TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-101-3p
miRNA Sequence: UACAGUACUGUGAUAACUGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43102 2411 2380 1269 185 --12986
NM_000074chrX--1889 ----
NM_000088chr17----1446 --
NM_000091chr252816 1904 1808 778 67 1640 1200 --
NM_000093chr912163 --21802 600 1596
NM_000098chr11569 ------
NM_000104chr243030 847 453 92 12209 ----
NM_000109chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_000112chr565504 5431 3999 3875 1444 261 25341 4911 13902 2383 273
NM_000125chr673917 3402 2825 2665 1646 1339 675 11272 ----
NM_000141chr104528 455 383 261 --11331 --
NM_000161chr1461443 621 588 447 382 40 11995 ----
NM_000163chr541768 602 267 203 ------
NM_000165chr6------21193 59
NM_000168chr72944 373 --2798 225 13181
NM_000173chr17--1430 ----
NM_000176chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_000194chrX1383 ------
NM_000208chr1954601 3207 2978 1566 1426 13853 13619 13925
NM_000245chr721843 1653 11436 1125 11914
NM_000248chr342965 912 486 472 --1699 22941 215
NM_000251chr23241 64 44 ------
NM_000259chr15115676 4803 4322 4230 2547 2170 1840 852 647 488 103 36364 5917 2496 24858 192 15551
NM_000264chr93997 755 492 2369 139 1652 1648
NM_000267chr1743438 3284 3247 2174 33344 3121 3098 13201 13255
NM_000280chr112837 37 ----1143
NM_000304chr1721003 147 --1225 --
NM_000314chr10103231 2923 2754 2198 2150 1994 1038 1021 957 716 --13122 --
NM_000321chr1341727 1674 592 276 11343 ----
NM_000325chr41635 ------
NM_000328chrX------139
NM_000332chr6127176 6865 6283 6185 5444 5376 4868 4575 2607 1852 1132 793 26927 60 11006 32387 1181 65
NM_000337chr565555 5249 4102 4037 1355 1142 1564 15189 --
NM_000340chr311422 --1103 --
NM_000345chr43977 391 322 21043 849 2412 226 --
NM_000346chr1732001 1656 1511 --1459 --
NM_000368chr984877 4806 4405 4023 3848 1724 765 36 --13482 --
NM_000378chr1111116 2365 283 ----
NM_000393chr221694 543 11335 ----
NM_000408chr263287 3029 2614 2507 2233 1242 33416 2791 174 1979 --
NM_000430chr1752540 2481 1232 734 95 23779 187 23467 1075 --
NM_000452chr133245 188 136 ------
NM_000459chr92829 199 1884 --1118
NM_000461chr364044 3958 2830 1725 656 500 13772 24209 3776 13964
NM_000484chr21------2250 141
NM_000489chrX42689 2439 735 532 22655 2319 32583 2310 1042 12457
NM_000492chr731018 510 350 21514 1168 ----
NM_000516chr201312 ------
NM_000555chrX77756 5185 1902 1644 1587 1104 621 --17741 16912
NM_000572chr1--1109 ----
NM_000586chr4173 1100 ----
NM_000600chr7--1370 ----
NM_000609chr1022328 809 22965 249 22976 2473 --
NM_000610chr1132914 2725 2190 --1707 12895
NM_000619chr121493 ------
NM_000627chr2----1264 1720
NM_000633chr1865248 5003 4122 3947 2057 1781 ----14569
NM_000640chrX130 ------
NM_000684chr1011295 ----11131
NM_000719chr1276490 6237 6057 4266 1959 1877 682 16647 12531 --
NM_000724chr1041412 1269 167 134 21657 775 1546 1554
NM_000793chr1485096 3504 3421 1907 1064 395 372 27 ------
NM_000813chr545270 3595 842 390 14084 14636 13672
NM_000814chr1544057 3335 1159 488 14093 ----
NM_000816chr53629 205 153 ------
NM_000826chr472448 852 756 451 222 113 61 32410 2009 1946 ----
NM_000844chr331087 975 706 ------
NM_000859chr541516 1073 524 216 2409 249 ----
NM_000880chr82720 254 1154 ----
NM_000899chr1264398 3270 2775 1697 691 186 14308 ----
NM_000926chr1189435 8274 8003 7924 7232 6237 3734 737 37754 6350 1315 26354 674 26243 1640
NM_000935chr311169 11161 ----
NM_000958chr54967 500 443 303 11186 127 --
NM_000959chr133805 3426 132 --13970 --
NM_000961chr2033166 3137 3046 ------
NM_001001323chr1273206 2529 2306 2041 684 359 192 32218 915 832 ----
NM_001001389chr1132914 2725 2190 --1707 12895
NM_001001390chr1132914 2725 2190 --1707 12895
NM_001001391chr1132914 2725 2190 --1707 12895
NM_001001392chr1132960 2771 2236 --1753 12941
NM_001001394chr21637 ------
NM_001001419chr575217 5171 4624 3911 1108 76 29 1543 13227 13606
NM_001001420chr575217 5171 4624 3911 1108 76 29 1543 13227 13606
NM_001001436chr16----1211 --
NM_001001481chr833377 3033 621 --23448 308 --
NM_001001484chr1052007 1866 655 572 414 11722 11726 --
NM_001001521chr21232 1100 ----
NM_001001549chr72386 183 2439 425 11066 --
NM_001001550chr72386 183 2439 425 11066 --
NM_001001555chr72386 183 2439 425 11066 --
NM_001001664chr241465 851 448 265 23871 1242 1716 --
NM_001001668chr1974175 3794 3508 2759 1665 1542 1397 ----13060
NM_001001706chr61809 2902 237 ----
NM_001001890chr2194224 3551 3443 3043 2684 1559 1446 1243 351 23626 740 1957 --
NM_001001928chr2298243 7154 5663 5601 5507 5209 3245 1270 387 18294 ----
NM_001001933chr12539 83 1390 1238 --
NM_001001974chr1022339 1978 --11585 1484
NM_001002243chr2--1732 ----
NM_001002259chr121242 ------
NM_001002860chr1474652 4294 4072 3902 3073 3049 323 --14366 --
NM_001002919chr21531 ------
NM_001003652chr1876229 3098 2931 2784 2590 2561 1757 12240 32346 347 342 11900
NM_001003674chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_001003675chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_001003712chr1263489 1174 871 782 500 137 11612 13008 --
NM_001003760chr623021 2255 ----1118
NM_001003810chr4----1650 1267
NM_001004023chr11188 ------
NM_001004065chr953861 3678 3316 2944 2844 --13437 --
NM_001004196chr311029 --11212 --
NM_001004317chr653066 3046 3038 1682 1397 --24015 1808 14011
NM_001004342chr145966 5893 4470 1113 --24631 1806 --
NM_001004360chr222014 175 2428 74 11300 --
NM_001004722chr2--11243 ----
NM_001005353chr141045 837 318 61 --168 --
NM_001005353chr141045 837 318 61 --168 --
NM_001005366chr121365 ------
NM_001005375chrY21848 515 ------
NM_001005404chr1733440 1525 790 11160 13183 --
NM_001005463chr1032533 806 693 1619 ----
NM_001005474chr311223 1551 ----
NM_001005609chrX73761 2359 658 573 309 96 76 23530 1245 ----
NM_001005849chr17--1156 ----
NM_001006600chr522401 526 42449 1933 1777 800 --21909 1782
NM_001006623chr242387 557 425 105 22433 1029 12005 --
NM_001006657chr232982 2436 2316 2506 64 1768 --
NM_001007023chr1485096 3504 3421 1907 1064 395 372 27 ------
NM_001007024chr1774275 3892 3747 3525 2832 2757 507 14338 21571 185 --
NM_001007025chr1774275 3892 3747 3525 2832 2757 507 14338 21571 185 --
NM_001007075chr411086 ------
NM_001007097chr984454 3222 1066 1016 950 178 107 85 24903 4795 15045 --
NM_001007102chr621598 1399 --31049 479 195 --
NM_001007189chr5124 --140 --
NM_001007226chr1741488 933 583 249 --11098 --
NM_001007227chr1741488 933 583 249 --11098 --
NM_001007228chr1741488 933 583 249 --11098 --
NM_001007229chr1741488 933 583 249 --11098 --
NM_001007230chr1741488 933 583 249 --11098 --
NM_001007246chr2131697 1471 103 11867 --11597
NM_001007257chr141235 1224 941 46 21529 1088 ----
NM_001007466chr664088 3995 1933 1642 357 292 24615 1093 14701 14740
NM_001007559chr1851994 1882 1494 743 48 11509 ----
NM_001007565chr3180 ------
NM_001008225chr71503 1651 ----
NM_001008392chr33870 554 478 13339 33545 3240 2556 13344
NM_001008401chr1921383 1349 11391 11395 --
NM_001008408chr786279 5717 5441 4591 3874 1653 1552 697 36398 4996 1122 26342 2048 --
NM_001008495chr83573 481 225 ----11684
NM_001008539chr895000 4527 4493 4400 3720 2075 1842 771 322 15136 ----
NM_001008564chr1332268 2092 2036 ------
NM_001008660chr1121431 85 2584 379 ----
NM_001008738chr532335 2247 2066 12123 1659 --
NM_001008783chr62732 137 1569 ----
NM_001008860chr153787 669 225 ------
NM_001008892chr153787 669 225 ------
NM_001008894chr153787 669 225 ------
NM_001008895chr13--11414 ----
NM_001009899chr366463 5997 5898 2239 428 306 36259 6154 4009 1805 --
NM_001009909chr1163824 3396 2735 360 82 40 1701 13552 13719
NM_001009958chr7----2608 190 --
NM_001009959chr222623 2427 --11784 --
NM_001009993chr284212 3432 3396 2911 1404 1376 1027 66 14532 21630 934 --
NM_001010844chr6--123 ----
NM_001010852chr6145 ------
NM_001010861chr132779 2375 2293 1666 --12787
NM_001010888chrX34372 1754 676 24615 4268 14323 13945
NM_001010891chr5126608 5346 4977 4907 2764 2294 1742 1676 1245 1115 898 798 26877 2163 --1255
NM_001010927chr62481 169 ----1541
NM_001011515chr42873 142 ----11025
NM_001011516chr42873 142 ----11025
NM_001011537chr341838 1619 587 411 22096 1906 1822 --
NM_001011553chr71284 ----1980
NM_001011666chr756467 6190 1812 1739 1176 --26269 452 --
NM_001011708chr262812 2370 752 467 449 156 ------
NM_001011885chr1511732 11469 ----
NM_001012393chr1164721 3833 1892 1807 1574 909 11007 ----
NM_001012420chr1552525 2340 589 526 421 32930 2741 725 --1717
NM_001012423chr1552525 2340 589 526 424 32930 2741 725 --1717
NM_001012751chr1081691 1405 477 444 399 177 117 47 ------
NM_001012755chrX85114 4822 3522 1522 1449 978 931 471 24332 3763 11721 --
NM_001012968chrX52732 1959 923 867 125 1695 ----
NM_001013620chr12177841 7379 7309 7037 6733 6540 6239 6071 5698 5188 3155 3088 1837 1711 1429 967 618 1743 ----
NM_001013699chr12--1536 ----
NM_001013746chr721826 209 12046 ----
NM_001014380chr1385829 5413 5250 4544 1964 1094 511 209 34600 1664 1597 14182 --
NM_001014434chr1----1183 --
NM_001014797chr1077435 6242 6075 5737 5274 2579 945 --32966 1920 973 --
NM_001014831chr191650 ------
NM_001014832chr191650 ------
NM_001014834chr191650 ------
NM_001014835chr191650 ------
NM_001015048chr1443168 2648 2077 29 --1984 12614
NM_001015049chr1443168 2648 2077 29 --1984 12614
NM_001015508chr81477 --1525 2494 489
NM_001017371chr221174 60 31351 1148 352 ----
NM_001017395chr353416 2596 955 842 440 43656 3326 2631 1000 ----
NM_001017434chr12742 160 ------
NM_001017926chr831453 678 60 1363 ----
NM_001018005chr15--1150 ----
NM_001018037chr9--11360 ----
NM_001018053chr131964 1350 261 31875 1511 692 ----
NM_001018056chr9--2570 419 ----
NM_001018064chr941577 565 556 186 1502 ----
NM_001018065chr956014 5677 4262 3917 1642 14228 15007 --
NM_001018066chr956014 5677 4262 3917 1642 14228 15007 --
NM_001018067chr194804 3318 1956 1660 1174 812 504 281 219 13736 14681 --
NM_001018068chr194804 3318 1956 1660 1174 812 504 281 219 13736 14681 --
NM_001018069chr194804 3318 1956 1660 1174 812 504 281 219 13736 14681 --
NM_001018074chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_001018075chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_001018076chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_001018077chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_001018090chr155855 241 235 197 87 12086 ----
NM_001018091chr155965 351 345 307 197 12196 ----
NM_001018102chr155855 241 235 197 87 12086 ----
NM_001023567chr1542420 2413 592 529 22322 2128 22357 724 --
NM_001024094chr563847 3614 3190 3028 513 106 2595 56 12750 --
NM_001024647chr1277501 6555 4983 1165 936 687 166 27202 1684 17459 --
NM_001024649chr51998 ----1441
NM_001024934chr63571 512 504 ------
NM_001024935chr63571 512 504 ------
NM_001024936chr63571 512 504 ------
NM_001024947chr5--2902 837 ----
NM_001024948chr163246 3052 2761 2134 1059 187 ------
NM_001025076chr1095910 5869 4686 3897 3802 2158 1482 1275 741 1769 35780 3976 1361 --
NM_001025077chr10117268 7227 6044 5255 5160 4644 2840 2633 2099 917 653 12127 77138 5334 5064 4703 4578 2719 1244 --
NM_001025105chr521534 1137 1178 --11161
NM_001025108chr254102 3948 3522 2709 485 ------
NM_001025252chr843125 2579 2004 1287 32090 1225 1090 1703 --
NM_001025253chr843125 2579 2004 1287 32090 1225 1090 1703 --
NM_001025580chrX54291 1659 953 711 289 34272 2887 92 ----
NM_001025595chr4----21224 245 --
NM_001025780chr921237 299 2532 290 11579 1257
NM_001029858chr683230 1047 1002 765 321 315 285 252 --23139 581 169
NM_001029860chr81265 ------
NM_001029884chr642614 2258 2084 1734 22708 2366 --1184
NM_001030007chr1643984 3128 1029 402 43813 1567 1193 599 23993 2854 --
NM_001030055chr1494398 4236 2900 1744 1555 1473 1065 745 306 13736 --11504
NM_001031684chr2------1540
NM_001031685chr12662 219 1947 ----
NM_001031695chr2274979 4286 4184 3890 2074 690 423 15224 ----
NM_001031712chr61298 ------
NM_001031716chr22920 75 11099 ----
NM_001031732chr443671 2340 745 647 13213 22613 1355 --
NM_001031801chr221185 ------
NM_001031804chr1664438 3938 3429 1740 1618 540 ------
NM_001031812chr541773 1478 595 50 11736 2700 530 --
NM_001032280chr651677 1657 1299 1289 1146 --1538 11071
NM_001032282chr82463 330 1849 ----
NM_001032289chrX----1141 --
NM_001032393chrX--1234 1724 1747
NM_001032999chr2044019 3243 540 176 11912 11014 15310
NM_001033002chr171102 ------
NM_001033047chr41422 --1642 12574
NM_001033057chr321890 626 1440 21398 179 11462
NM_001033561chr17--1735 ----
NM_001033566chr173985 766 167 --2992 330 --
NM_001033568chr173985 766 167 --2992 330 --
NM_001033578chr8--32345 2227 2199 ----
NM_001033925chr1031660 736 336 1791 ----
NM_001034841chr1675261 5182 1887 1694 1139 442 263 25144 3653 11806 --
NM_001034915chr841235 1155 1086 1079 ------
NM_001034954chr1053125 2190 610 199 170 13248 ----
NM_001034955chr1053125 2190 610 199 170 13248 ----
NM_001034956chr1053125 2190 610 199 170 13248 ----
NM_001034957chr1053125 2190 610 199 170 13248 ----
NM_001037132chr731745 1713 730 2438 112 --11620
NM_001037133chr731745 1713 730 2438 112 --11620
NM_001037317chr132779 2375 2293 1666 --12787
NM_001037334chr1852278 619 498 383 199 1831 2865 639 --
NM_001037553chr2164707 4175 3126 2072 800 428 --14603 14272
NM_001037582chr421594 1195 ------
NM_001037954chr1153387 3276 949 834 560 --22464 708 --
NM_001038493chr231324 1315 1300 ------
NM_001038640chr151660 ------
NM_001039091chrX21351 143 ------
NM_001039348chr2150 1110 ----
NM_001039349chr2150 1110 ----
NM_001039547chr398094 6692 6185 1956 1877 1810 1738 1406 381 57910 6751 5852 3216 1601 ----
NM_001039577chr143689 198 140 21 43882 1729 463 251 31663 1173 1117 --
NM_001039585chr144062 3683 389 146 --14227 --
NM_001039590chrX53772 3661 3112 1411 157 33067 1298 645 ----
NM_001039591chrX53772 3661 3112 1411 157 33067 1298 645 ----
NM_001039618chr1195808 5122 4950 4857 4689 3969 3919 1470 453 25047 4271 14015 --
NM_001039709chr2044019 3243 540 176 11912 11014 15310
NM_001039762chr1022196 1908 ------
NM_001039802chr1----1213 --
NM_001039840chrX74806 4145 3974 2276 820 710 89 1629 ----
NM_001039937chr1364068 3306 3267 1228 1178 1017 23854 451 ----
NM_001040001chr652004 1991 1267 748 450 21932 1913 ----
NM_001040092chr82360 55 ----1321
NM_001040100chr33828 413 75 ------
NM_001040142chr232390 2155 1643 21554 528 1406 21742 533
NM_001040143chr232390 2155 1643 21554 528 1406 21742 533
NM_001040152chr765120 4552 3617 3116 3097 1515 25072 1242 1312 --
NM_001040153chr133972 960 711 1784 1222 --
NM_001040157chr442895 2698 575 431 2680 51 ----
NM_001040159chr451498 1341 1167 1130 1081 1970 ----
NM_001040167chr751193 800 781 405 145 --1805 --
NM_001040284chr16105641 4342 3815 3625 2320 1265 1131 1077 578 496 24074 1378 21216 888 --
NM_001040402chr473151 3041 2583 469 264 164 70 ----1333
NM_001040429chr1323529 1084 11141 ----
NM_001040633chr72910 848 1237 1927 --
NM_001040665chr743825 3668 680 86 1214 11604 --
NM_001040712chr942680 2645 1373 380 21025 685 --1516
NM_001040876chr421591 481 ------
NM_001042355chr1675367 4973 3983 3917 1836 727 482 13874 35058 3536 1145 --
NM_001042399chr12194 1146 --1151
NM_001042406chr64995 850 370 327 --11230 --
NM_001042412chr1675367 4973 3983 3917 1836 727 482 13874 35058 3536 1145 --
NM_001042413chr933614 3208 941 1705 ----
NM_001042414chr13192 --1257 --
NM_001042425chr651677 1657 1299 1289 1146 --1538 11071
NM_001042453chrX31686 1516 526 11454 ----
NM_001042492chr1743438 3284 3247 2174 33344 3121 3098 13201 13255
NM_001042506chrX21372 464 21364 112 ----
NM_001042510chr851909 762 273 140 45 22055 1353 --12170
NM_001042511chr851909 762 273 140 45 22055 1353 --12170
NM_001042543chr4--11595 ----
NM_001042550chr961909 1849 1573 1518 202 101 22082 1373 11868 --
NM_001042555chr1284630 4566 4025 3322 1350 1290 1013 605 44549 3997 3769 3758 ----
NM_001042599chr257416 6647 5551 4781 4762 37190 5964 4754 --12150
NM_001042601chr363082 773 705 398 378 255 --13028 --
NM_001042603chr1295153 4460 2040 1490 1245 1039 994 755 137 23975 1991 21849 1535 --
NM_001042604chr374802 4480 4262 3126 590 563 158 33591 3570 3528 14485 --
NM_001042683chr641524 740 181 131 ------
NM_001042749chrX41827 1629 1612 1359 2804 534 11841 --
NM_001042750chrX41827 1629 1612 1359 2804 534 11841 --
NM_001042751chrX41827 1629 1612 1359 2804 534 11841 --
NM_001044305chr62240 152 11222 1507 1403
NM_001044722chr541773 1478 595 50 11736 2700 530 --
NM_001044723chr541773 1478 595 50 11736 2700 530 --
NM_001046chr542989 2438 2259 1930 22940 964 --1493
NM_001048183chr11175 21522 228 --13701
NM_001068chr31127 --1203 --
NM_001069chr6----1155 --
NM_001071775chr1341958 1268 650 331 1454 ----
NM_001079874chr11178 --11842 11831
NM_001083620chr472446 851 755 450 221 113 61 32408 2007 1944 ----
NM_001099678chr386400 6219 5932 5922 5781 4660 4523 1051 45877 5466 4608 1244 ----
NM_001106chr3129594 9382 9353 8023 7788 3105 2971 2687 1287 1162 651 259 37248 971 220 39176 3397 2382 18698
NM_001117chr181155 1472 ----
NM_001124chr112556 470 1526 ----
NM_001126chr12336 155 ------
NM_001128chr1643984 3128 1029 402 43813 1567 1193 599 23993 2854 --
NM_001146chr852142 2109 482 277 98 ------
NM_001149chr1041267 1184 281 46 21174 490 11178 --
NM_001160chr1272155 1965 833 494 365 349 112 12675 1265 --
NM_001167chrX96552 5868 5733 5506 5111 2613 2118 617 211 36711 5213 1682 26595 1777 --
NM_001173chr1494398 4236 2900 1744 1555 1473 1065 745 306 13736 --11504
NM_001177chr1252492 2428 2138 828 535 ------
NM_001186chr2121097 97 12066 ----
NM_001200chr201880 ------
NM_001204chr257696 6030 5572 1083 326 57759 7524 7147 6189 5967 11861 --
NM_001233chr722239 577 2619 37 ----
NM_001239chr51121 ------
NM_001241chr232343 228 196 42105 1927 434 308 ----
NM_001241chr232343 228 196 42105 1927 434 308 ----
NM_001256chr1742668 2005 707 45 ----11850
NM_001257chr1621556 352 11480 ----
NM_001259chr7116382 4916 4834 4466 2339 1869 1613 943 285 167 120 35602 4080 1982 ----
NM_001270chr51873 11011 1120 --
NM_001271chr1552835 2436 2413 1074 117 33245 3102 1203 1782 --
NM_001284chr52430 172 ----1130
NM_001288chr61191 ------
NM_001290chr42746 346 1417 ----
NM_001304chr1763368 3133 2893 2569 805 702 23021 2751 13011 --
NM_001310chr1262719 2436 2261 2039 696 229 22567 853 ----
NM_001326chr111415 --1113 --
NM_001343chr531282 397 369 ------
NM_001351chr331827 1407 417 ------
NM_001356chrX12252 22415 221 22446 310 --
NM_001390chr1863516 2986 2268 2234 464 376 13501 13530 13482
NM_001396chr2152555 2420 2324 2267 999 12565 --1527
NM_001399chrX73761 2359 658 573 309 96 76 23530 1245 ----
NM_001401chr911373 11042 --11010
NM_001412chrX83103 3034 2813 2726 2614 1163 701 629 ------
NM_001417chr1241641 1525 416 181 ------
NM_001418chr112677 39 ------
NM_001418chr112677 39 ------
NM_001427chr71111 ------
NM_001429chr2231097 758 63 ------
NM_001430chr221941 411 1517 ----
NM_001432chr433722 2952 2806 12591 ----
NM_001438chr173573 3516 2627 2418 958 640 628 33565 2452 2253 ----
NM_001452chr6----1556 --
NM_001463chr24782 288 220 104 ------
NM_001490chr963483 2944 2419 1407 1341 849 1531 22566 535 11488
NM_001491chr662755 1068 929 360 262 229 12692 ----
NM_001494chr102756 701 177 ----
NM_001495chr831130 1023 899 11107 ----
NM_001497chr972568 1908 1093 900 872 397 51 1936 12669 --
NM_001498chr62313 289 2871 358 1107 11151
NM_001527chr6124662 4357 4317 4255 3843 3631 3507 3161 880 708 471 165 ------
NM_001530chr141810 --11137 --
NM_001546chr641427 1076 442 249 2592 507 ----
NM_001560chrX52665 2453 2220 2186 2074 --1456 --
NM_001584chr1141190 1118 1079 801 1833 1401 --
NM_001604chr112837 37 ----1143
NM_001609chr1054325 2954 1317 1104 523 141 13887 --
NM_001616chr243394 768 506 444 33489 3387 467 2909 797 12242
NM_001619chr11199 ------
NM_001621chr731120 987 223 12644 12727 11227
NM_001621chr731120 987 223 12644 12727 11227
NM_001642chr11--1151 1303 --
NM_001649chrX----12022 --
NM_001650chr1863196 3162 3061 2898 2585 185 11253 ----
NM_001660chr33655 592 145 ------
NM_001663chr1431751 859 125 31777 648 429 ----
NM_001668chr131841 705 300 11715 ----
NM_001677chr12422 310 3387 254 200 1859 --
NM_001682chr1262920 2243 2020 1035 398 73 31932 629 546 ----
NM_001690chr342406 1679 437 100 1264 22411 2016 --
NM_001693chr84493 480 225 142 1257 --1266
NM_001695chr854254 3138 2604 372 325 --1542 --
NM_001726chr1--1107 ----
NM_001730chr1331498 1294 1210 1210 21531 1010 --
NM_001730chr1331498 1294 1210 1210 21531 1010 --
NM_001743chr24496 462 163 96 ------
NM_001746chr51998 ----1441
NM_001753chr731420 1195 288 ------
NM_001754chr2194224 3551 3443 3043 2684 1559 1446 1243 351 23626 740 1957 --
NM_001759chr12105169 5106 3852 3725 1858 1768 1362 913 611 247 24680 853 ----
NM_001769chr12--1322 ----
NM_001786chr10156 ------
NM_001788chr71284 ----1980
NM_001791chr1----1213 --
NM_001792chr182300 176 --11120 --
NM_001802chr161908 1986 ----
NM_001821chr164683 3800 3683 1456 264 24 14418 ----
NM_001830chrX63889 3465 2807 2473 726 247 13979 --11420
NM_001839chr11250 1112 1498 1192
NM_001845chr1331333 908 340 ------
NM_001858chr644938 4434 4144 719 34864 1743 1693 54868 4801 3205 1808 1635 --
NM_001881chr101117 ------
NM_001892chr521534 1137 1178 --11161
NM_001918chr1107791 7356 7321 6540 6406 6120 3254 2114 1349 244 23316 95 18977 --
NM_001920chr12--1540 ----
NM_001924chr1--1426 ----
NM_001931chr112926 186 ------
NM_001935chr21231 ------
NM_001938chr121523 152 11917 1418 11731
NM_001939chrX43652 3635 2687 586 11403 12525 --
NM_001964chr5--1475 ----
NM_001967chr31390 ----1467
NM_001969chr1443280 785 413 137 23477 932 23005 2739 --
NM_001977chr421412 40 --21655 661 --
NM_001978chr81965 ------
NM_001999chr531396 1348 1143 31209 1104 216 1961 --
NM_002006chr423610 218 25754 5715 21688 753 --
NM_002009chr1532649 942 667 1731 ----
NM_002013chr14--195 ----
NM_002015chr1331159 761 430 32624 2529 225 43016 2666 2606 2181 --
NM_002024chrX31512 271 156 11626 ----
NM_002025chrX88326 6672 6317 5790 5652 2571 1221 290 27118 6717 ----
NM_002039chr4--1274 1219 --
NM_002041chr15----144 --
NM_002063chrX21034 393 --11102 11255
NM_002074chr121696 1282 --21741 1556 1204
NM_002114chr61526 1422 ----
NM_002129chr41389 ------
NM_002138chr4----1650 1267
NM_002140chr941184 335 299 178 ------
NM_002146chr17--11234 ----
NM_002147chr173850 602 197 ------
NM_002158chr233825 950 166 ----1898
NM_002165chr201359 ----1328
NM_002193chr211877 ----11889
NM_002210chr233144 886 321 ----12743
NM_002214chr732057 350 210 1243 24604 2277 --
NM_002222chr3--1133 --1176
NM_002223chr1273735 3506 1544 1026 988 943 96 ------
NM_002234chr122754 617 ------
NM_002239chr22827 148 1295 ----
NM_002242chr251959 1881 1719 1568 1555 21639 67 ----
NM_002247chr1032087 1778 540 --11883 --
NM_002264chr354854 4717 1974 1964 113 34182 3595 3300 31511 1351 1248 --
NM_002265chr17----11065 --
NM_002266chr17158 ------
NM_002270chr545109 4960 2067 1691 55620 5189 4521 3681 1145 33803 1210 1149 25625 1083
NM_002271chr1332207 2010 1611 22343 984 21843 689 --
NM_002285chr254102 3948 3522 2709 485 ------
NM_002290chr62271 236 ------
NM_002293chr132521 539 111 1288 22201 1021 --
NM_002310chr576381 5928 5908 4213 2348 1901 695 34558 1552 603 26598 103 16188
NM_002332chr121770 ------
NM_002336chr1274789 4325 4208 1578 1564 894 611 --14184 --
NM_002342chr12--1599 ----
NM_002351chrX21394 491 167 ----
NM_002356chr682807 2781 2587 2060 967 958 740 73 1815 12764 --
NM_002380chr85391 379 268 123 85 ------
NM_002397chr511902 ------
NM_002398chr21558 1542 ----
NM_002399chr1521351 1281 21172 574 --11296
NM_002408chr143681 545 242 ------
NM_002430chr2232415 2342 962 22579 375 1389 --
NM_002457chr111101 ------
NM_002467chr81425 ------
NM_002469chr12------1488
NM_002480chr122606 585 11024 11129 11500
NM_002481chr185937 5812 5746 3133 2756 2009 1629 1387 --13039 12498
NM_002487chr152737 175 ------
NM_002499chr1562477 2205 936 908 785 636 12430 1332 --
NM_002500chr221316 141 --11194 11237
NM_002508chr111972 ------
NM_002515chr1431688 1381 366 1288 --168
NM_002519chr1141321 279 144 114 2585 271 ----
NM_002527chr12177 --1271 --
NM_002538chr52248 146 ------
NM_002545chr1164721 3833 1892 1807 1574 909 11007 ----
NM_002552chr231241 134 65 ------
NM_002577chr333643 3533 2751 34024 3263 1378 ----
NM_002581chr995576 5529 5098 4540 3892 3783 2050 1275 60 25232 1726 ----
NM_002591chr201545 --1452 --
NM_002595chr1241808 1576 1343 334 11610 ----
NM_002605chr153972 307 180 1804 ----
NM_002610chr212407 1584 ----
NM_002613chr16125196 5105 4810 4341 4202 3733 3311 1726 1205 629 399 389 35228 4887 3263 1791 --
NM_002623chr20147 ------
NM_002628chr341076 995 973 916 ------
NM_002647chr18--1214 ----
NM_002655chr865242 5190 5054 4569 3418 1373 25278 4749 ----
NM_002656chr61241 --2895 164 --
NM_002687chr14------1909
NM_002709chr243075 2386 1098 752 11210 --1183
NM_002710chr1241027 929 422 79 --1793 --
NM_002715chr531280 953 26 ------
NM_002718chr3--32314 2262 1044 --1604
NM_002721chr91157 ------
NM_002731chr142876 2861 1106 411 23113 2038 ----
NM_002736chr721936 507 --11872 --
NM_002738chr16156 ------
NM_002745chr2273707 1737 1453 872 729 699 270 22900 1369 43589 3530 2904 1272 13610
NM_002748chr1511204 31080 1038 416 ----
NM_002753chr42626 314 ------
NM_002755chr156799 665 613 322 193 169 ------
NM_002765chrX21351 143 ------
NM_002788chr14180 123 ----
NM_002806chr14182 149 ----
NM_002813chr1281470 1451 1326 1283 944 489 327 282 --2514 143 --
NM_002814chrX2678 216 ------
NM_002819chr19----11300 --
NM_002821chr61751 ------
NM_002827chr2041679 628 585 539 ------
NM_002833chr15--21481 576 ----
NM_002834chr1223849 2881 23554 3452 --13735
NM_002837chr1244333 3551 2969 454 31187 867 173 ----
NM_002839chr942680 2645 1373 380 21025 685 --1516
NM_002843chr1163383 3229 2980 1171 578 416 33257 2392 1331 ----
NM_002844chr61267 ------
NM_002845chr18--1642 1544 --
NM_002851chr71265 --1649 --
NM_002869chr1141790 1555 1544 116 1536 ----
NM_002886chr364230 4136 3283 1495 1375 681 34840 3628 787 14354 --
NM_002902chr153217 194 28 1542 --1268
NM_002906chr1122121 2095 11570 ----
NM_002922chr12483 220 --1228 --
NM_002923chr11453 --1485 --
NM_002924chr11615 ------
NM_002940chr421591 481 ------
NM_002941chr321142 172 ------
NM_002942chr31339 ----1523
NM_002968chr1621136 789 21080 288 --1277
NM_002971chr31906 1463 ----
NM_002977chr263160 2854 2473 2465 876 22 23426 3415 2944 699 --
NM_003010chr1772050 1950 1710 1673 804 766 205 --11737 --
NM_003016chr1781286 549 458 451 383 326 251 116 ------
NM_003034chr12116619 6256 6003 5471 2551 2099 1422 1175 1046 953 252 28024 5075 ----
NM_003042chr321931 1547 21992 1460 11654 --
NM_003046chr895000 4527 4493 4400 3720 2075 1842 771 322 15136 ----
NM_003048chr262649 2270 2241 1121 780 690 12710 12625 --
NM_003054chr10----1278 --
NM_003070chr92686 203 1601 ----
NM_003079chr17--1698 ----
NM_003093chr62184 72 124 ----
NM_003099chr15106545 5893 5110 4414 2575 2070 1619 1006 520 265 11296 ----
NM_003106chr34919 871 762 690 ------
NM_003108chr276926 6237 5092 4564 1543 1004 908 17086 --11291
NM_003110chr17--1902 1159 --
NM_003111chr221174 60 31351 1148 352 ----
NM_003112chr731265 195 32 22791 460 ----
NM_003126chr1--2440 164 ----
NM_003128chr222458 649 2927 704 1317 --
NM_003140chrY196 ------
NM_003150chr1752330 2270 2059 1709 343 12379 ----
NM_003155chr852667 2624 1953 1859 462 --178 2762 661
NM_003161chr1793456 2713 2402 1133 1124 1056 1004 803 202 ------
NM_003176chr11217 ------
NM_003176chr11217 ------
NM_003178chr342182 1866 1495 867 1514 ----
NM_003182chr72389 147 ----1163
NM_003182chr72389 147 ----1163
NM_003184chr82883 819 1438 ----
NM_003185chr2021315 74 11054 ----
NM_003199chr1875668 5058 4924 4691 4459 3747 733 1765 --15257
NM_003202chr5--11826 11850 --
NM_003211chr1231503 1290 1191 11524 --11390
NM_003220chr651677 1657 1299 1289 1146 --1538 11071
NM_003221chr654174 3273 3181 1366 1315 ------
NM_003246chr1552048 1404 741 328 49 11602 ----
NM_003262chr374673 3763 3444 3286 1737 1053 328 11028 ----
NM_003274chr2152947 2329 2176 1875 626 ------
NM_003286chr20--2877 344 ----
NM_003291chr131114 ----1709
NM_003300chr141491 ------
NM_003304chr321349 454 41612 1561 1442 601 ----
NM_003305chr41153 ------
NM_003336chrX21059 792 1291 1117 1204
NM_003337chr511061 ----11101
NM_003338chr1031642 497 87 2433 345 --137
NM_003340chr441067 900 514 58 --11270 --
NM_003342chr1723115 296 33229 1149 1027 12953 13234
NM_003383chr9--2570 419 ----
NM_003392chr354221 3080 2949 2821 1611 11318 ----
NM_003403chr141633 ----1800
NM_003404chr2031451 435 248 ------
NM_003405chr222681 105 ------
NM_003410chrX42866 2738 897 108 32975 2895 92 ----
NM_003413chrX31984 1879 1777 11453 11801 --
NM_003452chr94869 817 706 375 ------
NM_003458chr332900 1141 49 23629 3471 24012 3957 13879
NM_003463chr652851 1163 276 214 114 1882 --1625
NM_003469chr24462 450 391 368 ------
NM_003473chr101902 --1784 --
NM_003483chr1272832 2664 2309 2161 2082 283 86 1240 ----
NM_003489chr2132390 458 130 11212 12808 --
NM_003505chr71406 --11678 --
NM_003506chr82469 121 ----11247
NM_003507chr231519 606 316 11969 --21876 1718
NM_003508chr71292 ------
NM_003563chr1741488 933 583 249 --11098 --
NM_003566chr1263056 3038 2991 1062 710 412 13146 13271 --
NM_003574chr1865396 4547 2170 1672 1534 367 22149 1661 25667 22 --
NM_003582chr11188 ------
NM_003583chr1233905 3778 3707 43843 3516 1544 247 ----
NM_003589chr13--11414 ----
NM_003590chr253007 1193 1145 752 248 42958 809 545 269 11386 11578
NM_003603chr451967 770 535 427 164 ------
NM_003615chr363939 3763 3131 2663 1443 94 183 1445 --
NM_003618chr21123 21316 461 ----
NM_003626chr1131387 1270 1188 1392 --1333
NM_003659chr2----1307 --
NM_003663chr342533 1062 607 174 13325 ----
NM_003664chr51222 1503 ----
NM_003670chr31490 ------
NM_003671chr983541 3375 3285 3217 3073 1139 513 234 ------
NM_003672chr12688 427 11729 1339 --
NM_003677chr1241601 1562 695 412 ----11448
NM_003692chr91631 --1118 --
NM_003722chr321058 988 --22217 389 --
NM_003743chr2--2800 736 11425 --
NM_003749chr1362404 2274 1896 1632 1607 753 --22234 223 --
NM_003759chr464235 3420 3267 3078 733 617 1897 11255 1993
NM_003800chr621838 189 --1673 12425
NM_003809chr171498 ------
NM_003816chr841069 971 542 322 ------
NM_003822chr143118 1064 835 204 43099 1950 1929 1231 ----
NM_003828chrX1519 ----1363
NM_003850chr133282 75 60 ------
NM_003872chr262971 2724 2702 2336 2013 557 11042 ----
NM_003873chr1062221 1009 767 598 582 545 ----1533
NM_003876chr171309 ------
NM_003884chr321749 94 11836 21665 1426 --
NM_003885chr1732186 683 586 --32679 2534 2042 --
NM_003902chr11701 1545 ----
NM_003909chr872377 1977 1866 710 596 379 314 1780 12431 --
NM_003913chr663560 2893 1490 1329 967 378 11192 23676 758 --
NM_003924chr4194 ------
NM_003927chr182840 383 ------
NM_003931chr63571 512 504 ------
NM_003941chr732157 1735 209 42418 900 709 108 ----
NM_003948chr432026 312 71 12158 --1790
NM_003958chr673923 3883 3732 3046 2443 1283 317 11573 23363 2750 --
NM_003968chr32704 245 ------
NM_003971chr17------1430
NM_003972chr1021285 975 21339 853 ----
NM_003983chr1673486 3342 1748 1070 848 670 639 34375 3758 1452 13122 --
NM_003994chr1264398 3270 2775 1697 691 186 14308 ----
NM_003998chr4--1604 ----
NM_004006chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004007chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004009chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004010chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004011chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004012chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004013chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004014chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004015chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004016chrX62575 2566 2448 2418 873 154 22555 124 ----
NM_004017chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004018chrX62575 2566 2448 2418 873 154 22555 124 ----
NM_004020chrX62661 2652 2534 2504 959 240 22641 210 ----
NM_004021chrX62575 2566 2448 2418 873 154 22555 124 ----
NM_004022chrX62575 2566 2448 2418 873 154 22555 124 ----
NM_004023chrX62575 2566 2448 2418 873 154 22555 124 ----
NM_004028chr1863196 3162 3061 2898 2585 185 11253 ----
NM_004056chr831043 1037 275 ------
NM_004061chr53448 438 188 ------
NM_004073chr11242 ------
NM_004075chr12123 ----1481
NM_004080chr721383 172 ------
NM_004081chrY21848 515 ------
NM_004087chr341847 1616 1294 89 ----11689
NM_004093chr1362778 1056 496 285 248 85 22757 2680 1978 --
NM_004094chr142925 86 23040 2084 ----
NM_004100chr642656 2171 605 512 22667 2198 ----
NM_004105chr2150 1110 ----
NM_004114chrX2956 828 --153 --
NM_004119chr131637 ------
NM_004124chr1473575 3342 2677 2527 2166 792 459 ------
NM_004133chr832616 2567 338 31982 1847 472 1114 --
NM_004136chr1562350 2014 1226 1062 375 56 23276 807 --13214
NM_004161chr21223 2601 546 1643 184
NM_004162chr321093 903 --1977 1891
NM_004170chr931850 1674 1564 ----1613
NM_004171chr11119001 8305 7900 7330 6838 6696 6100 3477 2621 2203 1000 29563 7668 1177 18126
NM_004202chrY1693 2650 29 ----
NM_004215chr8----1520 --
NM_004226chr2--199 ----
NM_004229chrX21795 816 1398 ----
NM_004241chr101322 ------
NM_004249chr4--129 ----
NM_004272chr53813 712 600 11367 11314 11711
NM_004274chr1412646 23227 752 ----
NM_004293chr973824 3818 3401 2779 1310 1077 1051 ------
NM_004319chr132815 2224 825 13161 ----
NM_004326chr111246 1426 --1416
NM_004330chr1551115 886 876 851 39 21075 168 21120 54 --
NM_004331chr83722 439 237 --152 --
NM_004338chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_004342chr752256 911 611 237 197 --1538 --
NM_004384chr541773 1478 595 50 11736 2700 530 --
NM_004385chr51166 ------
NM_004392chr1322629 1785 22636 2233 ----
NM_004396chr17153 ------
NM_004397chr1133583 3027 215 13960 11235 11173
NM_004411chr74591 505 128 102 1497 ----
NM_004430chr832733 2567 755 12619 11735 --
NM_004438chr222344 2174 1309 ----
NM_004440chr661597 1368 1302 637 362 52 --1626 --
NM_004457chr241716 518 507 439 21411 418 --11602
NM_004459chr1751831 1494 620 401 235 11819 ----
NM_004464chr494316 4305 4083 3959 3695 3494 592 509 116 ------
NM_004474chr11775 ------
NM_004480chr141309 ------
NM_004482chr21688 1977 ----
NM_004491chr1933995 3880 3770 ----14303
NM_004496chr142534 517 1184 ----
NM_004499chr5--1420 --1455
NM_004500chr1441843 1496 710 585 --1460 --
NM_004501chr142818 1356 1304 466 1861 ----
NM_004504chr221007 636 13064 1397 1285
NM_004505chr1732002 1939 1913 11830 12021 --
NM_004508chr101450 31121 948 245 1815 --
NM_004525chr211476 1252 --11076
NM_004529chr921263 34 ------
NM_004538chrX4810 791 704 643 --1744 --
NM_004540chr214753 280 192 177 ------
NM_004578chr11627 --1864 1276
NM_004582chr12108 90 1150 ----
NM_004583chr171575 ----1740
NM_004586chrX65121 4902 4749 3404 493 128 35209 4243 3318 1596 --
NM_004593chr33157 67 44 1276 ----
NM_004612chr943567 3508 588 312 34412 4228 3105 24004 466 24057 4000
NM_004615chrX2942 768 ------
NM_004654chrY181 ------
NM_004655chr171195 21370 1312 ----
NM_004660chrY21433 76 12285 1308 --
NM_004684chr4----1332 --
NM_004703chr1752534 2395 1995 1892 1845 21927 457 --11732
NM_004708chr19182 ------
NM_004709chrX11734 ----11127
NM_004713chr141737 1655 ----
NM_004714chr19--1235 ----
NM_004719chr1242817 2747 2558 1159 1611 12842 --
NM_004738chr205807 779 750 661 372 1285 ----
NM_004741chr1011149 --11517 --
NM_004742chr331664 1212 1188 21451 733 1248 --
NM_004744chr453776 3279 1183 543 154 1388 1334 --
NM_004745chr855560 2114 2065 1193 1129 22091 814 --12671
NM_004748chr1533346 2889 2829 22688 1121 ----
NM_004753chr11266 ------
NM_004772chr521500 43 ------
NM_004775chr182885 726 ------
NM_004781chr161532 1229 608 582 89 27 ------
NM_004781chr161532 1229 608 582 89 27 ------
NM_004787chr4--1100 ----
NM_004788chr1142282 2227 386 363 ------
NM_004798chr2033237 3076 2650 13682 43390 2633 964 164 --
NM_004800chr13----1199 --
NM_004808chr1072345 2291 2109 1047 565 366 200 ------
NM_004815chr174463 4295 3963 3232 1897 1856 1560 13872 23755 54 --
NM_004822chr17----13811 --
NM_004824chr611161 ----2316 174
NM_004834chr273395 3376 3077 2936 2092 1081 443 --1237 --
NM_004836chr2----1382 --
NM_004841chr11315 ------
NM_004849chr611326 ------
NM_004856chr151384 ------
NM_004859chr1752649 2377 849 793 39 --22414 396 1682
NM_004866chr564823 4638 4410 3934 1329 645 23356 58 ----
NM_004871chr1774275 3892 3747 3525 2832 2757 507 14338 21571 185 --
NM_004872chr11321 --1167 --
NM_004873chr1443168 2648 2077 29 --1984 12614
NM_004887chr521069 152 ------
NM_004904chr756467 6190 1812 1739 1176 --26269 452 --
NM_004922chr102876 283 ------
NM_004949chr1812067 1786 ----
NM_004956chr774409 1406 1116 1062 951 741 567 42901 1744 1393 492 ----
NM_004985chr1212857 34524 3471 2902 14465 --
NM_004992chrX67998 7717 7619 6363 2223 1945 12464 16961 17188
NM_004992chrX67998 7717 7619 6363 2223 1945 12464 16961 17188
NM_004999chr654487 3203 1234 1081 682 --22776 1073 --
NM_005010chr731745 1713 730 2438 112 --11620
NM_005036chr2298243 7154 5663 5601 5507 5209 3245 1270 387 18294 ----
NM_005037chr31143 ------
NM_005045chr71265 ------
NM_005056chr1285397 4704 1734 1489 1283 1238 999 381 24219 2235 22093 1779 --
NM_005065chr1445087 3717 1506 1336 24056 296 21102 377 14004
NM_005066chr12820 307 1229 ----
NM_005079chr843125 2579 2004 1287 32090 1225 1090 1703 --
NM_005086chr1211304 1174 ----
NM_005093chr2044019 3243 540 176 11912 11014 15310
NM_005116chr2074468 4159 3895 1718 1112 871 148 23285 1141 ----
NM_005121chr1722806 135 33090 2979 451 32508 856 650 --
NM_005126chr322104 1731 11643 ----
NM_005151chr1852278 619 498 383 199 1831 2865 639 --
NM_005156chr984567 3853 3733 3629 3536 3295 1118 1027 25002 1970 --14877
NM_005160chr2286521 6104 5839 5792 5459 1881 1401 968 26577 6562 15999 --
NM_005168chr211345 11631 ----
NM_005171chr1241312 1283 1271 1213 ------
NM_005180chr1021535 1411 11053 ----
NM_005188chr11127966 7373 6918 6688 3190 2280 1899 1419 733 719 500 424 22156 1464 22478 769 --
NM_005197chr1455622 5203 5192 2353 1676 16142 36190 2281 1062 --
NM_005222chr71918 1376 ----
NM_005233chr342437 2159 1831 664 ------
NM_005235chr257416 6647 5551 4781 4762 37190 5964 4754 --12150
NM_005238chr1143276 3052 2406 643 23553 3535 ----
NM_005239chr21--1527 ----
NM_005242chr521474 1309 ------
NM_005249chr141841 1738 ----
NM_005252chr142766 636 --1232 1531
NM_005254chr1511134 11301 ----
NM_005256chr111941 ------
NM_005257chr183952 939 566 11202 11146 --
NM_005259chr231253 971 389 21470 454 ----
NM_005264chr101902 1236 --1601
NM_005279chr21115 ------
NM_005295chr71103 ------
NM_005302chr7--2323 131 1401 --
NM_005311chr72386 183 2439 425 11066 --
NM_005316chr111977 1151 ----
NM_005328chr81254 --2505 68 --
NM_005339chr483853 3470 3200 3046 2745 2661 1671 687 43039 1731 1569 1069 13829 --
NM_005342chrX42756 1738 1021 287 1131 11765 --
NM_005347chr9--21119 30 11596 122
NM_005358chr1331578 1260 349 1426 ----
NM_005359chr18156205 6115 5430 5364 4514 4494 3999 2342 2110 1984 1239 1094 982 440 370 ----1537
NM_005375chr62871 854 ------
NM_005378chr22849 549 ----1570
NM_005385chr331844 976 487 --22567 2263 --
NM_005386chr202783 763 ------
NM_005398chr1041280 1150 572 65 11417 ----
NM_005399chr143984 3474 3445 845 --1262 --
NM_005400chr243032 2240 1052 819 --23073 2943 13047
NM_005406chr1861407 1285 1231 563 274 129 1629 ----
NM_005410chr51667 ------
NM_005426chr12662 219 1947 ----
NM_005429chr41283 ------
NM_005430chr121747 ------
NM_005433chr1852636 2141 894 792 356 12252 22181 886 12629
NM_005436chr1054116 2991 2704 1290 1230 21490 997 13628 13726
NM_005456chr11--1185 ----
NM_005458chr912097 12204 --11826
NM_005461chr2011779 21940 1243 ----
NM_005475chr122466 212 --13224 13237
NM_005476chr951403 1277 1090 953 100 ------
NM_005493chr62102 32 ------
NM_005497chr1775347 4959 4675 4050 1279 1045 112 1368 ----
NM_005502chr932710 2387 727 42929 2693 1305 123 ----
NM_005520chr5----1716 --
NM_005544chr221041 210 ----1929
NM_005569chr2251352 1316 1171 209 70 11393 ----
NM_005575chr52650 593 ------
NM_005578chr373445 1631 904 878 779 469 348 14856 ----
NM_005593chr12--1460 ----
NM_005596chr9106351 6237 4295 2161 2017 1980 1890 1366 1311 544 15437 25087 4605 --
NM_005604chr641870 1628 451 438 --1714 --
NM_005611chr1621115 224 11300 ----
NM_005618chr62607 580 ------
NM_005627chr6------2909 819
NM_005637chr1851994 1882 1494 743 48 11509 ----
NM_005639chr12--21533 262 ----
NM_005655chr82463 330 1849 ----
NM_005668chr574599 4572 3513 3329 3056 1435 920 13767 23334 1478 23540 3389
NM_005694chr3--1110 ----
NM_005721chr21694 ------
NM_005733chr51243 ------
NM_005737chr262937 1933 1114 909 678 323 22872 2364 21015 1008 --
NM_005739chr1542004 1488 737 132 ------
NM_005742chr2--1837 ----
NM_005744chr15--1166 ----
NM_005746chr742605 2305 741 254 2549 52 --1707
NM_005748chr122733 581 1660 ----
NM_005749chr171646 ------
NM_005751chr71483 --182 --
NM_005759chr264307 3312 3134 2921 1151 711 31345 1076 339 1888 13989
NM_005765chrX1175 ------
NM_005786chr1821008 843 11226 ----
NM_005795chr222529 2470 21039 830 11939 12695
NM_005802chr91315 ------
NM_005807chr11181 ------
NM_005808chr33870 554 478 13339 33545 3240 2556 13344
NM_005822chr651702 1580 1568 1547 614 ------
NM_005826chr13456 143 122 ------
NM_005828chr1753975 1344 1217 1042 605 --34897 3867 191 14821
NM_005832chr33389 237 45 11402 ----
NM_005840chrX97301 5347 5274 4667 2936 2768 2109 943 378 1785 37084 1741 701 --
NM_005841chr41246 11033 ----
NM_005842chr133605 234 125 2555 518 ----
NM_005868chr74905 263 179 100 ------
NM_005870chr13--2405 155 21304 240 11094
NM_005875chr31258 ------
NM_005884chr191650 ------
NM_005898chr1123072 902 3875 643 112 1879 --
NM_005901chr1876229 3098 2931 2784 2590 2561 1757 12240 32346 347 342 11900
NM_005902chr1574562 4360 3582 2995 2808 1499 1354 --23670 1341 --
NM_005903chr575217 5171 4624 3911 1108 76 29 1543 13227 13606
NM_005904chr18----11330 --
NM_005906chr62395 231 11485 --11405
NM_005909chr533822 3637 131 ------
NM_005911chr2--11107 ----
NM_005920chr151449 1359 1217 665 641 21398 1281 --23777 1428
NM_005935chr475238 4932 4326 4264 3331 976 701 --24587 598 --
NM_005941chr844173 3697 208 78 13286 11598 --
NM_005944chr311029 --11212 --
NM_005955chr174983 4464 3917 2106 1412 699 106 15466 23806 868 --
NM_005966chr242339 1752 1638 557 1281 11763 --
NM_005999chr1190 ------
NM_006007chr944423 3177 1422 1073 43426 1460 1037 678 ----
NM_006016chr641582 787 606 249 12240 --11799
NM_006036chr242371 2155 2143 1603 1648 ----
NM_006037chr262965 1754 1526 1107 904 805 33984 3892 3704 ----
NM_006039chr1711081 ------
NM_006070chr3180 ------
NM_006080chr752390 1112 766 726 367 12975 --11911
NM_006083chr51113 ------
NM_006089chrX31590 1240 248 11846 145 --
NM_006095chr424333 313 34300 3757 2776 --1183
NM_006100chr32107 52 2382 160 ----
NM_006106chr1182990 2724 2603 2429 1145 256 180 170 1846 12559 --
NM_006113chr11178 --11842 11831
NM_006135chr12311 143 1971 ----
NM_006136chr721230 1144 1932 ----
NM_006139chr222373 552 32785 2290 2076 11152 --
NM_006147chr1163 143 ----
NM_006159chr121215 1496 ----
NM_006166chr1252440 1962 1051 609 294 21694 505 11013 --
NM_006178chr1741595 1583 1009 566 --11436 --
NM_006180chr941577 565 556 186 1502 ----
NM_006190chr221032 703 ------
NM_006195chr9--1107 --21281 1228
NM_006203chr564716 3956 1280 1234 1139 613 --11759 14528
NM_006206chr462284 1025 903 671 528 474 1645 ----
NM_006209chr82360 55 ----1321
NM_006211chr8182 ------
NM_006226chr23967 422 116 1410 ----
NM_006243chr11215 1187 --1166
NM_006246chr14--11173 183 --
NM_006251chr522452 2433 1996 13157 12784
NM_006252chr1107017 4615 2811 2139 1825 1116 1005 409 356 200 ------
NM_006256chr152619 959 768 696 421 32181 905 490 --12720
NM_006265chr841501 1292 978 959 1946 ----
NM_006267chr21762 ------
NM_006281chr84999 817 309 181 1385 ----
NM_006281chr84999 817 309 181 1385 ----
NM_006282chr2054561 4101 3520 3297 3178 11581 1477 --
NM_006284chr11173 ------
NM_006300chr1951912 550 479 395 169 ------
NM_006306chrX44893 1615 1105 223 23925 1734 24444 2178 --
NM_006310chr1721299 312 ------
NM_006313chr121275 ----21417 1251
NM_006317chr51169 ------
NM_006330chr851619 547 540 392 287 31369 1093 1072 --11625
NM_006352chr132031 1550 690 31607 704 697 ----
NM_006353chr621326 44 ------
NM_006366chr651344 1140 1061 502 467 ------
NM_006375chrX51596 1564 1305 1225 308 ----1212
NM_006379chr732078 1501 805 ----12163
NM_006380chr1744381 1723 1349 56 31368 1066 428 ----
NM_006393chr1044217 2979 1501 231 13749 ----
NM_006401chr9140 ------
NM_006416chr62239 212 ------
NM_006434chr1053125 2190 610 199 170 13248 ----
NM_006463chr21569 ----153
NM_006464chr254026 3053 1497 1205 53 --21335 147 --
NM_006482chr1233905 3778 3707 43843 3516 1544 247 ----
NM_006483chr19--1235 ----
NM_006484chr19--1235 ----
NM_006489chr1431688 1381 366 1288 --168
NM_006496chr141969 1234 290 64 11898 11341 --
NM_006517chrX21519 364 1550 ----
NM_006526chr2061743 633 613 585 502 448 ----1127
NM_006534chr2073154 2595 2555 920 843 423 212 1992 ----
NM_006538chr274068 3483 3347 2831 2639 1313 989 54149 3964 2863 2845 2800 ----
NM_006540chr831310 1194 969 ------
NM_006544chr1455594 5581 4844 3791 303 46104 5364 5331 3742 24781 1431 --
NM_006546chr1766661 2409 1619 1496 832 547 --12199 --
NM_006561chr1095910 5869 4686 3897 3802 2158 1482 1275 741 1769 35780 3976 1361 --
NM_006565chr1641113 239 230 181 11273 11180 --
NM_006572chr1763099 2953 2816 1355 969 694 2926 202 ----
NM_006577chr221213 989 ------
NM_006597chr11------1193
NM_006599chr16107342 7284 6498 3276 2917 2887 2416 2407 2275 2006 15849 21057 994 --
NM_006603chrX41827 1629 1612 1359 2804 534 11841 --
NM_006614chr362980 2572 1182 1098 1010 209 ----13600
NM_006621chr111983 ------
NM_006628chr1584534 3698 3254 2975 1202 267 141 134 21762 376 ----
NM_006644chr131589 ------
NM_006654chr1284630 4566 4025 3322 1350 1290 1013 605 44549 3997 3769 3758 ----
NM_006660chr151306 ------
NM_006696chr5----1243 --
NM_006704chr13158 --128 --
NM_006713chr51834 2641 98 2287 32 --
NM_006717chr932925 2762 1243 12559 12563 --
NM_006718chr61241 --2895 164 --
NM_006722chr342965 912 486 472 --1699 22941 215
NM_006729chrX45500 5200 1437 533 34679 4384 1395 15573 --
NM_006750chr1675123 5022 4957 4895 2653 2211 501 28106 6658 --27290 5696
NM_006754chr741205 952 786 337 1386 11071 --
NM_006759chr21232 1100 ----
NM_006769chr11657 1521 ----
NM_006775chr673037 2241 2219 1130 950 530 382 1866 1445 --
NM_006777chrX32395 2377 2122 --12747 12847
NM_006813chr62346 198 1174 ----
NM_006823chr851287 1268 571 477 110 11004 --1502
NM_006832chr141964 --11035 --
NM_006836chr121445 ------
NM_006885chr161554 14068 ----
NM_006888chr1463242 3192 2975 1232 806 175 33109 2941 2883 ----
NM_006912chr122489 71 --1155 142
NM_006913chr6148 ------
NM_006914chr91975 1304 1461 --
NM_006922chr252056 1919 851 814 208 11911 ----
NM_006924chr1794006 3889 3695 3228 945 788 528 505 252 14121 ----
NM_006936chr2181099 1012 994 885 477 437 240 43 21306 1226 ----
NM_006937chr17--1156 ----
NM_007006chr1653550 3387 3336 2594 137 13145 22556 708 --
NM_007007chr12104825 4624 3165 2987 1788 1540 1496 1180 950 535 23903 3890 ----
NM_007008chr21900 ----1202
NM_007010chr1751831 1709 748 497 22 --1771 --
NM_007013chr81182 ------
NM_007023chr22962 83 1820 ----
NM_007030chr585184 5115 5069 4942 3934 3491 560 353 24409 4109 ----
NM_007038chr2185929 4756 4657 3682 1758 1598 560 383 46008 5760 5382 1266 13914 --
NM_007050chr2057181 6921 5492 353 42 35105 2866 1319 27889 1512 --
NM_007054chr543038 2903 2482 744 43845 3796 1138 329 1240 13956
NM_007106chr131804 ------
NM_007107chr342287 2271 2139 1807 12388 --1254
NM_007114chr322574 1130 33120 2088 111 11206 22093 328
NM_007115chr22490 459 ------
NM_007146chr1732775 1116 463 1357 ----
NM_007159chr321616 1507 1203 ----
NM_007166chr1121431 85 2584 379 ----
NM_007175chr863153 999 714 577 303 112 1904 12823 --
NM_007192chr141262 ------
NM_007203chr953861 3678 3316 2944 2844 --13437 --
NM_007214chr621276 53 11070 --11032
NM_007217chr3143 ------
NM_007218chr81143 2222 157 1687 --
NM_007222chr831453 678 60 1363 ----
NM_007249chr1389230 8044 7307 6781 2259 2044 1688 1152 29114 5947 38169 7210 260 19082
NM_007257chr852813 2517 1921 483 416 22605 2315 11134 --
NM_007275chr31163 --11099 --
NM_007276chr721086 919 11099 ----
NM_007282chr32879 832 154 --1205
NM_007345chr1821981 1791 1237 --11596
NM_007350chr1284433 4253 4041 3364 3209 1181 870 69 1779 --1284
NM_007353chr742647 2538 2205 138 12775 --12912
NM_007358chr121928 173 --1749 --
NM_007372chr171674 1316 ----
NM_007373chr1011790 11731 21364 477 31720 1126 412
NM_007375chr142674 1103 617 239 21113 75 --1593
NM_012062chr122996 93 ----1915
NM_012073chr521340 85 1269 1484 --
NM_012081chr573631 3452 2958 1374 1199 724 249 21355 864 21359 1346 --
NM_012082chr82708 295 1285 --1760
NM_012089chr141304 1129 325 306 --11118 --
NM_012096chr363643 3180 2673 1247 1026 614 11098 1566 --
NM_012110chr41224 ------
NM_012115chr6--1421 ----
NM_012120chr632490 571 217 22642 881 --12858
NM_012141chr1364068 3306 3267 1228 1178 1017 23854 451 ----
NM_012156chr2073319 2742 2288 1321 1146 985 699 --1116 13393
NM_012177chr6----180 --
NM_012193chr1194546 4187 3407 2140 2007 779 722 542 326 13727 --25383 637
NM_012214chr264130 1751 1046 936 756 290 55081 1099 1003 835 112 11788 26201 5945
NM_012229chr1011338 ----1439
NM_012234chr393312 2616 1445 1288 895 694 611 385 291 ------
NM_012238chr1011458 21641 662 ----
NM_012243chr11121 2939 893 ----
NM_012245chr141408 ------
NM_012247chr102247 234 ------
NM_012250chr1121310 376 ------
NM_012255chr201393 ------
NM_012262chr1105212 5199 5160 4095 4067 3781 1186 1089 1061 113 63821 3434 1793 1318 959 532 13750 --
NM_012281chr73890 731 455 ----12298
NM_012286chrX1578 ------
NM_012287chr373510 3287 1497 1265 1022 929 603 ------
NM_012290chr211392 21478 1360 ----
NM_012297chr462391 2067 1804 961 600 349 22521 859 12326 --
NM_012301chr7--12197 --11865
NM_012311chr102421 80 1134 ----
NM_012316chr145555 2061 1249 1051 13432 ----
NM_012328chr711070 ------
NM_012329chr1741585 1305 1066 134 ----11687
NM_012330chr10--1423 --1496
NM_012334chr564681 4489 3446 1722 923 516 34551 851 784 ----
NM_012399chr2221399 1251 ----1319
NM_012416chr931254 1181 481 11097 11190 --
NM_012421chr11155 1416 ----
NM_012454chr62481 169 ----1541
NM_012464chr462586 2094 936 922 894 760 12739 12843 --
NM_012479chr762232 2182 1002 706 205 199 12288 ----
NM_013229chr1272155 1965 833 494 365 349 112 12675 1265 --
NM_013230chrY31735 1668 560 21711 477 1494 --
NM_013231chr1464240 3466 2818 1739 805 345 ----1262
NM_013233chr221466 1408 ------
NM_013255chr798248 7711 7591 6842 2843 2241 1025 569 407 13052 22274 1219 17646
NM_013257chr8--32345 2227 2199 ----
NM_013261chr433610 2900 2373 11243 13698 --
NM_013281chr2021139 348 ----2255 122
NM_013282chr19--11036 1219 --
NM_013313chr22133 13123 22797 2202 1904
NM_013316chr72961 301 ------
NM_013322chr7--11277 ----
NM_013330chr12209 85 ------
NM_013341chr262812 2370 752 467 449 156 ------
NM_013374chr382375 2137 2122 953 793 580 521 194 23094 925 ----
NM_013381chr123604 478 362 1276 ----
NM_013396chr2141348 1116 1092 985 21434 461 ----
NM_013410chr141045 837 318 61 --168 --
NM_013438chr931730 405 397 2439 232 1104 --
NM_013448chr145626 546 496 229 217 173 --1487
NM_013943chr122210 503 33302 1187 490 ----
NM_013989chr1485096 3504 3421 1907 1064 395 372 27 ------
NM_013996chr72389 147 ----1163
NM_013996chr72389 147 ----1163
NM_013997chr72389 147 ----1163
NM_013997chr72389 147 ----1163
NM_013998chr72389 147 ----1163
NM_013998chr72389 147 ----1163
NM_014010chr91618 ------
NM_014011chr231665 910 145 11699 1587 --
NM_014016chr31397 11514 --11702
NM_014021chr132840 2615 1326 33007 392 325 1972 --
NM_014028chr683188 3151 2604 2438 2042 1048 985 455 13144 12388 --
NM_014034chr611415 ------
NM_014043chr321664 623 ------
NM_014048chr1675117 4786 3548 3280 1406 1190 692 35200 4529 3837 24384 3248 25257 5180
NM_014059chr13--1248 ----
NM_014089chr1332268 2092 2036 ------
NM_014106chr1552902 2886 2632 831 264 22265 242 12740 12290
NM_014112chr854435 4069 1359 387 271 1995 34397 4239 1288 14021
NM_014117chr163406 379 227 ------
NM_014153chr162629 104 --2674 665 --
NM_014154chr341214 396 348 142 1342 ----
NM_014155chr1197354 5839 2851 2502 2393 1115 1017 853 216 37315 7217 691 --17291
NM_014181chr242867 2091 1164 789 1730 ----
NM_014203chr191329 ------
NM_014243chr442132 2121 583 141 2485 451 ----
NM_014253chrX4767 582 342 163 167 1590 --
NM_014267chr112360 43 ------
NM_014278chr41355 1455 ----
NM_014283chr121194 1013 --11279 --
NM_014294chr821202 336 1121 ----
NM_014296chr311003 ------
NM_014309chr2274969 4276 4174 3880 2064 680 413 15214 ----
NM_014317chr10----1261 --
NM_014319chr1221487 1217 21820 1391 ----
NM_014333chr1152752 1792 703 188 145 1720 12506 --
NM_014351chr2211219 1318 --21421 1247
NM_014372chr11320 ------
NM_014382chr311437 2480 366 ----
NM_014393chr882397 2286 2269 1888 1860 940 881 456 12368 11810 --
NM_014399chr71740 1235 2945 375 1876
NM_014423chr595581 5452 5274 4841 4749 4344 4041 909 565 14076 15156 --
NM_014445chr33887 719 621 ----12041
NM_014447chr4----21223 245 --
NM_014456chr103654 433 422 --11173 --
NM_014458chr111357 ------
NM_014488chr111472 ------
NM_014494chr161523 --12353 --
NM_014500chrX1275 ------
NM_014548chr151462 ----11507
NM_014554chr1271982 1942 1835 1579 1473 792 99 11857 1208 --
NM_014574chr1451537 1243 640 372 235 1187 ----
NM_014577chr222239 64 1571 ----
NM_014584chr1431220 192 138 21604 1079 ----
NM_014606chr4197 ------
NM_014612chr941471 1098 1085 421 21418 1074 ----
NM_014613chr533008 1099 750 ----13090
NM_014615chr1643523 1423 978 843 13621 1786 13571
NM_014616chr312696 33460 3359 1290 23244 1353 1638
NM_014620chr122714 541 1745 ----
NM_014630chr1593844 2577 1533 1024 796 740 461 307 149 12998 ----
NM_014633chr111392 1462 ----
NM_014660chr72806 125 ------
NM_014677chr8--11302 ----
NM_014682chr842265 1613 102 77 12189 11822 12323
NM_014683chr1741724 1335 847 622 ------
NM_014701chr1563096 3081 2665 1134 1025 664 1549 ----
NM_014707chr752247 1572 862 767 541 12189 ----
NM_014711chr1611611 --1633 --
NM_014712chr16--1636 ----
NM_014717chr191865 --1676 1785
NM_014721chr697029 6959 5574 2403 1332 1238 1059 1008 940 66915 6130 5078 4840 4627 2677 11305 16850
NM_014727chr19--1222 ----
NM_014729chr872018 1525 888 875 709 271 262 ------
NM_014730chr1245000 4481 3832 1849 ----11950
NM_014730chr1245000 4481 3832 1849 ----11950
NM_014733chr52704 273 ------
NM_014735chrX31899 508 494 ------
NM_014739chr673663 2670 1607 1380 1001 188 107 --24182 1527 --
NM_014743chr431967 583 26 --12318 --
NM_014746chr253567 3553 3376 2888 705 42752 1377 853 649 34338 682 260 --
NM_014751chr822076 2053 11999 ----
NM_014752chr111599 --11736 --
NM_014755chr253746 3097 1024 606 585 --1896 --
NM_014757chr522273 387 --12259 --
NM_014774chr122855 477 1104 13085 --
NM_014779chr321027 730 11102 ----
NM_014781chr81967 1845 --1850
NM_014787chr121821 1782 42670 2166 826 524 ----
NM_014795chr231129 415 71 11023 2178 48 --
NM_014810chr143504 968 961 908 1550 23473 3356 13469
NM_014822chr41548 ------
NM_014827chr111276 31207 646 66 1372 --
NM_014828chr1431810 840 821 21567 185 ----
NM_014829chr5258 31 12037 --180
NM_014839chr162533 2520 2355 978 773 458 --12428 --
NM_014841chr641274 1101 1093 904 21062 1053 --1237
NM_014872chr92576 158 12142 2742 727 1526
NM_014873chr1114429 4246 3660 3578 2968 1788 1703 1625 1619 1465 602 24638 4184 ----
NM_014877chr1747141 6608 6578 2426 --26556 251 17086
NM_014897chr1722789 2724 13170 13049 12853
NM_014900chr22780 290 ------
NM_014904chr1073483 2924 645 270 264 123 22 ------
NM_014906chr1743421 3353 3119 185 13770 11061 --
NM_014910chr19----1656 --
NM_014912chr10103418 3144 3084 2960 2872 2570 1179 333 218 29 --12969 --
NM_014913chr1851491 1125 189 141 116 ------
NM_014918chr1521326 1119 21579 335 ----
NM_014920chr663472 2891 2518 1328 588 398 23389 3299 23457 3196 13453
NM_014923chr133441 149 68 32213 2017 1661 --21573 1543
NM_014942chr632086 1755 426 22550 89 ----
NM_014946chr253121 2244 882 437 318 22374 1251 ----
NM_014947chr142964 2871 1176 430 12907 11917 13073
NM_014961chr442206 2153 1855 182 11599 ----
NM_014962chr2042369 2020 925 738 12843 --12848
NM_014969chr11202 21026 472 ----
NM_014978chr1021785 1770 31808 1447 533 ----
NM_014982chr1465403 4203 3847 3654 1875 699 25335 1595 ----
NM_014988chr442468 2124 1779 180 1556 ----
NM_014990chr1431080 526 359 ------
NM_015000chr1262701 2017 1210 1061 408 238 22958 1157 22715 316 1754
NM_015008chr353416 2596 955 842 440 43656 3326 2631 1000 ----
NM_015011chr1321138 923 1386 ----
NM_015015chr192368 72 11808 ----
NM_015018chr61185 ------
NM_015020chr1643898 3120 2535 553 13113 23233 372 13798
NM_015025chr282640 2539 2469 2439 2283 1937 1045 518 2703 62 ----
NM_015026chr1253671 3327 1441 1184 560 44415 3579 2981 821 --1441
NM_015027chr1671990 1980 597 430 210 100 29 --137 --
NM_015032chr1351104 881 778 676 439 22172 828 11121 12528
NM_015033chr963303 3205 2740 2618 1220 992 1490 ----
NM_015035chr20116513 6244 5754 5072 5039 4407 2533 2409 1198 1177 830 1661 ----
NM_015040chr243173 2445 999 533 12425 --43403 3312 2835 2213
NM_015046chr962648 2584 2480 1869 814 521 141 1109 --
NM_015049chr263235 2719 2440 2390 2215 2068 11072 --12871
NM_015051chr9--12704 1482 12307
NM_015053chr1----1229 12247
NM_015062chr101191 ------
NM_015069chr162478 211 ------
NM_015071chr5136291 6016 5670 5611 5046 4979 4760 4530 4376 2276 2146 1894 196 36324 6197 1653 26206 1173 --
NM_015074chr164329 3585 3357 402 337 197 14905 13723 --
NM_015076chr683655 3598 3172 3000 1803 1596 1181 524 31668 1530 326 --1940
NM_015092chr1684335 3591 3327 3021 2941 1402 763 499 ------
NM_015097chr372279 1965 1589 1552 1447 641 105 ------
NM_015100chr12413 390 ----11282
NM_015110chr932467 2162 1598 ------
NM_015115chr473151 3041 2583 469 264 164 70 ----1333
NM_015124chr2221967 140 ----22488 2412
NM_015132chr741613 1466 472 83 ------
NM_015137chr872411 2252 2219 2056 1966 790 651 12311 ----
NM_015144chr1674009 3706 3560 3360 2593 1109 83 ------
NM_015156chr1493840 3412 2824 2718 2642 1194 1122 233 38 13777 ----
NM_015172chr131502 1313 493 1170 11471 11077
NM_015176chr161653 1637 718 542 505 74 ------
NM_015180chr142921 586 ------
NM_015185chrX22697 712 --2726 432 --
NM_015187chr42926 56 ------
NM_015192chr2012812 22293 597 22517 741 --
NM_015199chr322468 1120 31894 626 325 22648 2616 --
NM_015200chr432483 1639 752 ------
NM_015203chr1167 ------
NM_015206chr1523462 1214 33506 3499 2783 13276 --
NM_015208chr1883279 3016 1317 865 771 534 500 58 --126 --
NM_015215chr132872 952 440 33187 2152 1181 22898 1167 --
NM_015216chr52579 315 11269 ----
NM_015230chr41347 2499 44 --2336 331
NM_015231chr111750 ------
NM_015247chr1675367 4973 3983 3917 1836 727 482 13874 35058 3536 1145 --
NM_015250chr911731 1687 --11792
NM_015252chr23829 810 279 ------
NM_015263chr1521212 89 1912 --1218
NM_015265chr2--22582 868 ----
NM_015271chr463606 3530 3111 2777 2656 1206 22621 400 --11537
NM_015272chr1642142 1949 1919 457 ------
NM_015275chr12--11982 11575 --
NM_015278chr673369 3261 2927 2554 950 926 317 1454 23345 2171 23102 2190
NM_015285chr1852583 2538 1603 489 397 11875 11750 --
NM_015286chr1542414 2351 2183 1879 ------
NM_015308chr113756 75 34 ------
NM_015310chr8128240 8058 7945 7627 6109 5901 5167 2513 2455 656 509 26 21629 134 --15355
NM_015313chr1164423 4126 3791 3483 1100 585 24507 4300 ----
NM_015314chr742437 927 576 382 1671 22604 2470 --
NM_015323chr631715 1638 655 11705 --1148
NM_015326chr131905 969 574 12902 ----
NM_015336chr124523 493 415 335 ------
NM_015338chr2021956 1769 ------
NM_015344chr831967 765 22 1143 12079 --
NM_015349chr653031 3002 2274 585 519 ----11969
NM_015358chr2121165 156 21178 123 ----
NM_015359chr862828 2401 1877 1865 617 324 1164 ----
NM_015365chrX54291 1659 953 711 289 34272 2887 92 ----
NM_015375chr164885 4548 4063 3589 3268 501 ----35030 3084 3079
NM_015378chr142040 448 254 226 ------
NM_015385chr1053125 2190 610 199 170 13248 ----
NM_015387chr242091 1558 580 25 ----21934 52
NM_015423chr111450 --31705 1330 417 --
NM_015429chr31765 --1997 --
NM_015446chr12586 393 1104 ----
NM_015455chr563806 3642 3477 2860 1186 1023 ----1524
NM_015458chr835106 5015 935 21626 150 15231 14994
NM_015460chr342116 1839 1732 1554 1310 11784 183
NM_015461chr181706 ----1115
NM_015462chr171273 ------
NM_015497chr1531019 771 717 --1855 --
NM_015509chr1261185 1074 1036 593 571 548 11643 ----
NM_015520chr312588 --22096 877 12160
NM_015532chr155855 241 235 197 87 12086 ----
NM_015554chr1532369 1971 1870 22539 37 --1432
NM_015565chr2121635 1423 11410 ----
NM_015567chr1321273 1156 11098 ----
NM_015569chr144823 1591 1166 225 --14145 --
NM_015570chr721735 578 ----11703
NM_015571chr632358 2221 1721 ----1985
NM_015578chr1972055 1555 740 716 571 522 383 --11565 --
NM_015601chr1031013 877 719 1188 ----
NM_015602chr121458 1431 11579 ----
NM_015640chr194804 3318 1956 1660 1174 812 504 281 219 13736 14681 --
NM_015678chr1361363 1253 1163 515 263 50 11657 ----
NM_015687chr63480 440 111 ------
NM_015691chrX21089 276 1538 12927 1340
NM_015711chr191781 --1249 2773 751
NM_015723chr72278 242 1487 ----
NM_015866chr141235 1224 941 46 21529 1088 ----
NM_015869chr31143 ------
NM_015872chr131346 224 170 ----1248
NM_015878chr81568 12092 --11988
NM_015879chr18128610 8500 8259 8166 7884 7528 5665 3449 3209 3195 2208 1123 13152 --23163 1603
NM_015886chr865386 4612 3902 3833 1228 910 25562 231 25747 5663 11305
NM_015888chr133132 2812 2448 12221 11127 --
NM_015906chr163824 3336 1826 1553 1091 555 24071 3290 14590 --
NM_015912chr842210 2133 1020 984 12278 11877 11821
NM_015913chr12739 669 1770 ----
NM_015932chr132508 89 1715 --160
NM_015990chr411086 ------
NM_016009chr1124901 4826 4781 4384 4357 4152 1946 1778 1135 1113 1022 345 1785 1789 23186 1259
NM_016018chr832485 1130 754 --11886 --
NM_016019chr74915 870 329 56 1776 ----
NM_016021chr642657 2590 645 491 ------
NM_016040chr142789 2514 2269 313 12004 12781 12009
NM_016045chr201277 2687 401 --21199 610
NM_016072chr1232170 1674 36 12407 ----
NM_016073chr1541097 934 891 882 11035 11064 --
NM_016075chr1342471 2218 741 639 ----11170
NM_016076chr143043 2500 2028 786 12897 13122 --
NM_016078chr17--2951 873 ----
NM_016081chr452196 1840 1501 451 425 22141 2033 1558 --
NM_016083chr673938 3777 3642 3178 1065 938 72 33687 3369 3008 23691 956 --
NM_016090chr113991 805 323 --11074 --
NM_016096chr851909 762 273 140 45 22055 1353 --12170
NM_016100chr201365 ------
NM_016101chr1631353 308 227 1131 ----
NM_016106chr141163 ------
NM_016120chrX1906 --1478 --
NM_016122chr12194 1146 --1151
NM_016125chr17------1563
NM_016132chr1573422 3274 2115 924 901 759 234 53081 443 327 158 81 ----
NM_016133chr241666 1118 473 345 ------
NM_016195chr102707 119 ----168
NM_016201chr352286 1595 728 595 451 --11667 --
NM_016203chr72910 848 1237 1927 --
NM_016205chr441436 1232 901 562 11336 21205 1200 --
NM_016220chr721826 209 12046 ----
NM_016227chr121194 1013 --11279 --
NM_016231chr1711479 11366 1601 193
NM_016247chr31433 ------
NM_016248chr1342563 1000 771 327 23488 2545 13814 12569
NM_016255chr662725 2468 1308 1211 738 142 22091 868 ----
NM_016258chr11138 1710 ----
NM_016260chr287384 7077 6144 5943 5189 2450 214 124 26802 5001 17509 15006
NM_016270chr19--3397 389 366 1341 --
NM_016271chr1832341 2312 2244 31434 820 351 ----
NM_016272chr2252774 2252 2090 952 846 ------
NM_016275chr352264 1066 654 178 84 21017 224 ----
NM_016277chr65633 554 416 346 328 ------
NM_016279chr51364 --140 --
NM_016281chr122257 209 1843 ----
NM_016287chr121868 657 --11742 --
NM_016300chr3--1464 --1469
NM_016315chr21489 31629 235 194 ----
NM_016322chr973148 2351 1995 1170 862 843 433 43185 2451 2029 1058 ----
NM_016351chr72428 250 ------
NM_016374chr131245 1169 1086 31578 1229 343 ----
NM_016374chr131245 1169 1086 31578 1229 343 ----
NM_016395chr1551920 1796 1357 337 157 1169 ----
NM_016410chr92492 419 1525 ----
NM_016422chr1163074 2899 2523 319 200 31 32637 635 599 13105 --
NM_016424chr1721547 78 --146 --
NM_016436chr2072344 2117 1910 888 588 493 477 ------
NM_016441chr231586 881 99 --11807 12238
NM_016467chr231333 564 558 --1144 --
NM_016470chr202498 471 1399 ----
NM_016485chr62896 300 21431 792 22207 918 --
NM_016505chr12670 602 ------
NM_016507chr1742687 1189 1124 350 12671 ----
NM_016513chr663472 2891 2518 1328 588 398 23389 3299 23457 3196 13453
NM_016530chr1534056 2813 1343 13941 --12692
NM_016531chr463886 3334 3194 3045 2624 1351 13086 1689 13707
NM_016542chrX31686 1516 526 11454 ----
NM_016545chr11893 ------
NM_016559chr341237 623 597 50 1531 ----
NM_016570chr12170 ------
NM_016584chr12--1256 ----
NM_016587chr721086 919 11099 ----
NM_016607chrX21520 1363 1120 ----
NM_016651chr1421142 142 --1968 --
NM_016654chr1511134 11301 ----
NM_016655chr15----144 --
NM_016733chr2251352 1316 1171 209 70 11393 ----
NM_016936chr1621700 841 ------
NM_016950chr451498 1341 1167 1130 1081 1970 ----
NM_016953chr255954 5691 1854 1812 1532 15293 14498 14790
NM_017415chr583768 3315 3062 1771 1678 583 108 44 11761 23972 1483 --
NM_017420chr1473604 3044 2989 2622 1172 762 744 ----23764 3561
NM_017423chr43661 187 87 22240 2016 ----
NM_017426chr41148 1270 ----
NM_017435chr123731 697 315 ------
NM_017447chr2154369 4279 3941 3337 264 --1910 --
NM_017577chr331337 1227 1143 1601 --1496
NM_017580chr1052194 1932 1630 867 663 ------
NM_017593chr41351 ------
NM_017599chr123817 512 230 41619 1296 639 385 ----
NM_017610chr1571530 768 699 467 258 117 54 2508 235 ----
NM_017615chr10--169 ----
NM_017628chr464281 1019 953 805 727 560 1665 --1902
NM_017632chr4197 ------
NM_017633chr673387 3328 3208 2593 1275 1140 508 1326 23298 3002 --
NM_017634chr8------11594
NM_017635chr1121611 101 1128 1525 --
NM_017637chr999314 9074 8077 7655 6436 3281 2152 750 569 39220 6335 2134 48015 5760 3634 2620 --
NM_017641chr1231112 249 35 ------
NM_017644chr3114421 4382 4238 3914 3546 3420 1454 1154 837 605 582 11514 ----
NM_017645chr933175 2973 442 ------
NM_017650chr746062 4858 1881 812 24975 2042 11723 --
NM_017657chr2--1732 ----
NM_017658chr14124227 4017 3400 3260 3254 1652 805 667 434 414 404 45 11387 24363 3779 --
NM_017664chr131280 1955 ----
NM_017666chrX31662 1571 408 --12224 --
NM_017672chr1541378 1069 961 54 ------
NM_017676chr521890 570 ----11372
NM_017694chr221956 1808 1819 --31763 1603 1598
NM_017709chr173428 3411 3325 1421 1180 926 442 1648 ----
NM_017719chr312274 ------
NM_017737chr151955 1761 1470 843 275 1704 ----
NM_017742chr1831915 1403 299 11837 --11842
NM_017752chrX21698 828 11763 ----
NM_017762chr1592481 2227 2199 2150 1984 1969 1835 916 824 1847 ----
NM_017779chr122740 1762 ------
NM_017780chr82347 57 --2843 182 --
NM_017813chr854963 4422 4299 2294 1787 35754 4644 870 24213 203 --
NM_017830chr41183 ------
NM_017831chr1884763 4557 4529 4254 4177 3018 1124 136 23308 870 ----
NM_017848chrX53889 690 661 597 132 ------
NM_017905chr13--1540 ----
NM_017919chr975704 4371 2203 2012 1759 1674 59 13702 23811 736 13869
NM_017925chr931752 1378 1269 11690 ----
NM_017938chrX22081 33 11995 1676 1570
NM_017944chr1112110 13013 12821 1212
NM_017953chr131165 1016 846 --188 --
NM_017987chr1051797 1717 737 721 572 ------
NM_017998chr971366 1331 1127 1042 506 382 274 ------
NM_018011chr131492 --2570 467 --
NM_018024chr81478 --2525 455 --
NM_018036chr1434323 1015 95 14397 21563 1073 --
NM_018046chr531778 1512 689 1549 --1604
NM_018061chr141221 473 385 235 1523 ----
NM_018063chr10161 ------
NM_018071chr141150 ------
NM_018084chr222119 833 22742 468 22704 265 --
NM_018092chr1631262 548 67 41341 1291 1176 134 ----
NM_018101chr121265 79 ------
NM_018112chr92975 60 1908 ----
NM_018120chr81425 --11007 --
NM_018149chr172167 85 1181 ----
NM_018156chr142040 448 254 226 ------
NM_018157chr1253261 3028 2864 1024 933 13224 ----
NM_018159chrX21462 1404 --31487 647 26 --
NM_018176chr4--21563 1547 11556 11552
NM_018181chr1831733 1713 1406 11370 2306 96 --
NM_018182chr1731594 1433 671 22193 1813 11991 --
NM_018184chr332039 1680 53 ------
NM_018243chr433940 3815 3529 ----13208
NM_018254chr162128 1971 1875 1639 1542 659 1309 --22038 2020
NM_018266chr321111 447 ------
NM_018272chr12------124
NM_018293chr352694 2455 2002 504 172 ----22973 2756
NM_018299chr833377 3033 621 --23448 308 --
NM_018307chr173985 766 167 --2992 330 --
NM_018312chr11--2354 230 2594 234 --
NM_018320chr111248 ------
NM_018323chr431672 1591 77 1213 ----
NM_018325chr941510 1045 664 303 21575 417 21579 1098 11458
NM_018326chr72808 206 ------
NM_018328chr2171 2421 370 1379 --
NM_018330chr1011070 21705 459 1694 21431 1426
NM_018339chr931693 1186 59 1704 ----
NM_018360chrX123 ------
NM_018362chr1153914 3432 3047 1538 231 --13067 --
NM_018364chr131498 774 368 ------
NM_018374chr775128 5044 4768 4739 4605 3639 1235 1731 ----
NM_018375chr14--11512 ----
NM_018388chrX11087 2521 508 2487 477 --
NM_018416chr1232377 2370 266 ------
NM_018433chr2--2492 450 ----
NM_018439chr1862643 2607 2427 1930 576 74 --1390 --
NM_018440chr868408 5676 5630 5397 1822 369 26779 2272 1820 --
NM_018444chr82803 339 12075 22046 376 --
NM_018448chr1221159 982 21192 1114 ----
NM_018452chr6_random63809 2855 2432 2363 375 175 11234 11238 --
NM_018466chrX1677 ------
NM_018469chr1731101 104 29 --11311 176
NM_018471chr2----1475 --
NM_018472chrX1132 ------
NM_018482chr872388 2172 1830 963 649 263 90 ----12557
NM_018555chr1961846 1610 1583 585 568 539 1744 12087 --
NM_018638chr1285424 5263 5025 4824 4809 3591 936 879 64613 4438 4102 2093 1737 1278 --14956
NM_018641chr72557 139 ----1129
NM_018650chr12230 67 21825 1451 11546 11542
NM_018667chr1622833 2627 ----12669
NM_018686chr121130 ----1240
NM_018695chr522401 526 42449 1933 1777 800 --21909 1782
NM_018717chr452349 2289 2177 2111 667 ----12386
NM_018723chr16164 ------
NM_018834chr5--1104 ----
NM_018837chr202794 99 --1873 --
NM_018841chr133916 3803 248 23651 611 13376 --
NM_018948chr141446 1402 912 158 --1437 --
NM_018951chr761241 1036 298 261 195 92 11231 2475 470 --
NM_018970chr732099 1184 445 ----1485
NM_018976chr1252385 2276 2040 1045 951 --12812 --
NM_018979chr1242315 1755 533 99 1859 ----
NM_018993chr2011423 31485 1324 958 11328 --
NM_018999chr1074083 3902 3564 3122 1323 1085 809 1175 14833 --
NM_019001chr374802 4480 4262 3126 590 563 158 33591 3570 3528 14485 --
NM_019004chr742388 1601 813 628 11880 12120 1869
NM_019022chr1822853 2275 21220 987 22833 2082 --
NM_019027chr412377 22125 266 1944 --
NM_019035chr41495 1144 ----
NM_019036chr64995 850 370 327 --11230 --
NM_019072chr563973 3817 2805 1267 790 723 ------
NM_019083chr131590 580 118 ------
NM_019091chr241020 851 66 34 2756 53 1864 1337
NM_019098chr821743 364 ------
NM_019114chr932025 1790 750 22515 1632 11730 --
NM_019116chr1663756 2577 2477 1336 730 657 --11329 --
NM_019117chrX31261 1016 546 22653 708 ----
NM_019555chr331484 449 316 ----1159
NM_019556chrX11113 11174 ----
NM_019593chr2032802 793 707 11039 --12647
NM_019597chrX--1234 1724 1747
NM_019600chr151740 2812 594 1205 --
NM_019610chr122190 1970 11525 11529 --
NM_019852chr14------1113
NM_019860chr1021624 251 ------
NM_019892chr92694 48 ------
NM_020116chr411415 1675 --11206
NM_020119chr754022 3911 3616 2900 2879 21226 696 --1898
NM_020122chr255975 5873 5616 713 312 35949 4638 2168 --138
NM_020130chr811369 1951 2533 213 --
NM_020132chr2164707 4175 3126 2072 800 428 --14603 14272
NM_020147chr15--176 ----
NM_020148chr1853033 2912 1971 299 160 32864 2602 1209 ----
NM_020159chr431654 1188 354 ------
NM_020177chr55918 770 419 279 198 ----13309
NM_020178chr1721233 779 ------
NM_020189chr81137 ------
NM_020190chr11451 ------
NM_020199chr52250 61 1862 ----
NM_020204chr1----1183 --
NM_020209chr19188 ------
NM_020228chr1172351 2191 1902 993 867 614 333 12503 ----
NM_020245chr663994 3901 1839 1548 263 198 24521 999 14607 14646
NM_020315chr221963 ------
NM_020336chr2053215 3122 1059 780 114 13670 ----
NM_020337chr472800 2686 2344 2094 1147 1089 423 21977 144 ----
NM_020338chr10----13084 --
NM_020340chr621458 111 --1639 --
NM_020342chr242563 2291 1819 1801 --1162 170
NM_020357chr32542 335 ----31189 1160 432
NM_020379chr1--1614 ----
NM_020381chr631814 794 25 11935 --11592
NM_020403chr1341318 1265 475 411 --1480 --
NM_020420chrY21848 515 ------
NM_020428chr19--11166 ----
NM_020432chr721739 49 21901 622 ----
NM_020440chr123323 1294 --13313 12051
NM_020443chr196556 6444 5998 5949 5041 2807 2503 2320 2293 --17036 1163
NM_020466chr633979 1844 1729 23720 771 ----
NM_020529chr142306 145 --1445 --
NM_020532chr21900 ----1202
NM_020640chr342122 1933 491 345 --21864 647 --
NM_020654chr331469 466 353 21148 425 ----
NM_020673chr2057690 6228 2223 815 480 22824 2237 27562 5487 21481 1049
NM_020696chr31303 ------
NM_020708chr2032485 2448 2391 ------
NM_020711chr222623 2427 --11784 --
NM_020717chrX94471 3688 3538 3433 1836 1699 1421 1089 841 14325 ----
NM_020718chr1684431 4071 4027 1987 1906 1743 1562 430 24521 2238 ----
NM_020727chr2183729 3025 2761 1502 857 453 348 198 13681 --14053
NM_020734chr1263313 2806 2755 2178 661 81 ------
NM_020739chr1533346 2889 2829 22688 1121 ----
NM_020740chr172357 350 ------
NM_020748chr1731982 1443 556 1223 1101 --
NM_020752chr102811 763 ------
NM_020766chrX84273 4025 3602 1262 909 584 540 450 23338 1391 1129 --
NM_020771chr611090 3624 550 443 ----
NM_020772chr17128030 7764 7255 6786 6123 5863 5632 3297 2996 2235 356 257 33399 1910 1824 22817 951 13040
NM_020774chr1855618 4892 4159 1397 1310 16212 ----
NM_020779chr232982 2436 2316 2506 64 1768 --
NM_020783chr182959 284 --12148 --
NM_020794chr111016 11561 --11463
NM_020796chr582894 2730 2566 2465 2334 1858 709 572 12079 ----
NM_020805chr181396 --1345 --
NM_020808chr121078 110 --1815 1401
NM_020819chr631038 889 437 11168 ----
NM_020841chr1263489 1174 871 782 500 137 11612 13008 --
NM_020844chr8127046 5963 5268 5136 5130 5113 5107 5029 2992 2454 2267 349 11307 11912 --
NM_020856chr191357 21260 596 --21173 1131
NM_020858chr1542315 1777 834 215 11734 12363 --
NM_020860chr451114 983 969 462 165 --1938 --
NM_020868chr222014 175 2428 74 11300 --
NM_020871chrX32497 1017 892 12347 --1563
NM_020872chr321683 523 11515 ----
NM_020899chr1712282 ------
NM_020918chr1083633 1416 1332 1003 985 594 391 330 1668 23561 584 13258
NM_020921chr1423130 1183 32707 938 915 ----
NM_020929chr111153 ------
NM_020937chr142694 70 1123 2545 325 --
NM_020940chr1052759 2561 2172 802 39 22916 117 ----
NM_020959chr191108 ------
NM_020964chr1844324 3634 59 34 11892 24566 510 --
NM_020973chr41245 ------
NM_020987chr1041267 1184 281 46 21174 490 11178 --
NM_021007chr232390 2155 1643 21554 528 1406 21742 533
NM_021033chr1343420 3121 2327 435 21051 315 ----
NM_021038chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_021061chr821700 1207 12854 24353 157 1471
NM_021064chr641783 1685 1640 1417 ----11500
NM_021069chr451967 770 535 427 164 ------
NM_021072chr522111 1980 ------
NM_021097chr221980 1152 --22895 1232 --
NM_021101chr322149 867 11687 1977 197
NM_021120chrX71272 1010 983 922 723 435 101 12413 33060 3055 2671 --
NM_021132chr1031307 1207 930 ------
NM_021140chrX41142 1061 853 165 11053 ----
NM_021148chr742247 1707 634 226 32261 1747 346 ----
NM_021159chr431624 1586 346 ------
NM_021183chrX11617 1849 --12421
NM_021222chr12590 117 ------
NM_021238chr1232099 2063 1876 1480 --11997
NM_021239chr1411185 3900 512 254 --1361
NM_021240chr91215 1228 1647 --
NM_021249chr1411167 --11439 1616
NM_021252chr1042069 1846 1645 1595 21735 780 ----
NM_021255chr1443606 2815 88 42 24070 3234 23979 3338 --
NM_021614chr5--169 ----
NM_021622chr1022339 1978 --11585 1484
NM_021629chr334749 3866 3541 45101 3878 1655 431 ----
NM_021637chrX21317 1265 --11220 --
NM_021638chr464980 4245 1284 1093 752 688 24713 178 13824 --
NM_021639chr11169 ------
NM_021722chr72387 209 ------
NM_021723chr72428 250 ------
NM_021728chr142851 729 1642 ----
NM_021809chr2062258 1957 1641 519 256 22 22463 908 1379 --
NM_021813chr665774 4819 4469 3881 141 82 55651 5585 4512 928 833 ----
NM_021818chr143958 477 407 1221 11018 11278
NM_021825chr114343 173 162 21 ------
NM_021911chr545270 3595 842 390 14084 14636 13672
NM_021912chr1544057 3335 1159 488 14093 ----
NM_021935chr32987 687 ----11027
NM_021940chr62240 152 11222 1507 1403
NM_021946chrX1527 11454 1468 --
NM_021947chr172381 287 11309 2448 70 --
NM_021954chr1343253 1093 870 176 12744 --12258
NM_021960chr122504 1804 1385 11735 1469
NM_021961chr1187141 6270 6123 5253 5037 4601 1985 1287 16941 15569 1786
NM_021964chr396187 5803 4806 4797 4735 4139 2596 2450 364 24618 4412 15854 185
NM_021998chrX21462 1284 1468 ----
NM_022041chr1652476 1713 1000 894 99 1362 --12562
NM_022048chr15116412 6396 6358 5816 2058 1956 1672 1520 802 645 228 12330 ----
NM_022079chr1031013 877 719 1188 ----
NM_022103chr19----1941 --
NM_022114chr154259 3829 1623 1496 456 24719 636 23661 1722 --
NM_022130chr51921 21244 566 ----
NM_022166chr1666322 5647 4558 4315 1928 385 36273 5396 4813 21626 1078 --
NM_022337chr111535 1591 ----
NM_022351chr843598 3437 2447 311 31422 404 98 ----
NM_022456chr1277501 6555 4983 1165 936 687 166 27202 1684 17459 --
NM_022459chr1366107 5252 4743 1551 774 185 14042 24640 4456 --
NM_022465chr1212182 23046 3011 --13060
NM_022474chr1432278 1761 856 52811 2357 2049 1945 1021 12081 22823 1026
NM_022475chr4--1690 ----
NM_022648chr2103973 3592 3044 2897 2887 1709 1594 694 570 554 14219 --14580
NM_022658chr1211137 ----11348
NM_022728chr72304 136 ------
NM_022735chr121526 225 21635 1242 --11370
NM_022739chr17--1978 ----
NM_022753chr172650 2510 2451 1832 957 899 76 12549 ----
NM_022756chr121421 432 11452 11097 --
NM_022763chr3------13069
NM_022771chr1231012 124 88 ------
NM_022778chr111479 ------
NM_022825chrX1308 ------
NM_022836chr141762 539 406 400 11698 11854 --
NM_022841chr1552459 2430 2397 2315 1925 1499 --151
NM_022843chr131444 21035 125 --21338 393
NM_022893chr222603 430 33080 2593 843 ----
NM_022894chr221314 225 1175 1552 11271
NM_022898chr1474702 4488 3968 3331 1502 777 436 24531 1191 ----
NM_022918chr1152142 1777 1663 1561 515 --11654 --
NM_022970chr104528 455 383 261 --11331 --
NM_023016chr212021 ----1595
NM_023074chr192852 168 11362 ----
NM_023075chr181784 --1169 --
NM_023076chr1642416 2124 513 347 --1483 --
NM_023923chr11175 21522 228 --13701
NM_023925chr121242 ------
NM_024007chr531932 849 249 13094 1641 --
NM_024019chr41229 ------
NM_024045chr101208 ------
NM_024061chr7----2608 190 --
NM_024345chr9105602 4949 4362 4072 3908 2092 2082 1116 657 525 12144 35483 5057 1243 --
NM_024408chr123603 2660 1687 1691 --
NM_024424chr1111116 2365 283 ----
NM_024425chr1111116 2365 283 ----
NM_024426chr1111116 2365 283 ----
NM_024429chr72910 848 1237 1927 --
NM_024496chr141248 ------
NM_024524chr333115 2056 25 12551 ----
NM_024546chr1331191 987 164 11226 21230 1136 --
NM_024557chr1141747 1577 1520 523 1283 --11711
NM_024582chr41951 11112 1359 --
NM_024615chr5191 ------
NM_024631chr111581 1520 ----
NM_024632chr5--196 ----
NM_024665chr3114680 4512 4322 4047 3701 3151 1646 966 232 216 75 12893 14545 --
NM_024670chr1031181 501 435 ------
NM_024692chr221565 1248 11290 11155 --
NM_024721chr841682 861 668 656 32630 2522 1814 --21055 341
NM_024744chr222363 685 --22617 1724 --
NM_024749chr12844 392 --21989 1625 --
NM_024751chr441990 1846 1350 115 ------
NM_024772chr11214 1444 --1201
NM_024786chr58791 770 749 705 682 661 638 617 --1318 --
NM_024814chr7----1321 --
NM_024817chr1554900 3841 795 561 223 25875 1229 21952 1047 --
NM_024824chr1471415 1336 479 357 330 282 53 ------
NM_024887chr142136 1488 661 584 ----11630
NM_024900chr451621 866 555 437 228 22215 1557 1527 --
NM_024900chr451621 866 555 437 228 22215 1557 1527 --
NM_024930chr522827 763 --22124 824 --
NM_024946chr16--21726 417 ----
NM_024947chr3149574 9506 8562 8493 7564 7265 6779 3418 3119 2392 1254 911 867 97 39597 9123 7712 18765 --
NM_024953chr1222404 2314 1179 --21845 1840
NM_024989chr277378 3048 2440 1123 921 777 731 26940 6572 12115 --
NM_024991chr1053125 2190 610 199 170 13248 ----
NM_025047chr31389 ------
NM_025054chr853989 3059 1128 658 37 11668 13104 --
NM_025073chr1114746 4688 4231 4123 3471 3158 2894 1058 671 655 52 --171 --
NM_025133chr231084 1016 215 ------
NM_025134chr1621823 1667 ------
NM_025147chr221092 417 ------
NM_025152chr1431915 1357 34 1740 1437 --
NM_025164chr11----1153 22093 1979
NM_025179chr154886 3817 3251 843 106 14898 14946 --
NM_025191chr153413 3397 1306 1057 166 13284 23459 448 13387
NM_025235chr103884 870 350 --1505 12229
NM_025238chr1511529 11266 ----
NM_030583chr85391 379 268 123 85 ------
NM_030594chr152348 340 1533 ----
NM_030621chr1443082 2981 1671 527 24032 3715 11173 --
NM_030625chr104793 725 682 675 --159 --
NM_030627chr573902 3820 3632 3485 1641 356 207 13668 13285 --
NM_030629chr1621896 702 ----1663
NM_030647chr7105999 5721 5655 5593 5112 4509 4190 1032 1025 676 24573 4536 12342 --
NM_030648chr475461 5112 3885 2094 1419 697 97 --1223 --
NM_030650chr263968 3867 2768 2699 2606 1525 13317 ----
NM_030664chr1052007 1866 655 572 414 11722 11726 --
NM_030670chr1252216 2063 1866 1793 113 --12202 1189
NM_030671chr1252216 2063 1866 1793 113 --12202 1189
NM_030751chr1031164 114 95 11429 1641 11297
NM_030751chr1031164 114 95 11429 1641 11297
NM_030755chr1433053 1176 317 ----12081
NM_030759chr10--2779 686 ----
NM_030762chr1251818 1640 1610 1387 1378 ------
NM_030789chr20----1283 --
NM_030799chr5--42004 1750 1362 837 12225 --
NM_030806chr1119419 7904 3254 3234 2937 2614 1283 761 582 308 37 1129 27028 6696 --
NM_030816chr113453 12806 1284 --
NM_030820chr6----1957 --
NM_030885chr31470 22337 2065 --1805
NM_030918chr1104868 4808 4782 4129 2092 1538 1459 340 322 308 ------
NM_030920chr132048 1868 1573 2272 186 ----
NM_030922chr153787 669 225 ------
NM_030954chr81344 ------
NM_030964chr563759 3729 3488 3443 3403 2831 23678 578 13272 --
NM_030965chr11296 ------
NM_031215chr2021643 858 ------
NM_031262chr941127 278 242 121 ------
NM_031263chr941184 335 299 178 ------
NM_031266chr5--1420 --1455
NM_031268chr16125196 5105 4810 4341 4202 3733 3311 1726 1205 629 399 389 35228 4887 3263 1791 --
NM_031289chr121803 ------
NM_031314chr1441843 1496 710 585 --1460 --
NM_031362chr242742 1830 1734 704 1566 1126 --
NM_031365chr252878 1966 1870 840 129 1702 1262 --
NM_031366chr252878 1966 1870 840 129 1702 1262 --
NM_031369chr4----1650 1267
NM_031370chr4----1650 1267
NM_031371chr131245 1169 1086 31578 1229 343 ----
NM_031371chr131245 1169 1086 31578 1229 343 ----
NM_031418chr111824 32791 997 905 ----
NM_031419chr311223 1551 ----
NM_031427chr1445919 4968 3970 3630 --1262 --
NM_031431chr1351848 1707 1265 134 124 11578 ----
NM_031442chrX53015 2992 2151 2041 1023 --12201 --
NM_031445chr243137 1346 318 274 ----13439
NM_031461chr821980 1545 21813 83 1727 --
NM_031483chr2073054 2730 2415 2174 1140 1032 510 23434 2554 13317 12951
NM_031844chr142818 1356 1304 466 1861 ----
NM_031889chr411962 ------
NM_031953chr44438 424 169 96 1329 ----
NM_031990chr19----11300 --
NM_031991chr19----11300 --
NM_032012chr975213 4496 4440 3813 1348 753 364 44714 4227 1225 1201 24558 412 --
NM_032021chr111921 ----1940
NM_032042chr542824 2087 1016 669 --1870 --
NM_032047chr352335 2287 2119 1833 390 ------
NM_032102chr1153138 3094 3020 1177 648 1209 23063 2824 --
NM_032116chr1385829 5413 5250 4544 1964 1094 511 209 34600 1664 1597 14182 --
NM_032128chr4--31032 850 703 ----
NM_032132chr12584 149 --1420 --
NM_032142chr18------1187
NM_032145chr631830 1812 107 --1157 --
NM_032156chr121242 ------
NM_032181chr22229 101 1606 ----
NM_032189chr1384671 4316 1947 1223 1193 428 331 266 --14250 --
NM_032199chr1051525 965 785 662 68 23816 3598 --13222
NM_032208chr243310 2910 2714 2693 ------
NM_032228chr1121300 266 12738 --11371
NM_032233chr141276 1668 ----
NM_032288chr341838 1619 587 411 22096 1906 1822 --
NM_032289chr511383 21905 1400 ----
NM_032291chr11206 1233 1350 --
NM_032295chr751443 560 506 63 47 11064 ----
NM_032329chr274418 4132 3583 3473 2920 2687 758 --1865 --
NM_032373chr1034216 861 807 25494 1560 15847 --
NM_032379chr111839 --1304 --
NM_032408chr711212 1428 ----
NM_032410chr81363 ------
NM_032424chr113608 400 204 11203 1248 --
NM_032431chr11--11048 ----
NM_032435chr142291 180 164 88 12197 --22351 940
NM_032438chr621598 1399 --31049 479 195 --
NM_032439chr1021491 525 --1571 --
NM_032440chr1042912 2360 1842 94 2733 27 12562 --
NM_032446chr563066 1413 673 467 219 49 2952 258 12865 --
NM_032457chr443727 3316 2850 161 22924 179 --12455
NM_032458chrX22736 652 22640 2156 --11213
NM_032491chr122994 841 ----21022 472
NM_032494chr21550 ------
NM_032505chr342062 1829 511 73 --1497 12710
NM_032547chr431302 1212 548 ----1207
NM_032558chr941374 1331 519 82 --11295 --
NM_032569chr1611713 ------
NM_032595chr17----11535 --
NM_032626chr16--161 ----
NM_032632chr142481 200 --1499 --
NM_032638chr351517 1490 1322 1196 159 --11565 --
NM_032682chr363086 1456 985 595 549 452 13200 12248 --
NM_032689chr1931637 370 139 --1568 --
NM_032765chr53810 699 98 ------
NM_032784chr6--122 ----
NM_032801chr1161876 1008 953 817 701 331 12490 --11898
NM_032804chr1022461 510 42010 1810 983 835 1214 --
NM_032810chr102341 174 31291 1114 256 ----
NM_032828chr1994260 3723 3377 3244 1902 994 445 396 121 13313 191 --
NM_032829chr1221170 1144 ----11052
NM_032857chr151202 1164 ----
NM_032859chr1333977 1095 265 --1362 --
NM_032860chr6--1180 ----
NM_032869chr851840 1426 1381 331 30 2697 75 11565 1409
NM_032873chr1144425 4318 4219 608 14347 11130 --
NM_032932chr17116294 6005 5644 5356 4771 4728 4290 4161 1864 331 255 1296 15307 16445
NM_032943chr111839 --1304 --
NM_032961chr411271 ------
NM_032968chrX64244 3256 3107 2789 611 578 14174 14073 --
NM_032969chrX64244 3256 3107 2789 611 578 14174 14073 --
NM_032973chrY64236 3251 3102 2784 611 578 14166 14065 --
NM_032975chr1863516 2986 2268 2234 464 376 13501 13530 13482
NM_032980chr1863516 2986 2268 2234 464 376 13501 13530 13482
NM_033020chr163824 3336 1826 1553 1091 555 24071 3290 14590 --
NM_033029chr31365 ------
NM_033031chrX2206 164 ------
NM_033055chr1--1435 ----
NM_033081chr20--2292 124 ----
NM_033083chr333389 2399 860 12787 12791 12773
NM_033089chr2011517 ------
NM_033103chr1951304 1099 865 480 45 1222 --1248
NM_033116chr141197 ------
NM_033119chr163117 101 83 --1815 --
NM_033121chr1271418 1381 613 479 451 264 59 ------
NM_033138chr752256 911 611 237 197 --1538 --
NM_033139chr752256 911 611 237 197 --1538 --
NM_033140chr752256 911 611 237 197 --1538 --
NM_033143chr4114647 4636 4414 4290 4026 3825 2934 923 840 447 222 ------
NM_033157chr752256 911 611 237 197 --1538 --
NM_033181chr673938 3777 3642 3178 1065 938 72 33687 3369 3008 23691 956 --
NM_033222chr92962 370 ------
NM_033224chr736146 5629 1922 22342 2175 --24884 2131
NM_033225chr852880 2052 1159 985 847 22960 2218 ----
NM_033227chr51113 1480 ----
NM_033254chr3135 ------
NM_033285chr843723 3413 2845 165 14242 --24151 1077
NM_033305chr9--11360 ----
NM_033326chr1182268 2154 1649 460 389 351 198 192 1723 --12414
NM_033331chr983541 3375 3285 3217 3073 1139 513 234 ------
NM_033337chr32786 580 ----1292
NM_033360chr1212978 34645 3592 3023 14586 --
NM_033379chr10156 ------
NM_033389chr1784353 3416 1640 1626 1195 1010 286 116 13120 ----
NM_033402chr81356 267 48 ----
NM_033425chr1153387 3276 949 834 560 --22464 708 --
NM_033426chr1462591 2127 1887 311 156 53 --22771 2577 --
NM_033430chr433322 605 278 1118 11074 1576
NM_033437chr433322 605 278 1118 11074 1576
NM_033495chrX3941 294 288 127 1252 --
NM_033505chr286675 6417 5332 4747 4721 4654 2412 2227 16747 34605 2553 960 22076 32
NM_033515chr631275 1072 159 1358 --11098
NM_033546chr181205 ------
NM_033642chrX2956 828 --153 --
NM_033656chr2155988 5168 4158 3790 671 13672 25310 603 --
NM_052832chr862836 2758 1075 678 310 248 --11971 1316
NM_052834chr1852583 2538 1603 489 397 11875 11750 --
NM_052854chr11--1440 ----
NM_052904chr62249 216 ------
NM_052905chr221419 373 21411 1219 1665 --
NM_052911chr182975 171 ----1374
NM_052923chr6130 ------
NM_052937chr852355 2019 1945 1775 1090 1488 ----
NM_052978chr1411805 ----11771
NM_052996chr1621382 1372 ------
NM_053016chr977355 5472 1895 859 463 425 86 27984 7880 1571 25403 1013
NM_053024chr341398 1317 1295 1238 ------
NM_053043chr786279 5717 5441 4591 3874 1653 1552 697 36398 4996 1122 26342 2048 --
NM_053064chr1432847 385 347 --12678 --
NM_054016chr141956 1728 1650 157 12021 ----
NM_054016chr141956 1728 1650 157 12021 ----
NM_054016chr141956 1728 1650 157 12021 ----
NM_054026chr81875 ------
NM_057159chr911373 11042 --11010
NM_057175chr442382 1919 974 397 12025 --22305 2164
NM_057749chr831347 1223 308 11072 192 --
NM_058172chr41646 11380 ----
NM_058237chr141902 ------
NM_058241chr242243 902 128 96 42005 1827 334 208 ----
NM_058241chr242243 902 128 96 42005 1827 334 208 ----
NM_078487chr943165 3066 2956 183 --12213 --
NM_080422chr18--1301 --1284
NM_080423chr18--1301 --1284
NM_080425chr201312 ------
NM_080426chr201312 ------
NM_080546chr921611 839 1368 ----
NM_080742chr6----192 --
NM_080745chr15147 ------
NM_080759chr1322629 1785 22636 2233 ----
NM_080760chr1322629 1785 22636 2233 ----
NM_080792chr2012157 ------
NM_080862chr32370 304 --11021 --
NM_080867chr1484100 3913 3824 1860 1526 1207 1085 353 14513 ----
NM_080872chr833692 2876 1299 12793 11032 13957
NM_080927chr323167 2617 32649 918 234 1381 13250
NM_130391chr942680 2645 1373 380 21025 685 --1516
NM_130392chr942680 2645 1373 380 21025 685 --1516
NM_130393chr942680 2645 1373 380 21025 685 --1516
NM_130436chr2152555 2420 2324 2267 999 12565 --1527
NM_130438chr2143132 2997 2901 2844 13142 --11104
NM_130787chr191329 ------
NM_130809chr553107 2928 1141 781 469 11043 ----
NM_130810chr15----127 --
NM_130847chr1185790 5692 5172 4737 3901 1405 1149 805 15847 ----
NM_133170chr2057181 6921 5492 353 42 35105 2866 1319 27889 1512 --
NM_133334chr476052 5382 5196 4740 4264 1178 603 26211 653 46406 5201 4686 2470 1474
NM_133370chr443671 2340 745 647 13213 22613 1355 --
NM_133372chr532335 2247 2066 12123 1659 --
NM_133433chr51736 2833 644 ----
NM_133445chr943684 3486 1391 653 --23302 2748 --
NM_133468chr7----1221 --
NM_133474chr421700 427 ------
NM_133478chr222400 351 ------
NM_133496chr163900 3165 2815 1583 1120 937 11294 23342 1399 153
NM_133503chr12--1540 ----
NM_133504chr12--1540 ----
NM_133505chr12--1540 ----
NM_133506chr12--1540 ----
NM_133507chr121108 1718 ----
NM_133631chr321142 172 ------
NM_133646chr255331 5186 4710 1617 780 14819 13635 --
NM_138270chrX42689 2439 735 532 22655 2319 32583 2310 1042 12457
NM_138286chr1943938 3290 1371 263 23352 845 23295 2816 --
NM_138288chr1452214 1970 1488 850 378 1391 ----
NM_138290chr72295 91 ------
NM_138316chr1041255 1245 481 441 1224 ----
NM_138335chr43888 767 230 1849 ----
NM_138423chr1542213 1599 902 698 1183 1858 22043 38
NM_138426chr72887 353 21849 378 22398 269 --
NM_138444chr1344903 3851 1746 1204 13437 13103 11906
NM_138459chr663663 2435 2271 2260 1111 235 13582 ----
NM_138473chr1224905 1149 12033 13457 --
NM_138555chr151384 ------
NM_138576chr1474702 4488 3968 3331 1502 777 436 24531 1191 ----
NM_138621chr274068 3483 3347 2831 2639 1313 989 54149 3964 2863 2845 2800 ----
NM_138689chr111185 ------
NM_138711chr31143 ------
NM_138712chr31143 ------
NM_138713chr16107342 7284 6498 3276 2917 2887 2416 2407 2275 2006 15849 21057 994 --
NM_138714chr16107342 7284 6498 3276 2917 2887 2416 2407 2275 2006 15849 21057 994 --
NM_138731chr1453476 2853 871 836 389 11287 12899 --
NM_138771chr741404 966 552 23 41327 594 464 212 21451 1331 --
NM_138782chr532079 1859 176 21678 721 ----
NM_138792chr15--138 ----
NM_138959chr175129 4715 2265 2240 2218 2037 1071 36814 6449 1513 ----
NM_138980chr42495 183 ------
NM_138981chr42626 314 ------
NM_138982chr42495 183 ------
NM_139045chr92686 203 1601 ----
NM_139057chr1552401 2070 1784 737 173 22807 936 22572 780 12587
NM_139072chr22770 706 ------
NM_139076chr431216 380 65 21239 1023 ----
NM_139168chr541731 1425 648 544 --1394 --
NM_139182chr41347 2499 44 --2336 331
NM_139207chr1231632 553 460 ----21531 1500
NM_139276chr1752330 2270 2059 1709 343 12379 ----
NM_139319chr1231848 1294 564 11494 11862 --
NM_139321chr2033375 3240 2759 ----24128 4052
NM_139323chr2031451 435 248 ------
NM_144571chr456385 2060 1445 1288 768 32126 253 132 25617 5419 --
NM_144574chr14--1395 ----
NM_144578chr1464057 3567 2198 1822 541 335 24767 3988 21485 1342 --
NM_144590chr101558 32668 1947 961 ----
NM_144591chr102452 392 1140 ----
NM_144595chr133972 960 711 1784 1222 --
NM_144599chr1565365 5223 4797 4164 1202 860 24879 4755 ----
NM_144600chr1641667 1363 1178 63 2683 669 1206 11430
NM_144632chr222245 758 12216 1208 11884
NM_144642chr31104 --11404 --
NM_144643chr4164 ------
NM_144660chr101393 ------
NM_144664chr11--32531 660 614 22350 1027 --
NM_144778chr1351092 607 467 318 164 22518 63 --11814
NM_144949chr231665 910 145 11699 1587 --
NM_144963chr822730 481 ------
NM_144967chrX----11088 1981
NM_144973chr1255173 4637 3562 2076 1297 21310 507 35257 5188 481 1161
NM_144979chr4171 --1651 --
NM_144981chr11131 ------
NM_144982chr122785 764 ------
NM_145025chr611123 11132 ----
NM_145049chr531054 401 85 ------
NM_145117chr1163077 2972 2439 2328 256 240 --12247 --
NM_145175chr21253 31379 1312 1288 ----
NM_145259chr276531 5583 5280 4636 2780 2765 583 --17055 --
NM_145284chrX81982 1778 1022 772 652 617 334 35 ------
NM_145303chr61179 ------
NM_145306chr102506 472 ------
NM_145307chr1053335 1758 1720 643 510 ------
NM_145341chr103654 433 422 --11173 --
NM_145649chr662755 1068 929 360 262 229 12692 ----
NM_145655chr662755 1068 929 360 262 229 12692 ----
NM_145686chr273395 3376 3077 2936 2092 1081 443 --1237 --
NM_145687chr273395 3376 3077 2936 2092 1081 443 --1237 --
NM_145693chr242561 2268 1028 869 12278 11006 --
NM_145725chr141491 ------
NM_145726chr141491 ------
NM_145728chr1542414 2351 2183 1879 ------
NM_145735chr1342775 688 637 72 --2900 494 12757
NM_145753chr31518 --1593 --
NM_145793chr101902 1236 --1601
NM_145805chr153579 569 114 ------
NM_145808chr773113 2812 2751 1027 901 434 414 12833 ----
NM_145859chr3143 ------
NM_145860chr3143 ------
NM_145891chr1631082 189 64 ------
NM_145892chr1631082 189 64 ------
NM_145893chr1631204 311 186 ------
NM_145909chr62181 69 ------
NM_147150chr953861 3678 3316 2944 2844 --13437 --
NM_147156chr101954 ----11381
NM_147171chr71483 --182 --
NM_147175chrX61998 1741 1473 669 269 168 12055 21928 1436 --
NM_147185chr71483 --182 --
NM_147189chr852183 1654 1474 1431 329 ------
NM_147223chr2--2983 919 11608 --
NM_147233chr2--2800 736 11425 --
NM_148174chr81568 12092 --11988
NM_148894chr42861 169 --1827 1112
NM_148955chr15106545 5893 5110 4414 2575 2070 1619 1006 520 265 11296 ----
NM_148977chr1041255 1245 481 441 1224 ----
NM_148978chr1041255 1245 481 441 1224 ----
NM_152132chr14180 123 ----
NM_152233chr1411167 --11439 1616
NM_152261chr1241898 741 127 114 12028 1642 --
NM_152263chr195976 5817 5268 4543 1986 1617 1416 917 235 1282 ----
NM_152300chr1751831 1709 748 497 22 --1771 --
NM_152323chr121152 ------
NM_152365chr1------1400
NM_152390chr24568 531 455 178 --1637 --
NM_152400chr471974 1899 1596 1527 547 235 114 ----11909
NM_152407chr523122 2362 13098 2696 261 181
NM_152408chr5186 ------
NM_152409chr543341 2726 2375 1297 12561 22529 2524 --
NM_152412chr831098 1076 518 --11492 --
NM_152417chr82539 414 --21322 66 --
NM_152422chr91130 1260 --11877
NM_152423chrX3507 185 41 21029 491 1495 --
NM_152424chrX64384 3721 3479 1745 1492 1313 24416 286 13550 --
NM_152433chr1131740 1084 395 --21153 306 --
NM_152446chr144743 702 151 122 ------
NM_152455chr1542543 2017 975 688 --22718 45 12692
NM_152520chr21294 ------
NM_152556chr752240 1859 282 225 85 22322 2159 ----
NM_152574chr92337 152 ------
NM_152594chr1542133 2020 1900 602 ----12231
NM_152605chr1911390 ------
NM_152608chr142314 1977 1871 742 22504 2465 11819 --
NM_152621chr41151 ------
NM_152622chr543268 2931 2542 1201 --22812 1328 --
NM_152624chr5176500 5968 5952 5199 5003 4509 2945 2452 2077 1856 1828 1684 896 773 659 314 305 37209 4517 1365 37134 2917 2125 --
NM_152629chr933614 3208 941 1705 ----
NM_152641chr1252527 1780 809 227 57 32358 817 340 12630 --
NM_152676chr18121 ------
NM_152678chr331755 344 313 12410 --1147
NM_152682chr431453 222 84 ------
NM_152716chr1131568 1269 1056 11423 --21647 1357
NM_152727chr161248 ------
NM_152731chr61775 1914 ----
NM_152739chr72847 267 21016 791 --1212
NM_152742chr71622 ------
NM_152745chr71402 1863 11086 1911
NM_152758chr822576 252 1512 ----
NM_152773chr3163 ------
NM_152787chrX13854 43765 3543 3507 3368 ----
NM_152826chr15106545 5893 5110 4414 2575 2070 1619 1006 520 265 11296 ----
NM_152835chr142920 2237 1110 1081 12765 ----
NM_152857chr611013 ------
NM_152858chr611013 ------
NM_152905chr12----176 --
NM_152994chr2--1242 1111 --
NM_152999chr743825 3668 680 86 1214 11604 --
NM_153013chr572360 2104 2057 1916 682 261 94 1845 1945 --
NM_153020chr641530 1080 364 124 ------
NM_153038chr2--1785 ----
NM_153042chr611465 ----2688 570
NM_153184chr311546 41483 704 182 117 11719 11797
NM_153188chr545109 4960 2067 1691 55620 5189 4521 3681 1145 33803 1210 1149 25625 1083
NM_153201chr11------1193
NM_153207chr1252731 1425 1297 1220 660 21206 213 22536 241 21138 1047
NM_153223chr521450 1011 21597 136 ----
NM_153240chr331234 1163 143 ------
NM_153261chr1631310 1231 613 21293 336 11049 --
NM_153262chr143181 2599 710 62 ----1745
NM_153267chr91354 2615 279 ----
NM_153321chr1721003 147 --1225 --
NM_153322chr1721003 147 --1225 --
NM_153331chr31502 --1678 1452
NM_153353chr32156 42 ------
NM_153354chr5----2618 370 1829
NM_153367chr1043195 3066 2987 350 13996 11035 --
NM_153371chr1372265 1891 1700 1614 805 729 410 21715 839 ----
NM_153426chr41635 ------
NM_153427chr41635 ------
NM_153456chr1355273 4494 4322 1278 405 --36242 4122 1806 --
NM_153464chr191788 ------
NM_153607chr532925 2793 1123 31281 1194 983 1321 1794
NM_153616chr1542315 1777 834 215 11734 12363 --
NM_153617chr1542315 1777 834 215 11734 12363 --
NM_153618chr1542315 1777 834 215 11734 12363 --
NM_153619chr1533553 3015 1453 22972 2491 13601 --
NM_153633chr122714 541 1745 ----
NM_153634chr122334 44 11359 1294 --
NM_153686chr422354 616 1720 --1339
NM_153689chr23799 444 321 12260 ----
NM_153715chr761241 1036 298 261 195 92 11231 2475 470 --
NM_153809chr91577 ------
NM_153810chr10114618 4563 4090 3803 3484 3410 3095 1374 1105 873 400 11666 14388 --
NM_153816chr6144 ----1309
NM_153828chr21900 ----1202
NM_170607chr1711544 ------
NM_170665chr1274565 4467 3449 2848 1433 983 55 21162 765 2508 401 --
NM_170674chr1521351 1281 21172 574 --11296
NM_170675chr1521027 957 2848 250 --1972
NM_170676chr1521027 957 2848 250 --1972
NM_170677chr1521351 1281 21172 574 --11296
NM_170679chr53510 310 134 ------
NM_170692chr11315 ------
NM_170709chr8--32345 2227 2199 ----
NM_170710chr412103 23075 2447 ----
NM_170725chr12742 160 ------
NM_170750chrX2824 362 ------
NM_170751chr611161 ----2316 174
NM_170752chr611161 ----2316 174
NM_170775chr5--169 ----
NM_172070chr252261 2126 1741 668 549 32174 1632 501 ----
NM_172071chr186556 5704 5692 4947 4552 2868 2078 1509 15420 ----
NM_172103chr642656 2171 605 512 22667 2198 ----
NM_172105chr642656 2171 605 512 22667 2198 ----
NM_172193chr1421328 1278 11307 --11249
NM_172230chr11--11048 ----
NM_172315chr1521351 1281 21172 574 --11296
NM_172316chr1521351 1281 21172 574 --11296
NM_172337chr142851 729 1642 ----
NM_173054chr71265 ------
NM_173075chr441770 1689 1680 258 3472 250 210 ----
NM_173082chr621261 477 ------
NM_173214chr16107342 7284 6498 3276 2917 2887 2416 2407 2275 2006 15849 21057 994 --
NM_173355chr21395 1160 ----
NM_173454chr153972 307 180 1804 ----
NM_173468chr485745 5693 5104 4133 3731 281 275 55 35479 4122 1968 ----
NM_173469chr151379 1219 --1597
NM_173470chrX82828 2686 2431 2208 2069 386 375 152 1685 12526 --
NM_173475chr1621719 443 1151 2478 466 --
NM_173478chr171868 ------
NM_173495chrX22257 1658 12514 11991 --
NM_173496chr1053007 2953 2264 438 360 11095 12710 1213
NM_173510chr2232894 2540 1805 12931 1580 --
NM_173511chr243647 3180 2952 747 13581 13897 --
NM_173519chr812038 21836 278 ----
NM_173548chr191528 ------
NM_173552chr362426 1633 1518 584 558 280 1499 --12417
NM_173582chr1166241 4120 2077 2047 1772 1580 34264 2034 619 1263 --
NM_173591chr125981 957 917 241 94 1108 1973 --
NM_173595chr1265263 4538 4038 4022 3319 1208 1634 21557 477 --
NM_173602chr1223622 1486 --13678 1389
NM_173626chr172759 222 1566 ----
NM_173644chr2021698 655 11875 31885 1752 41 --
NM_173645chr21474 ------
NM_173665chr52778 754 ----1608
NM_173683chr851093 650 482 406 289 --21735 500 --
NM_173808chr153904 3087 1489 1429 46 --13672 --
NM_173822chr231960 1612 858 21772 138 11524 --
NM_174911chr873188 1572 1461 1258 1005 980 837 --12983 --
NM_174916chr1541919 1634 158 94 ------
NM_175061chr732014 317 305 --12037 12033
NM_175607chr341515 687 87 26 --11714 --
NM_175612chr341515 687 87 26 --11714 --
NM_175619chr41137 ------
NM_175623chr1277501 6555 4983 1165 936 687 166 27202 1684 17459 --
NM_175736chr1287455 6339 5248 2876 1784 1497 1166 195 57844 7104 2725 1648 836 --17145
NM_175768chr631718 1110 131 21635 1180 ----
NM_175847chr19----11300 --
NM_175854chr1332263 1967 1072 11877 ----
NM_175856chr53617 100 80 173 ----
NM_175866chr13542 491 420 ----1536
NM_175907chr1852865 2489 2339 2210 276 ------
NM_175920chr52650 593 ------
NM_175921chr543909 2915 1676 316 13133 ----
NM_177424chr121982 334 1543 11499 --
NM_177438chr1443082 2981 1671 527 24032 3715 11173 --
NM_177553chr111941 ------
NM_177938chr32168 162 ------
NM_177939chr32168 162 ------
NM_177947chrX21520 1363 1120 ----
NM_177948chrX21520 1363 1120 ----
NM_177968chr241651 1626 1416 246 ------
NM_177974chr1542213 1599 902 698 1183 1858 22043 38
NM_177995chr91130 1260 --11877
NM_177996chr2073319 2742 2288 1321 1146 985 699 --1116 13393
NM_178120chr231146 1137 1122 ------
NM_178123chr21780 ------
NM_178140chr51696 11874 12406 --
NM_178151chrX77756 5185 1902 1644 1587 1104 621 --17741 16912
NM_178152chrX77756 5185 1902 1644 1587 1104 621 --17741 16912
NM_178153chrX77756 5185 1902 1644 1587 1104 621 --17741 16912
NM_178154chr141309 ------
NM_178155chr141309 ------
NM_178156chr141309 ------
NM_178157chr141309 ------
NM_178426chr131941 805 400 11815 ----
NM_178427chr131841 705 300 11715 ----
NM_178566chr961701 1527 1418 715 499 314 11902 ----
NM_178581chr20----1283 --
NM_178812chr831429 1378 59 11162 ----
NM_178832chr104317 239 171 31 ----11665
NM_180989chr1352481 2321 2272 1652 785 ------
NM_181054chr141956 --11283 --
NM_181265chr412103 23075 2447 ----
NM_181291chr14--1688 ----
NM_181302chr14--1395 ----
NM_181308chr14--1395 ----
NM_181353chr201616 ----1585
NM_181354chr851648 1230 1203 1059 337 ------
NM_181358chr133947 1500 404 21624 1494 13045 --
NM_181361chr33389 237 45 11402 ----
NM_181427chr15----144 --
NM_181443chr2042369 2020 925 738 12843 --12848
NM_181481chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_181482chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_181483chr18127052 6593 5899 5295 4645 2605 1564 1449 1098 965 775 417 46401 5474 5059 1343 17007 24993 1890
NM_181504chr542771 1177 902 461 11454 ----
NM_181521chr1696567 5949 5186 2685 1773 1418 1368 1174 450 27262 4616 11449 --
NM_181523chr542771 1177 902 461 11454 ----
NM_181524chr542771 1177 902 461 11454 ----
NM_181527chr201365 ------
NM_181528chr201420 ------
NM_181659chr2073154 2595 2555 920 843 423 212 1992 ----
NM_181659chr2073154 2595 2555 920 843 423 212 1992 ----
NM_181670chr1231300 1283 960 ------
NM_181672chrX21560 380 22004 1909 1826 --
NM_181673chrX21560 380 22004 1909 1826 --
NM_181689chr202783 763 ------
NM_181713chr2----1275 --
NM_181723chr862274 2115 2109 2093 891 679 ----1923
NM_181741chr231241 134 65 ------
NM_181742chr231241 134 65 ------
NM_181762chrX21059 792 1291 1117 1204
NM_181777chrX21059 792 1291 1117 1204
NM_181782chr632218 518 334 --12242 --
NM_181839chr851287 1268 571 477 110 11004 --1502
NM_181861chr1272155 1965 833 494 365 349 112 12675 1265 --
NM_181868chr1272155 1965 833 494 365 349 112 12675 1265 --
NM_181869chr1272240 2050 918 579 450 434 197 12760 1350 --
NM_181886chr441067 900 514 58 --11270 --
NM_181887chr441067 900 514 58 --11270 --
NM_181888chr441067 900 514 58 --11270 --
NM_181889chr441067 900 514 58 --11270 --
NM_181890chr441067 900 514 58 --11270 --
NM_181891chr441067 900 514 58 --11270 --
NM_181892chr441114 947 561 105 --11317 --
NM_181893chr441067 900 514 58 --11270 --
NM_181897chr3--32314 2262 1044 --1604
NM_182314chrX51596 1564 1305 1225 308 ----1212
NM_182481chr2111169 ------
NM_182482chr2111169 ------
NM_182485chr4113739 3663 3621 3113 3053 2948 2595 890 802 455 57 ------
NM_182492chr22--1298 ----
NM_182493chr1675347 5335 5033 3929 3690 1960 1694 21095 440 ----
NM_182503chr663699 3412 1894 1573 313 99 ------
NM_182511chr181300 --21051 338 --
NM_182515chr1986025 5823 5806 5657 2483 2315 1976 760 31683 1180 321 ----
NM_182537chr31299 ------
NM_182540chrX163 --1780 144
NM_182569chr17124 1188 ----
NM_182641chr1751831 1494 620 401 235 11819 ----
NM_182646chr4113739 3663 3621 3113 3053 2948 2595 890 802 455 57 ------
NM_182648chr145626 546 496 229 217 173 --1487
NM_182700chr731798 1474 534 ------
NM_182715chr741205 952 786 337 1386 11071 --
NM_182734chr2013059 22540 844 22764 988 --
NM_182756chr22413 245 1558 ----
NM_182758chr1522863 2752 33938 903 74 1624 --
NM_182763chr122493 1793 1374 11724 1458
NM_182765chr1032090 602 56 ----12329
NM_182767chr1252089 2001 1578 768 474 ------
NM_182835chr141163 ------
NM_182898chr756467 6190 1812 1739 1176 --26269 452 --
NM_182899chr756467 6190 1812 1739 1176 --26269 452 --
NM_182910chr142921 586 ------
NM_182913chr142921 586 ------
NM_182914chr142921 586 ------
NM_182920chr341216 379 350 253 ------
NM_182943chr311169 11161 ----
NM_182948chr142876 2861 1106 411 23113 2038 ----
NM_182964chr1163077 2972 2439 2328 256 240 --12247 --
NM_182972chr182148 1733 1094 1052 1014 895 623 404 12416 22547 2197 --
NM_182975chr121144 1104 ------
NM_182976chr1----1292 --
NM_183004chr1443280 785 413 137 23477 932 23005 2739 --
NM_183078chr673829 3789 3638 2952 2349 1189 223 11479 23269 2656 --
NM_183227chr65633 554 416 346 328 ------
NM_183353chrX1906 --1478 --
NM_183381chr32879 832 154 --1205
NM_183383chr32879 832 154 --1205
NM_183384chr32879 832 154 --1205
NM_194285chr1163185 2327 748 711 316 129 --13365 --
NM_194291chr862003 1926 1886 209 147 61 --1469 1296
NM_194292chr121458 138 21403 1315 ----
NM_194301chr143908 354 187 ------
NM_194314chr175495 5120 5097 4891 4549 4160 3964 --25206 1843 15614
NM_194318chr1372543 2154 1877 674 625 448 291 1542 22456 72 --
NM_194434chr1865396 4547 2170 1672 1534 367 22149 1661 25667 22 --
NM_194449chr18--1387 ----
NM_194452chr111248 ------
NM_194453chr111248 ------
NM_197956chr962091 1785 1668 1506 649 596 21843 759 21847 1519 --
NM_197972chr12209 85 ------
NM_197977chr94869 817 706 375 ------
NM_198077chr13130 73 27 1446 ----
NM_198120chr8----1520 --
NM_198128chr1832341 2312 2244 31434 820 351 ----
NM_198150chr5--2608 565 ----
NM_198158chr342965 912 486 472 --1699 22941 215
NM_198159chr342965 912 486 472 --1699 22941 215
NM_198177chr342965 912 486 472 --1699 22941 215
NM_198178chr342965 912 486 472 --1699 22941 215
NM_198181chr1562938 2778 2771 2683 603 507 12505 12730 --
NM_198186chr91618 ------
NM_198187chr91618 ------
NM_198188chr91357 ------
NM_198195chr32704 245 ------
NM_198204chr1711544 ------
NM_198205chr1711544 ------
NM_198212chr722201 539 1581 ----
NM_198268chr133947 1500 404 21624 1494 13045 --
NM_198269chr133947 1500 404 21624 1494 13045 --
NM_198271chr32777 328 1374 ----
NM_198279chrX1871 1102 ----
NM_198281chr483435 2520 2457 2431 2387 2106 868 640 32194 462 311 12641 --
NM_198390chr1621896 702 ----1663
NM_198391chr2021139 348 ----2255 122
NM_198439chr1131740 1084 395 --21153 306 --
NM_198465chrX1251 ----1783
NM_198467chr7------1590
NM_198513chr821735 1647 22005 384 ----
NM_198531chr18--1619 1544 --
NM_198581chr2157542 7498 6674 5953 5730 5402 2629 2547 2516 2218 1887 1705 732 545 57 77239 6250 5969 5010 614 607 250 11902 --
NM_198595chr464980 4245 1284 1093 752 688 24713 178 13824 --
NM_198597chr102876 283 ------
NM_198715chr1116018 5795 5634 5553 5216 4379 4072 2509 1225 405 62 35667 5038 1963 ----
NM_198896chr1141790 1555 1544 116 1536 ----
NM_198900chr1287455 6339 5248 2876 1784 1497 1166 195 57844 7104 2725 1648 836 --17145
NM_198903chr53629 205 153 ------
NM_198904chr562023 1955 1439 629 205 153 ------
NM_198935chr2042773 2714 1040 765 --22498 214 22294 227
NM_198956chr731798 1474 534 ------
NM_198965chr12183 197 ----
NM_198966chr12183 197 ----
NM_198989chr132534 144 --1381 --
NM_198992chr122394 148 1346 1860 --
NM_199000chr732229 1919 345 ------
NM_199003chr83950 303 58 1434 11154 --
NM_199039chr411086 ------
NM_199189chr5--1104 ----
NM_199229chr251395 650 435 226 98 ------
NM_199244chr91912 ------
NM_199324chr433192 2747 2452 23158 1036 ----
NM_199327chr41246 11033 ----
NM_199342chr11288 ------
NM_199421chr1484100 3913 3824 1860 1526 1207 1085 353 14513 ----
NM_199436chr253121 2244 882 437 318 22374 1251 ----
NM_199437chr1172351 2191 1902 993 867 614 333 12503 ----
NM_199438chr1172351 2191 1902 993 867 614 333 12503 ----
NM_199439chr1172351 2191 1902 993 867 614 333 12503 ----
NM_199454chr154259 3829 1623 1496 456 24719 636 23661 1722 --
NM_199461chr103773 473 171 1303 1796 --
NM_199462chr164885 4548 4063 3589 3268 501 ----35030 3084 3079
NM_199482chr242091 1558 580 25 ----21934 52
NM_201266chr262971 2724 2702 2336 2013 557 11042 ----
NM_201279chr262971 2724 2702 2336 2013 557 11042 ----
NM_201413chr21------2250 141
NM_201414chr21------2250 141
NM_201434chr171575 ----1740
NM_201570chr1041412 1269 167 134 21657 775 1546 1554
NM_201571chr1041412 1269 167 134 21657 775 1546 1554
NM_201572chr1041412 1269 167 134 21657 775 1546 1554
NM_201590chr1041412 1269 167 134 21657 775 1546 1554
NM_201593chr1041412 1269 167 134 21657 775 1546 1554
NM_201596chr1041412 1269 167 134 21657 775 1546 1554
NM_201597chr1041412 1269 167 134 21657 775 1546 1554
NM_201613chr121336 ------
NM_201628chr173176 2990 2243 1089 1042 635 468 ------
NM_201632chr5--11826 11850 --
NM_201634chr5--11925 11949 --
NM_201647chr21569 ----153
NM_203282chr1931535 1474 1369 1527 ----
NM_203327chr2074468 4159 3895 1718 1112 871 148 23285 1141 ----
NM_203372chr241716 518 507 439 21411 418 --11602
NM_203406chr532738 676 663 12358 21138 877 --
NM_203416chr12--1566 --1388
NM_203434chr9--1266 ----
NM_203437chr2--1732 ----
NM_203453chr951349 716 303 297 147 1228 ----
NM_203458chr143010 2831 1249 843 23242 3213 23051 722 --
NM_203459chr142578 2563 1666 1610 --1753 12569
NM_203464chr141045 837 318 61 --168 --
NM_203473chrX1308 ------
NM_203474chrX1308 ------
NM_203475chrX1308 ------
NM_203476chrX1308 ------
NM_203486chr191207 ------
NM_203487chr1341318 1265 475 411 --1480 --
NM_203488chr141284 ------
NM_203499chr171674 1316 ----
NM_203504chr462391 2067 1804 961 600 349 22521 859 12326 --
NM_203505chr462391 2067 1804 961 600 349 22521 859 12326 --
NM_205768chr132031 1550 690 31607 704 697 ----
NM_205860chr143118 1064 835 204 43099 1950 1929 1231 ----
NM_205861chr142136 1488 661 584 ----11630
NM_206594chr173573 3516 2627 2418 958 640 628 33565 2452 2253 ----
NM_206595chr173573 3516 2627 2418 958 640 628 33565 2452 2253 ----
NM_206808chr13138 ------
NM_206853chr673560 2637 1187 686 618 597 240 33799 3677 500 ----
NM_206854chr694821 3898 1947 1879 1858 1501 660 155 143 45060 4938 3680 1761 ----
NM_206855chr695786 4863 4151 4075 2466 1625 1120 1108 426 36025 5903 4645 ----
NM_206866chr2121097 97 12066 ----
NM_206876chr243075 2386 1098 752 11210 --1183
NM_206907chr522452 2433 1996 13157 12784
NM_206909chr8128240 8058 7945 7627 6109 5901 5167 2513 2455 656 509 26 21629 134 --15355
NM_206927chr111839 --1304 --
NM_206928chr111839 --1304 --
NM_206929chr111839 --1304 --
NM_206930chr111839 --1304 --
NM_206943chr2----1264 1720
NM_207032chr2021360 1065 --21590 1523 --
NM_207033chr2021268 973 --21498 1431 --
NM_207034chr2021268 973 --21498 1431 --
NM_207123chr4--1274 1219 --
NM_207171chr12413 390 ----11282
NM_207189chr1--1107 ----
NM_207292chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_207293chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_207294chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_207295chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_207296chr362942 2913 2245 714 383 233 53365 3029 2220 962 86 ----
NM_207297chr362967 2938 2270 739 408 258 53390 3054 2245 987 111 ----
NM_207303chr1074166 3869 3049 1540 1476 273 184 22903 1364 134 --
NM_207304chr135979 494 354 205 51 12405 --11701
NM_207362chr2----172 --
NM_207406chr496210 5465 5287 5268 5192 4546 2544 2256 2113 --26258 4276 --
NM_207481chr22459 78 ----11353
NM_207517chr1541944 638 314 28 21891 1599 --11932
NM_207520chr21900 ----1202
NM_207521chr21900 ----1202
NM_207660chr1471415 1336 479 357 330 282 53 ------
NM_207661chr1471415 1336 479 357 330 282 53 ------
NM_207662chr1471415 1336 479 357 330 282 53 ------
NM_213589chr275030 2139 2001 1818 1594 762 729 35511 4805 4414 1835 --
NM_213594chr122994 841 ----21022 472
NM_213622chr21569 ----153
NM_213648chr5--11826 11850 --
NM_213654chr341214 396 348 142 1342 ----
NM_213662chr1752424 2364 2153 1803 437 12473 ----