TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-100-5p
miRNA Sequence: AACCCGUAGAUCCGAACUUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000875chr1546233 4695 1153 652 ----15609
NM_001010986chrX21717 251 --1659 1594
NM_001037132chr721788 1399 1216 --191
NM_001037133chr721788 1399 1216 --191
NM_002581chr934411 1603 1000 ----15115
NM_004486chr92227 209 ----1246
NM_005010chr721788 1399 1216 --191
NM_032505chr312189 22384 120 --1386
NM_173694chrX21783 317 --1725 1660