3089 1365 390 294 13071 ----
NM_001008938chr114420 413 158 91 ------
NM_001009571chr721685 490 1519 ----
NM_001009881chr14611 569 217 207 ------
NM_001009882chr14611 569 217 207 ------
NM_001009899chr3136503 5843 5751 5529 5245 4870 2498 2121 1209 1172 1064 77 65 16329 --1111
NM_001009959chr241973 1838 936 492 12431 1401 --
NM_001009993chr264214 4128 2909 1497 1441 1065 --24145 33 --
NM_001010853chr633065 2655 489 11011 ----
NM_001010854chr141521 1681 ----
NM_001010861chr122430 2278 ------
NM_001010867chr1116086 5515 4388 2219 1884 1691 1187 609 459 392 347 ------
NM_001010888chrX34616 3941 3448 13964 11081 11020
NM_001010891chr586120 5792 5010 4252 1846 1695 1383 342 26843 2412 2901 257 15680
NM_001010895chr92220 162 11877 ----
NM_001011513chr474121 4036 3455 3059 3043 825 214 23988 3342 ----
NM_001011515chr421054 82 --1876 --
NM_001011516chr421054 82 --1876 --
NM_001011537chr352302 2098 1908 1747 1474 ------
NM_001011553chr74963 942 393 193 1291 ----
NM_001011554chr20------21939 620
NM_001011708chr221932 447 32727 1816 874 --12222
NM_001011713chr1421483 67 ------
NM_001012267chr9------11595
NM_001012337chr3147 196 ----
NM_001012393chr1175182 5119 3470 3424 2019 1022 475 --13815 --
NM_001012420chr1552198 793 718 489 379 1671 ----
NM_001012423chr1552198 793 718 489 379 1671 ----
NM_001012751chr1041645 1618 625 318 11310 ----
NM_001012755chrX54946 4827 3520 1980 1730 34987 4936 4844 --11974
NM_001012761chr572681 438 395 319 147 108 97 12044 ----
NM_001013031chr1073393 2709 1126 1006 980 928 198 13260 22939 155 --
NM_001013399chr62977 448 ------
NM_001013406chr761502 1169 1137 447 436 422 ----1552
NM_001013438chr32781 655 2973 214 --1897
NM_001013620chr12146731 6538 6038 5895 5870 3113 2464 2408 1765 1663 1463 1438 1292 434 1300 ----
NM_001013703chr15169 ------
NM_001014380chr13105868 5612 5005 4966 4404 4275 3940 2171 1980 358 13894 13737 --
NM_001014797chr1098211 8200 7560 7433 6486 5575 1453 605 361 15907 27212 5440 --
NM_001015508chr81490 ------
NM_001015877chrX33017 2211 256 --12312 --
NM_001015880chr101372 21695 583 1614 2520 430
NM_001015892chr5250 28 ------
NM_001017368chr173994 456 343 32700 2118 215 12671 --
NM_001017369chr431083 1053 1023 ------
NM_001017371chr231352 1255 1149 31201 546 96 ----
NM_001017395chr353422 2806 2632 2582 738 11138 13658 --
NM_001017405chr41177 1705 ----
NM_001017415chr15788 761 603 507 25 --1671 --
NM_001017416chr15788 761 603 507 25 --1671 --
NM_001017424chr131636 1537 92 11903 11530 --
NM_001017425chr131636 1537 92 11903 11530 --
NM_001017440chr788075 7829 7821 1431 1151 1049 753 47 18154 26339 2419 18223
NM_001017523chr1261847 1753 1718 1195 1181 399 11487 ----
NM_001017922chr151724 1199 1161 614 137 ------
NM_001017923chr142427 75 1493 --1172
NM_001017969chr94663 575 517 489 1532 ----
NM_001017979chr42788 639 ------
NM_001017992chr531561 1363 607 ----1379
NM_001018009chr331191 1023 27 --11107 --
NM_001018056chr91508 --1572 --
NM_001018064chr941649 1500 1349 824 1592 1504 --
NM_001018065chr986012 5312 5018 4432 1381 919 901 713 --14230 13848
NM_001018066chr986012 5312 5018 4432 1381 919 901 713 --14230 13848
NM_001018067chr1104902 4798 4696 4210 4140 4108 3859 3737 3483 3320 24522 4444 11456 --
NM_001018068chr1104902 4798 4696 4210 4140 4108 3859 3737 3483 3320 24522 4444 11456 --
NM_001018069chr1104902 4798 4696 4210 4140 4108 3859 3737 3483 3320 24522 4444 11456 --
NM_001018072chr1261847 1753 1718 1195 1181 399 11487 ----
NM_001018074chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_001018075chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_001018076chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_001018077chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_001018676chr81496 ------
NM_001018677chr81496 ------
NM_001020658chr191543 1523 1436 1420 1105 1067 277 259 247 11591 11056 --
NM_001020658chr191543 1523 1436 1420 1105 1067 277 259 247 11591 11056 --
NM_001020825chr551351 1049 978 145 65 ------
NM_001023567chr1552029 721 673 492 181 11540 --12424
NM_001023587chr311068 --21108 228 11055
NM_001024094chr5113876 3574 3503 2670 2590 1380 1246 936 785 596 474 31022 821 59 1415 --
NM_001024218chr144799 728 692 53 --1112 --
NM_001024463chr152937 278 ----1782
NM_001024660chr361408 1269 1239 657 413 299 --1682 --
NM_001024808chr1252784 1818 1056 726 303 22843 2836 ----
NM_001024847chr312365 --1289 --
NM_001024924chr42567 426 ----1395
NM_001024948chr163439 3349 2728 2578 2549 1053 --23318 1038 13152
NM_001024956chr1155895 5521 1165 1127 274 --14030 --
NM_001025068chr351777 1628 1528 1185 538 ------
NM_001025069chr351777 1628 1528 1185 538 ------
NM_001025076chr1054621 4504 2467 1785 752 34138 1316 1180 ----
NM_001025077chr1085979 5862 5067 5061 4811 4796 2110 241 55496 2674 2538 687 384 ----
NM_001025079chr343527 2775 1313 1280 13719 --1760
NM_001025108chr264090 3659 3419 3175 1101 68 33728 3698 3623 13890 --
NM_001025205chr31427 ------
NM_001025252chr853220 2622 2573 790 200 --31227 582 397 --
NM_001025253chr853220 2622 2573 790 200 --31227 582 397 --
NM_001025266chr32467 49 11970 13188 1601
NM_001025356chr1252808 2155 2127 1121 1031 --22983 2941 --
NM_001025579chr1741056 1018 753 425 --21143 966 --
NM_001025580chrX73863 3533 3371 3341 531 423 93 ------
NM_001025595chr431572 1044 577 --11565 --
NM_001025603chr141130 574 242 233 --1122 --
NM_001025616chr441520 515 221 99 ----11918
NM_001025780chr93501 258 119 --1555 --
NM_001029858chr632553 354 65 ----13384
NM_001029863chr643250 538 461 80 12610 1222 --
NM_001029884chr662612 2553 2462 645 180 82 --22710 626 12369
NM_001030002chr171322 ------
NM_001030007chr1663009 2701 1568 1194 993 92 --32899 601 591 --
NM_001030055chr14104586 3737 3371 3333 1896 1570 1505 1130 741 562 33876 3151 682 ----
NM_001031623chr62356 186 1177 --1363
NM_001031692chr7------1291
NM_001031695chr2295226 4684 4399 2099 1917 1331 1188 296 231 15358 ----
NM_001031732chr472967 2610 1352 1154 1097 672 461 22480 754 12505 --
NM_001031804chr1623081 1738 --14342 --
NM_001031812chr552045 1999 1945 1561 1503 2888 753 11769 11739
NM_001032221chr931801 1791 331 1248 11364 11121
NM_001032280chr641655 1597 1246 249 --1688 --
NM_001032293chr174637 548 446 215 ------
NM_001032296chr13102939 2795 2781 2272 685 585 438 428 321 166 1493 ----
NM_001032393chrX2748 605 --147 --
NM_001032394chr622594 1005 --22698 952 --
NM_001032395chr622461 872 --22565 819 --
NM_001032999chr2065242 4930 4666 4343 4215 730 --45289 1817 1017 168 15313
NM_001033047chr41408 2447 165 --12577
NM_001033057chr351888 1521 1338 658 556 11595 ----
NM_001033085chr2------145
NM_001033087chr2023235 2898 ----12468
NM_001033117chr393453 1784 839 478 414 394 384 368 356 13148 34249 3088 135 --
NM_001033507chr141882 1600 1540 1374 1136 1472 --
NM_001033557chr231365 1304 72 --11374 --
NM_001033561chr175903 860 693 212 66 --2911 32 --
NM_001033659chr17------11604
NM_001033723chr832511 1904 275 1437 11705 --
NM_001034852chr1441474 547 377 365 1524 1342 --
NM_001034954chr1052766 2744 2730 2371 2188 --23250 613 --
NM_001034955chr1052766 2744 2730 2371 2188 --23250 613 --
NM_001034956chr1052766 2744 2730 2371 2188 --23250 613 --
NM_001034957chr1052766 2744 2730 2371 2188 --23250 613 --
NM_001037131chr221241 1147 11207 ----
NM_001037132chr751616 877 542 498 113 --12067 11623
NM_001037133chr751616 877 542 498 113 --12067 11623
NM_001037174chr242189 1838 618 472 2809 34 ----
NM_001037317chr122430 2278 ------
NM_001037334chr1852280 1842 912 862 648 --1150 1834
NM_001037553chr2175090 4620 4605 4453 4414 4188 1846 --11679 --
NM_001037582chr4175 11213 ----
NM_001038628chr321818 389 11792 --11429
NM_001038702chr562673 1110 967 927 844 358 11729 --11059
NM_001039091chrX31390 1091 127 --1445 --
NM_001039465chr141426 ------
NM_001039538chr223516 2522 1497 13678 12744
NM_001039577chr1134472 4430 3883 3840 3682 3470 3461 1730 1721 1706 424 258 252 --1623 --
NM_001039580chr494614 4582 4546 4532 4414 3966 883 493 306 45046 3984 1655 1047 ----
NM_001039585chr133220 3197 1318 --22976 435 24203 1562
NM_001039590chrX63250 1299 968 736 243 191 22751 2714 21571 37 --
NM_001039591chrX63250 1299 968 736 243 191 22751 2714 21571 37 --
NM_001039618chr1154202 3795 2006 1994 1980 34000 1241 664 25049 588 --
NM_001039693chr283789 3761 3556 2628 1211 797 447 171 13034 ----
NM_001039709chr2065242 4930 4666 4343 4215 730 --45289 1817 1017 168 15313
NM_001039762chr1052326 1730 899 563 150 --1344 --
NM_001039840chrX95976 5384 4593 3827 1819 1696 1680 818 234 35500 5130 2072 ----
NM_001039845chr21591 1619 --1631
NM_001039937chr1333684 1230 424 1461 13983 --
NM_001040097chr71153 ------
NM_001040098chr71153 ------
NM_001040099chr71153 ------
NM_001040100chr31793 1446 ----
NM_001040110chr74412 323 315 277 --11627 --
NM_001040142chr291979 1591 826 810 798 790 782 776 122 1536 ----
NM_001040143chr291979 1591 826 810 798 790 782 776 122 1536 ----
NM_001040153chr134965 785 382 263 ------
NM_001040157chr472817 2668 1935 573 429 277 53 22230 683 ----
NM_001040158chr51380 ------
NM_001040202chr492264 2175 2140 2018 1969 1873 1011 210 60 ------
NM_001040214chr652212 2204 2011 545 503 11781 11971 1722
NM_001040272chr942377 2362 2256 1816 --31960 1757 868 --
NM_001040284chr1645160 2318 1963 503 11420 1451 135
NM_001040402chr442946 1159 278 257 43118 2936 641 287 ----
NM_001040429chr1352781 2360 2199 1424 1260 21367 979 --1558
NM_001040446chr552522 2410 2285 1826 665 --22673 2559 12529
NM_001040450chr1572422 1994 1831 1766 572 522 91 ------
NM_001040453chr1572422 1994 1831 1766 572 522 91 ------
NM_001040619chr111567 ------
NM_001040633chr72238 99 --1990 --
NM_001040708chr831139 385 284 ------
NM_001040712chr9103555 3020 2907 2835 2705 2692 2319 1275 931 536 22850 726 --12717
NM_001040876chr461487 1423 737 704 368 215 --11447 --
NM_001042355chr1675402 5386 3875 1989 1846 1242 1155 --23607 1214 --
NM_001042357chr1031201 478 78 11526 ----
NM_001042358chr1031201 478 78 11526 ----
NM_001042360chr1031201 478 78 11526 ----
NM_001042363chr1031201 478 78 11526 ----
NM_001042388chr181946 --2774 625 --
NM_001042389chr1031201 478 78 11526 ----
NM_001042390chr1031201 478 78 11526 ----
NM_001042392chr1031201 478 78 11526 ----
NM_001042395chr1031201 478 78 11526 ----
NM_001042404chr161471 1401 722 699 377 76 --1414 --
NM_001042412chr1675402 5386 3875 1989 1846 1242 1155 --23607 1214 --
NM_001042413chr973766 3663 3520 3424 1571 679 325 --13225 --
NM_001042425chr641655 1597 1246 249 --1688 --
NM_001042481chr1472521 2351 2029 1745 1731 888 207 --2479 24 --
NM_001042492chr1743355 3270 2410 1073 ------
NM_001042493chr6174 ----31774 1513 286
NM_001042494chr1543850 3558 2804 639 23723 3607 1112 --
NM_001042495chr1543850 3558 2804 639 23723 3607 1112 --
NM_001042496chr1543850 3558 2804 639 23723 3607 1112 --
NM_001042497chr1543850 3558 2804 639 23723 3607 1112 --
NM_001042506chrX71366 1332 1321 1163 1044 933 256 ------
NM_001042510chr862056 1664 730 572 489 184 ------
NM_001042511chr862056 1664 730 572 489 184 ------
NM_001042537chrX62044 1998 1598 1552 737 63 --2918 152 --
NM_001042539chr161725 ------
NM_001042543chr431596 506 82 11488 --1629
NM_001042555chr12104112 3998 3913 1922 1823 1257 924 369 210 133 43835 3751 3259 3239 ----
NM_001042599chr297734 7331 7191 7014 7005 4798 4783 2146 432 26218 3009 46470 6375 5871 4756 17742
NM_001042603chr1295234 4960 4511 4106 4071 3529 3347 1592 1488 --43472 3414 3356 2043 11994
NM_001042604chr384482 4426 3529 849 838 619 200 185 23954 1618 13428 34806 3502 1758
NM_001042616chr42214 165 --126 --
NM_001042669chr441520 515 221 99 ----11918
NM_001042749chrX41924 1838 774 369 11621 21684 90 --
NM_001042750chrX41924 1838 774 369 11621 21684 90 --
NM_001042751chrX41924 1838 774 369 11621 21684 90 --
NM_001043318chr1464142 3981 3847 3028 2579 997 --34010 1207 193 --
NM_001044305chr661223 1143 649 504 404 150 ----11072
NM_001044385chr251578 951 648 623 79 24048 2836 13722 --
NM_001044722chr552045 1999 1945 1561 1503 2888 753 11769 11739
NM_001044723chr552045 1999 1945 1561 1503 2888 753 11769 11739
NM_001046chr563006 2348 2276 2016 965 494 ------
NM_001048183chr183761 3726 3702 3603 3498 1071 1027 542 --1338 --
NM_001049chr1452200 2047 2024 1680 1647 ------
NM_001068chr3177 ------
NM_001078chr12735 260 --2608 240 2664 45
NM_001079874chr122079 1624 ----21670 209
NM_001083620chr452409 2269 2008 1945 417 ------
NM_001096chr174847 730 260 65 ------
NM_001099678chr3116280 4658 4610 4434 2316 2275 1922 1631 1257 861 503 24725 1540 21890 412 14700
NM_001106chr3109785 9272 9183 9005 8887 7030 6379 3715 3179 221 ----18582
NM_001107chr141146 --1169 --
NM_001117chr1852316 2192 1991 825 28 12416 2786 474 --
NM_001124chr112636 513 ----1696
NM_001128chr1663009 2701 1568 1194 993 92 --32899 601 591 --
NM_001148chr441438 554 409 386 42253 2224 1705 548 ----
NM_001149chr1021175 263 1245 --1508
NM_001160chr1272676 2256 505 379 355 262 106 ------
NM_001167chrX106418 5485 4898 4463 1755 1414 1309 678 192 128 14775 22298 372 26714 6129
NM_001173chr14104586 3737 3371 3333 1896 1570 1505 1130 741 562 33876 3151 682 ----
NM_001198chr661543 1506 723 670 648 77 12406 1220 1503
NM_001200chr202391 251 ------
NM_001201chr473699 3653 3394 2761 856 590 181 23913 3340 33530 3198 1406 12602
NM_001204chr276811 6352 6190 5895 5636 2520 1834 27498 513 25969 2794 17527
NM_001206chr963139 3130 3041 1129 773 403 ------
NM_001233chr722309 780 12335 1621 --
NM_001235chr111667 ------
NM_001241chr262339 1913 1829 1624 787 582 ----12108
NM_001241chr262339 1913 1829 1624 787 582 ----12108
NM_001256chr1742923 2673 2606 928 --2154 69 11853
NM_001259chr7115603 4585 4177 1983 1867 1732 1523 1076 779 714 410 11161 ----
NM_001304chr1753708 3022 2753 2556 991 ----13851
NM_001329chr1031118 1008 662 --2541 255 --
NM_001332chr551145 1125 545 511 39 11092 1457 --
NM_001356chrX42272 1539 597 312 --12449 --
NM_001364chr11114653 4429 4211 4190 4103 4094 3355 3013 1372 732 148 1136 44677 4220 1720 1647 --
NM_001385chr81286 ------
NM_001399chrX73786 3766 2802 1530 1246 756 660 ------
NM_001401chr941371 1333 1247 1012 ------
NM_001412chrX83456 3449 3387 3380 2702 1445 393 378 ------
NM_001419chr1994851 4158 4133 3002 2993 1606 1360 884 23 175 ----
NM_001420chr1933165 2175 2084 ------
NM_001427chr762048 1977 1800 1694 1562 145 178 ----
NM_001429chr223688 262 61 --21064 131 --
NM_001430chr211972 ------
NM_001432chr493540 3381 2461 2410 2392 768 432 185 113 23521 179 12852 --
NM_001438chr153567 3492 2766 2690 1058 13347 12255 --
NM_001451chr1611329 11320 1299 11248
NM_001454chr172746 236 ------
NM_001490chr973555 2563 1489 1188 532 485 362 --11081 --
NM_001491chr642693 1749 1056 430 --1572 --
NM_001498chr651147 255 186 180 104 2325 77 1873 --
NM_001514chr14503 225 149 51 ------
NM_001527chr694752 4225 4198 3938 3338 1711 1447 336 114 22950 1020 11252 --
NM_001533chr191243 ------
NM_001543chr5104634 4061 3806 3711 3448 3279 3142 1854 1036 788 14840 ----
NM_001546chr63540 509 258 --11156 --
NM_001550chr74636 623 513 427 2206 143 ----
NM_001557chr221213 1144 ------
NM_001564chr41140 ------
NM_001614chr171599 --1234 --
NM_001614chr171599 --1234 --
NM_001616chr253388 3358 2828 520 250 13492 ----
NM_001621chr773052 2836 2793 2724 2646 2306 586 11071 ----
NM_001621chr773052 2836 2793 2724 2646 2306 586 11071 ----
NM_001635chr731032 735 261 1152 1741 --
NM_001650chr1854123 2896 1207 794 101 23731 2776 ----
NM_001656chr551981 1951 1930 1850 1504 21746 632 ----
NM_001668chr161854 1839 1716 1594 581 284 ------
NM_001682chr1262564 2471 1895 1033 591 547 1129 ----
NM_001683chr321766 508 --2654 340 --
NM_001684chr143710 2540 1460 366 54022 3850 3058 3011 447 14197 --
NM_001689chr231872 163 105 --11349 --
NM_001693chr84491 478 267 258 ------
NM_001694chr161117 ------
NM_001695chr894272 4259 3474 1618 1556 852 386 328 147 ----1531
NM_001706chr33806 385 343 ----11048
NM_001709chr1132330 1153 56 1118 ----
NM_001730chr134303 217 135 126 --11571 --
NM_001730chr134303 217 135 126 --11571 --
NM_001731chr125884 863 851 752 323 --1670 --
NM_001743chr24577 474 460 116 136 ----
NM_001754chr2144257 1444 1425 741 33815 3768 1652 23123 1525 --
NM_001755chr1661778 1629 1597 1562 848 448 ------
NM_001769chr121323 ------
NM_001777chr343527 2775 1313 1280 13719 --1760
NM_001788chr74963 942 393 193 1291 ----
NM_001792chr1831117 975 252 ------
NM_001795chr1611574 ------
NM_001830chrX21435 1421 33637 3312 1134 13810 1294
NM_001839chr14712 534 271 113 1615 ----
NM_001845chr131921 11299 --1449
NM_001858chr654213 4197 4112 1913 1884 23893 1790 31695 1651 1267 1675
NM_001860chr9----11127 --
NM_001882chr52413 171 ------
NM_001894chr2221197 46 ------
NM_001938chr121918 1727 1601 ----
NM_001944chr1832342 1835 84 --21911 1595 --
NM_001946chr125920 447 248 237 124 11017 1210 1945
NM_001949chr682911 2833 2640 2630 2371 2348 2061 337 42708 2579 2541 277 ----
NM_001954chr61751 ------
NM_001964chr541190 1108 414 403 1813 ----
NM_001966chr321502 1260 ------
NM_001968chr44952 839 652 164 1930 ----
NM_001969chr14103530 3134 2744 2408 933 783 766 710 678 547 183 ----
NM_001992chr562241 2063 1937 578 495 292 1116 22159 700 --
NM_001995chr411259 ------
NM_002006chr485545 4946 2062 885 561 296 191 92 32301 2244 853 11084 --
NM_002009chr1562592 2109 995 732 697 151 32741 831 258 ----
NM_002010chr131403 ------
NM_002015chr13103270 2603 2530 1059 952 661 471 335 239 208 33255 2554 712 1186 --
NM_002017chr1121016 980 --21000 305 --
NM_002024chrX42093 2040 1558 547 --21689 811 --
NM_002025chrX98096 7119 7034 6182 5825 2627 1813 1758 188 69174 9080 8309 7201 1796 785 38993 7977 6079 --
NM_002027chr81496 ------
NM_002040chr2133180 2792 2496 --31095 671 108 --
NM_002056chr23756 234 32 124 ----
NM_002063chrX11099 ----11258
NM_002069chr73515 388 283 1545 ----
NM_002087chr171298 ------
NM_002092chr484747 4295 3084 1321 1141 1113 998 531 45104 4011 1593 967 13904 11827
NM_002106chr42323 81 ------
NM_002111chr4103868 3837 2969 2347 1257 751 645 491 448 250 ------
NM_002126chr1784094 3371 1583 1454 741 718 160 138 13440 12729 --
NM_002128chr1332526 2227 143 12370 31893 126 58 12449
NM_002130chr531443 1272 390 ------
NM_002137chr731974 839 483 1607 11516 135
NM_002139chrX1240 ------
NM_002146chr1721235 1158 --11333 --
NM_002158chr263448 3059 2920 1443 1433 899 43519 3509 2758 1279 ----
NM_002166chr21515 ----1748
NM_002193chr221901 1890 ------
NM_002196chr203884 749 33 11008 1282 21112 265
NM_002196chr203884 749 33 11008 1282 21112 265
NM_002202chr52981 787 ------
NM_002203chr583845 3817 3614 3278 3170 2853 794 452 13986 32540 1136 1076 --
NM_002210chr262920 2868 2745 425 338 261 1679 --13587
NM_002222chr331138 529 134 ----1362
NM_002240chr21--1586 2621 525 --
NM_002241chr152762 2737 2727 923 459 --11133 --
NM_002247chr1061902 1681 1505 954 144 34 11986 ----
NM_002253chr411364 ------
NM_002264chr394960 4596 4183 3596 3301 1865 1326 1250 457 14645 ----
NM_002268chr341616 683 599 67 31573 1334 577 ----
NM_002270chr5145621 5503 5470 5408 5092 4848 4522 4496 3700 1509 1481 1207 341 182 ----25192 1190
NM_002271chr1332344 2165 1513 1801 ----
NM_002285chr264090 3659 3419 3175 1101 68 33728 3698 3623 13890 --
NM_002293chr132541 1018 528 --1290 --
NM_002310chr596441 6189 4559 4076 2225 1714 595 368 300 26419 4059 23991 1237 24762 606
NM_002313chr10115026 4730 4448 4025 4014 3738 3109 1864 1608 1167 266 ------
NM_002336chr1254240 3336 242 158 113 35016 665 229 --15001
NM_002349chr241411 302 273 241 21575 1426 11639 --
NM_002350chr841219 1185 974 177 ------
NM_002351chrX2168 22 --1487 --
NM_002356chr662779 2751 2658 2076 729 695 22794 818 ----
NM_002358chr43579 499 259 --1471 --
NM_002359chr1784311 3225 2868 1359 1186 1101 255 143 --24268 582 --
NM_002374chr223516 2522 1497 13678 12744
NM_002382chr1431270 1212 871 --1197 --
NM_002387chr564999 4961 1526 653 249 189 --1321 --
NM_002397chr542239 842 683 422 2233 217 ----
NM_002408chr142539 311 1833 ----
NM_002430chr2252581 2565 2008 876 376 --12591 --
NM_002448chr4157 --1725 --
NM_002478chr112555 512 ------
NM_002480chr1231502 1455 358 ------
NM_002487chr152652 262 ------
NM_002492chr33355 340 69 1330 ----
NM_002499chr1532203 863 76 1378 22396 773 1992
NM_002500chr251233 830 454 278 44 --11259 --
NM_002515chr1451267 720 229 144 69 --11384 21692 1549
NM_002518chr231243 1076 107 ------
NM_002519chr1151512 1319 1279 1108 112 --1249 --
NM_002524chr11803 ------
NM_002545chr1175182 5119 3470 3424 2019 1022 475 --13815 --
NM_002546chr8------1636
NM_002577chr364025 3570 3264 3256 3187 701 1544 1934 --
NM_002581chr9115699 5323 4980 4965 4954 4538 4203 2072 1809 559 246 14171 23733 3537 --
NM_002589chr41125 ------
NM_002594chr2071905 1879 1869 1808 772 702 479 21898 1819 --12089
NM_002595chr1281909 1793 1736 1611 1377 760 275 195 ------
NM_002599chr1121204 994 ----21167 167
NM_002645chr1143131 2257 734 103 43073 2817 2550 843 12272 --
NM_002655chr865021 4958 4750 4622 4152 46 85104 5067 4553 4346 3761 3314 408 112 ----
NM_002656chr61196 ------
NM_002687chr1431271 345 160 21056 420 1300 --
NM_002709chr293451 3171 2428 1254 1138 755 720 179 67 12647 11212 --
NM_002711chr71840 ------
NM_002713chr12995 983 ------
NM_002716chr1193536 2842 2452 2357 906 801 700 608 429 --1840 --
NM_002718chr322315 512 ------
NM_002719chr1472441 2363 2191 2172 2144 1498 75 22426 1793 12295 --
NM_002736chr772073 1738 1532 1495 1452 756 232 ------
NM_002737chr17115861 5432 5254 4436 1546 1452 1424 1364 1006 940 783 16616 --16504
NM_002742chr143686 523 285 ----1594
NM_002745chr22124510 3951 3920 3611 3586 2934 2911 2901 1648 1370 781 741 --11400 13763
NM_002748chr1551210 1081 1053 1008 876 --2418 341 --
NM_002753chr44770 592 334 312 --1877 --
NM_002760chrY155950 5827 5425 5165 4489 2064 1706 1207 1081 1037 712 567 531 322 311 --25796 5605 14225
NM_002765chrX31390 1091 127 --1445 --
NM_002779chr101546 ------
NM_002786chr11------1206
NM_002787chr71503 ------
NM_002834chr1294081 4049 3736 3382 3304 3070 761 311 178 13544 13556 --
NM_002837chr1263813 1718 1318 1188 306 174 1112 ----
NM_002838chr14456 435 259 184 2856 793 ----
NM_002839chr9103555 3020 2907 2835 2705 2692 2319 1275 931 536 22850 726 --12717
NM_002840chr111573 ------
NM_002841chr33700 473 462 ------
NM_002843chr1173374 3151 1176 1037 926 903 576 22395 1266 1715 --
NM_002844chr65974 915 277 85 69 1524 --1425
NM_002852chr31142 ------
NM_002873chr51438 ------
NM_002874chr922485 1851 ----1676
NM_002890chr54972 674 290 254 --2953 193 --
NM_002892chr1411401 1301 21484 117 --
NM_002906chr1162062 1881 1869 595 335 122 12351 ----
NM_002912chr63748 372 64 2864 195 1806 1667
NM_002940chr461487 1423 737 704 368 215 --11447 --
NM_002942chr371243 1231 1113 889 519 362 295 --1279 --
NM_002953chr1------1228
NM_002957chr953528 3031 2598 2395 592 13504 13131 1683
NM_002959chr174402 3905 3875 3852 1417 1039 813 --24419 3898 --
NM_002968chr165896 861 436 243 148 --1426 --
NM_002971chr3------21070 1057
NM_002982chr171372 ------
NM_002998chr842234 1705 799 511 1554 --12077
NM_003010chr1742359 2276 2235 2167 22252 110 22205 144 --
NM_003020chr154423 326 132 60 ------
NM_003043chr374253 4207 3958 3275 1620 1299 737 34181 3648 216 ----
NM_003045chr13124968 4744 4736 4217 4037 3827 3645 3092 1613 1602 726 395 13951 13345 --
NM_003048chr242783 2711 2558 378 22087 896 1103 --
NM_003068chr851052 919 862 113 90 ----11104
NM_003072chr191365 ----1116
NM_003081chr201206 ------
NM_003099chr1595586 5559 4466 2149 1685 1593 1297 1012 292 --11381 --
NM_003106chr351016 983 742 320 271 ------
NM_003107chr622345 2331 ----12477
NM_003108chr2137087 6577 6162 5718 5321 4991 4550 2433 1554 1292 1282 1185 979 25945 1430 --1731
NM_003111chr231352 1255 1149 31201 546 96 ----
NM_003114chr83791 683 157 ------
NM_003115chr12365 342 ------
NM_003128chr2102735 2693 2460 2072 1147 1046 902 705 358 88 2782 751 12090 --
NM_003156chr1111325 --1137 --
NM_003173chrX51385 1280 1253 883 497 11165 ----
NM_003178chr372252 2180 2144 1893 722 648 484 22266 803 --1218
NM_003185chr204997 944 878 335 ------
NM_003187chr5250 28 ------
NM_003189chr183377 3307 3228 3178 2814 1270 1197 183 --1918 12891
NM_003194chr62468 187 --1537 1570
NM_003199chr18105227 5085 4545 4184 3741 1647 1194 1092 267 61 25186 254 14277 --
NM_003220chr641655 1597 1246 249 --1688 --
NM_003236chr273529 3512 3125 989 511 317 287 --23341 131 --
NM_003242chr312365 --1289 --
NM_003246chr1562041 1997 1626 1424 799 119 12061 ----
NM_003247chr641696 1596 667 353 --31279 377 36 --
NM_003253chr2151813 1530 461 439 69 1338 1228 --
NM_003257chr1541271 1067 949 494 --1549 --
NM_003262chr374816 3765 2086 1411 1029 970 612 --1733 --
NM_003269chr621302 1173 21265 403 ----
NM_003274chr2142636 2502 1034 564 11093 --1840
NM_003286chr2041084 815 345 227 1880 ----
NM_003292chr131882 1550 208 12109 11759 11540
NM_003298chr3146136 4622 4124 4115 4105 4086 4079 4052 4019 3927 1247 862 593 356 188 11298 --
NM_003299chr121198 1243 ----
NM_003319chr22244 204 --1213 --
NM_003336chrX31128 292 205 ------
NM_003337chr531059 663 301 2250 44 ----
NM_003338chr103381 346 97 --2757 435 --
NM_003339chr551379 453 194 186 154 --1118 --
NM_003340chr421203 894 ------
NM_003342chr1783296 3230 3113 2835 2562 1047 325 305 21030 109 1262 --
NM_003344chr721638 1220 ------
NM_003352chr251016 800 734 691 238 --1886 --
NM_003368chr15788 761 603 507 25 --1671 --
NM_003372chrX1937 ------
NM_003373chr1071626 721 651 510 446 235 210 11540 --1201
NM_003383chr91508 --1572 --
NM_003390chr113904 749 152 --1930 --
NM_003392chr354347 3323 3098 1421 1319 14293 ----
NM_003403chr144823 801 631 83 1612 ----
NM_003404chr2041778 1449 411 41 --11836 --
NM_003409chr181111 ------
NM_003410chrX43096 2280 729 694 1114 22913 94 12703
NM_003412chr352378 951 856 541 390 2658 597 ----
NM_003413chrX----21455 707 --
NM_003439chr793448 3263 2731 2199 1322 793 617 562 515 ------
NM_003442chr112360 166 2620 208 1115 --
NM_003457chr174637 548 446 215 ------
NM_003458chr364009 3967 3586 2981 1238 903 11422 1841 23882 1145
NM_003463chr663156 2213 661 626 376 165 1814 12261 --
NM_003468chr253939 3780 3755 3302 2786 13100 11416 --
NM_003471chr341848 1765 1665 49 21467 698 3334 245 164 --
NM_003474chr1071871 1657 938 533 404 151 75 ------
NM_003477chr112572 534 ----1264
NM_003478chr1163278 2814 2181 2148 1140 280 13342 --13253
NM_003482chr12----22709 2585 12383
NM_003483chr1252844 2498 2318 457 84 12507 ----
NM_003488chr172974 848 2702 659 --1885
NM_003489chr2152937 2911 2901 2709 230 12865 43389 3010 3002 2853 166
NM_003563chr1731095 972 505 ------
NM_003566chr1243166 3059 2372 386 53091 2592 2474 844 377 12316 13418
NM_003574chr18105699 5685 3836 3542 1662 1443 896 884 204 117 24204 1583 ----
NM_003576chr13102939 2795 2781 2272 685 585 438 428 321 166 1493 ----
NM_003583chr1263844 3744 3565 3126 529 248 11450 ----
NM_003590chr293404 3223 1574 1218 781 757 546 270 37 1737 ----
NM_003603chr461982 1732 1545 1522 1502 523 ------
NM_003607chr144380 4095 3378 568 --13888 --
NM_003613chr154720 639 633 266 ------
NM_003618chr231308 1153 225 1316 1336 181
NM_003620chr171153 2972 382 --1407
NM_003622chr1232126 1969 513 ------
NM_003629chr153315 2209 1367 729 720 ----13404
NM_003630chr61707 ------
NM_003633chr531664 748 338 ----12482
NM_003642chr2------145
NM_003644chr1766372 5252 4519 2513 1091 250 --24930 927 --
NM_003658chr111584 ------
NM_003659chr221203 435 ------
NM_003663chr363360 3326 2367 540 288 129 12642 ----
NM_003672chr161837 1779 1773 1754 1578 316 ------
NM_003677chr1291858 240 220 198 172 164 144 126 104 11986 11450 1309
NM_003692chr93217 40 22 ------
NM_003701chr132940 76 ----21033 751
NM_003705chr25745 309 299 290 127 ------
NM_003713chr11458 21428 227 --11638
NM_003714chr522429 637 --13069 --
NM_003718chr71208 ------
NM_003722chr342214 2011 1748 551 22567 347 ----
NM_003744chr1431312 415 244 ------
NM_003749chr1342402 2142 2128 751 22096 1779 32330 2321 2027 --
NM_003759chr474307 1709 1692 1322 1307 995 523 11331 13340 --
NM_003772chr113414 229 184 ------
NM_003780chr11673 ------
NM_003781chr321818 389 11792 --11429
NM_003783chr141199 1017 836 56 2446 28 --1218
NM_003796chr191558 ------
NM_003797chr111163 ------
NM_003799chr1884510 3107 3011 2908 1358 1174 186 112 14538 1454 --
NM_003818chr202926 439 --1163 --
NM_003822chr153100 2044 539 471 333 12078 ----
NM_003846chr11601 ----1724
NM_003861chr1442909 763 404 325 11786 12665 --
NM_003862chr51111 ------
NM_003872chr222722 2006 23030 2416 ----
NM_003873chr1062364 2345 765 614 464 195 2985 474 ----
NM_003884chr321837 1584 11753 ----
NM_003885chr1752676 2189 323 277 75 12075 22442 1858 --
NM_003887chr272092 1864 1704 1493 1434 860 544 22229 601 22219 827 --
NM_003895chr2161759 1417 1370 471 159 140 184 22184 506 --
NM_003913chr693759 3224 3201 3095 1243 513 411 250 75 --14181 --
NM_003922chr151337 1348 ----
NM_003927chr182989 168 --2439 397 --
NM_003932chr2231534 1451 1409 --11656 --
NM_003934chr911043 1223 ----
NM_003941chr732507 2286 369 21808 215 1110 1148
NM_003947chr321270 841 ------
NM_003948chr442242 2159 439 326 ----1430
NM_003953chr142739 2618 2100 259 2161 148 ----
NM_003958chr643942 3051 2969 586 --12753 --
NM_003966chr5107791 7764 7678 7612 7321 5535 5353 2473 645 53 ------
NM_003972chr1081171 1161 1134 1087 1071 358 323 183 ----11251
NM_003980chr631392 1231 542 ----11090
NM_003993chr11309 ------
NM_003994chr1254309 4301 2981 1648 1410 1835 1515 --
NM_004028chr1854123 2896 1207 794 101 23731 2776 ----
NM_004050chr1482679 1995 924 767 494 478 472 348 ------
NM_004068chr31427 ------
NM_004071chr2279 45 ------
NM_004081chrY21253 602 ----1205
NM_004093chr1362877 2595 2255 932 250 24 32926 2266 469 22386 224 --
NM_004094chr1432999 2085 662 ----13043
NM_004096chr1061558 829 721 461 244 50 1596 1741 --
NM_004098chr101887 ------
NM_004100chr632721 2145 1852 11920 12200 1454
NM_004113chr322010 287 ------
NM_004124chr1473573 2774 910 794 533 514 488 1141 ----
NM_004133chr842363 2345 485 202 12594 11972 --
NM_004145chr192299 279 1371 ----
NM_004161chr23628 602 80 ------
NM_004162chr361260 926 887 848 491 479 ------
NM_004170chr971498 1436 1393 756 677 614 102 ------
NM_004171chr11149656 8905 8814 8303 8139 8115 8017 7669 6692 6660 2933 2626 1586 1034 12582 18556 38979 1296 1214
NM_004180chr21619 ----1231
NM_004226chr21238 ------
NM_004229chrX51758 1450 560 430 195 1183 ----
NM_004232chr1863756 3727 3256 2736 730 244 13866 ----
NM_004241chr102768 245 ----1579
NM_004272chr581723 1585 1463 666 577 544 239 154 1422 --11370
NM_004274chr1442101 2069 753 642 3885 861 681 1852 --
NM_004279chr731475 108 77 11815 1825 --
NM_004281chr101476 ----1195
NM_004316chr123932 796 733 31141 777 328 ----
NM_004323chr962715 2365 1977 702 215 23 --11766 --
NM_004329chr1011056 11001 --11435
NM_004331chr81344 22669 1038 --1650
NM_004337chr8--2642 570 1348 11485
NM_004338chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_004342chr751939 701 349 276 144 12326 ----
NM_004349chr831247 1220 152 ------
NM_004379chr261350 1341 1197 1155 690 639 --11294 --
NM_004380chr1642328 1024 929 50 1892 22562 835 12431
NM_004384chr552045 1999 1945 1561 1503 2888 753 11769 11739
NM_004392chr1362174 1732 1041 807 364 279 22522 226 --12533
NM_004395chr51211 ------
NM_004396chr172237 197 ------
NM_004397chr1154240 3961 3694 2933 979 1988 ----
NM_004414chr2151013 517 511 321 291 ------
NM_004430chr812691 12455 ----
NM_004432chr952411 2314 2135 1878 1602 11816 12381 --
NM_004440chr641609 1427 1360 310 --11819 --
NM_004441chr311213 ------
NM_004454chr342286 2057 1792 1503 12295 21913 875 --
NM_004456chr71194 ------
NM_004457chr251604 1097 419 361 233 ----1324
NM_004458chrX52567 2224 2198 966 29 ------
NM_004459chr17102039 1902 1829 1666 1618 829 583 575 495 390 ------
NM_004481chr182592 2460 1956 1757 906 880 671 628 --22582 162 --
NM_004482chr21298 ------
NM_004491chr1994355 4304 4060 3802 3132 1309 1060 773 331 ------
NM_004501chr183179 2994 1206 837 464 318 217 165 ----1864
NM_004503chr123637 622 78 ----1800
NM_004504chr242976 886 317 225 22084 158 1287 --
NM_004505chr1731950 1928 1877 1485 --11833
NM_004521chr103339 324 310 1134 1153 --
NM_004523chr1071219 1203 1091 1071 607 576 82 11341 ----
NM_004525chr261346 1240 1055 545 254 206 --11078 --
NM_004529chr911309 ------
NM_004537chr121195 ------
NM_004540chr212663 122 ------
NM_004560chr94993 924 787 748 --1267 --
NM_004575chr411450 --21493 537 --
NM_004578chr13861 277 99 ------
NM_004580chr1541744 1550 1544 1174 1101 11731 --
NM_004583chr171729 ----1189
NM_004586chrX85210 4244 3452 1085 661 509 491 427 ----14763
NM_004588chr1163868 3654 2668 2588 453 409 --33701 547 58 --
NM_004594chr161944 ------
NM_004596chr191142 ------
NM_004598chr563139 2621 2597 675 663 477 12141 43046 1216 875 639 --
NM_004606chrX184 ------
NM_004612chr9144535 4377 4223 4115 4065 4053 4037 4016 4001 3904 3145 635 578 314 11221 1197 --
NM_004615chrX2793 309 ----1693
NM_004655chr1771270 1153 1092 1069 852 341 268 11235 21083 1044 --
NM_004657chr261454 1291 1246 1240 1139 27 ------
NM_004660chrY11485 ------
NM_004670chr101372 21695 583 1614 2520 430
NM_004671chr182241 207 ------
NM_004685chr1362946 1907 1861 1058 942 936 --1261 --
NM_004686chr811182 ------
NM_004687chr1741889 1592 473 465 1355 12056 --
NM_004690chr61317 1121 --1526
NM_004703chr1762532 2142 2125 516 458 152 ------
NM_004713chr14----1657 --
NM_004714chr192342 236 ------
NM_004721chr31308 ------
NM_004722chr7------1234
NM_004726chrX95608 5450 4804 3635 2204 1390 1344 535 418 ------
NM_004736chr112152 ----1669
NM_004742chr341599 1186 735 245 --21180 445 --
NM_004744chr463706 3642 3469 3329 331 35 ------
NM_004745chr8106766 5694 2667 2489 2150 2092 2002 1297 907 55 16563 16715 16452
NM_004760chr721953 1855 32345 2336 289 ----
NM_004768chr151147 1133 1103 100 74 1984 130 --
NM_004774chr1752992 2543 1163 389 226 --13053 --
NM_004788chr1162678 2130 2046 1867 1857 994 1612 ----
NM_004792chr21185 ------
NM_004795chr1341663 1500 1379 305 11366 ----
NM_004796chr1452293 1845 1722 1630 258 ------
NM_004798chr2063683 3387 2482 1458 961 322 ------
NM_004815chr154865 3131 595 223 98 44732 3050 1499 649 ----
NM_004824chr621255 1139 --11313 21416 319
NM_004836chr23922 607 379 ------
NM_004844chr331191 1023 27 --11107 --
NM_004859chr1772427 2411 1070 1055 818 690 683 ------
NM_004866chr5104085 3484 3357 3060 987 643 505 127 59 38 --11899 --
NM_004869chr1851777 1680 1206 1196 151 --11601 --
NM_004871chr1774373 4345 3291 2824 1491 505 182 --14388 --
NM_004874chr81413 ------
NM_004893chr51380 ------
NM_004912chr761502 1169 1137 447 436 422 ----1552
NM_004921chr142597 2561 2236 213 ------
NM_004929chr8278 39 1378 157 --
NM_004932chr531546 718 387 --21618 356 --
NM_004938chr941166 1145 1000 504 ------
NM_004939chr2169 ------
NM_004946chr51420 ------
NM_004947chr372474 2439 2351 2288 2264 436 173 --12503 --
NM_004948chr1851287 1211 460 437 324 1583 1466 --
NM_004956chr744394 4125 1394 931 1472 1172 --
NM_004958chr1147 --2686 139 --
NM_004973chr651736 1347 1119 254 175 ------
NM_004985chr1254507 4310 4281 2754 55 11751 12904 --
NM_004992chrX118446 8382 8260 8090 7554 7184 5724 5357 3304 1108 543 --38480 8148 5494 --
NM_004992chrX118446 8382 8260 8090 7554 7184 5724 5357 3304 1108 543 --38480 8148 5494 --
NM_004998chr152826 704 --2766 738 --
NM_004999chr684456 4338 3687 3516 1504 1464 1232 200 --13584 --
NM_005010chr751616 877 542 498 113 --12067 11623
NM_005011chr74412 323 315 277 --11627 --
NM_005023chr531508 271 237 170 ----
NM_005027chr1911199 ------
NM_005030chr161234 ------
NM_005036chr2278311 8099 6901 5981 5661 5476 2541 --27454 2055 --
NM_005044chrX104507 4383 4160 3980 1495 747 443 405 139 128 --11734 --
NM_005056chr1295478 5204 4755 4350 4315 3773 3591 1836 1732 --33716 3658 3600 32238 149 140
NM_005065chr14165306 5107 4667 4493 4050 4000 3986 3696 3670 1594 1504 1363 1099 380 342 297 ------
NM_005079chr853220 2622 2573 790 200 --31227 582 397 --
NM_005080chr222840 625 ------
NM_005093chr2065242 4930 4666 4343 4215 730 --45289 1817 1017 168 15313
NM_005095chr141956 1915 1652 1622 41818 318 158 83 ----
NM_005109chr342222 2151 487 353 ------
NM_005112chr42415 364 --1164 --
NM_005116chr2084572 4161 3905 3720 3471 568 428 89 --13771 --
NM_005121chr1792980 2943 2780 2626 2477 1403 907 748 661 23762 468 12797 124
NM_005124chr64685 313 276 68 1910 2417 400 --
NM_005126chr341644 812 472 74 --141 11593
NM_005134chr181946 --2774 625 --
NM_005135chr1543850 3558 2804 639 23723 3607 1112 --
NM_005141chr4250 32 ------
NM_005151chr1852280 1842 912 862 648 --1150 1834
NM_005153chr163773 675 546 ------
NM_005156chr995406 5315 5111 4878 4276 1971 1776 992 366 11578 15281 --
NM_005159chr1542247 1791 1693 100 1700 1884 11912
NM_005160chr22126578 6524 6217 5790 5653 5407 5207 4509 1822 1015 781 455 1920 --26841 1077
NM_005178chr191425 ------
NM_005180chr1021621 598 ------
NM_005188chr1168013 7404 7210 6504 2500 569 16709 ----
NM_005190chr62977 448 ------
NM_005197chr1485924 5915 5712 5346 5208 4176 1687 1674 --34904 1749 810 --
NM_005203chr102143 39 ------
NM_005204chr102804 699 --3625 288 83 --
NM_005221chr7----1306 --
NM_005222chr71934 --1912 --
NM_005233chr352439 2302 2146 1829 903 32538 2464 2250 12229 --
NM_005235chr297734 7331 7191 7014 7005 4798 4783 2146 432 26218 3009 46470 6375 5871 4756 17742
NM_005239chr214799 552 522 457 ------
NM_005241chr321222 1102 31331 1050 398 ----
NM_005245chr42606 200 --2711 553 --
NM_005254chr1561330 1107 867 568 469 436 --164 11304
NM_005256chr113897 752 43 ------
NM_005257chr1841363 1302 1203 69 --21161 1039 --
NM_005259chr221471 962 ----11223
NM_005277chr451867 1389 1210 632 448 21471 1370 ----
NM_005284chr63492 203 193 ------
NM_005302chr73415 392 325 ------
NM_005310chr171322 ------
NM_005316chr115806 429 282 270 152 ------
NM_005324chr1772043 1752 1332 510 311 258 105 ------
NM_005329chr1612144 --1869 --
NM_005333chrX31238 1005 175 --1272 --
NM_005339chr484254 3826 3040 1171 1070 668 456 430 --33130 2647 1396 --
NM_005342chrX41724 761 220 209 --3576 391 278 --
NM_005359chr18104169 4131 2551 1850 1246 1206 1036 775 655 344 1429 36476 4847 985 --
NM_005385chr342691 2666 599 447 1275 --12653
NM_005392chr931907 1774 1472 --11257 --
NM_005399chr123425 843 12756 22739 1131 14017
NM_005400chr233048 2959 849 12884 1248 --
NM_005402chr741582 718 576 115 ------
NM_005414chr31207 ------
NM_005436chr1093961 3727 3637 2702 1491 1320 1237 650 234 21093 294 13953 --
NM_005445chr10136 ----1206
NM_005455chr131780 1692 1674 ------
NM_005475chr12--13283 --13240
NM_005477chr1572594 2219 966 581 575 556 550 --3922 719 538 --
NM_005477chr1572594 2219 966 581 575 556 550 --3922 719 538 --
NM_005487chr2272121 1972 1950 1767 1751 1478 56 32103 1962 150 1588 --
NM_005493chr61773 ------
NM_005497chr17116002 5824 5620 4984 4629 3793 1557 755 354 302 24 --26081 5130 --
NM_005499chr194536 492 224 176 ------
NM_005502chr982892 2814 2708 2694 1323 1035 897 124 --22763 2489 --
NM_005504chr1276213 5880 2450 1052 837 294 46 15785 2578 104 --
NM_005506chr43898 687 257 ------
NM_005509chr561591 1211 725 643 585 360 123 ----
NM_005513chr341446 515 285 236 1125 ----
NM_005517chr141461 1251 1048 918 --144 --
NM_005539chr101295 --21048 1017 --
NM_005573chr51460 --154 --
NM_005587chr153809 102 23 --1396 --
NM_005595chr1182 ------
NM_005596chr9115467 5438 5084 4837 4651 4206 3982 1888 1713 1623 1384 11165 13990 --
NM_005602chr311209 --1918 11319
NM_005613chr171793 1767 1511 543 517 458 77 --1501 --
NM_005626chr1144 --198 --
NM_005637chr1852064 2020 1789 421 394 ------
NM_005639chr1231338 348 277 --1693 11690
NM_005651chr4------1363
NM_005665chr164563 3284 1062 1044 977 90 1374 ----
NM_005668chr5114581 4069 4035 3813 3633 3558 3542 3385 3264 3019 1753 21661 246 14045 12995
NM_005688chr341128 430 418 381 --1321 --
NM_005715chr632542 2523 383 ----12205
NM_005725chr162306 2288 2261 1752 963 124 12034 12190 --
NM_005731chr23384 164 129 ------
NM_005746chr742477 739 708 53 2552 375 1677 --
NM_005759chr274602 4183 3990 3475 1511 1077 400 24393 203 1341 11283
NM_005778chr33436 422 414 ------
NM_005786chr1871227 1034 981 968 925 420 144 --1172 --
NM_005808chr383523 3340 3242 3147 2715 2627 2407 1058 --22344 31 13309
NM_005813chr211874 12360 1969 12288
NM_005822chr652365 2357 923 853 829 21672 838 ----
NM_005828chr1785096 4894 4862 4817 1119 1044 482 280 14629 --15042
NM_005839chr1142 ------
NM_005840chrX167710 6229 4684 2946 2638 2366 2185 2000 1958 1738 1609 1570 1326 629 521 380 37009 6975 1693 --13031
NM_005842chr132556 550 ------
NM_005859chr541061 966 608 365 11346 11539 --
NM_005863chr10155 --1566 11429
NM_005870chr1351301 1136 406 237 175 ------
NM_005880chr162439 286 41521 363 160 124 ----
NM_005882chr41177 1705 ----
NM_005885chr571066 651 600 287 267 261 206 1583 1445 --
NM_005897chr111104 ------
NM_005898chr1162694 2541 2286 876 843 739 ----22400 646
NM_005899chr1711568 --1110 --
NM_005900chr421098 272 ------
NM_005901chr18118616 8606 7894 7434 5326 3423 3096 1901 1771 1696 308 1911 12639 --
NM_005902chr1594643 4553 3989 3667 3351 2993 1708 1611 764 11509 ----
NM_005906chr631641 1550 430 --11670 --
NM_005909chr553416 3082 3007 1356 1278 24245 964 13275 --
NM_005920chr143778 917 303 234 1145 11430 --
NM_005923chr62616 495 ----1471
NM_005924chr72946 749 ------
NM_005935chr4105109 4973 4668 4324 4002 3679 3595 3212 703 552 15017 11555 --
NM_005944chr311209 --1912 --
NM_005955chr175467 4732 4602 3803 3635 305 252 35453 3506 720 ----
NM_005963chr17171 ------
NM_005966chr242427 2198 1875 1678 2809 307 ----
NM_005969chr1131202 820 248 ------
NM_005986chr1382332 2110 891 837 709 354 257 96 ------
NM_005990chr582493 903 856 775 234 148 134 105 --11929 12611
NM_006007chr9123255 3153 2758 1487 1400 1277 1038 944 867 679 385 201 34160 3598 1104 ----
NM_006011chr1554270 4202 4151 4001 955 13879 23777 2878 --
NM_006015chr151334 874 859 486 113 --11026 --
NM_006016chr642290 2241 1632 321 1595 ----
NM_006022chr1321054 710 1679 21021 994 --
NM_006033chr18112293 2284 2230 2197 1986 1777 1644 1610 1530 741 335 11512 12127 --
NM_006037chr264870 4277 3881 3706 1666 1425 21721 1145 --23683 1852
NM_006047chr2053231 3116 2992 2628 188 12927 2547 497 --
NM_006060chr773755 3429 2965 1650 1038 528 381 --11750 --
NM_006080chr712056 --31966 1913 273 --
NM_006094chr862411 1739 1654 1622 689 184 --11845 1220
NM_006095chr484465 3672 3292 2864 1663 348 179 150 13338 --23151 173
NM_006100chr32103 50 --1162 --
NM_006113chr122079 1624 ----21670 209
NM_006133chr1122483 2376 12496 32476 2460 518 --
NM_006134chr2151525 1494 1294 194 96 1650 ----
NM_006135chr121445 381 ------
NM_006141chr16147 --32644 2590 531 --
NM_006147chr12463 44 1419 ----
NM_006154chr1542188 887 339 295 22076 925 12196 --
NM_006158chr831810 1705 1528 31739 402 121 1231 --
NM_006164chr22378 42 ------
NM_006166chr1291790 1695 963 506 277 267 256 105 48 1238 ----
NM_006167chr842097 917 313 100 ----1703
NM_006180chr941649 1500 1349 824 1592 1504 --
NM_006183chr12--1206 --1239
NM_006194chr1431237 939 352 1389 1127 --
NM_006197chr821601 858 --22283 1536 2530 87
NM_006202chr1931729 1715 1580 --11464 --
NM_006203chr543466 1854 1422 711 24143 953 14530 --
NM_006206chr482698 2641 2372 2244 1994 1045 1023 901 ----12579
NM_006212chr175379 5370 5069 4524 4255 3734 3549 24673 1452 14612 --
NM_006246chr1431337 1174 80 187 1136 --
NM_006251chr5103308 2308 2285 2190 1355 1301 1234 287 215 206 12759 22786 952 12149
NM_006252chr155599 5267 4689 1805 1249 26952 549 ----
NM_006254chr3----1299 --
NM_006256chr1112624 2182 2010 1092 1039 970 951 777 517 186 78 1977 ----
NM_006264chr42449 170 ------
NM_006265chr821236 564 31534 1330 273 --1109
NM_006267chr221909 605 ----136
NM_006281chr831200 997 319 --1184 --
NM_006281chr831200 997 319 --1184 --
NM_006282chr2044492 1136 592 190 --1428 --
NM_006283chr854495 4376 4157 3495 1266 44526 4287 3282 1734 11703 --
NM_006298chr683185 2624 2306 2160 2146 958 537 356 --2859 680 11016
NM_006301chr12122 ------
NM_006306chrX95013 4540 3926 1967 1585 1554 897 601 359 25345 2269 43663 1736 1692 1406 --
NM_006315chr454164 3875 3501 3283 2918 12816 --21818 1739
NM_006321chr352053 2004 1955 1800 472 1330 --1581
NM_006330chr831370 1050 447 ------
NM_006333chr22656 540 --1457 --
NM_006343chr22309 67 1456 ----
NM_006352chr122043 699 ------
NM_006359chrX62044 1998 1598 1552 737 63 --2918 152 --
NM_006364chr1441165 486 472 312 ------
NM_006379chr742164 2087 1993 389 21701 500 ----
NM_006380chr1724373 1067 1827 13967 --
NM_006393chr1054380 4120 1594 978 615 --12821 --
NM_006400chr121374 ----1345
NM_006401chr9------1347
NM_006416chr63700 246 105 ------
NM_006420chr2032813 2697 2208 53435 3359 2790 2710 2411 21006 370 --
NM_006421chr831143 969 375 ----21197 1185
NM_006424chr451791 1759 1667 1285 1237 11808 21716 1551 --
NM_006434chr1052766 2744 2730 2371 2188 --23250 613 --
NM_006457chr474121 4036 3455 3059 3043 825 214 23988 3342 ----
NM_006467chr522224 303 1878 1680 --
NM_006469chr121593 1166 --1151 --
NM_006482chr1263844 3744 3565 3126 529 248 11450 ----
NM_006483chr192342 236 ------
NM_006484chr192342 236 ------
NM_006489chr1451267 720 229 144 69 --11384 21692 1549
NM_006520chrX41735 1425 470 303 ------
NM_006526chr2071947 1806 1621 1578 858 195 123 21914 845 1129 --
NM_006530chr124435 390 348 151 1339 ----
NM_006534chr2052586 2553 2195 1010 706 ----140
NM_006538chr273965 3497 2865 2732 2633 1363 842 24139 2700 24014 3542 13487
NM_006544chr1495923 5832 5750 4317 3989 3889 1731 1625 346 12402 --36107 4785 1916
NM_006547chr722052 171 12083 --11300
NM_006549chr121828 12878 42975 2619 1023 988 --
NM_006559chr131126 1097 179 ------
NM_006561chr1054621 4504 2467 1785 752 34138 1316 1180 ----
NM_006565chr1621177 1167 1806 11275 --
NM_006572chr1762674 2380 1378 1130 1000 551 11141 ----
NM_006574chr34293 266 223 72 --1233 --
NM_006577chr231311 1048 260 ------
NM_006593chr21539 ------
NM_006597chr111189 ------
NM_006599chr16118245 8094 7443 7256 6528 6125 3086 2439 2004 1633 559 36948 6171 1549 35851 1617 706 --
NM_006603chrX41924 1838 774 369 11621 21684 90 --
NM_006605chr222238 130 ------
NM_006614chr383473 3003 2700 2602 1379 1192 983 897 11072 ----
NM_006625chr141187 1160 927 203 ----180
NM_006625chr141187 1160 927 203 ----180
NM_006625chr141187 1160 927 203 ----180
NM_006628chr1584532 3605 1218 761 686 500 392 240 2974 854 ----
NM_006633chr52225 31 ----1552
NM_006650chr573972 2963 2941 2537 1556 1524 1147 13937 23304 1391 --
NM_006654chr12104112 3998 3913 1922 1823 1257 924 369 210 133 43835 3751 3259 3239 ----
NM_006662chr162391 262 ------
NM_006666chr19------166
NM_006682chr731082 662 306 22807 2028 ----
NM_006717chr953186 2764 455 420 395 33417 2516 918 12750 --
NM_006718chr61196 ------
NM_006720chr10115026 4730 4448 4025 4014 3738 3109 1864 1608 1167 266 ------
NM_006722chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_006726chr461033 934 863 775 441 423 1969 ----
NM_006734chr691580 1509 1489 1073 588 509 458 297 231 ------
NM_006738chr15104161 3645 3523 2946 2812 1346 1234 1037 705 421 24511 690 14490 --
NM_006743chrX2606 74 --1381 --
NM_006745chr431083 1053 1023 ------
NM_006750chr16148031 7965 7837 7262 7187 6659 6181 5757 5093 5020 4908 3069 2608 2569 11629 --17690
NM_006754chr751261 1144 395 154 23 ------
NM_006761chr172836 795 ------
NM_006766chr832526 1893 1658 22464 1820 32687 1849 1082 --
NM_006775chr612221 --2868 818 --
NM_006777chrX52699 2160 2124 1857 432 22865 903 ----
NM_006790chr5186 ------
NM_006827chr1421190 32 12302 --13235
NM_006832chr143962 751 148 ----11065
NM_006838chr1231745 1405 1210 ------
NM_006854chr741758 469 382 246 1212 ----
NM_006885chr1684091 2660 1350 1306 935 825 395 333 13960 ----
NM_006888chr1483518 3248 3111 2925 2884 964 553 238 --12956 --
NM_006902chr12762 673 12956 22533 1113 --
NM_006908chr731335 540 47 ----11359
NM_006912chr14833 781 298 43 --11667 --
NM_006915chrX2527 469 ------
NM_006918chr1155895 5521 1165 1127 274 --14030 --
NM_006924chr1754245 2828 1299 797 39 --24088 1157 --
NM_006925chr141426 ------
NM_006937chr173479 180 157 ------
NM_006938chr18149 ------
NM_006947chr431744 626 202 ------
NM_006951chr101784 ------
NM_006955chr1083420 2782 2319 2277 2177 766 664 436 1973 11200 --
NM_006962chrX41232 1084 817 180 1834 ----
NM_006996chr181858 1817 569 556 494 352 303 101 11810 11878 --
NM_006997chr103350 302 117 ------
NM_007005chr941501 1494 1250 1114 21310 487 1469 --
NM_007007chr1263891 3289 3264 3079 2968 1164 21507 293 34376 1784 1656 14571
NM_007011chr1536091 5223 930 --15234 --
NM_007013chr82788 74 --194 --
NM_007023chr241073 964 821 81 ------
NM_007030chr575163 4842 1793 636 491 351 81 14903 1610 14412
NM_007034chr131015 720 204 ----190
NM_007038chr21105780 5383 5229 5106 4112 1462 1304 1267 731 169 24371 3994 15762 22021 1911
NM_007050chr20107886 7805 6661 5976 5771 2867 1930 1320 1129 610 12110 37983 7123 346 16569
NM_007054chr583962 3943 3846 3709 797 722 237 218 23920 193 3450 331 243 --
NM_007064chr361408 1269 1239 657 413 299 --1682 --
NM_007067chr174566 283 225 158 --11375 --
NM_007084chr1371348 573 126 115 52 44 34 ------
NM_007114chr343121 2856 2089 474 1181 1697 1656
NM_007125chrY4964 921 227 190 21327 932 ----
NM_007145chr1951293 1243 1233 1001 151 ------
NM_007174chr1232001 295 278 --12061 --
NM_007178chr121441 ------
NM_007185chr12331 318 ------
NM_007187chr1321003 21 --11052 --
NM_007192chr143940 342 76 ------
NM_007200chr15104161 3645 3523 2946 2812 1346 1234 1037 705 421 24511 690 14490 --
NM_007203chr963883 3084 3036 2668 1371 1277 --1867 --
NM_007212chr151645 1564 811 432 318 12273 ----
NM_007214chr621150 1033 --11065 --
NM_007217chr3------183
NM_007218chr85656 598 313 223 214 ------
NM_007236chr151820 1170 12409 --
NM_007249chr13149337 9279 9068 8166 8005 7488 6972 6621 5948 3759 3049 2184 1424 295 29349 7681 11484 27447 6490
NM_007270chr721478 141 1619 21516 213 1518
NM_007315chr251388 1323 1271 1170 1119 ------
NM_007347chr1531061 197 171 ------
NM_007373chr1031308 1122 70 11466 --1177
NM_007375chr152434 2157 1114 1076 937 1965 11722 --
NM_012081chr562802 769 762 661 569 547 1393 12369 --
NM_012082chr84969 651 618 287 --1321 --
NM_012092chr241816 1636 750 152 --1524 --
NM_012097chr242189 1838 618 472 2809 34 ----
NM_012104chr111183 ----23825 499
NM_012104chr111183 ----23825 499
NM_012115chr61483 3602 573 457 1507 1559
NM_012120chr672859 2299 882 774 498 284 215 11066 ----
NM_012129chr732509 2439 333 31995 1745 59 ----
NM_012137chr172962 2929 2784 295 103 95 60 ------
NM_012141chr1333684 1230 424 1461 13983 --
NM_012183chr12601 474 ------
NM_012193chr1175379 4929 4096 2138 2009 777 638 15353 15162 15407
NM_012199chr154602 4557 2905 819 60 14270 24346 1446 --
NM_012214chr2146371 6203 6171 5426 5293 5082 4958 3881 1785 1140 768 486 283 248 13944 ----
NM_012215chr1051461 670 618 598 204 ------
NM_012223chr241222 1154 928 395 1937 ----
NM_012238chr1051746 1642 692 304 176 1184 ----
NM_012243chr13701 387 154 1896 1941 --
NM_012262chr195201 5036 4691 3822 3435 2047 1319 877 98 13204 ----
NM_012281chr742461 2294 931 795 1757 31642 1492 576 1620
NM_012287chr364500 3506 1090 1066 1056 50 34381 3307 630 23044 640 1960
NM_012288chr655734 5586 4350 1591 263 14942 ----
NM_012290chr261529 1492 1479 1361 1289 606 --11078 --
NM_012294chr753947 3938 3919 608 26 --13577 33563 2968 669
NM_012297chr45963 939 860 838 616 21012 394 ----
NM_012301chr742198 2080 1965 1866 --22073 701 --
NM_012302chr12427 187 --1809 --
NM_012307chr181753 --1952 --
NM_012309chr1154787 4535 4361 1701 1087 ------
NM_012316chr1134310 3865 3578 3528 3433 2142 1758 1659 1162 1123 936 538 129 ------
NM_012319chr185812 377 268 203 80 2647 209 ----
NM_012330chr1041537 1302 425 151 11120 11211 1499
NM_012333chr13656 447 61 --21628 397 --
NM_012338chr711197 ------
NM_012345chr1351616 1514 1289 717 205 ------
NM_012347chr642876 1878 1021 100 --22850 2284 --
NM_012395chr733371 3049 2820 --23033 2929 --
NM_012428chr152879 761 11002 ----
NM_012434chr641614 1288 107 73 ----1464
NM_013229chr1272676 2256 505 379 355 262 106 ------
NM_013230chrY21731 449 1237 21713 1333 --
NM_013231chr1474206 4082 3940 2776 1737 117 64 1275 22993 264 --
NM_013237chr5167 ------
NM_013255chr7168846 8700 7272 7105 6213 6045 3468 3054 2841 2684 2475 2271 1622 1450 567 519 26369 5535 18361 --
NM_013261chr473749 3527 3009 1244 1117 630 302 ----1121
NM_013269chr1243587 3293 3113 356 --24483 759 23436 3255
NM_013281chr2021292 251 --21089 124 --
NM_013286chr353476 2942 392 282 257 2746 232 1760 --
NM_013300chr122210 68 ------
NM_013313chr2242794 2716 2199 189 --13421 --
NM_013341chr221932 447 32727 1816 874 --12222
NM_013354chr841360 1138 977 50 1562 ----
NM_013374chr382478 2398 2290 2185 926 777 561 152 1126 --11145
NM_013377chr122545 509 ------
NM_013381chr125721 708 687 681 642 42210 2200 936 736 3350 278 264 --
NM_013386chr141733 1513 621 169 --11701 --
NM_013436chr24811 673 326 161 1608 --2685 518
NM_013438chr981728 1535 1444 726 609 476 170 101 --11199 --
NM_013446chr721409 1270 ------
NM_013448chr143718 488 249 1737 --2753 76
NM_013450chr221161 69 --1831 --
NM_013943chr162902 1128 876 799 491 326 --12777 --
NM_013960chr8------1676
NM_013993chr61751 ------
NM_013994chr61751 ------
NM_013995chrX32412 842 402 32505 2142 230 ----
NM_014000chr1071626 721 651 510 446 235 210 11540 --1201
NM_014021chr193008 2856 2378 2265 1324 764 494 387 240 12250 21257 951 --
NM_014023chr1082460 2370 1812 341 211 201 161 121 --32618 2524 387 --
NM_014028chr663153 3145 2310 2101 827 480 ------
NM_014048chr1675240 5216 5201 1736 907 812 770 --25182 3344 --
NM_014089chr1342090 1786 1692 488 11809 11510 --
NM_014106chr1552900 2615 2334 262 57 12119 --1293
NM_014110chr12995 983 ------
NM_014112chr894576 4017 3775 3722 3352 1701 1561 1118 996 11328 1648 --
NM_014154chr331441 1431 344 21563 649 --1400
NM_014155chr11127316 7293 7060 6904 6330 5961 5245 2500 2054 872 329 317 25981 708 37304 6638 693 15203
NM_014157chr1663892 2939 2860 2539 877 584 33544 1050 356 ----
NM_014160chr331411 1086 79 ------
NM_014181chr222550 1788 21087 608 11808 --
NM_014184chr11139 ------
NM_014191chr1231050 935 773 ------
NM_014217chr131636 1537 92 11903 11530 --
NM_014240chr364068 3572 3550 3107 1586 662 ------
NM_014243chr462130 2108 2036 1974 1651 303 21853 1769 21421 487 --
NM_014250chr2272121 1972 1950 1767 1751 1478 56 32103 1962 150 1588 --
NM_014253chrX42009 892 765 681 --42366 2165 658 95 --
NM_014280chr13716 293 165 1674 ----
NM_014290chr91194 ------
NM_014294chr82122 100 ----11041
NM_014305chr13------1130
NM_014309chr2295216 4674 4389 2089 1907 1321 1178 286 221 15348 ----
NM_014310chr2291939 1795 1727 1715 1693 1678 745 720 66 ------
NM_014319chr12101807 1656 1646 760 723 711 685 576 553 392 31906 1346 585 ----
NM_014325chr1241893 1659 808 774 1559 --1645
NM_014332chrX2170 139 ------
NM_014333chr1182763 2691 2523 2453 2278 784 345 296 12610 1722 --
NM_014351chr2241458 1422 1248 64 --1934 --
NM_014363chr1341299 794 516 62 ------
NM_014382chr351770 1552 1143 481 367 ------
NM_014397chr951429 1181 1048 1041 294 ------
NM_014415chr331362 304 40 --11438 --
NM_014417chr192931 637 --2908 871 --
NM_014423chr565660 5355 5188 5001 1886 1322 25603 1928 55425 4078 3987 3509 3460 --
NM_014431chr1011683 ------
NM_014445chr332353 2042 1573 21749 368 ----
NM_014447chr431571 1043 577 --11564 --
NM_014458chr1368 37 24 11408 1184 --
NM_014489chr112854 593 ------
NM_014517chr381956 1662 557 467 379 327 148 24 ------
NM_014554chr1252064 2030 1975 1858 1418 ------
NM_014574chr1451529 1490 1452 233 188 --11027 --
NM_014585chr251100 1054 346 117 62 ------
NM_014587chr1641553 1354 1078 1022 ------
NM_014613chr553006 2626 2057 964 899 --3826 770 268 --
NM_014614chr231197 1063 978 1946 21313 582 11445
NM_014615chr1693437 3261 2256 1247 976 791 783 686 672 --1342 --
NM_014616chr353461 2124 919 897 634 ------
NM_014618chr92279 39 1383 1333 1172
NM_014630chr1593541 2738 2601 2552 1083 794 338 114 21 --13314 --
NM_014633chr112165 135 1544 --1465
NM_014636chr964297 3821 3773 2847 1585 999 24355 456 33485 954 490 --
NM_014637chr831303 1168 276 ----1352
NM_014655chr121976 245 12051 1342 12324
NM_014659chr152937 278 ----1782
NM_014667chr372444 1827 1813 1709 959 452 163 ------
NM_014674chr332911 1525 508 23855 3144 23086 3024 1129
NM_014676chr191543 1523 1436 1420 1105 1067 277 259 247 11591 11056 --
NM_014682chr882261 2145 2123 1517 1485 1461 1444 257 --12325 --
NM_014683chr1762025 1574 1402 863 850 682 ----11567
NM_014702chr663171 3083 464 399 291 253 22780 244 ----
NM_014705chr751588 1456 845 672 263 ------
NM_014707chr752190 1847 1540 737 112 11975 1422 --
NM_014711chr1661804 1720 1514 1397 648 217 --1798 --
NM_014712chr161637 --1577 --
NM_014717chr194786 643 152 106 ------
NM_014720chr1021281 242 --11721 --
NM_014721chr656846 5933 4842 2495 1302 37097 7008 2275 57032 6803 5080 2679 1769 15771
NM_014723chr2013231 ------
NM_014725chrX41220 1180 1113 226 --11129 --
NM_014729chr852232 2184 896 707 68 21879 782 --11986
NM_014730chr1254991 4186 3332 299 74 --11696 --
NM_014730chr1254991 4186 3332 299 74 --11696 --
NM_014732chr1685846 4877 2146 2076 1747 1517 1145 252 --15216 1985
NM_014733chr531876 826 393 1511 ----
NM_014735chrX41690 1621 1580 796 ------
NM_014739chr654123 3724 3100 186 172 --23879 436 --
NM_014743chr463035 2894 2562 1230 532 260 12772 11161 12867
NM_014746chr254278 4136 3708 2753 565 34239 4104 3991 ----
NM_014747chr185794 5664 5643 4496 1239 1102 423 194 --24826 71 13806
NM_014751chr842074 1865 1760 871 22122 463 12098 --
NM_014752chr1161836 1817 1733 1337 474 290 11957 1273 --
NM_014755chr2114246 4194 4144 4057 3867 3176 3129 1607 687 561 338 33883 2985 674 2450 77 --
NM_014756chr114420 413 158 91 ------
NM_014757chr541503 901 811 341 --32167 2031 893 --
NM_014764chr1241190 819 290 22 --11172 --
NM_014781chr841277 1239 293 133 1445 --1864
NM_014787chr142699 2579 2233 36 12260 ----
NM_014795chr251251 1030 876 476 208 ------
NM_014802chr1231131 954 893 ------
NM_014803chr1042536 1982 1884 981 11805 ----
NM_014807chr111645 ------
NM_014810chr163637 3470 3283 940 108 68 --13476 11253
NM_014812chr161471 1401 722 699 377 76 --1414 --
NM_014820chr332046 1868 619 ----1210
NM_014822chr41189 1624 1647 --
NM_014826chr144380 4095 3378 568 --13888 --
NM_014829chr542228 1617 359 29 1808 11745 --
NM_014830chr1263870 3822 3482 3422 2598 1519 11547 ----
NM_014838chr2262330 1768 843 727 389 59 32368 368 96 ----
NM_014839chr142332 2169 2113 302 1524 ----
NM_014841chr651369 1099 1063 425 370 1240 11055 --
NM_014847chr12533 495 ------
NM_014850chr393453 1784 839 478 414 394 384 368 356 13148 34249 3088 135 --
NM_014860chr242491 2475 789 389 1315 1961 11764
NM_014862chr1574171 4103 3962 1357 658 583 559 --33098 549 30 --
NM_014872chr942134 1574 621 527 --1390 --
NM_014877chr17117555 7100 7082 7071 5673 4968 2819 2808 1870 1179 413 2437 297 15706 17384
NM_014882chr22579 216 ------
NM_014887chr131798 ------
NM_014897chr1763172 2849 2420 2206 588 371 ------
NM_014901chr532312 2199 2171 --21501 270 --
NM_014903chr1252445 2437 2245 1552 1529 22080 545 32228 1900 1617 --
NM_014904chr1043939 2879 501 470 33999 3983 1281 ----
NM_014906chr1753275 3056 3025 2880 806 ------
NM_014912chr1043142 2966 2616 2494 22977 2954 198 --
NM_014914chr221241 1147 11207 ----
NM_014916chr72674 520 ------
NM_014918chr1511580 ------
NM_014920chr693561 3536 3454 3142 2761 2467 454 264 86 1206 13301 --
NM_014923chr1362336 1698 1662 1569 864 66 22088 825 12019 --
NM_014932chr381685 1660 1476 1405 1389 647 619 163 ------
NM_014935chr132846 1177 1045 23902 2670 1691 13633
NM_014937chr10178 ------
NM_014942chr652435 2376 705 428 91 --12552 --
NM_014946chr253055 2849 1154 314 128 22948 1176 12376 --
NM_014950chr1431687 1613 1192 --1616 --
NM_014953chr1394172 3755 3323 1598 1583 1309 775 525 156 ----1796
NM_014962chr2052844 2754 2235 1089 159 32896 915 439 12226 12024
NM_014964chr1742456 2316 461 35 ----12436
NM_014969chr151182 1149 1121 1027 269 --11115 --
NM_014978chr10101858 1762 1708 1540 1511 1284 1263 535 500 204 ------
NM_014982chr1464772 3597 1596 1405 697 482 14552 23431 2087 --
NM_014991chr493203 3174 3043 2990 2562 1171 1062 769 419 32878 2807 2700 ----
NM_014996chr34740 249 231 165 ------
NM_015000chr1221158 755 22961 2568 1733 --
NM_015002chr1232113 2049 1795 12274 11981 --
NM_015004chr31104 ------
NM_015008chr353422 2806 2632 2582 738 11138 13658 --
NM_015009chr35706 258 244 88 23 ------
NM_015011chr1341140 740 387 253 --2997 350 --
NM_015015chr1942024 1774 717 706 --2761 327 11964
NM_015024chr841269 1239 576 335 1326 125 --
NM_015025chr242576 1915 512 201 52674 2527 2299 1904 1751 12037 11948
NM_015026chr1253656 3631 2983 1302 299 33806 1566 505 --1527
NM_015027chr165735 420 190 77 27 ------
NM_015032chr133886 829 305 12458 22696 2174 12531
NM_015040chr263399 3314 3196 2426 2112 105 22605 720 ----
NM_015042chr1583834 3534 3517 3458 2859 2852 1385 1312 ------
NM_015045chr1012215 ------
NM_015046chr962606 2483 2458 2197 317 309 11889 ----
NM_015049chr273120 2872 2386 2230 2213 1249 936 ------
NM_015055chr1131174 440 337 32864 2443 1126 12684 --
NM_015057chr132677 158 --2698 523 1551
NM_015074chr184883 4784 4459 4200 3685 3626 400 175 14922 24907 3261 --
NM_015076chr684245 3983 3471 1532 941 814 405 148 13892 ----
NM_015079chr1573203 2814 2746 2625 1127 527 250 13268 22875 470 --
NM_015090chr186244 5607 5430 4092 2429 1252 914 378 ------
NM_015092chr1664637 3975 1237 961 938 873 34490 3469 376 1896 14510
NM_015093chr651630 1399 709 609 250 --1641 1602
NM_015097chr341815 1649 1595 282 1324 11618 --
NM_015115chr442946 1159 278 257 43118 2936 641 287 ----
NM_015116chr1341655 1608 546 28 21692 1205 1446 --
NM_015124chr2222408 2270 12491 ----
NM_015132chr741961 1619 1222 327 2745 412 --1405
NM_015137chr882597 2375 2250 2191 1719 994 918 763 --22313 877 2723 351
NM_015138chr1542836 2222 704 552 --1158 --
NM_015141chr352463 2198 2047 1689 964 22669 952 ----
NM_015144chr1653971 3562 3380 3294 3034 ----11203
NM_015153chr62653 163 --1245 --
NM_015156chr1463476 2969 1097 823 403 144 23744 2646 13779 --
NM_015158chr93723 260 82 ------
NM_015172chr181596 1578 1520 1468 1109 1078 201 171 1130 ----
NM_015176chr141319 1295 1086 213 --1263 11497
NM_015192chr2062897 2797 2458 2450 1010 692 ----12316
NM_015199chr351895 1118 627 421 46 --1292 --
NM_015206chr1553507 3236 2841 2784 54 23846 3671 23733 3501 --
NM_015208chr1893765 3527 3138 2962 2602 2535 683 537 471 33096 2936 600 --1573
NM_015215chr193061 2895 2106 1205 1183 1174 1128 1018 349 1828 22224 2154 1374
NM_015225chr933005 2489 1183 1934 --13169
NM_015231chr114901 235 171 75 1113 2886 852 --
NM_015236chr43603 458 206 ------
NM_015245chr642552 2315 715 23 --22750 2592 12666
NM_015247chr1675402 5386 3875 1989 1846 1242 1155 --23607 1214 --
NM_015250chr941793 1757 1311 232 --21805 345 --
NM_015251chr1652268 1753 1611 667 145 ------
NM_015252chr22827 115 ------
NM_015254chr883161 2861 2830 2789 2117 314 209 181 ------
NM_015265chr252655 1967 418 412 406 --12181 --
NM_015269chr14611 569 217 207 ------
NM_015271chr494066 4026 3825 2802 2622 1662 1377 1124 177 11690 14178 --
NM_015272chr1672091 2081 1535 1456 720 156 90 ------
NM_015278chr643103 2140 880 455 11074 23220 50 --
NM_015282chr242992 2945 261 195 --12645 --
NM_015285chr1892554 2466 2435 2369 2350 1913 1661 629 147 ------
NM_015310chr8118384 8209 8135 7606 6632 6309 5356 2169 2155 548 136 38404 6268 2933 25070 156 --
NM_015313chr11104850 4791 4508 4452 3854 3603 1911 1475 307 277 14228 ----
NM_015315chr542205 2139 1052 145 13485 11159 --
NM_015317chr2112890 2795 2350 1761 1132 1123 690 677 430 274 167 22805 1822 1260 --
NM_015321chr1974902 4779 4745 4735 4407 4209 3584 ------
NM_015326chr11845 --12180 1913
NM_015328chr762445 1916 1239 1081 576 163 ------
NM_015331chr11577 ------
NM_015335chr1242372 1661 1615 1029 32215 2082 1772 22406 362 12150
NM_015336chr1262574 2525 1663 763 481 467 ------
NM_015339chr2021047 396 2988 648 --1855
NM_015347chr1262953 2947 2332 2268 2246 2092 --12342 --
NM_015349chr682912 2883 2603 2236 1965 874 827 583 ------
NM_015355chr1732010 220 186 --11622 --
NM_015358chr2141054 1019 124 49 3978 522 340 11180 --
NM_015359chr842416 2180 165 126 ------
NM_015361chr22365 320 ----1923
NM_015365chrX73863 3533 3371 3341 531 423 93 ------
NM_015375chr174913 3587 3457 3086 3080 1021 1015 21849 1283 24996 321 15033
NM_015378chr152678 773 357 301 285 1310 ----
NM_015385chr1052766 2744 2730 2371 2188 --23250 613 --
NM_015387chr251930 1488 1441 582 528 --2177 54 --
NM_015396chr321182 360 ----1485
NM_015397chr941846 1811 1238 586 --1160 --
NM_015424chr11------124
NM_015429chr341065 790 458 275 199 ----
NM_015435chr831414 1166 1061 ----21184 36
NM_015436chr453290 2908 1184 209 113 12890 ----
NM_015455chr593794 3174 2629 1501 940 833 649 495 459 --2996 977 13979
NM_015458chr855141 5028 4944 1842 151 24648 695 11338 --
NM_015461chr184698 191 116 92 ------
NM_015475chr211030 ------
NM_015477chr152800 790 1916 ----
NM_015483chr751166 1131 884 751 291 --1988 --
NM_015508chr331320 1025 267 ------
NM_015509chr1251644 1627 1304 1032 183 ------
NM_015525chr61899 11162 1927 1870
NM_015531chr111157 ------
NM_015541chr331387 499 215 21351 184 199 --
NM_015548chr62694 281 ----1161
NM_015550chr773309 2830 2512 2412 677 583 43 11040 ----
NM_015554chr1552821 2708 2540 834 562 --32794 1064 39 --
NM_015555chr62356 186 1177 --1363
NM_015560chr362795 2320 2183 733 434 218 ------
NM_015564chr553219 3176 2765 2466 814 ------
NM_015565chr2142300 2233 2069 269 --11903 --
NM_015569chr1134841 4794 4561 4555 4226 4064 3291 3265 3247 3236 3115 244 223 33083 1793 1700 1997 --
NM_015570chr771849 1746 1671 1165 385 168 136 1466 ----
NM_015571chr652629 2360 2043 1829 986 1121 ----
NM_015575chr253552 2415 1345 1339 287 23671 918 23687 2684 --
NM_015576chr342916 2512 2096 553 22906 2470 11150 1991
NM_015578chr1941476 654 556 256 --1102 1663
NM_015626chr1741014 767 315 127 --1244 --
NM_015640chr1104902 4798 4696 4210 4140 4108 3859 3737 3483 3320 24522 4444 11456 --
NM_015641chr751271 1174 1026 1016 950 ------
NM_015678chr1371429 1247 1232 1218 1161 432 108 1487 1137 --
NM_015691chrX102924 1805 1087 732 690 539 533 520 336 263 194 ----
NM_015726chr141736 1605 1267 598 ------
NM_015850chr831755 1736 916 1655 1626 --
NM_015879chr18138496 7882 7470 7119 5504 3211 3164 1965 1946 1281 1155 595 581 13272 27531 5572 --
NM_015885chr112354 79 2261 223 --1276
NM_015886chr8105674 5563 5388 5345 4404 1723 1021 348 233 54 24424 136 --1914
NM_015888chr163135 2772 2442 662 295 68 --13143 --
NM_015892chr1072401 2353 2116 1807 1767 1581 480 ------
NM_015902chr83760 640 360 ------
NM_015905chr72614 480 ------
NM_015906chr164008 3548 3291 3044 958 756 44404 4145 3389 3172 1839 --
NM_015913chr14771 737 729 610 ------
NM_015914chr16141 ------
NM_015920chr152594 243 ------
NM_015932chr13272 56 ------
NM_015995chr1565411 5154 4948 4866 4336 3999 --21014 311 --
NM_016009chr1114775 4538 4529 4311 3926 1594 1260 1115 873 835 786 21975 1632 14741 --
NM_016018chr862669 2317 2160 1936 352 263 --1486 --
NM_016033chr891953 1808 1789 1729 1545 1428 1183 675 580 ------
NM_016040chr152798 2005 1991 617 186 ----1162
NM_016076chr153033 2898 2690 1985 378 ------
NM_016078chr1711032 11126 ----
NM_016081chr431852 1708 598 ------
NM_016083chr643768 3538 914 553 --23267 930 13757
NM_016090chr1121071 888 1864 188 --
NM_016096chr862056 1664 730 572 489 184 ------
NM_016131chr242118 569 511 201 32205 372 336 ----
NM_016152chr331218 369 333 --1443 --
NM_016156chr1162293 2274 2151 1954 914 352 --1362 1888
NM_016169chr1072994 2589 1131 785 636 565 316 13105 ----
NM_016185chr173804 750 300 1632 178 --
NM_016195chr106830 753 210 168 82 64 ------
NM_016200chr7139 ------
NM_016203chr72238 99 --1990 --
NM_016205chr451337 1303 1202 316 292 21280 179 21208 38 1372
NM_016206chr397723 5707 2734 1817 1286 751 721 574 391 38483 5787 5512 12428 1236
NM_016221chr531484 1462 329 11495 ----
NM_016224chr62862 462 21601 1581 11669 --
NM_016230chr62176 83 ------
NM_016231chr1731378 1093 89 11695 11085 11282
NM_016242chr43574 520 130 ------
NM_016248chr13103811 3785 3696 3573 3489 2782 2625 2565 842 163 23086 2827 12571 --
NM_016258chr11612 ------
NM_016260chr2137506 7433 7408 7389 6883 5986 5095 5002 2869 2697 1526 1316 601 27443 5766 27619 7368 26241 5107
NM_016270chr192368 338 --1399 --
NM_016271chr186915 891 352 261 94 29 11437 ----
NM_016275chr331019 138 82 22446 2437 22292 226 --
NM_016277chr671557 1501 1217 638 595 576 536 2505 39 ----
NM_016284chr162610 23 1294 ----
NM_016289chr252254 818 774 598 241 ------
NM_016299chr10------1102
NM_016300chr32465 369 ------
NM_016315chr241630 1483 1204 45 21565 482 ----
NM_016322chr972538 2367 2090 2030 1191 761 697 32208 983 658 31060 349 87 --
NM_016339chr1741799 1436 1361 1331 ------
NM_016357chr1251161 1093 912 446 302 ------
NM_016374chr131464 1230 1165 41581 1048 484 434 1345 --
NM_016374chr131464 1230 1165 41581 1048 484 434 1345 --
NM_016376chr17104329 4245 4186 3874 3482 1677 1648 1547 790 539 --12801 --
NM_016396chr1572950 1993 885 630 499 254 102 --12710 11063
NM_016422chr1152861 2685 2190 1963 600 12962 12703 1638
NM_016436chr2052712 2706 2465 2138 1067 --22656 242 --
NM_016442chr522054 1443 3618 471 202 --12222
NM_016451chr11174 ------
NM_016513chr693561 3536 3454 3142 2761 2467 454 264 86 1206 13301 --
NM_016520chr91319 ------
NM_016525chr91882 ------
NM_016526chr1142477 2287 1854 1595 --12343 --
NM_016530chr1543636 2849 1656 382 --23943 2796 13128
NM_016531chr453703 3011 3005 804 93 24149 3474 33709 3088 832 --
NM_016538chr172397 171 ------
NM_016544chr253605 3435 3273 217 130 --1762 --
NM_016548chr931631 418 107 2650 624 ----
NM_016559chr32192 48 ------
NM_016562chrX31403 1068 576 ------
NM_016603chr562231 1819 1757 1688 261 120 11554 12156 --
NM_016654chr1561330 1107 867 568 469 436 --164 11304
NM_016830chr122515 494 ------
NM_016952chr1163052 2956 2570 1579 1572 727 13533 23629 3414 --
NM_016953chr2105747 5642 5531 4792 4469 3903 2071 1719 1053 374 15907 --15613
NM_017409chr122758 570 ------
NM_017410chr12147 --11193 --
NM_017415chr574258 3969 3313 2935 1245 671 106 11786 34459 4074 1763 --
NM_017420chr14113718 3640 3606 3562 3501 3095 3062 3042 2676 697 338 ------
NM_017423chr422125 621 22146 1908 21879 102 --
NM_017426chr44442 425 271 222 ------
NM_017455chr152879 761 11002 ----
NM_017491chr42415 364 --1164 --
NM_017519chr621354 1021 31027 1011 203 --1494
NM_017548chr342132 2104 1995 538 --11895 --
NM_017551chr103530 228 135 ------
NM_017553chr1541258 1181 825 456 11268 1255 --
NM_017563chr3116373 6314 6278 5591 5132 4548 1447 1206 1187 858 794 14171 ----
NM_017580chr1031759 488 323 ------
NM_017582chr141200 371 306 65 ----11799
NM_017596chr164639 4585 4573 4018 3494 3218 14258 14604 --
NM_017599chr1241297 713 640 386 ------
NM_017610chr1581964 1926 1736 1423 819 236 223 164 1440 1510 --
NM_017626chr1041786 1758 483 477 11719 191 --
NM_017628chr494144 4038 3712 3621 1558 1017 903 637 222 2682 306 15194 --
NM_017632chr42308 63 ------
NM_017633chr662919 2826 2751 1077 1045 327 31025 971 115 13346 --
NM_017634chr851876 1798 1661 1267 669 ------
NM_017635chr1151519 1468 1024 269 139 2638 175 ----
NM_017637chr9209337 9221 9172 9133 8169 8104 7411 7292 6991 6336 6201 3631 2965 2716 2436 2135 1803 794 391 117 69456 6697 3259 2814 928 332 23602 2535 18469
NM_017641chr124984 956 76 50 11029 ----
NM_017643chr1762981 2878 905 623 579 271 23093 2403 173 12909
NM_017644chr374098 3950 3643 1900 1559 887 351 14827 --11325
NM_017650chr7115812 5729 5628 5558 5381 5359 4934 4757 2289 2184 2110 15289 24202 3908 --
NM_017657chr24895 733 261 159 --1803 --
NM_017658chr1474497 4439 3735 1255 683 302 43 ------
NM_017661chr151135 --21274 381 --
NM_017693chr131157 ----161
NM_017694chr231759 1713 1599 ------
NM_017714chr202716 664 1783 ----
NM_017719chr3102349 2311 2302 2215 2105 2010 1955 1884 1785 167 12262 ----
NM_017737chr142148 2058 1437 598 --12027 11861
NM_017740chr1661737 1450 1290 682 625 606 11802 1510 1195
NM_017742chr1851838 1802 1557 592 142 1305 21844 1329 --
NM_017753chr931033 301 131 ------
NM_017761chr151519 1436 484 178 131 ------
NM_017769chr1473059 2840 2414 2375 2206 1246 912 11086 ----
NM_017798chr2021154 164 ------
NM_017813chr875460 5103 4102 1487 1465 999 691 35637 3834 2280 ----
NM_017824chr1032162 1767 355 --1939 1307
NM_017848chrX114407 4387 4019 3981 3113 1040 1028 940 924 659 531 ------
NM_017857chr111681 ------
NM_017919chr953955 2246 2181 1361 733 1796 35599 5472 3871 14532
NM_017925chr951691 1364 1330 765 737 11793 ----
NM_017938chrX22150 289 ----12125
NM_017943chr142786 679 1797 1111 2841 168
NM_017944chr1162073 967 836 691 325 192 1232 22617 826 1389
NM_017954chr721685 490 1519 ----
NM_017958chr263025 2235 2091 180 140 23 2242 48 --12047
NM_017988chr122932 738 ------
NM_017998chr941364 1329 1125 903 ------
NM_018008chr3135 ----1361
NM_018025chr19181 ------
NM_018036chr1454131 3570 1757 1220 961 24184 661 --24400 3447
NM_018043chr1141469 1405 1393 1364 11102 ----
NM_018061chr141262 403 253 79 2484 323 2525 262 --
NM_018064chr62240 212 ------
NM_018084chr283077 2931 2779 2743 2701 2435 852 262 --12654 --
NM_018092chr1651424 1342 606 550 40 ----11179
NM_018117chr101693 ------
NM_018133chr342188 1907 870 315 ------
NM_018151chr23814 707 697 ------
NM_018155chr383419 3407 3388 2555 2390 1218 552 342 43136 2272 1381 1314 11371 --
NM_018156chr152678 773 357 301 285 1310 ----
NM_018157chr1293225 3172 3026 2530 2197 1169 884 749 729 1525 11155 --
NM_018159chrX41701 1544 644 185 ------
NM_018181chr1861962 1440 1344 1300 303 201 ------
NM_018192chr341046 900 761 72 ------
NM_018195chr1141675 758 417 123 11875 1699 --
NM_018200chr1582506 2363 2279 2258 1983 1776 235 188 ----12545
NM_018230chr12228 106 190 --140
NM_018243chr463419 2882 1267 988 910 496 --2336 208 --
NM_018261chr42567 426 ----1395
NM_018270chr202624 610 ------
NM_018287chr1051079 951 836 821 324 11228 11317 --
NM_018293chr332969 1902 895 --12975 --
NM_018298chr15879 831 731 326 278 ----1718
NM_018312chr1142175 764 591 158 1430 ----
NM_018313chr322586 263 --32139 668 121 21780 1032
NM_018318chr121949 ------
NM_018325chr931600 1576 1454 ------
NM_018328chr22371 323 3439 424 388 162 --
NM_018330chr1051622 572 527 460 317 ------
NM_018351chr1244658 3294 915 302 183 1296 --
NM_018360chrX2114 21 144 ----
NM_018361chr833705 1100 780 23141 189 1651 13544
NM_018362chr1121299 526 ------
NM_018364chr173892 3691 3526 3365 2981 1620 1599 11492 ----
NM_018370chr1252353 1583 602 304 186 ----1445
NM_018374chr753433 3421 1898 666 190 24379 724 1744 --
NM_018383chr22671 341 ------
NM_018429chr572812 1989 1926 1864 748 329 281 --1730 --
NM_018433chr23172 140 108 ----1495
NM_018439chr1842558 2520 387 77 --12601 --
NM_018440chr8108209 5977 5822 5623 3219 2913 2046 1916 1126 319 11151 12748 --
NM_018444chr862341 2312 2198 2095 1716 409 ------
NM_018457chr12174 ------
NM_018464chr102358 283 ------
NM_018471chr22438 398 ------
NM_018482chr862558 2443 2273 863 485 80 ------
NM_018490chr1141870 1696 1590 1556 11613 21385 1376 --
NM_018534chr21413 ----1582
NM_018555chr1992254 2229 1492 1482 1454 660 623 587 306 --1230 1747
NM_018557chr261499 1491 1267 1149 671 337 21447 36 --128
NM_018638chr12105220 4973 4952 4903 4445 3733 3547 1237 1142 734 11423 22258 2067 --
NM_018640chr125428 292 217 156 69 1944 1412 --
NM_018641chr72446 130 ------
NM_018650chr141810 1538 296 216 1267 ----
NM_018682chr74599 502 263 90 1106 150 --
NM_018686chr121241 ------
NM_018695chr551910 1778 489 275 125 1325 21784 174 --
NM_018698chrX41944 1873 1839 1578 ----11901
NM_018704chr11675 12095 --2836 117
NM_018712chr111331 --1991 --
NM_018834chr51105 1915 ----
NM_018841chr1103914 3373 3299 2958 2404 842 719 575 479 459 21579 614 1427 --
NM_018844chr751992 598 486 440 190 1708 11674 --
NM_018890chr731335 540 47 ----11359
NM_018898chr541554 1465 776 323 21933 1792 12258 --
NM_018899chr541554 1465 776 323 21933 1792 12258 --
NM_018900chr541554 1465 776 323 21933 1792 12258 --
NM_018901chr541554 1465 776 323 21933 1792 12258 --
NM_018902chr541554 1465 776 323 21933 1792 12258 --
NM_018903chr541554 1465 776 323 21933 1792 12258 --
NM_018904chr541554 1465 776 323 21933 1792 12258 --
NM_018905chr541554 1465 776 323 21933 1792 12258 --
NM_018906chr541554 1465 776 323 21933 1792 12258 --
NM_018907chr541554 1465 776 323 21933 1792 12258 --
NM_018908chr541554 1465 776 323 21933 1792 12258 --
NM_018909chr541554 1465 776 323 21933 1792 12258 --
NM_018910chr541554 1465 776 323 21933 1792 12258 --
NM_018911chr541554 1465 776 323 21933 1792 12258 --
NM_018945chr673600 3547 2316 1438 1053 787 173 --1714 1861
NM_018963chr2131025 329 162 ------
NM_018970chr732855 673 308 ------
NM_018976chr1282809 2786 2452 2417 2377 668 443 189 12570 12532 --
NM_018979chr1242541 2480 1952 860 1850 ----
NM_018993chr2071486 1430 1374 1367 1325 305 299 11131 ----
NM_018999chr1074511 3535 1513 1420 1210 1078 790 13877 14876 --
NM_019001chr384482 4426 3529 849 838 619 200 185 23954 1618 13428 34806 3502 1758
NM_019004chr792117 2098 2066 1706 1677 1560 870 652 193 --11882 --
NM_019006chr153706 670 612 ------
NM_019015chr7199 ------
NM_019027chr452398 2126 550 279 267 21941 1619 ----
NM_019035chr481664 1276 207 188 158 145 125 35 ------
NM_019042chr751167 923 887 177 170 --162 --
NM_019044chr2134736 4728 4712 4702 4594 4562 4297 3146 1873 1575 1433 306 22 34322 4307 3591 23461 791 --
NM_019049chr12757 192 ----155
NM_019063chr241692 1583 729 409 22041 671 21808 1704 --
NM_019072chr564205 3063 2627 654 297 145 ------
NM_019080chr1321524 1071 ------
NM_019084chr102729 221 ------
NM_019094chr1262801 2680 751 520 233 33 23005 2764 ----
NM_019096chr631130 1098 1070 --11046 --
NM_019117chrX82786 2654 2595 2489 1360 992 806 318 11348 13434 --
NM_019555chr351518 1407 1394 361 140 11799 147 11268
NM_019590chr1041174 933 551 98 21093 352 ----
NM_019593chr2052097 1087 1041 782 486 1680 12262 --
NM_019597chrX2748 605 --147 --
NM_019605chr11506 191 1165 --
NM_019610chr121950 1526 ------
NM_019843chr225458 360 333 319 188 1346 1399 --
NM_019859chr1021261 144 11492 ----
NM_020116chr431571 1396 643 11521 --1678
NM_020122chr2156063 5973 5614 5529 5016 4225 4206 4107 3867 2220 1227 1155 234 124 34 --35551 4640 2170 --
NM_020132chr2175090 4620 4605 4453 4414 4188 1846 --11679 --
NM_020133chr696021 6012 5786 5662 5491 5120 4382 1791 1721 11028 ----
NM_020144chr762078 1844 1832 731 717 506 ------
NM_020148chr1852945 2537 1210 851 442 12582 1610 --
NM_020159chr421608 1524 11217 1473 --
NM_020177chr543310 3083 2938 1178 22254 477 12632 --
NM_020180chr1821149 999 ------
NM_020182chr2063537 3326 3200 2433 2383 431 23231 138 ----
NM_020198chr1731146 643 529 ------
NM_020199chr53910 863 172 3932 421 65 ----
NM_020228chr1152504 2293 2010 944 436 ------
NM_020240chr562673 1110 967 927 844 358 11729 --11059
NM_020245chr694964 4809 4586 4453 4233 3940 3462 3121 378 44430 3443 1960 1354 21551 1262 13335
NM_020310chr1752712 2693 2684 1813 699 ------
NM_020338chr1083565 3485 3021 1483 1235 1192 814 83 23498 3383 13632 --
NM_020340chr631760 660 646 ------
NM_020342chr252163 1606 1044 598 66 12285 ----
NM_020345chr33754 733 263 ------
NM_020346chr1131539 516 391 --21352 1122 --
NM_020381chr631936 1826 1634 ----11987
NM_020390chr364777 3781 3219 3081 1840 1553 1185 14144 --
NM_020420chrY21253 602 ----1205
NM_020425chr6174 ----31774 1513 286
NM_020443chr197033 6803 6165 5947 5785 5524 4710 2173 164 11770 26447 2323 --
NM_020455chr622594 1005 --22698 952 --
NM_020466chr664508 4418 1885 772 669 103 --23722 1093 --
NM_020474chr1841903 1870 1624 326 --1221 --
NM_020546chr572860 2128 677 443 318 197 33 ------
NM_020640chr322306 27 ----139
NM_020647chr872317 2301 2155 2115 2106 1762 633 12295 ----
NM_020654chr331476 534 333 11615 ----
NM_020673chr20107559 6745 5826 5670 4906 2825 2376 2238 1691 1264 36890 1052 216 11910 --
NM_020686chr1622892 1145 ------
NM_020699chr163541 3505 2153 1549 839 90 11415 --11304
NM_020711chr241973 1838 936 492 12431 1401 --
NM_020718chr16126351 6156 4765 4522 4514 2420 2053 1873 732 289 94 81 --26282 4030 --
NM_020726chr52549 207 ------
NM_020727chr2184049 3189 3166 2764 1552 785 770 272 11304 --13280
NM_020728chr762925 2552 1238 1072 811 298 ------
NM_020732chr621354 1021 31027 1011 203 --1494
NM_020734chr1293363 2751 2703 1357 1314 1308 1106 915 729 22672 340 12969 --
NM_020742chrX42348 1016 631 425 12728 42061 747 560 546 1571
NM_020760chr251987 1931 1256 611 511 ------
NM_020766chrX104397 4387 4374 3513 3339 1264 1212 1165 911 578 13797 ----
NM_020772chr17118673 7774 7064 6457 6104 5331 1891 1343 1310 848 417 43195 2034 1926 872 --16997
NM_020773chr442622 1939 1871 1025 --11956 --
NM_020774chr18116191 6074 5660 4169 4120 2153 1708 1213 1114 1004 941 24507 3889 26214 4554 --
NM_020779chr243219 2630 2434 652 --166 13106
NM_020783chr1862395 2211 1780 1573 916 286 31579 889 491 ----
NM_020794chr121104 375 1122 2601 224 --
NM_020800chr331492 1404 922 2450 442 ----
NM_020805chr1851916 1846 1576 467 348 11750 ----
NM_020806chr144799 728 692 53 --1112 --
NM_020808chr12863 751 1839 1343 --
NM_020809chr1122211 1646 22155 82 ----
NM_020810chr1473569 2890 2874 2312 923 742 107 --12906 --
NM_020825chr1693838 3706 2721 2550 1314 664 465 449 292 23670 2429 1378 1113
NM_020826chr1163102 2715 1121 788 613 66 --12405 --
NM_020839chr351198 1068 1004 998 260 ------
NM_020841chr1293931 3536 3265 2498 1625 1613 1029 688 278 33398 3138 713 ----
NM_020854chr1871116 1089 538 496 331 222 62 11308 1165 --
NM_020856chr1951510 1169 1127 598 589 21465 144 1151 --
NM_020870chr421751 225 1211 ----
NM_020871chrX52562 2348 890 559 28 ------
NM_020872chr331794 602 307 --11517 --
NM_020909chr264155 3696 1437 1416 606 152 12893 --11153
NM_020918chr1063259 2521 1432 983 828 581 13518 ----
NM_020932chrX2501 487 ------
NM_020937chr142322 125 ------
NM_020940chr10102586 2578 2570 2553 2170 1976 1144 1093 663 44 22508 176 ----
NM_020948chr153386 758 653 585 323 23693 742 ----
NM_020977chr441438 554 409 386 42253 2224 1705 548 ----
NM_020987chr1021175 263 1245 --1508
NM_020993chr1252784 1818 1056 726 303 22843 2836 ----
NM_021005chr152902 428 1260 11088 --
NM_021007chr291979 1591 826 810 798 790 782 776 122 1536 ----
NM_021032chr322010 287 ------
NM_021038chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_021069chr461982 1732 1545 1522 1502 523 ------
NM_021072chr532571 2369 322 --22495 2458 --
NM_021090chr2264253 3921 3564 1816 1759 1489 --31924 1557 117 --
NM_021097chr263028 2898 2702 2308 1978 137 162 11129 --
NM_021110chr81738 ------
NM_021111chr91347 ----11346
NM_021116chr799029 6599 6008 5613 3428 3160 3124 2368 1141 23474 3461 36148 773 224 17985
NM_021132chr1061372 1335 1205 893 878 464 ------
NM_021136chr141162 1533 ----
NM_021140chrX5947 881 806 239 204 1983 ----
NM_021144chr91340 ------
NM_021148chr752245 2120 358 347 53 21853 141 11749 --
NM_021168chr1621622 328 --126 --
NM_021183chrX32591 871 576 --1446 --
NM_021189chr13997 164 76 --1135 --
NM_021191chr1232387 1787 299 ------
NM_021202chr2072320 2308 2234 2181 2128 779 773 --1519 --
NM_021205chr182875 1052 1044 1003 619 420 343 112 12702 ----
NM_021215chr2022383 33 ------
NM_021229chr1241124 1089 901 493 2511 42 ----
NM_021238chr1282051 1998 1919 1858 1324 770 582 431 ------
NM_021239chr142521 513 --2363 256 --
NM_021242chrX3834 744 290 1721 1649 --
NM_021252chr1031593 1383 671 --31293 690 57 --
NM_021255chr1474071 3932 3668 3235 2602 1412 998 --1493 --
NM_021619chr951274 1249 1138 958 416 11256 ----
NM_021629chr3105066 4897 4373 3868 1676 1553 1054 432 358 297 13881 ----
NM_021724chr17137 ------
NM_021813chr675586 5472 4912 4561 4430 3860 1342 35778 5117 4548 44532 930 835 425 25462 2089
NM_021911chr5105004 4519 3912 3673 3434 3424 1799 1388 1341 54 ----14833
NM_021912chr1551205 1034 194 176 132 11560 23322 82 --
NM_021914chr142968 670 ----1765
NM_021935chr331006 979 973 --11029 --
NM_021940chr661223 1143 649 504 404 150 ----11072
NM_021945chr663569 3539 2797 652 586 496 --13433 --
NM_021946chrX31455 542 494 ------
NM_021947chr1721310 1143 11164 1953 --
NM_021949chrX12609 12898 1954 12554
NM_021960chr172711 2696 2652 1902 883 857 698 ----1472
NM_021961chr11147235 6942 6125 4926 4873 2696 1634 1296 1210 897 787 657 263 53 26887 5968 133 --
NM_021964chr3156513 5143 5122 4864 4478 4137 4019 2051 1996 1403 861 780 750 742 321 --34414 1845 87 --
NM_022041chr1641715 522 363 97 --12081 --
NM_022048chr1565983 5711 5412 1954 537 51 25858 5768 32362 2332 544 --
NM_022051chr11178 ------
NM_022080chr2082627 2430 1002 957 869 669 556 384 12298 ----
NM_022114chr154172 4115 3658 1157 613 1677 54734 4391 4253 2955 1412 --
NM_022130chr581444 475 433 360 354 155 148 86 11405 ----
NM_022137chr1441474 547 377 365 1524 1342 --
NM_022138chr64432 372 238 105 ----11392
NM_022143chr73516 92 64 --1581 --
NM_022171chr331496 620 206 ------
NM_022351chr831423 1336 1125 23821 2636 1100 --
NM_022457chr1125 ------
NM_022458chr752695 2644 821 732 671 13190 11184 --
NM_022459chr1346131 5728 1786 844 21567 275 25014 1625 24475 1555
NM_022461chr321225 990 ----1143
NM_022474chr14112819 2780 2767 2370 1022 968 900 854 442 337 176 --32813 2359 1028 --
NM_022494chr10155 ------
NM_022496chr121454 1440 ----
NM_022497chr373667 3652 2879 2627 2537 675 454 ----13437
NM_022552chr2------1848
NM_022650chr54972 674 290 254 --2953 193 --
NM_022652chr125920 447 248 237 124 11017 1210 1945
NM_022716chr12606 517 12800 22377 957 --
NM_022719chr2263885 3788 1411 1392 525 146 --157 --
NM_022730chr211040 ------
NM_022735chr141636 1571 1403 1371 ------
NM_022763chr3113180 3168 3127 3065 2725 2584 2057 1253 803 606 395 1737 --1642
NM_022780chr251623 1197 422 263 147 ------
NM_022781chr973345 3297 3227 2477 2273 248 50 2557 456 22171 593 --
NM_022782chr12183 150 ----
NM_022802chr1031118 1008 662 --2541 255 --
NM_022828chr531592 1535 1485 ------
NM_022829chr20------21939 620
NM_022832chr452546 1832 819 627 295 32059 981 511 ----
NM_022841chr15102689 2585 2553 2313 2269 2244 2136 1918 889 31 --11693 --
NM_022843chr1361334 1036 989 407 394 179 ----11275
NM_022845chr1661732 1583 1551 1516 802 402 ------
NM_022893chr262594 2554 2234 1210 512 272 31942 1049 323 ----
NM_022894chr231683 1382 403 ------
NM_022898chr1464792 4486 869 632 263 230 --132 24721 218
NM_022900chr771071 953 915 419 231 173 158 ------
NM_022912chr292895 2505 2459 2274 1904 955 509 400 169 --23000 2930 12402
NM_022977chrX52567 2224 2198 966 29 ------
NM_023000chr1411401 1301 21484 117 --
NM_023001chr1411401 1301 21484 117 --
NM_023074chr193366 354 92 ----11365
NM_023105chr831755 1736 916 1655 1626 --
NM_023106chr831755 1736 916 1655 1626 --
NM_023110chr831755 1736 916 1655 1626 --
NM_023111chr831755 1736 916 1655 1626 --
NM_023923chr183761 3726 3702 3603 3498 1071 1027 542 --1338 --
NM_023948chr71153 ------
NM_024007chr582977 2695 2571 2133 2054 1987 247 212 12745 33064 2316 2147 --
NM_024015chr171893 --11173 --
NM_024052chr1772652 2221 1919 934 928 608 460 12477 1478 --
NM_024069chr191683 ------
NM_024071chr142613 562 --1601 --
NM_024117chr941370 1185 377 311 ------
NM_024297chr171547 ------
NM_024325chr2031246 1070 102 ------
NM_024336chr162307 289 3330 109 61 179 --
NM_024345chr975728 5346 4672 4266 1442 894 241 ------
NM_024408chr163055 2624 1182 1054 811 688 13691 13478 --
NM_024424chr112774 366 1836 --11173
NM_024425chr112774 366 1836 --11173
NM_024426chr112774 366 1836 --11173
NM_024429chr72238 99 --1990 --
NM_024511chr423255 792 163 13142 --
NM_024524chr353167 2997 2941 2885 719 --12308 2633 524
NM_024539chrX21197 1084 ------
NM_024556chr113495 471 385 ------
NM_024561chr1351422 1199 313 279 265 ----1235
NM_024569chr142816 2695 2177 336 2238 225 ----
NM_024574chr43141 111 105 ------
NM_024582chr421113 370 ------
NM_024594chr551573 662 419 293 192 11766 ----
NM_024607chr854422 1695 742 468 266 --33662 257 63 --
NM_024646chr11449 ----1422
NM_024659chr21370 1301 ----
NM_024665chr394542 4472 3632 3342 959 423 234 147 42 12884 13503 --
NM_024674chr183149 3030 2862 2743 1299 1287 747 696 ------
NM_024700chr151074 883 781 754 368 ------
NM_024713chr1521125 450 ----156
NM_024721chr852709 1815 729 342 210 22118 536 21641 1057 --
NM_024745chr1661125 1058 441 380 94 85 ----11051
NM_024751chr42528 448 --11936 --
NM_024761chr955180 3500 1673 1234 458 --43353 2062 1923 534 --
NM_024770chr2136724 5848 5713 5171 4629 4617 4487 2433 1753 879 192 145 40 ------
NM_024828chr921549 1130 ------
NM_024834chr1061947 1331 711 594 515 292 ------
NM_024854chr1231477 484 80 ------
NM_024900chr462179 1699 576 566 145 85 1155 ----
NM_024900chr462179 1699 576 566 145 85 1155 ----
NM_024915chr862009 1881 1142 758 637 576 12872 12234 --
NM_024930chr572835 2096 1947 996 783 460 86 1643 ----
NM_024941chr531272 451 200 ----11435
NM_024944chr2141294 1001 367 185 1392 --148
NM_024947chr3169370 8595 7713 7351 6985 6831 6500 3588 2382 2363 2275 1744 1377 1136 644 483 29219 3675 ----
NM_024953chr1242584 2195 1841 181 12551 ----
NM_024969chr23685 131 50 ----1335
NM_024989chr2127940 7495 7380 6458 5838 5481 5130 5086 5053 2687 2667 906 47934 6373 5849 975 76819 6574 6542 5460 5098 3077 270 1301
NM_024991chr1052766 2744 2730 2371 2188 --23250 613 --
NM_025054chr873823 3611 3057 1669 1172 1159 97 33532 3095 599 1890 --
NM_025076chr2136 ------
NM_025106chr161876 1731 1607 762 713 606 ------
NM_025133chr23874 265 106 ------
NM_025135chr182488 411 ------
NM_025137chr153310 112 30 ------
NM_025141chr152112 102 --1516 --
NM_025147chr221097 166 ------
NM_025154chr741326 607 35 24 11454 11213 --
NM_025160chr141554 721 622 255 23524 2674 ----
NM_025187chr1651361 1133 1099 1057 70 1975 21114 42 --
NM_025191chr143486 3430 3373 3004 --13498 --
NM_025195chr841867 1543 1519 1431 --11857 --
NM_025208chr1141952 880 489 281 1794 ----
NM_025222chr353013 1112 950 855 321 1828 52989 2950 1974 145 29 --
NM_025235chr1062225 1555 1489 420 248 174 12186 ----
NM_025238chr1511527 1265 ----
NM_030579chr1632709 1213 561 11016 12715 --
NM_030627chr523869 2792 23400 907 --11251
NM_030629chr161522 11913 11352 1666
NM_030631chr14--192 --1185
NM_030637chr142677 538 ------
NM_030647chr7106198 6074 5908 4844 1713 1681 1182 592 156 102 16306 ----
NM_030648chr465024 2055 940 492 281 163 --11169 --
NM_030650chr294251 3945 3865 3790 3338 3294 2664 687 306 32634 312 220 13319 11322
NM_030664chr1092397 2226 2162 2120 2069 2053 1723 838 171 22248 673 ----
NM_030670chr1231579 565 317 22178 367 1395 --
NM_030671chr1231579 565 317 22178 367 1395 --
NM_030674chr1282078 1547 1318 1283 1114 440 406 111 --24993 4884 --
NM_030751chr1031820 1293 90 11422 --21282 411
NM_030751chr1031820 1293 90 11422 --21282 411
NM_030756chr10195 ------
NM_030777chr2031956 1679 906 22369 892 12156 --
NM_030791chr1421468 1357 --1663 --
NM_030799chr542222 2153 1371 1363 142 ----
NM_030806chr1129371 8958 8889 8751 6240 6076 3252 2893 2609 2487 1452 130 11620 ----
NM_030808chr173970 932 339 --21057 880 --
NM_030809chr1212495 --22401 779 1514
NM_030820chr621059 701 ------
NM_030885chr352338 2311 2066 1806 1637 ----1808
NM_030917chr42186 25 ------
NM_030920chr132042 752 273 42102 1666 76 42 --11872
NM_030925chr1321458 52 ------
NM_030962chr1151509 1483 1465 1164 212 ------
NM_030964chr573619 3269 2354 1210 1195 580 172 --11361 13321
NM_030978chr91383 ------
NM_031216chr183851 182 172 12269 1622 --
NM_031243chr731974 839 483 1607 11516 135
NM_031267chr71208 ------
NM_031296chr411761 ------
NM_031305chr441520 515 221 99 ----11918
NM_031309chr842337 2106 937 931 ------
NM_031365chr272543 1903 931 703 544 259 45 1867 ----
NM_031366chr272543 1903 931 703 544 259 45 1867 ----
NM_031371chr131464 1230 1165 41581 1048 484 434 1345 --
NM_031371chr131464 1230 1165 41581 1048 484 434 1345 --
NM_031411chr541554 1465 776 323 21933 1792 12258 --
NM_031418chr1172580 2508 1990 1063 739 553 356 1112 12691 12631
NM_031419chr31552 1591 2519 67 --
NM_031422chr18183 --129 --
NM_031431chr1341797 1579 1530 634 1314 21764 21 --
NM_031435chr1243467 3397 741 338 ------
NM_031442chrX63013 2947 2891 2883 933 744 --12806 --
NM_031453chr1042467 2168 1913 1000 12539 12262 --
NM_031461chr831595 877 315 165 185 --
NM_031468chr788075 7829 7821 1431 1151 1049 753 47 18154 26339 2419 18223
NM_031477chr161371 --1129 --
NM_031483chr2053435 3426 2952 2400 2336 13379 ----
NM_031844chr183179 2994 1206 837 464 318 217 165 ----1864
NM_031845chr223516 2522 1497 13678 12744
NM_031847chr223516 2522 1497 13678 12744
NM_031849chr541554 1465 776 323 21933 1792 12258 --
NM_031857chr541554 1465 776 323 21933 1792 12258 --
NM_031858chr1711568 --1110 --
NM_031860chr541554 1465 776 323 21933 1792 12258 --
NM_031862chr1711568 --1110 --
NM_031889chr41572 --2608 422 11917
NM_031905chr71194 11177 ----
NM_031915chr132243 213 ----1268
NM_031946chr72441 416 ------
NM_031953chr42382 330 ------
NM_032012chr974715 3898 3632 2088 1202 1189 89 14599 12101 --
NM_032102chr1153060 1090 1071 575 363 23000 507 ----
NM_032116chr13105868 5612 5005 4966 4404 4275 3940 2171 1980 358 13894 13737 --
NM_032121chrX52466 2401 786 473 89 --22506 1844 --
NM_032128chr421033 372 1782 ----
NM_032142chr182188 86 ------
NM_032153chr352749 2542 1046 336 251 2946 153 1845 --
NM_032189chr1373560 3484 3349 3188 3106 3083 1832 23207 1486 131 --
NM_032195chr214507 496 490 470 --1441 --
NM_032199chr10103867 3817 3793 3656 3600 3223 1444 993 560 457 12793 1534 --
NM_032208chr252908 2883 2762 2550 1114 22927 705 1458 13632
NM_032221chr2022003 1412 ------
NM_032226chr92831 814 ------
NM_032228chr1132332 1367 1244 31095 70 54 --1313
NM_032242chr373281 2917 2681 2601 2502 1214 759 --32614 1276 1208 --
NM_032256chr123394 339 78 --1195 --
NM_032281chr1933165 2175 2084 ------
NM_032288chr352302 2098 1908 1747 1474 ------
NM_032291chr121625 247 ------
NM_032320chr11152 ------
NM_032324chr1181 ----1191
NM_032329chr274377 4215 3419 2952 1317 862 707 --33825 2905 868 --
NM_032352chr1461409 1368 1130 1088 483 423 --21259 243 --
NM_032373chr1095844 4306 4276 3783 3715 1208 1057 829 268 44799 1563 542 241 15004 25838 5828
NM_032382chr161439 ----1500
NM_032410chr831217 227 156 2882 252 ----
NM_032434chr231117 630 63 ----1287
NM_032435chr182352 2198 2123 1982 1956 1947 243 154 ------
NM_032436chr134963 798 689 308 --1212 --
NM_032438chr641645 1632 476 367 ------
NM_032439chr1041586 1178 1097 634 1578 ----
NM_032440chr1052442 678 188 152 137 11013 --130
NM_032445chr1542602 2517 2401 1683 32611 2484 1946 32590 2408 518 --
NM_032446chr563603 3540 2799 2437 1016 398 ------
NM_032457chr463882 3234 3053 2667 1476 561 11326 23083 2758 2336 182
NM_032458chrX33347 2541 586 --12642 --
NM_032482chr1952666 2355 1984 1839 180 --1827 --
NM_032491chr1251113 1023 972 468 281 11292 11283 1475
NM_032505chr312037 1747 --11744
NM_032521chr20113214 3162 2987 2692 2385 2080 2056 2048 1162 373 49 23247 2659 1343 --
NM_032532chr62654 593 ------
NM_032580chr171232 ------
NM_032595chr1711549 --11512 --
NM_032603chr21737 ------
NM_032638chr321397 1260 11503 11231 --
NM_032646chr1721806 1588 ------
NM_032682chr3123384 3201 3009 2956 2581 2541 2259 2245 697 382 222 99 13145 1230 12445
NM_032711chr1784311 3225 2868 1359 1186 1101 255 143 --24268 582 --
NM_032731chr17----162 11397
NM_032772chr102542 136 ------
NM_032784chr61253 ------
NM_032801chr1112512 --12492 --
NM_032810chr1061393 1292 1093 405 394 257 ------
NM_032828chr1984325 3314 3280 1927 1068 996 867 694 24975 1012 ----
NM_032837chr1722126 658 --22037 45 --
NM_032842chr731461 1280 363 --11150 --
NM_032859chr1383975 1269 925 767 601 523 86 42 ------
NM_032866chr1543029 2281 404 396 --1378 --
NM_032869chr861775 1740 410 381 367 28 21703 300 31517 803 699 --
NM_032873chr1144423 3372 1071 1006 14203 14187 1962
NM_032900chr1063859 3665 2815 2664 571 187 ----11395
NM_032932chr1776441 5626 5358 1069 669 611 141 --36447 5432 158 --
NM_032968chrX104242 3938 3503 1436 1419 812 627 279 237 40 31603 654 311 1662 --
NM_032969chrX104242 3938 3503 1436 1419 812 627 279 237 40 31603 654 311 1662 --
NM_032971chrY2941 325 ------
NM_032972chrY2941 325 ------
NM_032973chrY104234 3930 3499 1436 1419 812 627 279 237 40 31602 654 311 1662 --
NM_033012chr132940 76 ----21033 751
NM_033020chr164008 3548 3291 3044 958 756 44404 4145 3389 3172 1839 --
NM_033081chr2011136 11041 21432 1395 --
NM_033132chr1341574 280 246 160 12108 ----
NM_033135chr1141952 880 489 281 1794 ----
NM_033136chr541840 1686 1416 608 21780 1559 ----
NM_033137chr541840 1686 1416 608 21780 1559 ----
NM_033138chr751939 701 349 276 144 12326 ----
NM_033139chr751939 701 349 276 144 12326 ----
NM_033140chr751939 701 349 276 144 12326 ----
NM_033157chr751939 701 349 276 144 12326 ----
NM_033167chr321818 389 11792 --11429
NM_033168chr321818 389 11792 --11429
NM_033169chr321818 389 11792 --11429
NM_033181chr643768 3538 914 553 --23267 930 13757
NM_033196chr1941465 1266 493 374 ------
NM_033201chr1651185 1091 1033 989 312 --1170 --
NM_033211chr551794 1612 403 245 69 --177 --
NM_033224chr798018 6765 5713 3109 2379 2176 2139 2127 1875 37370 6573 2369 ----
NM_033225chr892911 2580 2517 2219 2185 1960 1161 736 241 22405 2151 --13173
NM_033285chr884349 3828 3411 2714 1725 208 69 63 13758 54244 4160 3136 445 410 --
NM_033337chr31288 ------
NM_033360chr1264628 4431 4402 2875 176 134 --13025 --
NM_033389chr17104852 4399 4192 3680 2979 2969 2961 1186 1170 167 ----11325
NM_033394chr231615 1481 394 21475 1427 ----
NM_033427chr74703 612 343 331 --2323 315 --
NM_033430chr493951 3660 3592 3115 1104 572 190 119 92 24131 1603 182 14094
NM_033437chr493951 3660 3592 3115 1104 572 190 119 92 24131 1603 182 14094
NM_033480chr642876 1878 1021 100 --22850 2284 --
NM_033481chr642876 1878 1021 100 --22850 2284 --
NM_033495chrX3919 674 375 1369 1975 --
NM_033496chr101738 ------
NM_033497chr101738 ------
NM_033498chr101738 ------
NM_033500chr101738 ------
NM_033505chr296567 6055 2342 2077 1941 1870 1847 1731 229 16523 ----
NM_033512chr863095 2894 2511 2491 2241 659 12331 ----
NM_033515chr621094 105 ------
NM_033540chr32108 99 --1961 --
NM_033551chr542205 2139 1052 145 13485 11159 --
NM_033624chr1232113 2049 1795 12274 11981 --
NM_052832chr842992 2796 2710 1067 11861 1462 --
NM_052834chr1892554 2466 2435 2369 2350 1913 1661 629 147 ------
NM_052851chr1372357 2166 362 350 339 273 70 11564 2515 381 --
NM_052869chr1721806 1588 ------
NM_052875chr1132117 1745 419 --11907 --
NM_052885chr1274843 4828 4611 4249 1597 1147 281 44230 3913 1470 377 24671 859 --
NM_052896chr142319 2287 1667 979 12418 22517 1605 --
NM_052897chr121838 ------
NM_052904chr641021 925 384 280 ------
NM_052911chr181375 --1995 --
NM_052918chr1073592 2908 1325 1205 1179 1127 397 13459 23138 354 --
NM_052927chr562132 847 788 706 630 27 11839 ----
NM_052937chr812050 --1490 1804
NM_052953chr31198 ------
NM_053001chr81390 --1286 --
NM_053016chr9117985 7881 7562 6930 5570 5404 2772 2467 574 68 38 --18013 --
NM_053044chr43939 919 229 ------
NM_053053chr181023 983 973 938 393 244 100 93 ------
NM_053064chr1463051 2356 683 466 456 345 11996 ----
NM_054016chr131809 1693 124 11962 1229 --
NM_054016chr131809 1693 124 11962 1229 --
NM_054016chr131809 1693 124 11962 1229 --
NM_057159chr941371 1333 1247 1012 ------
NM_057175chr442661 2515 2301 655 --22027 632 --
NM_057178chr173994 456 343 32700 2118 215 12671 --
NM_057749chr811313 --21246 1074 --
NM_058237chr143806 716 328 ------
NM_058241chr262239 1813 1729 1524 687 482 ----12008
NM_058241chr262239 1813 1729 1524 687 482 ----12008
NM_078474chr152112 102 --1516 --
NM_080546chr96369 123 117 109 95 87 12284 --1420
NM_080672chr201473 ------
NM_080676chr2023235 2898 ----12468
NM_080678chr22650 267 1595 1273 --
NM_080682chr12735 260 --2608 240 2664 45
NM_080683chr42449 170 ------
NM_080684chr42449 170 ------
NM_080685chr42449 170 ------
NM_080759chr1362174 1732 1041 807 364 279 22522 226 --12533
NM_080760chr1362174 1732 1041 807 364 279 22522 226 --12533
NM_080798chr102143 39 ------
NM_080799chr102143 39 ------
NM_080800chr102143 39 ------
NM_080801chr102143 39 ------
NM_080802chr102143 39 ------
NM_080803chr102143 39 ------
NM_080804chr102143 39 ------
NM_080805chr102143 39 ------
NM_080806chr102143 39 ------
NM_080807chr102143 39 ------
NM_080808chr102143 39 ------
NM_080809chr102143 39 ------
NM_080810chr102143 39 ------
NM_080811chr102143 39 ------
NM_080812chr102143 39 ------
NM_080813chr102143 39 ------
NM_080814chr102143 39 ------
NM_080815chr102143 39 ------
NM_080832chrX31795 1654 198 ------
NM_080867chr1474226 3849 3232 3077 1393 880 244 --14515 14900
NM_080872chr823958 3357 ------
NM_080881chr51211 ------
NM_080921chr14456 435 259 184 2856 793 ----
NM_130391chr9103555 3020 2907 2835 2705 2692 2319 1275 931 536 22850 726 --12717
NM_130392chr9103555 3020 2907 2835 2705 2692 2319 1275 931 536 22850 726 --12717
NM_130393chr9103555 3020 2907 2835 2705 2692 2319 1275 931 536 22850 726 --12717
NM_130440chr111573 ------
NM_130446chr354218 2870 1520 1472 271 --13086 --
NM_130469chr141952 ----1113
NM_130808chr33444 285 80 ------
NM_130811chr201206 ------
NM_130831chr362795 2320 2183 733 434 218 ------
NM_130832chr362795 2320 2183 733 434 218 ------
NM_130833chr362795 2320 2183 733 434 218 ------
NM_130834chr362795 2320 2183 733 434 218 ------
NM_130835chr362795 2320 2183 733 434 218 ------
NM_130836chr362795 2320 2183 733 434 218 ------
NM_130837chr362795 2320 2183 733 434 218 ------
NM_130838chr1561816 1170 501 478 291 161 ----1593
NM_130839chr1561816 1170 501 478 291 161 ----1593
NM_130847chr11115954 5848 5706 5690 5599 1938 1810 1533 1284 464 282 14591 ----
NM_133170chr20107886 7805 6661 5976 5771 2867 1930 1320 1129 610 12110 37983 7123 346 16569
NM_133264chr1742741 2589 2415 1098 ------
NM_133334chr496228 6204 5198 5004 4665 2503 2124 1186 668 --14979 --
NM_133338chr51438 ------
NM_133339chr51438 ------
NM_133340chr51438 ------
NM_133341chr51438 ------
NM_133342chr51438 ------
NM_133343chr51438 ------
NM_133344chr51438 ------
NM_133370chr472967 2610 1352 1154 1097 672 461 22480 754 12505 --
NM_133372chr5102906 2867 2632 2103 2091 1793 1108 568 266 146 12950 22889 2133 --
NM_133378chr22244 204 --1213 --
NM_133432chr22244 204 --1213 --
NM_133437chr22244 204 --1213 --
NM_133468chr73383 196 129 2923 263 12284 --
NM_133473chr1931211 274 196 11863 --1336
NM_133496chr173436 3396 1295 1057 558 495 71 ----21031 56
NM_133646chr295263 5191 4820 4712 3442 1673 1619 1031 955 25410 2241 --175
NM_133647chr1543850 3558 2804 639 23723 3607 1112 --
NM_134265chr1741014 767 315 127 --1244 --
NM_134442chr261350 1341 1197 1155 690 639 --11294 --
NM_134447chr191558 ------
NM_138270chrX52706 2437 2341 2321 448 31309 651 588 12681 192
NM_138288chr142242 204 11977 ----
NM_138290chr71288 ------
NM_138316chr1051095 1014 1007 507 225 21207 894 1219 --
NM_138333chr952557 2549 2424 2392 831 12522 ----
NM_138423chr1572201 2136 1890 607 328 266 160 --1851 --
NM_138426chr762395 2386 2241 1698 812 549 12182 21743 896 --
NM_138459chr653554 3241 723 192 176 11361 22563 92 --
NM_138468chr255978 4681 4493 4079 2516 1780 15839 --
NM_138473chr1254523 3966 3360 2034 176 45141 3829 1031 990 ----
NM_138479chr152048 2027 2012 1817 1783 --1268 --
NM_138554chr972589 2422 2414 2193 2030 1705 1104 --22495 2000 --
NM_138558chr12995 983 ------
NM_138576chr1464792 4486 869 632 263 230 --132 24721 218
NM_138609chr51380 ------
NM_138610chr51380 ------
NM_138621chr273965 3497 2865 2732 2633 1363 842 24139 2700 24014 3542 13487
NM_138638chr142968 670 ----1765
NM_138690chr19196 ------
NM_138713chr16118245 8094 7443 7256 6528 6125 3086 2439 2004 1633 559 36948 6171 1549 35851 1617 706 --
NM_138714chr16118245 8094 7443 7256 6528 6125 3086 2439 2004 1633 559 36948 6171 1549 35851 1617 706 --
NM_138731chr1484259 4079 3181 2896 2726 1424 1288 1122 1571 ----
NM_138766chr51101 --1122 --
NM_138771chr741448 596 465 213 21039 278 21142 159 --
NM_138792chr15139 ------
NM_138806chr36883 777 702 375 360 259 1159 ----
NM_138811chr721200 449 1309 11037 --
NM_138821chr51101 --1122 --
NM_138822chr51101 --1122 --
NM_138923chrX184 ------
NM_138927chr213817 293 99 ------
NM_138931chr33806 385 343 ----11048
NM_138970chr1452293 1845 1722 1630 258 ------
NM_138971chr111183 ----23825 499
NM_138971chr111183 ----23825 499
NM_138972chr111183 ----23825 499
NM_138972chr111183 ----23825 499
NM_138973chr111183 ----23825 499
NM_138973chr111183 ----23825 499
NM_138980chr44639 461 203 181 --1746 --
NM_138981chr44770 592 334 312 --1877 --
NM_138982chr44639 461 203 181 --1746 --
NM_139135chr151334 874 859 486 113 --11026 --
NM_139136chr1251020 892 823 305 41 ----1927
NM_139168chr541768 1236 1226 324 --1230 --
NM_139169chr1031682 759 53 --12255 --
NM_139207chr1241496 869 664 406 ------
NM_139246chr942042 673 660 632 --2744 475 11939
NM_139316chr731032 735 261 1152 1741 --
NM_139321chr2054209 3881 3144 1546 91 14008 14179 1348
NM_139323chr2041778 1449 411 41 --11836 --
NM_144563chr21306 ------
NM_144563chr21306 ------
NM_144571chr4126946 6398 5797 5630 5614 5597 2630 2318 2127 766 154 143 25094 2286 149 16753
NM_144578chr14104768 3989 3792 3558 1197 765 737 179 152 50 24455 1080 ----
NM_144595chr134965 785 382 263 ------
NM_144599chr15105515 4974 4576 4244 4162 4083 3586 3477 1981 707 34546 778 467 31133 962 422 --
NM_144642chr331401 1265 1134 11295 ----
NM_144660chr101276 ------
NM_144664chr1182563 2538 2532 2513 786 770 728 615 12244 ----
NM_144710chr231266 511 436 2384 360 ----
NM_144767chr15104161 3645 3523 2946 2812 1346 1234 1037 705 421 24511 690 14490 --
NM_144778chr1312180 32754 2299 2287 165 22385 976
NM_144967chrX21085 977 ------
NM_144973chr1264072 3853 1613 1358 859 508 25118 1451 21790 886 --
NM_145025chr61102 ------
NM_145055chr1833307 991 487 13657 --2935 373
NM_145112chr1431270 1212 871 --1197 --
NM_145113chr1431542 1484 1143 --1469 --
NM_145117chr1183293 3142 3030 2893 2603 2430 841 228 ------
NM_145185chr191684 ------
NM_145206chr1033155 801 560 ------
NM_145259chr2116837 6692 6630 5503 5465 4957 4759 2753 2316 1723 1052 ----15033
NM_145290chr41276 ------
NM_145296chr192892 786 ------
NM_145313chr1041640 1401 1350 111 --11500 --
NM_145320chr773309 2830 2512 2412 677 583 43 11040 ----
NM_145321chr773309 2830 2512 2412 677 583 43 11040 ----
NM_145322chr773309 2830 2512 2412 677 583 43 11040 ----
NM_145649chr642693 1749 1056 430 --1572 --
NM_145655chr642693 1749 1056 430 --1572 --
NM_145693chr2112559 2512 2505 2376 2279 2233 2188 1609 1603 406 227 ------
NM_145735chr13102835 2758 2734 2623 2445 2172 775 623 326 137 ------
NM_145753chr331579 1368 336 --1601 --
NM_145756chr1831269 512 445 ------
NM_145808chr763091 3006 2849 2835 2767 2108 ------
NM_145859chr3------183
NM_145860chr3------183
NM_147150chr963883 3084 3036 2668 1371 1277 --1867 --
NM_147175chrX42057 2006 1433 866 21834 1607 122 --
NM_148921chr1742456 2316 461 35 ----12436
NM_148955chr1595586 5559 4466 2149 1685 1593 1297 1012 292 --11381 --
NM_148976chr11------1206
NM_148977chr1051095 1014 1007 507 225 21207 894 1219 --
NM_148978chr1051095 1014 1007 507 225 21207 894 1219 --
NM_152221chr2221197 46 ------
NM_152253chr2293485 3461 3451 3352 3281 851 496 418 296 --2611 135 --
NM_152261chr1272490 2370 2272 2215 2029 1986 798 1344 --12208
NM_152271chr82802 757 ------
NM_152280chr123416 2496 ------
NM_152309chr1022093 1844 12189 1476 --
NM_152330chr1472521 2351 2029 1745 1731 888 207 --2479 24 --
NM_152352chr1823023 594 12527 ----
NM_152374chr191182 432 391 350 328 296 200 190 37 41706 519 166 24 ----
NM_152384chr242038 1993 1872 439 ------
NM_152388chr251578 951 648 623 79 24048 2836 13722 --
NM_152407chr5182 ----13069
NM_152409chr553030 2916 2577 2526 203 12564 12233 --
NM_152415chr82152 129 ------
NM_152463chr171513 ------
NM_152519chr221864 1656 1445 11396 11820
NM_152594chr1572275 2227 2151 1827 1733 1651 308 1493 1727 --
NM_152622chr5103496 3478 3435 2841 2762 2426 2398 2315 128 31 42977 2956 2383 664 ----
NM_152624chr5147248 7241 7210 7131 6502 5940 5449 4507 2676 1577 1062 831 580 488 36305 2896 2635 ----
NM_152629chr973766 3663 3520 3424 1571 679 325 --13225 --
NM_152653chr32702 479 1529 1554 136
NM_152665chr131114 470 53 11031 162 --
NM_152678chr322411 143 22246 150 ----
NM_152695chrX22031 274 ------
NM_152745chr751161 1125 1060 961 912 ------
NM_152754chr723834 64 2798 332 21179 1143 --
NM_152756chr544297 1634 1245 1188 54289 4214 4148 2972 1375 1116 --
NM_152774chr772675 2645 2209 2043 1056 756 730 --1669 --
NM_152787chrX93594 3508 3369 2601 2439 2410 1238 688 264 13886 13416 --
NM_152793chr764633 4104 3823 3539 1580 1429 13472 11781 --
NM_152826chr1595586 5559 4466 2149 1685 1593 1297 1012 292 --11381 --
NM_152829chr751271 1174 1026 1016 950 ------
NM_152835chr132551 423 411 ------
NM_152838chr2053231 3116 2992 2628 188 12927 2547 497 --
NM_152857chr6--1860 --1780
NM_152858chr6--1860 --1780
NM_152862chr23384 164 129 ------
NM_152902chr161763 1539 1455 1244 175 102 --11523 --
NM_152905chr122192 171 ------
NM_152924chr1536091 5223 930 --15234 --
NM_152991chr111693 ------
NM_152995chr43285 115 77 ------
NM_152998chr71194 ------
NM_153013chr532507 2377 514 --12530 2335 181
NM_153020chr641690 1528 1284 1082 --1679 21669 1292
NM_153029chr1674112 1638 1053 958 714 123 65 ------
NM_153035chr173229 3107 2853 2248 2038 1295 104 ------
NM_153042chr651605 1309 648 571 30 --11402 --
NM_153050chr2264253 3921 3564 1816 1759 1489 --31924 1557 117 --
NM_153051chr2264253 3921 3564 1816 1759 1489 --31924 1557 117 --
NM_153184chr361798 1484 596 183 140 118 1644 --11314
NM_153186chr93723 260 82 ------
NM_153188chr5145621 5503 5470 5408 5092 4848 4522 4496 3700 1509 1481 1207 341 182 ----25192 1190
NM_153201chr111189 ------
NM_153207chr1264074 3325 3292 2933 1207 1172 22864 2839 1215 --
NM_153235chr642160 548 498 482 --21840 813 --
NM_153262chr162463 2457 782 741 708 547 12746 23184 2418 --
NM_153273chr352409 2103 1879 1755 851 --22761 2368 12497
NM_153365chr431085 1019 713 1895 --12080
NM_153367chr1043997 3165 444 64 --33959 2681 95 --
NM_153371chr1352333 1840 638 364 294 ------
NM_153377chr121350 ------
NM_153456chr1336239 1692 1043 --14880 16204
NM_153487chr684278 4119 3379 2931 1470 1020 697 62 21407 1387 13204 --
NM_153499chr121926 12976 43073 2717 1121 1086 --
NM_153500chr121926 12976 43073 2717 1121 1086 --
NM_153607chr593000 2891 2639 2618 2157 984 911 745 448 1797 12832 1572
NM_153634chr1241539 1131 372 354 --11361 --
NM_153686chr44721 631 561 473 --1291 --
NM_153690chr31835 1852 1758 1803
NM_153693chr123637 622 78 ----1800
NM_153712chr263787 3526 3218 2772 2587 1020 --1504 1469
NM_153713chr1181 ------
NM_153748chr1251020 892 823 305 41 ----1927
NM_153756chr11135 ------
NM_153759chr2------1848
NM_153810chr1085133 5079 3482 3201 834 614 599 63 14109 23548 3379 --
NM_153819chr111165 ------
NM_153825chr411597 ------
NM_170606chr751687 1660 1617 1558 1501 11725 --11786
NM_170665chr12164563 4403 4382 4195 3785 3447 1435 1392 1164 1045 1018 948 672 661 266 211 24047 296 34287 3922 1637 --
NM_170675chr151282 ------
NM_170676chr151282 ------
NM_170710chr4103189 3147 3098 3076 2910 2830 2781 2448 2202 440 32240 787 352 12440 --
NM_170731chr1132330 1153 56 1118 ----
NM_170732chr1132330 1153 56 1118 ----
NM_170733chr1132330 1153 56 1118 ----
NM_170734chr1132330 1153 56 1118 ----
NM_170735chr1132330 1153 56 1118 ----
NM_170739chr112262 250 ------
NM_170751chr621255 1139 --11313 21416 319
NM_170752chr621255 1139 --11313 21416 319
NM_170780chr36883 777 702 375 360 259 1159 ----
NM_171998chrX52516 2478 2136 1810 666 --12456 --
NM_172020chr741916 1804 1712 399 --21471 278 11491
NM_172037chr841367 1356 431 326 ------
NM_172058chr841847 1774 718 697 --1467 11819
NM_172059chr841847 1774 718 697 --1467 11819
NM_172060chr841847 1774 718 697 --1467 11819
NM_172069chr241734 1549 738 51 1289 ----
NM_172070chr252106 1985 1862 1633 456 --1503 --
NM_172071chr187265 5782 2802 2365 1346 1240 547 137 2415 406 11801 12711
NM_172103chr632721 2145 1852 11920 12200 1454
NM_172105chr632721 2145 1852 11920 12200 1454
NM_172159chr341848 1765 1665 49 21467 698 3334 245 164 --
NM_172160chr341848 1765 1665 49 21467 698 3334 245 164 --
NM_172193chr1441318 1250 968 888 11310 ----
NM_172196chr22191 181 ------
NM_172216chr121828 12878 42975 2619 1023 988 --
NM_172218chr83791 683 157 ------
NM_172226chr121926 12976 43073 2717 1121 1086 --
NM_173078chrX2363 296 ------
NM_173084chr331805 898 293 22431 947 141 --
NM_173156chr141479 1468 1419 154 --1815 12202
NM_173163chr161464 ------
NM_173165chr161345 ------
NM_173177chr22656 540 --1457 --
NM_173214chr16118245 8094 7443 7256 6528 6125 3086 2439 2004 1633 559 36948 6171 1549 35851 1617 706 --
NM_173359chr341825 1685 1372 387 ----1447
NM_173468chr4145994 5872 5480 5356 5296 5035 5028 5013 4843 2214 2204 2137 2077 897 24358 4280 --15739
NM_173469chr1551535 1176 627 598 220 11332 ----
NM_173471chr351110 1080 1074 308 182 ------
NM_173473chr1041068 942 139 124 ------
NM_173475chr1661746 1717 1333 1310 463 152 11443 ----
NM_173508chr14886 838 423 80 2862 808 190 --
NM_173510chr2252932 2542 1869 388 276 11886 ----
NM_173511chr243924 3907 3223 995 1740 32973 1029 768 --
NM_173519chr811539 --1420 --
NM_173527chr141765 ------
NM_173533chr11293 ------
NM_173552chr352461 2413 2394 1658 731 ------
NM_173576chr1041662 1579 612 346 ------
NM_173582chr1174452 4168 2307 2097 620 353 337 ------
NM_173589chr112533 171 ------
NM_173595chr12114821 4707 4697 3430 1936 1681 1027 1002 970 635 582 ------
NM_173602chr124610 562 390 283 13692 ----
NM_173607chr1462100 1359 550 312 211 194 1832 ----
NM_173797chr521230 319 1902 ----
NM_173808chr133809 3669 3527 --1574 --
NM_173822chr252023 2017 1585 350 139 2280 59 1722 1511
NM_173829chr5115839 5436 4145 4139 4104 3825 2482 2418 1588 1112 239 34268 1162 699 ----
NM_173848chr81313 ----1187
NM_173854chr152263 2002 1614 623 172 ------
NM_174909chr52861 701 ----1169
NM_175061chr752054 2034 2019 1906 178 1694 ----
NM_175610chr1541271 1067 949 494 --1549 --
NM_175629chr2------1848
NM_175634chr831247 1220 152 ------
NM_175635chr831247 1220 152 ------
NM_175636chr831247 1220 152 ------
NM_175736chr12107857 7845 7790 7679 7141 6918 6468 5473 807 497 17775 27565 838 --
NM_175767chr52691 327 --11659 --
NM_175854chr1372780 2585 1074 700 540 346 285 11890 12108 12131
NM_175861chr12115937 5882 5861 5625 5216 4475 4040 3827 1801 632 300 11781 --11277
NM_175863chr621354 1021 31027 1011 203 --1494
NM_175876chr162734 2300 2114 2015 1986 26 12028 11799 --
NM_175910chr1972470 2376 2357 2348 2310 1908 1591 ------
NM_176814chr751397 1204 1103 444 271 11243 ----
NM_177398chr141882 1600 1540 1374 1136 1472 --
NM_177399chr141882 1600 1540 1374 1136 1472 --
NM_177414chr11458 21428 227 --11638
NM_177424chr12544 346 ------
NM_177452chr1452370 1992 1922 507 102 21682 1531 --1476
NM_177538chr287270 6390 3483 3046 2636 2218 172 119 1366 18904 --
NM_177553chr113897 752 43 ------
NM_177937chr931631 418 107 2650 624 ----
NM_177966chr341769 1576 1415 631 ------
NM_177968chr261853 1624 1419 543 244 199 --11829 --
NM_177974chr1572201 2136 1890 607 328 266 160 --1851 --
NM_177985chr242189 1838 618 472 2809 34 ----
NM_178006chr1372357 2166 362 350 339 273 70 11564 2515 381 --
NM_178007chr1372357 2166 362 350 339 273 70 11564 2515 381 --
NM_178011chr1073099 1204 1162 997 521 354 205 ----22483 297
NM_178140chr542035 765 650 158 42097 1028 644 164 22698 510 --
NM_178151chrX127856 7633 6913 6727 6632 5648 2818 1783 1699 1547 972 825 --15912 15614
NM_178152chrX127856 7633 6913 6727 6632 5648 2818 1783 1699 1547 972 825 --15912 15614
NM_178153chrX127856 7633 6913 6727 6632 5648 2818 1783 1699 1547 972 825 --15912 15614
NM_178426chr161954 1939 1816 1694 681 384 ------
NM_178427chr161854 1839 1716 1594 581 284 ------
NM_178450chr52586 256 ------
NM_178498chr1193881 3862 3473 3286 3177 2863 2789 938 96 ------
NM_178584chr231266 511 436 2384 360 ----
NM_178585chr493203 3174 3043 2990 2562 1171 1062 769 419 32878 2807 2700 ----
NM_178586chr1472441 2363 2191 2172 2144 1498 75 22426 1793 12295 --
NM_178863chr161430 ------
NM_181265chr4103189 3147 3098 3076 2910 2830 2781 2448 2202 440 32240 787 352 12440 --
NM_181332chrX42348 1016 631 425 12728 42061 747 560 546 1571
NM_181354chr851399 1262 423 335 121 ------
NM_181356chr61937 11005 ----
NM_181442chr2021047 396 2988 648 --1855
NM_181443chr2052844 2754 2235 1089 159 32896 915 439 12226 12024
NM_181459chr21388 ------
NM_181460chr21435 ------
NM_181481chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_181482chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_181483chr1886783 6678 5895 5624 5071 1886 1447 638 16714 14995 --
NM_181504chr5143887 3873 3861 3843 3795 3470 3041 3035 3027 1455 1029 960 713 184 --1464 --
NM_181521chr1687207 7050 5885 5794 5693 4581 2690 2383 --12717 11490
NM_181523chr5143887 3873 3861 3843 3795 3470 3041 3035 3027 1455 1029 960 713 184 --1464 --
NM_181524chr5143887 3873 3861 3843 3795 3470 3041 3035 3027 1455 1029 960 713 184 --1464 --
NM_181552chr72931 892 ------
NM_181581chr7172 ------
NM_181659chr2052586 2553 2195 1010 706 ----140
NM_181659chr2052586 2553 2195 1010 706 ----140
NM_181672chrX22005 432 --21468 93 --
NM_181673chrX22005 432 --21468 93 --
NM_181698chr101519 ------
NM_181713chr22641 272 ------
NM_181714chr621980 355 21904 1563 ----
NM_181723chr821836 689 1625 ----
NM_181762chrX31128 292 205 ------
NM_181777chrX31128 292 205 ------
NM_181780chr321906 439 ------
NM_181782chr671964 743 737 700 580 390 231 21764 766 ----
NM_181784chr252552 1664 570 542 271 --12468 --
NM_181787chr833199 3159 3102 2446 332 13870 --
NM_181836chr542509 2262 1890 1674 1133 ----
NM_181838chr551379 453 194 186 154 --1118 --
NM_181846chr1982998 2187 1907 1115 1109 993 799 458 ------
NM_181861chr1272676 2256 505 379 355 262 106 ------
NM_181868chr1272676 2256 505 379 355 262 106 ------
NM_181869chr1272761 2341 590 464 440 347 191 ------
NM_181871chr12262 38 ------
NM_181886chr421203 894 ------
NM_181887chr421203 894 ------
NM_181888chr421203 894 ------
NM_181889chr421203 894 ------
NM_181890chr421203 894 ------
NM_181891chr421203 894 ------
NM_181892chr421250 941 ------
NM_181893chr421203 894 ------
NM_181897chr322315 512 ------
NM_182485chr463661 3111 2593 1064 590 473 32965 2942 927 23400 755 22474 1033
NM_182487chr974383 4187 3024 2971 1679 1536 343 ------
NM_182551chr263411 3059 2625 2212 611 206 13485 12181 --
NM_182641chr17102039 1902 1829 1666 1618 829 583 575 495 390 ------
NM_182643chr862411 1739 1654 1622 689 184 --11845 1220
NM_182646chr463661 3111 2593 1064 590 473 32965 2942 927 23400 755 22474 1033
NM_182648chr143718 488 249 1737 --2753 76
NM_182697chr721638 1220 ------
NM_182700chr731390 1375 532 11283 ----
NM_182715chr751261 1144 395 154 23 ------
NM_182757chr663496 3420 3324 3011 2867 937 --1639 --
NM_182758chr15113187 2865 2779 2677 2637 2615 2442 1461 960 904 621 23651 2983 --177
NM_182762chr785446 4506 4478 4395 4224 4197 2334 1176 --12275 --
NM_182763chr172700 2685 2641 1891 872 846 687 ----1461
NM_182765chr1062325 2281 1871 649 361 58 62317 1990 1759 921 793 683 ----
NM_182767chr1252100 1749 1302 472 190 12081 2646 552 --
NM_182896chr361335 1299 1233 1148 599 479 --11317 --
NM_182907chr661543 1506 723 670 648 77 12406 1220 1503
NM_182920chr33513 271 139 1446 ----
NM_182931chr74599 502 263 90 1106 150 --
NM_182964chr1183293 3142 3030 2893 2603 2430 841 228 ------
NM_182972chr172459 2355 2146 2033 1735 332 60 21946 807 12418 1126
NM_183004chr14103530 3134 2744 2408 933 783 766 710 678 547 183 ----
NM_183078chr643848 2957 2875 492 --12659 --
NM_183227chr671557 1501 1217 638 595 576 536 2505 39 ----
NM_183234chr1541744 1550 1544 1174 1101 11731 --
NM_183235chr1541744 1550 1544 1174 1101 11731 --
NM_183236chr1541744 1550 1544 1174 1101 11731 --
NM_183244chr201473 ------
NM_183246chr201473 ------
NM_183380chr62694 281 ----1161
NM_183419chr831414 1166 1061 ----21184 36
NM_183422chr1321054 710 1679 21021 994 --
NM_194071chr765411 4676 4245 1600 1453 322 --21910 198 --
NM_194247chr263363 2970 1650 1354 756 258 14287 11659 --
NM_194272chr153754 402 390 ----1955
NM_194278chr1464142 3981 3847 3028 2579 997 --34010 1207 193 --
NM_194279chr14139 1348 ----
NM_194283chr53988 506 290 ----11409
NM_194291chr85669 466 337 297 205 ------
NM_194292chr141674 1601 1316 176 ------
NM_194313chr92443 47 11971 11939 1742
NM_194314chr185378 5275 5137 3962 2053 1365 1144 802 --15616 --
NM_194317chr252739 2650 2270 2244 373 --1604 --
NM_194328chr973345 3297 3227 2477 2273 248 50 2557 456 22171 593 --
NM_194329chr973345 3297 3227 2477 2273 248 50 2557 456 22171 593 --
NM_194330chr973345 3297 3227 2477 2273 248 50 2557 456 22171 593 --
NM_194332chr973345 3297 3227 2477 2273 248 50 2557 456 22171 593 --
NM_194434chr18105699 5685 3836 3542 1662 1443 896 884 204 117 24204 1583 ----
NM_194454chr761502 1169 1137 447 436 422 ----1552
NM_194455chr761502 1169 1137 447 436 422 ----1552
NM_194456chr761502 1169 1137 447 436 422 ----1552
NM_194463chrX21197 1084 ------
NM_197939chr1741186 455 437 404 --11052 --
NM_198077chr12567 25 ----1449
NM_198128chr186915 891 352 261 94 29 11437 ----
NM_198158chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_198159chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_198177chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_198178chr382989 2334 2096 1049 927 696 229 177 1218 23007 2046 --
NM_198179chr41616 ------
NM_198181chr1552574 806 731 683 397 --1465 --
NM_198212chr722271 742 12297 1583 --
NM_198215chr1031394 1241 1014 ----1931
NM_198243chr155962 768 700 610 261 ------
NM_198270chrX53499 3375 1249 1172 574 ----13391
NM_198273chr572976 2890 2412 2104 1938 1218 39 23053 2304 1713 --
NM_198390chr161522 11913 11352 1666
NM_198391chr2021292 251 --21089 124 --
NM_198399chr351777 1628 1528 1185 538 ------
NM_198400chr1542188 887 339 295 22076 925 12196 --
NM_198503chr132379 1797 1700 11590 ----
NM_198513chr831737 599 459 --1614 --
NM_198569chr622461 872 --22565 819 --
NM_198581chr2116916 6795 6371 6361 5755 1607 1496 926 615 609 373 --17530 --
NM_198715chr196295 5539 4361 4074 2477 2431 2334 1079 26 36312 4899 491 --11966
NM_198793chr343523 2771 1309 1276 13715 --1756
NM_198829chr731335 540 47 ----11359
NM_198830chr174847 730 260 65 ------
NM_198900chr12107857 7845 7790 7679 7141 6918 6468 5473 807 497 17775 27565 838 --
NM_198935chr2082418 2384 2295 701 534 500 326 219 ----13070
NM_198956chr731390 1375 532 11283 ----
NM_198993chr171153 --11683 --
NM_199000chr732113 1493 72 --1711 --
NM_199040chr1262801 2680 751 520 233 33 23005 2764 ----
NM_199168chr1041517 1438 1225 230 --1237 --
NM_199169chr2063537 3326 3200 2433 2383 431 23231 138 ----
NM_199170chr2063537 3326 3200 2433 2383 431 23231 138 ----
NM_199171chr2063537 3326 3200 2433 2383 431 23231 138 ----
NM_199189chr51105 1915 ----
NM_199320chr462932 2887 2832 2692 2499 1877 22643 2138 12950 --
NM_199320chr462932 2887 2832 2692 2499 1877 22643 2138 12950 --
NM_199324chr473758 3159 2868 1302 1038 643 458 13701 ----
NM_199328chr2141224 1103 1063 334 --1134 --
NM_199421chr1474226 3849 3232 3077 1393 880 244 --14515 14900
NM_199436chr253055 2849 1154 314 128 22948 1176 12376 --
NM_199437chr1152504 2293 2010 944 436 ------
NM_199438chr1152504 2293 2010 944 436 ------
NM_199439chr1152504 2293 2010 944 436 ------
NM_199454chr154172 4115 3658 1157 613 1677 54734 4391 4253 2955 1412 --
NM_199461chr1023341 2552 21460 779 22889 305 --
NM_199462chr174913 3587 3457 3086 3080 1021 1015 21849 1283 24996 321 15033
NM_199482chr251930 1488 1441 582 528 --2177 54 --
NM_201263chr111810 ------
NM_201266chr222722 2006 23030 2416 ----
NM_201267chr21413 ----1582
NM_201278chr1162293 2274 2151 1954 914 352 --1362 1888
NM_201279chr222722 2006 23030 2416 ----
NM_201281chr1162293 2274 2151 1954 914 352 --1362 1888
NM_201413chr215839 799 331 266 137 11079 ----
NM_201414chr215839 799 331 266 137 11079 ----
NM_201432chr1766372 5252 4519 2513 1091 250 --24930 927 --
NM_201433chr1766372 5252 4519 2513 1091 250 --24930 927 --
NM_201434chr171729 ----1189
NM_201568chr141479 1468 1419 154 --1815 12202
NM_201569chr141479 1468 1419 154 --1815 12202
NM_201570chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201571chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201572chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201590chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201591chr451867 1389 1210 632 448 21471 1370 ----
NM_201592chr451867 1389 1210 632 448 21471 1370 ----
NM_201593chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201596chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201597chr1041716 1605 768 454 31807 1293 49 1556 --
NM_201613chr121846 ----1260
NM_203282chr1951739 1616 1274 528 511 1313 ----
NM_203327chr2084572 4161 3905 3720 3471 568 428 89 --13771 --
NM_203350chr131675 1587 1569 ------
NM_203372chr251604 1097 419 361 233 ----1324
NM_203391chrX11813 1723 ----
NM_203394chr1262669 2499 2116 824 700 176 12288 11825 --
NM_203406chr542272 1816 983 54 1548 12360 --
NM_203413chr17131 ------
NM_203417chr2151013 517 511 321 291 ------
NM_203418chr2151013 517 511 321 291 ------
NM_203437chr24895 733 261 159 --1803 --
NM_203446chr2162569 2227 2180 969 950 94 1894 12994 --
NM_203454chr121212 1058 ------
NM_203459chr152565 2495 1671 1658 383 1986 ----
NM_203463chr264711 4195 1334 658 239 203 11932 1996 --
NM_203488chr141357 --1380 --
NM_203504chr45963 939 860 838 616 21012 394 ----
NM_203505chr45963 939 860 838 616 21012 394 ----
NM_205768chr122043 699 ------
NM_205836chr53647 164 151 ----1497
NM_205842chr24811 673 326 161 1608 --2685 518
NM_205860chr153100 2044 539 471 333 12078 ----
NM_206594chr153567 3492 2766 2690 1058 13347 12255 --
NM_206595chr153567 3492 2766 2690 1058 13347 12255 --
NM_206852chr141162 1533 ----
NM_206853chr663777 2896 2572 620 390 207 13070 11633 11318
NM_206854chr6135038 4157 3833 3397 1881 1651 1468 718 711 371 324 306 129 24331 398 --177
NM_206855chr6156003 5122 4798 4362 4095 4084 2433 1683 1676 1336 1289 1271 1094 546 222 25296 1363 13859 11042
NM_206857chr141162 1533 ----
NM_206860chr103350 302 117 ------
NM_206861chr103350 302 117 ------
NM_206862chr103350 302 117 ------
NM_206876chr293451 3171 2428 1254 1138 755 720 179 67 12647 11212 --
NM_206907chr5103308 2308 2285 2190 1355 1301 1234 287 215 206 12759 22786 952 12149
NM_206909chr8118384 8209 8135 7606 6632 6309 5356 2169 2155 548 136 38404 6268 2933 25070 156 --
NM_207032chr2011334 --11418 --
NM_207033chr2021242 558 --11326 --
NM_207034chr2021242 558 --11326 --
NM_207043chr192244 2054 2019 1970 1940 1853 1711 1688 427 1752 ----
NM_207044chr192244 2054 2019 1970 1940 1853 1711 1688 427 1752 ----
NM_207047chr192244 2054 2019 1970 1940 1853 1711 1688 427 1752 ----
NM_207292chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_207293chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_207294chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_207295chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_207296chr363366 2221 1344 611 212 88 12380 22459 680 22485 965
NM_207297chr363391 2246 1369 636 237 113 12405 22484 705 22510 990
NM_207299chr931033 301 131 ------
NM_207303chr10114091 4081 4006 3331 2955 2904 1516 377 269 99 31 11335 21366 23 1621
NM_207304chr1312067 32641 2186 2174 --22272 863
NM_207517chr1551933 1892 1779 1741 1600 --21394 1313 --
NM_207645chr1151331 1207 1088 438 166 --11227 --
NM_207647chr94991 924 573 373 11928 2175 55 --
NM_212539chr3----1299 --
NM_212558chr954133 3325 3007 2991 1017 ------
NM_213589chr2174979 4182 3787 3691 3481 1587 1362 1163 1032 677 666 280 211 187 179 156 144 25353 3939 33432 1140 168 --
NM_213594chr1251113 1023 972 468 281 11292 11283 1475
NM_213609chr33876 312 293 ------
NM_213651chr141733 1513 621 169 --11701 --
NM_213654chr331441 1431 344 21563 649 --1400
NM_213662chr1752474 1778 1661 668 649 ------