TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-101-5p
miRNA Sequence: CAGUUAUCACAGUGCUGAUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541928 1866 660 617 1452 11623 1604
NM_000052chrX52866 1389 1352 670 453 --12431 --
NM_000081chr151691 1350 1302 1244 200 --3494 477 99 --
NM_000084chrX75319 4783 2423 1742 1553 1074 666 36403 869 841 ----
NM_000088chr1721345 260 ------
NM_000091chr252736 2657 2473 1159 807 --22498 114 --
NM_000092chr254510 3569 2872 1584 1211 --24603 3815 --
NM_000093chr932289 2156 1990 12493 1888 --
NM_000109chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_000110chr14983 894 236 208 ------
NM_000125chr643518 1401 549 32 12998 23241 317 --
NM_000126chr151114 ------
NM_000138chr1511980 22481 26 12103 --
NM_000141chr1051111 1020 542 326 125 1513 ----
NM_000142chr411295 ------
NM_000163chr542125 953 779 554 22318 2243 11988 --
NM_000176chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_000202chrX93410 3195 3119 2554 1423 1189 741 450 200 12655 ----
NM_000217chr1254491 4232 4197 2085 1077 ----23438 3298
NM_000218chr111895 ------
NM_000227chr181385 ------
NM_000233chr21661 ------
NM_000237chr861355 1276 553 349 288 69 ------
NM_000238chr7--3393 357 338 --1376
NM_000248chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_000259chr1556209 5611 5251 4404 362 25532 2139 24094 1486 --
NM_000264chr973170 2973 2618 2308 891 387 374 12923 1522 --
NM_000267chr1753167 2773 2643 1348 1049 22401 660 13278 --
NM_000276chrX22243 670 ------
NM_000291chrX1669 1950 ----
NM_000314chr1063197 2477 2191 1165 810 534 12530 ----
NM_000328chrX2330 65 ------
NM_000332chr676276 6098 6003 4982 2725 2685 1552 32284 1258 1022 ----
NM_000337chr574027 2295 1775 1504 1493 1194 766 25159 2072 25847 4360 12198
NM_000345chr42998 936 ------
NM_000390chrX63341 3298 2865 978 307 270 1725 13094 --
NM_000408chr2103433 3339 3084 2880 2657 2563 933 692 588 390 11067 33276 103 70 --
NM_000415chr12156 ------
NM_000436chr551567 1150 1130 378 82 2582 204 11587 --
NM_000448chr1182563 1083 765 554 469 453 259 243 ------
NM_000450chr141801 1784 1162 487 2473 445 173 --
NM_000452chr1351996 1648 746 527 365 2839 54 22017 1947 --
NM_000461chr394577 4149 1867 1594 1335 1179 536 366 25 ------
NM_000462chr1531704 1654 1590 21409 246 ----
NM_000492chr721210 1096 --1430 --
NM_000493chr63877 720 454 ------
NM_000503chr82566 533 --1757 --
NM_000509chr4----1162 --
NM_000522chr7392 75 69 ------
NM_000523chr2--11060 ----
NM_000555chrX177346 7053 6803 6626 6512 6059 6034 5874 2931 2918 2564 2365 2161 1212 747 590 224 27355 2509 26268 1183 --
NM_000584chr441238 1112 877 245 ------
NM_000598chr731217 1168 1084 11571 ----
NM_000599chr264576 4359 4303 4141 1789 699 ------
NM_000609chr1023134 2999 ------
NM_000615chr1152574 1897 802 780 518 ------
NM_000618chr1296493 6376 4463 4162 1517 995 799 470 108 26509 1454 ----
NM_000618chr1296493 6376 4463 4162 1517 995 799 470 108 26509 1454 ----
NM_000621chr1331269 903 356 31138 400 282 --1536
NM_000673chr43581 330 243 ------
NM_000724chr1021734 1379 21810 52 ----
NM_000726chr23583 311 232 21392 1190 ----
NM_000758chr5--1294 ----
NM_000793chr1473728 3254 3207 3180 1734 1639 1602 43227 2052 970 351 11361 14864
NM_000806chr551448 1217 751 521 129 ------
NM_000807chr43698 127 80 2641 594 ----
NM_000809chr4168571 8366 8269 8056 7623 7054 7007 6281 2900 2773 2746 2717 2470 2458 1365 928 42854 2828 2207 1306 --18448
NM_000813chr5105143 4699 4390 4112 3941 1504 1095 941 483 298 25176 4073 34435 2233 1735 --
NM_000820chr131237 ------
NM_000824chr42655 317 1912 1309 --
NM_000826chr492494 2305 2184 2170 2083 1845 474 400 84 11984 ----
NM_000844chr31846 1856 ----
NM_000865chr61220 ------
NM_000866chr37742 623 429 401 369 208 132 2328 54 ----
NM_000868chrX52199 1998 706 683 127 11835 12410 --
NM_000875chr15137079 6829 6272 6224 5721 5708 5682 5463 2711 2234 1432 1220 363 --15139 --
NM_000879chr51105 ------
NM_000885chr242095 457 307 213 21989 680 --1666
NM_000891chr1762555 2537 928 806 726 79 13477 ----
NM_000899chr1284251 4045 3924 1490 1458 454 144 46 ------
NM_000901chr462466 2446 2034 1810 682 280 --12315 --
NM_000908chr51106 ------
NM_000912chr833091 1301 1253 13192 23246 1392 13512
NM_000926chr11119472 8932 8696 6666 3223 2969 2310 1884 1771 1366 488 1182 33022 2875 394 26794 6340
NM_000933chr203707 466 248 1195 ----
NM_000935chr331270 1030 46 ------
NM_000940chr7----162 --
NM_000941chr71331 ------
NM_000945chr281697 1640 1628 1619 768 751 620 185 1793 ----
NM_000950chrX83487 3217 2929 2889 2838 856 789 621 --33459 604 502 --
NM_000953chr1431752 1474 413 2657 635 21706 1168 --
NM_000963chr152202 2183 1698 869 542 21522 398 12261 --
NM_001001323chr1282760 2031 950 795 699 517 152 115 ------
NM_001001344chrX32546 2072 957 --11986 --
NM_001001395chr1242138 987 734 457 11952 ----
NM_001001419chr5125190 5021 4865 4558 4431 4329 3211 1053 696 588 546 125 1752 23793 1277 13768
NM_001001420chr5125190 5021 4865 4558 4431 4329 3211 1053 696 588 546 125 1752 23793 1277 13768
NM_001001436chr16141 ----1853
NM_001001481chr883413 3209 3042 2977 2299 834 323 249 23327 3129 ----
NM_001001556chr1571623 1390 1227 1127 572 472 247 ------
NM_001001557chr841952 1802 852 178 ------
NM_001001664chr263916 1597 979 857 794 227 21571 918 43123 2731 332 156 --
NM_001001668chr1994033 3723 3647 3194 3076 2748 457 188 110 --33654 3022 1609 --
NM_001001787chr11452 ------
NM_001001890chr2154105 4058 3565 2889 2656 11167 21230 804 --
NM_001001974chr1062104 830 381 352 266 179 --11644 --
NM_001002243chr21961 ------
NM_001002257chr283508 2740 2700 2455 2253 2241 1081 235 188 ----
NM_001002269chr91486 1461 ----
NM_001002843chr15------1239
NM_001002909chr172568 308 ----11966
NM_001003652chr1897775 7059 6532 6511 6119 5550 3198 2952 900 46473 1459 1274 973 27829 6182 37870 5424 3395
NM_001003674chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_001003675chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_001003712chr1243999 2723 1380 1132 42905 2486 1546 483 1877 --
NM_001003792chr3--1427 ----
NM_001003793chr3--1427 ----
NM_001003845chr21421 1446 --1437
NM_001004317chr673876 3428 1600 1257 701 695 363 23094 1545 --11582
NM_001004419chr1253803 3099 1094 687 202 23902 3331 21382 126 --
NM_001004441chr531244 1170 376 11228 11119 --
NM_001005386chr272076 2055 2002 1892 980 936 590 12246 --11522
NM_001005404chr1754416 3076 1473 532 487 --2712 471 --
NM_001005473chr5156373 5822 5705 5592 5360 5084 4343 4274 2144 2133 2054 1674 834 334 254 1525 --12568
NM_001005502chr1284776 4599 4565 4513 3494 3233 1028 174 45199 5135 1265 769 24801 1014 --
NM_001005746chr23583 311 232 21392 1190 ----
NM_001005747chr23583 311 232 21392 1190 ----
NM_001006600chr572176 2127 1796 919 688 386 312 32480 2051 891 ----
NM_001006610chr1621016 276 ------
NM_001006657chr242821 717 160 24 1877 2685 325 --
NM_001006681chrX146 ----1109
NM_001006682chrX146 ----1109
NM_001006683chrX146 ----1109
NM_001006684chrX1503 ------
NM_001007023chr1473728 3254 3207 3180 1734 1639 1602 43227 2052 970 351 11361 14864
NM_001007026chr121453 ------
NM_001007097chr965015 4718 4648 4511 3745 1450 1833 45121 4613 3484 214 --
NM_001007099chr13897 755 671 ------
NM_001007100chr13897 755 671 ------
NM_001007226chr171162 11084 ----
NM_001007227chr171162 11084 ----
NM_001007228chr171162 11084 ----
NM_001007229chr171162 11084 ----
NM_001007230chr171162 11084 ----
NM_001007245chr73509 232 133 --1103 --
NM_001007246chr2161607 1426 548 296 83 45 290 37 ----
NM_001007565chr31151 ------
NM_001008225chr72208 192 ----1646
NM_001008239chr1853620 2870 922 681 82 33104 2537 675 1608 13444
NM_001008405chr741695 1400 1239 468 2605 408 1223 2339 327
NM_001008491chr251956 1868 1771 1720 554 --11964 11700
NM_001008492chr251956 1868 1771 1720 554 --11964 11700
NM_001008495chr852072 1971 1630 1504 645 1841 ----
NM_001008541chr1021539 1486 11981 1910 1469
NM_001008541chr1021539 1486 11981 1910 1469
NM_001008738chr562872 2516 2395 2146 1016 236 ------
NM_001008895chr1341191 1064 521 251 ----11040
NM_001008925chr462710 1335 689 365 68 46 --13464 --
NM_001009552chr8--1439 ----
NM_001009571chr721469 467 11066 11149 --
NM_001009894chr122616 258 11167 ----
NM_001009899chr366278 5918 4692 4635 2619 1036 26495 6108 45684 5641 4246 351 --
NM_001009909chr11103708 3438 3206 3103 2862 1518 1001 587 350 120 53754 2828 1099 1045 637 23652 1012 --
NM_001009958chr72596 565 1627 ----
NM_001009960chr72824 115 --1141 --
NM_001010853chr633073 2611 2138 --12019 --
NM_001010854chr141517 ------
NM_001010861chr182770 2523 929 895 740 261 122 113 1687 12603 --
NM_001010888chrX74597 3269 1763 1708 1076 1039 85 54568 1855 239 79 70 ----
NM_001010984chr142511 2429 349 260 ------
NM_001010986chrX102482 2305 2151 2142 2045 1811 1005 866 840 242 1464 ----
NM_001010989chr161486 ------
NM_001010990chr161486 ------
NM_001011513chr454143 3776 2910 1089 960 23096 333 ----
NM_001011666chr796145 5903 5767 4662 4390 2240 2150 2061 1068 46205 5619 5219 2039 1405 --
NM_001012267chr921516 1432 1787 ----
NM_001012614chr41504 ------
NM_001012751chr1051876 1703 1312 745 213 ------
NM_001013398chr731217 1168 1084 11571 ----
NM_001013399chr661156 342 297 263 176 97 ------
NM_001013620chr12218507 8087 7778 6899 6789 6611 6378 5904 5557 5475 5306 5295 5216 2674 2660 2430 2287 1968 1941 1226 525 46704 6632 5184 42 27027 6601 --
NM_001013703chr15182 ------
NM_001014380chr1395547 5489 4722 4390 3740 2013 1392 505 167 --24237 1558 --
NM_001014434chr13884 792 278 ------
NM_001014764chr171130 ------
NM_001014797chr1048206 6358 6212 2656 25800 1968 18173 --
NM_001015048chr1423190 2905 11090 ----
NM_001015049chr1423190 2905 11090 ----
NM_001015508chr82737 168 ------
NM_001015877chrX73126 3119 2785 1952 1913 1192 97 21887 51 ----
NM_001017395chr3----12938 --
NM_001017424chr191865 1588 1573 1548 1314 622 405 326 63 ------
NM_001017425chr191865 1588 1573 1548 1314 622 405 326 63 ------
NM_001017926chr851617 1367 1255 633 83 11719 ----
NM_001017928chr32263 177 1252 --1187
NM_001017930chrX2202 181 ------
NM_001017992chr561524 1432 1034 956 473 167 21058 324 --1318
NM_001018037chr92347 257 ------
NM_001018067chr173342 3336 2127 2007 1720 707 242 --44993 4940 3418 589 --
NM_001018068chr173342 3336 2127 2007 1720 707 242 --44993 4940 3418 589 --
NM_001018069chr173342 3336 2127 2007 1720 707 242 --44993 4940 3418 589 --
NM_001018074chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_001018075chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_001018076chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_001018077chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_001018091chr1552725 2199 1823 117 86 22651 1996 1418 --
NM_001023567chr1562452 2075 1609 609 464 239 22485 951 ----
NM_001024094chr583526 3134 2824 1050 1024 576 426 47 2916 506 --13036
NM_001024647chr12127572 7195 7066 5059 2572 2402 2023 1876 1358 1109 557 39 27566 2393 47532 6635 1734 1409 --
NM_001024649chr542575 2424 2364 152 --12565 1478
NM_001024808chr1212796 ------
NM_001024948chr122847 695 --1485 12470
NM_001024956chr11105459 5278 5183 5142 4554 4129 910 815 566 475 45470 2106 1603 1119 22345 482 --
NM_001025077chr1087590 6847 5561 4891 2509 1765 1375 1088 1184 12829 --
NM_001025079chr364091 3936 3581 3390 334 120 32683 878 202 13400 1363
NM_001025107chr172686 1677 964 957 789 616 127 --1418 --
NM_001025107chr172686 1677 964 957 789 616 127 --1418 --
NM_001025252chr863115 2933 2756 2600 1189 970 22891 962 11005 --
NM_001025253chr863115 2933 2756 2600 1189 970 22891 962 11005 --
NM_001025356chr123896 636 464 33005 2963 486 12632 1819
NM_001025366chr611768 ------
NM_001025366chr611768 ------
NM_001025367chr611768 ------
NM_001025367chr611768 ------
NM_001025368chr611768 ------
NM_001025368chr611768 ------
NM_001025369chr611784 ------
NM_001025369chr611784 ------
NM_001025370chr611768 ------
NM_001025370chr611768 ------
NM_001025580chrX83799 3689 1718 1537 1480 1246 241 163 24106 889 21409 1157 --
NM_001029858chr642619 2237 1103 900 23170 821 ----
NM_001029863chr683081 2139 2073 2022 871 850 630 203 --22791 339 --
NM_001029884chr682719 2311 1950 1678 821 696 484 471 --1791 --
NM_001030055chr14114322 4018 3846 3416 3046 3005 1754 902 673 484 190 1224 1101 24178 458
NM_001031623chr641635 1228 643 51 21714 1594 21680 1652 --
NM_001031684chr241433 452 306 153 --195 --
NM_001031700chr472441 2414 2271 1917 861 756 129 ------
NM_001031732chr441240 1188 1012 985 --23383 352 --
NM_001031748chr124631 526 460 213 ------
NM_001031804chr1653373 1477 1102 931 299 11011 13331 --
NM_001031812chr562336 1741 1489 760 425 377 ------
NM_001032221chr911678 ------
NM_001032283chr123960 748 48 ------
NM_001032284chr123960 748 48 ------
NM_001032730chr12713 151 ------
NM_001033045chr2114197 3994 3821 3752 3515 2988 2871 1680 1095 987 239 1657 11772 --
NM_001033503chr52471 73 1428 ----
NM_001033557chr241322 1147 226 179 --11206 --
NM_001033578chr831742 562 389 31891 528 93 ----
NM_001033756chr611702 ------
NM_001033756chr611702 ------
NM_001033925chr1032130 1816 1730 1806 --12114
NM_001034845chr42906 382 --1251 --
NM_001035chr111161 ----1927
NM_001035003chr411146 ------
NM_001035004chr411146 ------
NM_001035005chr18148 1482 ----
NM_001037317chr182770 2523 929 895 740 261 122 113 1687 12603 --
NM_001037872chr23739 179 99 --134 --
NM_001037954chr1183463 3301 2310 2301 1392 1173 871 492 13218 ----
NM_001039091chrX2414 327 1495 1544 --
NM_001039199chr2045028 5013 4157 415 ----1956
NM_001039348chr21125 1897 ----
NM_001039349chr21125 1897 ----
NM_001039538chr233197 2607 407 11417 13581 1548
NM_001039547chr397942 2380 2366 1936 1288 514 462 123 74 31371 446 91 37957 7866 7783 15041
NM_001039577chr164517 4283 3973 2910 1699 1087 --34333 4304 214 --
NM_001039590chrX43526 3306 1234 528 --33217 1319 1104 13401
NM_001039591chrX43526 3306 1234 528 --33217 1319 1104 13401
NM_001039618chr11115940 5616 5100 4487 4408 3854 1999 1623 1144 570 183 55283 5176 1887 1497 496 25408 4589 --
NM_001039693chr244087 1043 565 228 22691 158 --12725
NM_001039762chr1031857 867 355 1363 --1163
NM_001039840chrX105942 5529 5311 4935 4723 1646 1144 984 864 326 34788 4716 2354 --15742
NM_001039937chr1373721 3548 3027 1616 1430 766 588 14001 24177 1080 --
NM_001040057chr731494 1369 232 21476 919 31334 367 220 --
NM_001040142chr232340 538 339 2894 663 --12398
NM_001040143chr232340 538 339 2894 663 --12398
NM_001040151chr1153160 2923 1625 757 330 --11300 11398
NM_001040152chr774888 4764 3196 3158 1991 1922 1600 11423 ----
NM_001040157chr452413 2323 2049 685 157 ------
NM_001040159chr431139 484 57 1125 1360 --
NM_001040272chr922384 1812 ------
NM_001040280chr61502 ------
NM_001040284chr1695524 4720 4197 1694 1422 1248 1143 917 706 14054 12257 --
NM_001040402chr493067 3059 3023 2284 1286 904 676 509 342 1583 ----
NM_001040429chr1383504 3140 3025 2694 922 435 186 76 --12477 --
NM_001040432chr32447 363 --2335 126 --
NM_001040441chr184912 4780 4588 4087 3849 3484 3355 130 1412 11826 --
NM_001040446chr512396 --1372 --
NM_001040450chr1562880 988 758 707 619 305 22777 2231 12102 --
NM_001040453chr1562880 988 758 707 619 305 22777 2231 12102 --
NM_001040665chr7105048 4747 4718 3925 3769 3386 647 495 365 60 --13503 --
NM_001040712chr973430 3369 2852 2568 2542 2405 614 11264 --1828
NM_001042355chr1684724 4344 4228 3362 1254 1201 813 434 --13290 --
NM_001042361chr1021373 252 31547 1392 1367 11487 --
NM_001042364chr1021373 252 31547 1392 1367 11487 --
NM_001042365chr1021373 252 31547 1392 1367 11487 --
NM_001042387chr1021373 252 31547 1392 1367 11487 --
NM_001042393chr1021373 252 31547 1392 1367 11487 --
NM_001042396chr1021373 252 31547 1392 1367 11487 --
NM_001042397chr1021373 252 31547 1392 1367 11487 --
NM_001042404chr151429 1272 715 576 190 --11226 --
NM_001042406chr64814 270 227 145 --1874 --
NM_001042412chr1684724 4344 4228 3362 1254 1201 813 434 --13290 --
NM_001042453chrX21522 201 21703 441 11570 11226
NM_001042459chr32335 271 ------
NM_001042473chr1071997 1698 1523 365 300 176 44 --12162 11982
NM_001042490chr51102 1312 1295 --
NM_001042492chr1753167 2773 2643 1348 1049 22401 660 13278 --
NM_001042533chr373331 3042 2636 2626 2453 2150 1126 33285 1246 864 ----
NM_001042550chr951984 1737 1598 661 607 --1433 169
NM_001042555chr1284297 4217 4127 3595 3313 3123 1540 1405 11616 14606 1386
NM_001042599chr2137309 7222 6029 5325 4924 3048 2938 2909 2777 2515 2127 1577 589 36803 1716 616 22226 1422 --
NM_001042601chr32590 268 2747 725 33013 2708 170 --
NM_001042603chr12105035 4954 4684 4570 4465 4452 4428 4251 840 831 21832 1651 --22115 1422
NM_001042604chr374585 3375 1325 1303 1114 852 442 21621 408 --13055
NM_001042681chr142569 546 499 447 1680 ----
NM_001042682chr142569 546 499 447 1680 ----
NM_001042682chr142569 546 499 447 1680 ----
NM_001042683chr651677 1433 510 93 53 11511 ----
NM_001044722chr562336 1741 1489 760 425 377 ------
NM_001044723chr562336 1741 1489 760 425 377 ------
NM_001046chr592934 2868 2585 2239 2139 2095 585 160 58 12667 22651 2063 --
NM_001049chr1462001 1939 1637 1544 1530 130 ------
NM_001078chr13478 255 197 --1749 --
NM_001083620chr492492 2303 2182 2168 2081 1843 473 399 84 11982 ----
NM_001083621chr133783 3446 633 11158 --11087
NM_001099678chr3122550 2489 2440 2097 1606 1411 1031 805 679 374 327 204 25946 1400 11912 --
NM_001100108chr1117899 7671 5928 3190 2984 2738 2673 1735 1438 1375 1321 ------
NM_001106chr399267 8683 8206 3196 2408 1885 1648 1630 736 36866 160 151 47964 6721 3469 3232 18972
NM_001111chr172686 1677 964 957 789 616 127 --1418 --
NM_001113490chrX42246 1372 1103 1032 --23515 2505 1713
NM_001117chr1822174 147 12471 22485 2376 --
NM_001121chr1091719 1526 1434 615 578 505 386 374 255 ------
NM_001123chr102846 807 ----1579
NM_001146chr821512 1486 ----12267
NM_001151chr42262 226 ------
NM_001153chr2--1166 ----
NM_001160chr1272776 2718 2546 2246 1985 1911 1722 21750 310 11953 --
NM_001167chrX76648 6145 5974 4905 2196 413 260 24937 4787 ----
NM_001173chr14114322 4018 3846 3416 3046 3005 1754 902 673 484 190 1224 1101 24178 458
NM_001174chrX51872 1570 1561 1553 744 12158 ----
NM_001177chr1212284 --1174 --
NM_001186chr2173115 2791 2709 2133 398 275 263 12278 11238 --
NM_001198chr692045 882 689 654 536 420 367 356 41 31944 402 340 1486 --
NM_001200chr2021138 397 2747 349 ----
NM_001201chr4133783 3762 3533 3342 3007 2800 2604 1589 1238 720 628 350 199 43740 3458 3407 375 ----
NM_001204chr2157475 7463 6783 6771 6532 5390 2887 2603 2574 2434 2390 1433 1343 1094 334 25610 4953 27221 7195 --
NM_001219chr731798 1680 375 --11928 --
NM_001241chr292435 2122 2110 1899 1871 1751 662 187 105 --11764 12332
NM_001241chr292435 2122 2110 1899 1871 1751 662 187 105 --11764 12332
NM_001259chr795260 5190 4791 3896 2548 2325 2048 1836 501 34366 1901 1164 14109 --
NM_001289chrX31134 655 392 ----11507
NM_001304chr1753334 1226 1194 910 482 12826 23197 2792 --
NM_001328chr41504 ------
NM_001349chr24479 444 230 36 ------
NM_001351chr321443 222 ----1662
NM_001356chrX42024 1554 274 58 --1838 --
NM_001364chr1184128 3695 1621 1413 1232 1132 704 509 1435 ----
NM_001378chr23481 379 205 124 --192
NM_001386chr822203 1886 12377 ----
NM_001390chr1843637 3146 2823 2421 33410 2441 473 --1208
NM_001401chr941268 1123 1028 488 ------
NM_001412chrX43621 2636 1432 161 12681 23285 1185 --
NM_001419chr1984864 4694 4489 4335 4201 3410 1096 860 11485 21516 829 137
NM_001432chr493741 3514 3153 2989 965 745 595 320 32 23236 3064 33851 3814 419 --
NM_001438chr193628 3605 3453 3212 2876 2550 2536 883 406 1652 1124 --
NM_001482chr153926 281 177 1297 ----
NM_001498chr621141 1080 ----11072
NM_001527chr684608 3894 1619 1588 1530 915 547 440 --33813 1129 1000 1463
NM_001530chr1431006 816 341 ------
NM_001550chr73509 232 133 --1103 --
NM_001554chr11583 ------
NM_001564chr4299 46 ------
NM_001565chr42215 103 1811 ----
NM_001587chrX22243 670 ------
NM_001608chr24831 368 331 71 1789 1921 --
NM_001609chr1083701 3694 3680 3354 2993 1458 1146 848 1918 ----
NM_001621chr762596 2420 1204 1113 767 510 22669 753 ----
NM_001621chr762596 2420 1204 1113 767 510 22669 753 ----
NM_001649chrX32248 712 144 1226 2880 547 --
NM_001650chr18103622 3212 2865 1594 1500 1314 1103 983 937 155 13688 ----
NM_001656chr581997 1703 1556 1301 509 409 279 45 ------
NM_001663chr1432484 2274 943 --1780 --
NM_001690chr372589 2137 1759 1606 424 397 286 ------
NM_001695chr894152 3880 3236 1155 960 883 597 555 401 1778 24008 717 --
NM_001709chr114472 325 234 99 12778 --1704
NM_001714chr122508 463 ------
NM_001718chr621122 166 --1248 --
NM_001730chr1341430 1413 1354 621 ------
NM_001730chr1341430 1413 1354 621 ------
NM_001746chr542575 2424 2364 152 --12565 1478
NM_001754chr2154105 4058 3565 2889 2656 11167 21230 804 --
NM_001755chr1641558 264 114 31 11738 1142 --
NM_001759chr1244326 4207 4183 396 23640 2015 14088 --
NM_001762chr7191 ------
NM_001777chr364091 3936 3581 3390 334 120 32683 878 202 13400 1363
NM_001786chr102180 142 ------
NM_001792chr181970 ------
NM_001795chr1651533 1510 1312 1031 153 11341 --1201
NM_001806chr1962946 2355 1065 945 879 102 21914 537 ----
NM_001812chr41237 ------
NM_001854chr1----31402 1118 537 --
NM_001855chr94845 777 749 629 1694 ----
NM_001858chr654494 4359 3691 505 32 13746 24273 3529 --
NM_001874chr1284776 4599 4565 4513 3494 3233 1028 174 45199 5135 1265 769 24801 1014 --
NM_001880chr21271 ------
NM_001881chr101134 --1463 --
NM_001903chr52853 715 1575 ----
NM_001938chr151854 1470 1173 677 255 --1298 --
NM_001940chr121453 ------
NM_001957chr452257 2195 1875 1503 691 --11893 --
NM_001964chr5----1459 --
NM_001968chr41759 2790 685 ----
NM_001969chr1473105 2403 2393 1503 567 344 329 --11306 --
NM_001977chr451571 1112 697 258 107 ------
NM_001992chr552059 2039 1496 194 181 1261 ----
NM_001999chr52230 103 11410 1163 --
NM_002006chr4105366 5319 4793 4609 3734 3506 1295 1287 461 95 21763 867 25470 109 --
NM_002009chr1561902 833 725 706 452 336 32638 2080 224 1584 --
NM_002015chr1363249 2131 2081 1330 893 290 12947 11095 --
NM_002017chr1161388 1307 1155 1059 1028 197 1887 1161 --
NM_002025chrX189164 8225 8130 7996 7803 7238 7203 7142 7136 6350 6285 5870 3162 3156 3000 2009 1546 959 15839 22066 1694 --
NM_002031chr61207 ------
NM_002035chr1853823 3027 2757 869 39 --13889 --
NM_002040chr2152906 2177 1090 387 59 ------
NM_002044chr1571623 1390 1227 1127 572 472 247 ------
NM_002063chrX1228 21237 997 ----
NM_002069chr731364 698 298 --11184 --
NM_002094chr161282 ------
NM_002128chr1372199 1970 1925 1860 660 353 176 12312 ----
NM_002130chr531707 1466 1453 --191 1149
NM_002137chr741511 506 327 64 1572 1673 11924
NM_002140chr9----1956 --
NM_002143chr11758 ------
NM_002147chr17--1209 ----
NM_002158chr293849 3672 3659 3521 2894 2604 1281 455 218 33539 2441 381 ----
NM_002165chr201407 ------
NM_002199chr441005 872 839 333 ------
NM_002203chr543450 3283 3245 661 23830 3484 1558 --
NM_002210chr243574 2942 1219 490 --33393 3210 2914 --
NM_002214chr7165564 5486 5419 5235 4758 4007 3979 3960 3613 2268 1713 838 253 173 66 47 13942 1707 --
NM_002223chr12103892 3805 3062 2495 1462 1236 705 511 471 162 13749 14010 --
NM_002233chr111141 ------
NM_002247chr1042231 1897 273 76 82160 2064 2052 2038 2030 2016 1989 822 ----
NM_002264chr374268 4156 3474 1945 1059 1039 211 1922 24248 1315 --
NM_002270chr595338 5306 4806 4790 4262 4236 4190 798 757 25195 5177 24673 4414 --
NM_002271chr1362412 2315 1732 978 767 485 1755 ----
NM_002290chr671409 1249 1124 954 589 527 82 11435 1374 --
NM_002293chr152055 1726 831 684 119 --21763 731 --
NM_002303chr11112 ------
NM_002310chr576421 6034 4035 4019 2040 1167 537 --26337 5215 1913
NM_002332chr121730 ------
NM_002349chr221485 1055 --11101 21265 291
NM_002351chrX61569 1309 620 261 73 38 21612 367 ----
NM_002356chr672744 2718 2454 2332 1133 994 24 --11967 --
NM_002359chr1713489 ------
NM_002374chr233197 2607 407 11417 13581 1548
NM_002381chr24880 333 240 101 --11022 --
NM_002384chr181943 ------
NM_002392chr123227 175 134 ------
NM_002395chr641519 1442 1352 55 21012 353 1475 11065
NM_002431chr142323 259 176 ----
NM_002451chr923576 572 32896 626 212 1834 --
NM_002465chr12172 ------
NM_002480chr1241410 1356 269 60 11072 11090 --
NM_002486chr972149 2123 954 556 373 288 50 --12168 --
NM_002499chr1512149 1672 ----
NM_002515chr1431758 817 349 21943 109 ----
NM_002519chr113579 506 252 31178 997 440 ----
NM_002524chr131085 895 882 1188 ----
NM_002546chr81624 1779 ----
NM_002556chr1112167 --21502 560 --
NM_002572chr11--1376 ----
NM_002577chr384045 3280 2801 1424 1417 1201 420 177 33430 733 130 ----
NM_002581chr995694 4596 4313 4115 3711 3549 1896 1295 957 25106 2201 ----
NM_002594chr20--22408 816 1650 --
NM_002595chr1241940 1778 1264 545 2330 256 ----
NM_002623chr20----161 --
NM_002628chr321094 189 11215 ----
NM_002635chr12--1114 ----
NM_002645chr1133127 2659 1133 32592 682 189 --1499
NM_002655chr894697 4453 3704 1848 1401 538 512 425 56 11478 ----
NM_002687chr1441276 966 230 173 ------
NM_002715chr56987 382 367 352 296 75 1427 1822 --
NM_002720chr161220 ------
NM_002731chr143160 2641 2067 1259 22475 450 ----
NM_002734chr1742309 2094 807 370 ------
NM_002736chr7102126 2012 1993 1563 1527 664 440 358 249 226 --11645 1309
NM_002737chr1756698 5628 5460 1333 1012 --1681 --
NM_002745chr2274413 4305 3161 2982 1513 1382 498 11364 34046 3143 1409 --
NM_002747chr1821867 1635 21894 172 ----
NM_002765chrX2414 327 1495 1544 --
NM_002819chr1911203 ------
NM_002822chr1261709 1536 1482 1367 1271 640 ------
NM_002824chr121478 ------
NM_002833chr1531573 1471 585 ------
NM_002834chr1263842 3612 3546 2921 2805 752 13274 1505 13695
NM_002835chr71550 ------
NM_002837chr12164445 4424 3906 3871 3820 3047 3040 3001 1579 1532 1432 661 276 160 150 114 21572 1031 24384 4079 --
NM_002839chr973430 3369 2852 2568 2542 2405 614 11264 --1828
NM_002845chr181115 ------
NM_002848chr1221254 359 21149 1116 1131 --
NM_002869chr1141930 1877 1854 298 --1243 --
NM_002874chr942474 1970 1876 427 1608 2279 75 --
NM_002892chr1421311 227 ------
NM_002902chr152140 43 1603 ----
NM_002906chr1182385 2338 2242 1843 1501 1473 468 349 12074 --1895
NM_002941chr331602 1351 67 11011 11498 --
NM_002956chr1251244 1079 912 551 329 ------
NM_002971chr32998 154 21203 376 ----
NM_002973chr122544 216 ------
NM_002977chr242681 2104 1035 893 13132 23075 809 --
NM_002979chr13897 755 671 ------
NM_002994chr451709 1681 1448 767 663 ------
NM_003017chr641266 929 386 285 ------
NM_003020chr15------1112
NM_003031chr1621016 276 ------
NM_003040chr71105 ------
NM_003054chr101317 ------
NM_003069chrX1635 ------
NM_003071chr351991 835 683 585 225 --1804 --
NM_003091chr201292 ------
NM_003099chr1565789 5519 1915 1692 901 398 56485 6362 4852 2300 833 35841 5714 1755 26222 4995
NM_003108chr276987 5956 5537 5410 5342 846 89 14582 ----
NM_003112chr773035 2692 1223 1142 758 454 393 --12526 --
NM_003128chr222166 866 1922 1718 --
NM_003155chr862592 838 809 744 664 319 32765 927 875 ----
NM_003161chr1733537 2452 1431 22786 2270 32954 1383 281 --
NM_003162chr21831 11047 2365 349 --
NM_003199chr1855620 4284 2210 573 559 54855 4631 2055 495 364 11369 11577
NM_003221chr643455 1158 283 157 1664 23366 2926 --
NM_003222chr2021219 1107 ------
NM_003234chr332194 1550 171 2964 939 ----
NM_003246chr1511813 ------
NM_003250chr17--1368 ----
NM_003262chr3115190 5159 4851 4790 3950 3253 2112 1743 1101 738 348 --21064 222 24018 3983
NM_003272chr13698 269 217 ----1539
NM_003274chr2152449 2402 2357 2245 2157 ------
NM_003292chr162116 849 691 645 573 354 11964 11725 --
NM_003298chr375833 5758 5474 4816 4657 1933 1109 15399 1806 --
NM_003304chr361292 1242 1032 468 65 29 ------
NM_003319chr23966 666 163 ------
NM_003326chr132671 2626 809 11897 21109 774 --
NM_003338chr102717 416 11682 --1521
NM_003342chr1782923 2586 2339 2270 1125 1111 285 23 12061 23284 655 --
NM_003344chr721530 1197 ------
NM_003369chr1152716 2303 334 87 81 --12769 --
NM_003376chr611768 ------
NM_003376chr611768 ------
NM_003392chr343816 3163 2796 669 1179 1561 --
NM_003407chr19--1611 ----
NM_003411chrY31406 455 235 11446 --1338
NM_003412chr3113076 3033 2893 2776 2761 2742 2690 1236 978 861 815 ------
NM_003413chrX41513 1270 723 587 11473 11328 --
NM_003418chr31679 ------
NM_003423chr1962258 1963 1779 1761 1656 993 1911 2336 86 --
NM_003427chr6----1670 --
NM_003462chr111773 ------
NM_003463chr663248 2983 2062 1202 1072 286 13367 --13407
NM_003468chr283731 3666 3399 2989 2840 930 696 273 ------
NM_003469chr21325 ------
NM_003489chr2153336 1111 1104 242 102 --11291 1433
NM_003503chr12993 104 1863 1465 --
NM_003557chr131445 1346 1321 ------
NM_003558chr91665 ------
NM_003563chr171162 11084 ----
NM_003566chr1273384 2671 2193 1029 348 312 231 21271 1052 --11369
NM_003569chr63723 282 215 1458 ----
NM_003574chr1835404 5367 827 23570 1837 64839 4318 4248 2058 1709 618 --
NM_003583chr1293863 3319 2996 2969 1310 1230 301 102 25 11353 13922 --
NM_003589chr1341191 1064 521 251 ----11040
NM_003590chr283935 3265 2982 2961 1521 1043 742 416 23162 2923 ----
NM_003591chr103386 377 92 ------
NM_003615chr383973 3272 3039 1421 1021 699 460 360 43835 2439 1554 1531 1547 1677
NM_003622chr1242578 2088 720 207 --22676 2122 --
NM_003630chr62713 246 ------
NM_003670chr331469 1343 112 11284 ----
NM_003672chr161879 1629 1588 1426 498 141 21744 182 ----
NM_003679chr143488 3236 1393 780 32902 255 119 ----
NM_003701chr131901 ------
NM_003718chr7196 ------
NM_003758chr1531225 1213 390 21635 1473 ----
NM_003758chr1531225 1213 390 21635 1473 ----
NM_003759chr484325 4168 3916 3457 1517 1505 1195 382 ----12968
NM_003762chr141144 1129 89 63 2552 199 ----
NM_003772chr1141252 958 479 191 21078 512 1314 --
NM_003787chr1851695 1617 1461 1422 1049 --1544 --
NM_003794chr33727 284 195 ------
NM_003816chr821366 415 ------
NM_003829chr91993 --1333 --
NM_003831chr1851677 732 319 223 217 --21586 302 1660
NM_003864chr4126 1138 ----
NM_003878chr8263 38 ----1167
NM_003884chr311374 2707 119 1656 --
NM_003887chr242134 2108 178 73 22276 1871 --1663
NM_003895chr2131789 1613 553 22130 1970 ----
NM_003913chr634298 1538 1269 11453 1641 13541
NM_003921chr141750 1115 57 32 ----1176
NM_003930chr742232 2046 647 410 1246 1519 --
NM_003934chr941050 1008 986 819 1870 ----
NM_003941chr722075 1552 11832 1847 --
NM_003961chr16------1197
NM_003966chr597256 7036 6832 6645 2197 1758 1420 1018 62 37549 1469 964 37062 2382 1312 --
NM_003972chr1041094 1016 443 394 1467 ----
NM_003994chr1284251 4045 3924 1490 1458 454 144 46 ------
NM_004006chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004007chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004009chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004010chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004011chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004012chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004013chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004014chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004015chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004016chrX72370 2192 2000 1969 1948 1702 245 32301 1811 527 11883 1238
NM_004017chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004018chrX72370 2192 2000 1969 1948 1702 245 32301 1811 527 11883 1238
NM_004020chrX72456 2278 2086 2055 2034 1788 331 32387 1897 613 11969 1324
NM_004021chrX72370 2192 2000 1969 1948 1702 245 32301 1811 527 11883 1238
NM_004022chrX72370 2192 2000 1969 1948 1702 245 32301 1811 527 11883 1238
NM_004023chrX72370 2192 2000 1969 1948 1702 245 32301 1811 527 11883 1238
NM_004028chr18103622 3212 2865 1594 1500 1314 1103 983 937 155 13688 ----
NM_004035chr1784943 4113 3901 1904 1281 761 283 245 35224 4963 88 11412 1294
NM_004063chr8193 ------
NM_004064chr1251341 1269 1079 881 843 --1514 --
NM_004080chr73472 419 41 ----1911
NM_004085chrX3626 308 219 ------
NM_004094chr1453023 2123 1002 759 687 --12621 11144
NM_004100chr662203 894 885 716 692 506 12695 ----
NM_004105chr21125 1897 ----
NM_004109chr1122180 2040 62022 1751 480 140 108 51 ----
NM_004114chrX21132 288 ------
NM_004124chr14123398 3314 3067 3001 2212 2197 1261 1001 896 616 473 271 13330 ----
NM_004133chr872576 2561 2183 1897 1693 328 71 22597 2401 1603 --
NM_004136chr1573249 2814 2647 2294 810 151 31 --138 --
NM_004156chr8--1439 ----
NM_004161chr21526 --21564 1198 --
NM_004171chr11119585 8627 7965 7790 7767 7302 3276 2997 1354 472 163 58982 7125 7005 5985 3418 2724 56 18223
NM_004187chrX31487 1325 1144 ------
NM_004215chr82590 397 ------
NM_004229chrX31918 1806 1790 11412 ----
NM_004232chr1883424 2650 2478 1356 1308 1214 857 845 1103 11138 --
NM_004233chr61502 ------
NM_004235chr92684 151 ------
NM_004261chr1172 --1291 --
NM_004272chr551829 1780 1421 568 467 ------
NM_004274chr1443008 2699 844 467 22548 2193 12355 --
NM_004279chr71232 1561 ----
NM_004282chr62690 609 ----173
NM_004291chr51430 ------
NM_004293chr983621 3613 3372 3253 1157 799 748 376 11476 --1111
NM_004311chr1053117 3067 2057 729 233 ----1558
NM_004331chr862671 1774 1721 1639 293 135 1381 --1836
NM_004337chr881830 1513 1447 1416 727 572 229 127 22108 1998 ----
NM_004338chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_004342chr772230 2128 1924 1509 1466 892 270 21612 782 1681 --
NM_004379chr251746 1496 1314 1190 277 ------
NM_004384chr562336 1741 1489 760 425 377 ------
NM_004386chr1911758 --11908 --
NM_004404chr251956 1868 1771 1720 554 --11964 11700
NM_004412chr1075998 5659 5555 5012 2344 2116 881 42210 1923 1912 1902 15024 --
NM_004419chr1011014 ------
NM_004430chr812287 --12223 --
NM_004440chr641924 1510 1494 472 11327 ----
NM_004458chrX72467 2442 2408 2327 943 712 554 31957 731 600 ----
NM_004464chr493528 3444 3379 3323 2843 1163 1000 620 536 32778 2631 1432 23592 1244 --
NM_004482chr24878 667 265 107 2323 194 ----
NM_004500chr1421452 258 1544 ----
NM_004501chr1103998 3684 3295 3165 3126 3026 1113 715 587 545 21227 867 --12592
NM_004523chr1031543 1504 1152 ----11408
NM_004525chr21580 2185 27 ----
NM_004535chr2041512 1402 1320 1307 11267 11419 --
NM_004565chr11743 ------
NM_004575chr4----21595 1376 --
NM_004580chr1511397 ------
NM_004582chr11271 1139 ----
NM_004583chr171141 ------
NM_004586chrX44510 4174 3686 45 35262 4313 3922 23777 1220 --
NM_004595chrX--1127 ----
NM_004612chr981782 1657 1552 1283 1211 1199 750 557 --1305 --
NM_004622chr242440 2088 1702 542 11865 --1434
NM_004660chrY31500 272 59 --1127 --
NM_004666chr661482 1198 573 461 395 147 --136 --
NM_004671chr182237 98 ------
NM_004709chrX31755 1370 289 ------
NM_004713chr141815 ------
NM_004721chr31349 ------
NM_004726chrX95532 5409 5020 4415 2250 1529 1039 835 311 25391 613 --15790
NM_004745chr8126679 6609 5830 5750 5090 4530 4505 2803 1535 1526 1238 658 55157 4250 2294 1303 394 15634 1371
NM_004748chr1594186 3371 2603 1617 1476 1355 1209 536 391 1462 13411 --
NM_004760chr762291 2168 1946 515 128 99 ------
NM_004768chr151180 955 749 355 189 ------
NM_004775chr1861837 1804 1704 647 525 294 --11868 --
NM_004786chr18----157 --
NM_004792chr21163 --1180 --
NM_004808chr1083345 3286 3201 2892 2660 1288 134 121 13328 ----
NM_004815chr184861 4678 4415 4372 1789 1702 1238 1221 ------
NM_004857chr14114737 4454 4341 4192 4170 4061 3970 3658 3527 1379 1170 13209 1374 --
NM_004865chr6191 ------
NM_004866chr593430 1570 1301 1203 812 578 564 521 253 12022 11710 --
NM_004869chr1841536 1339 1230 581 ------
NM_004873chr1423190 2905 11090 ----
NM_004897chr101635 ------
NM_004904chr796145 5903 5767 4662 4390 2240 2150 2061 1068 46205 5619 5219 2039 1405 --
NM_004929chr8152 ----1119
NM_004949chr1862123 1731 1574 1545 1407 250 22037 78 1161 11397
NM_004956chr7143622 3482 3197 1603 1336 1241 1190 1096 1076 655 610 597 520 354 --11213 13268
NM_004958chr12914 287 ------
NM_004967chr4--1538 ----
NM_004985chr12114031 3911 3881 3860 3718 2876 2767 966 881 797 704 13979 23799 1127 --
NM_004995chr14--11539 ----
NM_004999chr662998 1516 1175 1120 1041 377 1416 11048 --
NM_005006chr251025 919 306 243 104 ----138
NM_005023chr581295 1185 1006 573 482 475 371 42 ------
NM_005056chr12105279 5198 4928 4814 4709 4696 4672 4495 1084 1075 22076 1895 --11666
NM_005063chr1053815 3804 3452 3163 2647 13493 1376 13672
NM_005065chr1455402 4699 3952 1922 179 33410 1302 1285 34563 1655 520 11956
NM_005079chr863115 2933 2756 2600 1189 970 22891 962 11005 --
NM_005086chr1251558 1541 1427 682 527 1735 --1577
NM_005116chr2094224 3922 3408 3374 3307 3253 1482 1248 483 1889 ----
NM_005126chr361915 1898 1852 1826 1627 147 --136 --
NM_005154chr153144 88 75 1254 ----
NM_005156chr994849 4402 3900 3391 1282 861 746 107 39 34513 4213 740 ----
NM_005160chr22116330 5513 5195 4995 4216 2730 1767 1324 951 571 346 ----35266 4281 1461
NM_005190chr661156 342 297 263 176 97 ------
NM_005197chr14105888 5597 5476 5396 4720 2326 1771 1136 951 645 11884 ----
NM_005207chr2273742 3701 3630 3447 3007 2817 934 33296 2514 972 ----
NM_005235chr2137309 7222 6029 5325 4924 3048 2938 2909 2777 2515 2127 1577 589 36803 1716 616 22226 1422 --
NM_005239chr2131374 548 478 1541 ----
NM_005243chr22175 ------
NM_005249chr14------162
NM_005259chr261403 1396 1376 1325 533 24 11479 ----
NM_005271chr1061211 1137 898 481 390 44 1808 ----
NM_005277chr431427 428 378 11477 21745 485 1411
NM_005339chr452958 1639 1504 1139 348 22639 341 11479 --
NM_005358chr1341399 405 297 119 11458 21568 1366 --
NM_005359chr1885859 5697 4416 4155 2073 1829 1812 498 --1723 14318
NM_005382chr8--1348 ----
NM_005385chr352495 2352 2250 494 277 12631 ----
NM_005400chr242891 2793 2209 1950 22236 1878 32744 2113 2018 --
NM_005402chr761474 1330 739 552 217 49 ------
NM_005410chr51662 1506 --1319
NM_005433chr1861963 1792 828 781 434 243 12784 12649 1725
NM_005436chr10103617 3269 3235 3174 3040 3034 1571 1304 452 97 --24142 3977 23298 679
NM_005440chr1742657 2476 2286 1205 23011 813 12618 --
NM_005455chr121715 1489 ------
NM_005494chr72412 108 ------
NM_005497chr1775655 4583 3725 2151 1090 760 67 --15951 --
NM_005502chr933225 2135 358 22075 1184 ----
NM_005504chr12106544 5084 4862 4809 4629 2647 1678 1211 211 197 22503 2114 14176 --
NM_005513chr361568 1215 1063 976 639 556 ------
NM_005566chr111428 ------
NM_005578chr395020 4745 4483 4239 3477 1905 1834 864 281 21579 674 --14656
NM_005587chr155945 927 738 337 301 ----1848
NM_005596chr956255 5003 974 235 76 --15343 15790
NM_005605chr82229 118 ------
NM_005623chr172487 125 1441 ----
NM_005626chr11130 ------
NM_005665chr1124902 4443 4286 3820 3078 1935 1358 1306 1233 1116 904 75 11289 ----
NM_005668chr564476 4457 4209 3783 1359 1311 --11695 --
NM_005688chr32314 260 ------
NM_005694chr32103 30 ------
NM_005708chr131370 ------
NM_005721chr231007 743 47 --2974 324 --
NM_005722chr272076 2055 2002 1892 980 936 590 12246 --11522
NM_005725chr152266 1544 983 376 109 --1194 --
NM_005746chr772621 2031 2020 1890 939 805 298 12487 ----
NM_005748chr1292990 2932 2834 2236 1361 1015 715 305 112 42328 1145 972 787 ----
NM_005779chr573357 3305 2983 2673 1088 325 289 ----13161
NM_005786chr18--1515 ----
NM_005795chr252944 2711 1915 97 65 1526 ----
NM_005813chr2112665 2446 2377 2354 2299 2067 787 400 242 119 63 --22015 463 1717
NM_005832chr341061 574 193 23 ------
NM_005833chr91144 ------
NM_005839chr12212 108 ------
NM_005843chr251895 1852 1713 1285 656 1646 ----
NM_005863chr1021383 487 ------
NM_005868chr741785 542 530 191 11741 12375 --
NM_005888chr12--1114 ----
NM_005898chr1162655 2244 2036 924 799 296 12931 1397 --
NM_005899chr1781358 1220 1185 564 442 427 273 24 ------
NM_005901chr1897775 7059 6532 6511 6119 5550 3198 2952 900 46473 1459 1274 973 27829 6182 37870 5424 3395
NM_005902chr1544466 4027 3715 2932 ----14054
NM_005903chr5125190 5021 4865 4558 4431 4329 3211 1053 696 588 546 125 1752 23793 1277 13768
NM_005930chr144619 353 117 60 2909 204 1774 --
NM_005941chr874154 3743 3586 2834 1298 1158 854 44124 4073 4012 772 2551 48 --
NM_005962chr1021539 1486 11981 1910 1469
NM_005962chr1021539 1486 11981 1910 1469
NM_005966chr221468 51 22220 739 ----
NM_005977chr132804 661 --1678 --
NM_005999chr131212 1184 524 11241 1342 --
NM_006007chr9104007 3548 3209 1622 1582 940 856 661 262 134 24404 3373 13541 --
NM_006016chr65746 505 288 241 46 ----11552
NM_006036chr282267 2087 1796 1623 533 396 274 89 12197 ----
NM_006041chr17193 ------
NM_006043chr161675 ------
NM_006054chr111560 --21493 580 --
NM_006070chr31151 ------
NM_006073chr641747 1544 1503 320 12155 --1678
NM_006080chr782709 2438 2346 2117 813 649 166 54 --12357 --
NM_006095chr473534 3492 3434 3425 1735 359 325 13257 23125 1215 --
NM_006106chr1122919 2260 11054 2685 512 --
NM_006141chr1662469 2430 1917 1033 851 209 22333 41 11777 --
NM_006153chr32552 146 ------
NM_006154chr1552666 2216 1074 1036 299 --1383 --
NM_006155chr251956 1868 1771 1720 554 --11964 11700
NM_006157chr11----1118 --
NM_006158chr851768 1748 649 123 33 --21279 134 --
NM_006166chr12102653 2378 2059 1926 1799 1710 1699 478 260 114 ------
NM_006183chr121208 ----1589
NM_006195chr921317 270 1552 ----
NM_006196chr2193 ------
NM_006197chr842178 611 368 265 22049 744 11984 --
NM_006203chr5105570 4602 3516 3440 2170 1290 815 685 516 485 35027 4386 1431 --15175
NM_006206chr472965 2734 2494 2377 1034 822 366 1584 11849 --
NM_006212chr1125438 5375 5336 3844 2055 1785 1559 1406 1313 1116 955 35 ------
NM_006226chr241366 1138 1023 476 11118 21330 1038 --
NM_006243chr12672 302 199 --1279
NM_006251chr543339 3263 2924 1161 2444 93 1478 --
NM_006252chr1137533 7304 6613 6101 4811 2716 2653 2455 1653 1297 1047 599 79 55452 5283 2845 2829 635 ----
NM_006265chr851536 1246 1097 588 582 122 11416 --
NM_006267chr251828 1512 1288 163 136 --1398 --
NM_006275chr2062305 2131 800 627 245 228 1858 21878 214 --
NM_006279chr1----1362 --
NM_006282chr2074634 4063 3743 1597 1558 1354 325 11745 1284 --
NM_006283chr894207 3780 3587 3422 3317 1874 1686 343 84 14912 13225 --
NM_006287chr262291 2284 2191 2078 889 689 11895 1681 --
NM_006299chr61231 ------
NM_006306chrX84642 4275 4157 3796 2318 2189 1203 451 33767 2116 675 14267 15047
NM_006322chr134809 384 306 272 ------
NM_006325chr121181 1834 ----
NM_006333chr23433 222 71 --1652 --
NM_006352chr122020 1829 ------
NM_006363chr203143 128 69 1457 1569 --
NM_006372chr62381 82 ------
NM_006379chr732038 1703 1606 11762 ----
NM_006380chr1784273 4207 3719 3084 3039 1435 841 689 14323 11761 14003
NM_006393chr1084533 4124 3838 3762 2909 743 696 411 ------
NM_006416chr64743 554 528 253 ------
NM_006457chr454143 3776 2910 1089 960 23096 333 ----
NM_006469chr151240 536 456 415 327 11395 31572 1494 1023 11359
NM_006471chr181231 1301 1201 --
NM_006475chr131127 ------
NM_006480chr5--1509 ----
NM_006482chr1293863 3319 2996 2969 1310 1230 301 102 25 11353 13922 --
NM_006489chr1431758 817 349 21943 109 ----
NM_006496chr151997 1751 1735 560 389 1551 ----
NM_006504chr1012839 12720 ----
NM_006520chrX71654 1462 1345 1101 688 496 334 11456 ----
NM_006534chr2033380 660 271 --22983 2538 --
NM_006538chr284156 3882 3809 2848 1674 1507 1263 375 11559 ----
NM_006540chr831289 1254 1133 ------
NM_006544chr14105613 5334 4809 4752 4241 2404 1790 1123 497 130 34688 4135 2344 23957 2411 --
NM_006547chr752041 2033 1396 1371 1362 1422 ----
NM_006559chr1--1874 ----
NM_006565chr16--1809 ----
NM_006572chr1742715 2465 1143 830 ------
NM_006575chr141393 11267 1319 --
NM_006576chr12169 ------
NM_006595chr1121792 574 --1340 --
NM_006599chr16137948 7490 7167 7038 6685 6614 5920 5054 2137 1505 744 701 538 76977 6013 5962 3291 720 447 176 48198 6556 5581 228 --
NM_006602chr20--3261 247 237 1314 --
NM_006620chr674837 4420 4097 1621 1427 826 399 34490 3422 45 23316 1903 --
NM_006625chr131201 256 140 11055 ----
NM_006625chr131201 256 140 11055 ----
NM_006625chr131201 256 140 11055 ----
NM_006626chr961976 1823 1078 925 693 381 12696 12019 --
NM_006628chr1574400 3809 2980 845 790 582 339 ----13926
NM_006629chr1842463 1031 860 806 1377 12055 --
NM_006646chr1372838 2285 2227 835 764 582 320 1383 ----
NM_006654chr1284297 4217 4127 3595 3313 3123 1540 1405 11616 14606 1386
NM_006660chr15159 --1314 --
NM_006670chr64574 559 485 437 ------
NM_006682chr7112608 2575 2313 2164 2141 1910 1836 1054 982 938 319 62810 2722 2016 830 718 97 ----
NM_006699chr152397 1920 1733 1033 587 1509 12200 --
NM_006700chr12--1770 ----
NM_006717chr963373 2675 2205 2142 2106 523 33363 3103 2339 ----
NM_006721chr102846 807 ----1579
NM_006722chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_006726chr43971 133 86 ------
NM_006729chrX55623 4013 1671 1338 1145 --24983 2083 --
NM_006750chr16118053 7642 7004 6046 5726 5386 2757 1820 1710 903 128 37789 5070 2088 --12897
NM_006751chr24906 680 397 290 ------
NM_006754chr71254 ------
NM_006756chr85989 943 507 440 195 2587 54 ----
NM_006766chr81725 1286 22251 1077 --
NM_006773chr251398 484 312 254 30 21642 1124 ----
NM_006777chrX32882 2642 314 11927 1144 --
NM_006808chr91136 ------
NM_006814chr2082429 2300 2285 918 626 479 428 136 --21846 198 --
NM_006815chr122372 200 11181 ----
NM_006823chr8--11201 ----
NM_006838chr1241303 1170 470 267 31799 490 350 11720 --
NM_006872chr21144 ------
NM_006873chr2103453 3412 2412 2384 1125 1113 574 224 92 23 43075 2170 1267 1064 ----
NM_006885chr1653163 2855 2596 1276 369 --1684 --
NM_006893chr11100 ------
NM_006902chr152583 2112 2047 1309 688 1172 ----
NM_006915chrX112384 2334 1593 1014 710 603 586 488 338 174 66 1628 1795 --
NM_006918chr11105459 5278 5183 5142 4554 4129 910 815 566 475 45470 2106 1603 1119 22345 482 --
NM_006922chr242594 2347 2286 2260 22081 294 ----
NM_006924chr1783609 3246 1326 1316 1123 1011 956 491 13807 13343 --
NM_006930chr561688 1465 1349 766 463 88 21413 378 ----
NM_006947chr461479 551 226 196 120 69 ------
NM_006948chr2182311 2262 2155 1984 520 479 421 297 22057 415 --1269
NM_006951chr101323 ------
NM_006955chr1043366 2351 557 424 2481 103 ----
NM_006981chr992740 2623 2232 2121 1061 929 867 333 327 --12333 --
NM_007005chr941592 430 356 321 1490 1464 --
NM_007006chr1652815 2535 2514 531 193 --13242 --
NM_007007chr1274488 4056 3188 510 368 244 165 14172 34589 4297 3966 --
NM_007017chr51265 ------
NM_007023chr211114 1974 ----
NM_007038chr21125264 4650 4373 3737 2086 2072 1921 1800 1706 1326 1230 766 11821 24325 33 15587
NM_007050chr20107472 7301 6902 6810 4979 4961 3087 2973 1134 76 16876 45297 4927 3226 1587 --
NM_007054chr543820 577 141 92 11298 1542 21098 343
NM_007106chr1352447 2367 2112 1087 707 1878 ----
NM_007114chr362430 1099 1047 849 729 355 --12926 --
NM_007125chrY91454 1248 1111 1099 959 552 517 391 273 11212 11297 --
NM_007159chr351768 1662 1492 1378 213 --2610 360 1382
NM_007173chr1122074 2047 12153 21592 162 --
NM_007175chr853396 2884 2719 2575 215 12896 33468 2367 2292 --
NM_007214chr641240 446 265 244 1146 ----
NM_007222chr851617 1367 1255 633 83 11719 ----
NM_007249chr13169143 8445 7544 7195 7123 6767 3720 3686 3613 3353 3170 1896 1847 1714 1038 168 59352 8457 6418 2991 182 27131 3307 --
NM_007269chr12568 487 --1175 --
NM_007292chr1784943 4113 3901 1904 1281 761 283 245 35224 4963 88 11412 1294
NM_007331chr472788 2762 2713 2549 2492 595 562 12388 1878 --
NM_007345chr1882199 2064 1783 1726 888 748 555 410 12364 ----
NM_007347chr1572941 2572 910 776 614 404 311 13146 1601 --
NM_007373chr10--31614 1469 1449 ----
NM_012095chr1052737 2313 1216 1129 312 ----13360
NM_012096chr341428 1082 1073 69 43482 2527 1061 517 22375 160 --
NM_012102chr142569 546 499 447 1680 ----
NM_012111chr141214 ------
NM_012115chr63429 397 120 1460 ----
NM_012120chr652753 2669 2030 1068 667 1411 ----
NM_012141chr1373721 3548 3027 1616 1430 766 588 14001 24177 1080 --
NM_012153chr1132019 1004 598 ----12567
NM_012158chr1351498 1193 600 431 81 150 ----
NM_012180chr42621 183 ------
NM_012207chr105849 802 416 343 101 1408 1864 --
NM_012210chr941552 1209 1106 1030 11316 ----
NM_012214chr296332 6317 4878 4407 1859 1024 1015 243 162 15029 12104 15328
NM_012216chrX121 ------
NM_012234chr383293 2723 2682 2302 935 781 759 243 2835 473 21402 130 --
NM_012238chr1051694 1398 1187 1143 311 --1154 --
NM_012243chr11877 1888 ----
NM_012247chr102809 688 1798 ----
NM_012249chr243214 1432 1416 645 22660 291 12396 --
NM_012250chr1131379 1218 346 11091 --11210
NM_012252chr7135177 5157 4470 4200 3779 3757 3505 3370 2127 2007 1482 336 280 95394 5104 4008 3329 3265 2034 1955 1179 1052 24692 594 --
NM_012262chr1115180 4841 4800 4388 3544 3494 3294 1305 1155 829 440 1614 23423 3271 --
NM_012281chr742397 1516 747 552 32339 2266 1661 22275 870 --
NM_012287chr394053 3804 3774 3377 3295 1792 1095 654 497 11221 ----
NM_012290chr221147 218 --1242 --
NM_012294chr753979 3943 2970 1158 458 --13226 --
NM_012297chr412137 ------
NM_012308chr1122579 1979 1634 ----
NM_012309chr1144564 4336 3177 726 11838 ----
NM_012311chr101431 ------
NM_012328chr741474 1434 1273 454 1124 11250 --
NM_012334chr574604 4433 4001 3474 3108 2947 332 --23653 883 --
NM_012345chr1381873 1838 1466 1375 547 287 181 27 21813 1244 ----
NM_012347chr672949 2373 2258 2030 782 693 599 12087 ----
NM_012416chr931166 889 205 145 ----
NM_012419chr61414 ------
NM_012431chr723022 899 22246 122 2963 674 --
NM_012434chr621639 466 --1348 --
NM_012446chr5--1237 ----
NM_012464chr432851 1999 852 22707 1947 1427 12463
NM_013229chr1272776 2718 2546 2246 1985 1911 1722 21750 310 11953 --
NM_013231chr1483688 1624 1309 1102 1006 917 717 215 11171 ----
NM_013233chr231348 1334 169 11092 11435 --
NM_013255chr7128741 8006 7120 6504 6371 6039 5849 5715 2423 1652 1363 870 18218 12252 --
NM_013257chr831742 562 389 31891 528 93 ----
NM_013269chr1253730 3026 1021 614 129 23829 3258 21309 53 --
NM_013280chr111235 ------
NM_013281chr2021435 138 --21022 317 --
NM_013293chr71661 ------
NM_013322chr72664 273 --11184 31176 1103 328
NM_013357chr83627 610 180 1300 ----
NM_013372chr1533056 2817 2303 23344 2317 22697 2191 13064
NM_013373chr2211030 ------
NM_013374chr352879 1043 833 458 128 12200 12692 --
NM_013377chr12------1644
NM_013381chr1232301 1892 1793 22203 1583 ----
NM_013386chr131600 1288 130 --130 --
NM_013400chr71999 ------
NM_013423chrX3834 523 515 11120 ----
NM_013427chrX3834 523 515 11120 ----
NM_013436chr22284 225 --1623 --
NM_013438chr931374 382 44 21769 556 1460 --
NM_013449chr1242761 2498 1926 261 ----1721
NM_013986chr22175 ------
NM_013989chr1473728 3254 3207 3180 1734 1639 1602 43227 2052 970 351 11361 14864
NM_013995chrX62459 2201 2134 1898 989 961 12398 1784 --
NM_014003chr161377 ------
NM_014011chr261987 990 971 929 874 723 42097 1655 923 882 ----
NM_014016chr361470 1380 1186 608 209 145 11168 ----
NM_014021chr1103419 2680 2605 1053 1029 991 980 781 705 96 12508 ----
NM_014048chr16134755 4099 3966 3452 3328 3223 2125 2090 1806 1159 938 866 716 13754 ----
NM_014057chr921382 1064 --11074 11467
NM_014071chr201408 ------
NM_014079chr3171 ------
NM_014106chr1572919 1938 1119 1088 966 453 299 12004 ----
NM_014109chr831248 928 811 21224 309 1187 1282
NM_014112chr8114653 3711 3435 1721 1346 1273 1258 1232 1026 987 60 33851 1545 892 13475 --
NM_014153chr162597 568 ------
NM_014154chr351608 1565 1276 157 69 11631 ----
NM_014155chr1154583 1705 1315 1217 233 46984 2908 1959 264 15991 --
NM_014171chr21287 1171 --1103
NM_014217chr191865 1588 1573 1548 1314 622 405 326 63 ------
NM_014243chr41777 11397 11530 --
NM_014245chr341032 1013 698 308 --1206 --
NM_014267chr113613 567 96 2175 122 --1309
NM_014283chr131215 1087 438 11510 21242 409 --
NM_014313chr161598 1126 513 469 259 232 ------
NM_014319chr1241427 1305 360 317 11912 --1192
NM_014322chr121006 360 11029 1469 --
NM_014323chr22--1846 ----
NM_014331chr4156949 6360 5990 5952 5653 5426 5220 2651 2135 2091 1971 1963 834 524 178 47524 5097 4833 2901 26822 5057 24917 2452
NM_014363chr133817 393 222 1980 --11095
NM_014372chr141542 808 366 235 --11815 --
NM_014374chr71999 ------
NM_014399chr72925 752 1357 ----
NM_014410chr182379 83 ------
NM_014423chr585110 5073 4556 3936 1606 1046 740 147 24374 286 13892 14120
NM_014445chr342082 475 370 115 32374 1786 419 ----
NM_014458chr131410 1155 170 ------
NM_014472chr10----125 --
NM_014495chr12546 28 ----1648
NM_014496chrX1224 ------
NM_014504chr751547 576 403 395 307 187 ----
NM_014522chrX--2184 149 --1638
NM_014547chr151301 ------
NM_014547chr151301 ------
NM_014548chr1541475 404 363 126 21424 120 11208 --
NM_014570chr221900 ------
NM_014586chr21104770 4383 4174 3737 3572 3534 1948 1762 994 734 13653 ----
NM_014613chr572868 2852 2745 2083 2030 935 519 --13032 --
NM_014616chr343527 3475 3294 3260 ----12435
NM_014633chr111467 ------
NM_014635chr231654 1390 194 31545 1155 557 11196 --
NM_014660chr72838 191 ------
NM_014662chr22----1435 --
NM_014666chr52406 297 ------
NM_014670chr261530 1490 1449 1097 447 371 ------
NM_014671chr721325 209 21396 1249 ----
NM_014679chr1141291 908 60 34 2885 334 1166 --
NM_014682chr842358 2042 2032 309 1698 ----
NM_014683chr1731492 496 292 ----1319
NM_014685chr161486 ------
NM_014689chr21173 ------
NM_014701chr1573413 3380 3219 2350 1078 816 798 22570 630 12142 1465
NM_014702chr652808 2782 2352 1026 604 1155 ----
NM_014705chr771893 1879 1776 1690 1461 841 93 11550 ----
NM_014707chr752201 1793 1401 886 677 21729 1664 11716 --
NM_014712chr161617 ------
NM_014720chr1051591 1573 1429 596 370 --2424 84 --
NM_014733chr561530 865 752 660 513 479 1539 1500 --
NM_014739chr633825 3089 2959 54115 1627 970 589 228 33159 1212 1172 --
NM_014746chr263025 2832 1722 722 655 247 ----13812
NM_014755chr263993 3835 3375 1130 1119 416 ----1626
NM_014781chr821176 496 ------
NM_014787chr172111 2039 1846 586 432 379 229 --11925 --
NM_014791chr91243 ------
NM_014802chr1251144 919 822 355 299 ----1342
NM_014810chr153617 3384 3124 2645 851 12436 ----
NM_014812chr151429 1272 715 576 190 --11226 --
NM_014820chr341794 1723 1655 769 21535 796 1273 --
NM_014822chr44437 116 78 44 1540 ----
NM_014828chr1432505 2441 313 11976 22109 795 --
NM_014848chr1572853 2228 2101 2000 713 170 101 12725 1970 1618
NM_014870chr133783 3446 633 11158 --11087
NM_014872chr922225 2159 --11595 --
NM_014873chr174866 4797 4503 4452 4071 3460 3312 --21906 714 13210
NM_014877chr17127810 7750 7449 7213 6704 5877 5519 4873 2862 2766 2131 2045 12402 36898 5275 2852 1825
NM_014887chr131743 ------
NM_014890chr32335 271 ------
NM_014892chr62146 61 ------
NM_014900chr22279 172 ------
NM_014904chr1074001 3933 3889 2510 1005 969 895 23007 2734 128 --
NM_014906chr1763981 3856 3718 3629 2542 542 23777 1580 11553 --
NM_014912chr1062858 1348 1279 686 531 40 12361 23544 2301 --
NM_014920chr693624 3466 3056 2757 1525 1378 923 616 352 1983 13611 --
NM_014932chr341871 1727 1560 771 11741 31932 627 392 11534
NM_014934chr1353538 3168 3143 2652 1010 1670 33673 2870 577 --
NM_014946chr2102646 2584 2438 2297 2272 2064 1915 662 541 308 11014 12191 1975
NM_014950chr1441554 440 411 52 51644 1514 1259 1132 255 21237 562 --
NM_014953chr1394387 4163 3957 3606 3055 1555 1386 214 119 14021 ----
NM_014961chr462033 1569 1364 699 689 358 ----1439
NM_014962chr2062015 2008 823 647 476 378 12679 1319 --
NM_014978chr1031735 577 555 1541 ----
NM_014982chr1484262 4122 3366 3302 1247 1211 1117 375 23733 1573 24931 4605 --
NM_014989chr631982 1409 49 1686 ----
NM_014990chr1441315 1290 323 313 ----1445
NM_014991chr472952 2762 2734 2068 1018 889 262 32337 1209 413 ----
NM_015000chr1293124 2681 2570 2429 1945 711 442 396 73 --22365 1969 12000
NM_015008chr3----12938 --
NM_015020chr161429 23437 3368 42905 2693 1322 853 --
NM_015026chr12114760 4348 3544 3357 3303 1560 1521 1361 832 631 565 33516 2953 1569 197 1239
NM_015032chr1372912 2772 2503 2021 1960 308 187 ------
NM_015040chr263110 2778 2558 2452 2186 442 1845 23374 2228 --
NM_015045chr1052255 1961 1480 1447 526 21902 708 ----
NM_015046chr952660 2630 2463 779 54 ----1483
NM_015049chr262967 2544 2486 2224 1030 856 22251 2244 13157 --
NM_015051chr963362 3035 2402 1337 555 82 --1772 --
NM_015054chr122400 32 3550 503 438 ----
NM_015057chr131163 ------
NM_015071chr546545 6173 4619 2388 15153 14689 1239
NM_015076chr684487 4256 3580 1520 1264 1174 1002 485 --24341 160 --
NM_015092chr1654541 4026 3173 1329 780 11806 11005 --
NM_015110chr952027 583 471 358 142 1830 1387 --
NM_015115chr493067 3059 3023 2284 1286 904 676 509 342 1583 ----
NM_015132chr711938 ------
NM_015137chr821861 173 ------
NM_015141chr362763 2425 2348 2056 656 556 2494 188 ----
NM_015143chr411233 1443 ----
NM_015153chr62737 37 ------
NM_015156chr1473942 3921 3255 2865 1022 940 491 12598 12532 --
NM_015161chr1611122 --1339 --
NM_015172chr171587 1442 1328 582 367 295 66 --21342 486 --
NM_015192chr2032957 2939 1208 1810 ----
NM_015200chr431619 731 539 1273 ----
NM_015206chr1553558 3114 2471 1430 1232 23790 35 12833 --
NM_015208chr18113743 3441 3163 2998 1295 1278 802 787 746 517 330 12587 --1233
NM_015216chr531191 1130 1110 11264 ----
NM_015247chr1684724 4344 4228 3362 1254 1201 813 434 --13290 --
NM_015260chr1911613 ------
NM_015265chr241793 833 820 274 ----12637
NM_015271chr453438 3016 1730 1189 161 43571 3000 1693 83 --13592
NM_015272chr1671478 812 636 269 252 199 102 ------
NM_015275chr1262192 2035 1947 1491 1452 546 21485 623 ----
NM_015278chr643242 3051 2306 566 23439 2144 11146 12918
NM_015291chr123413 858 --1779 13346
NM_015310chr8108262 7721 7253 7125 6202 6058 5197 5082 1996 1202 32093 1865 1736 27667 2630 25543 212
NM_015313chr1184815 4552 4208 4179 3825 3497 3031 1193 24304 900 34363 3593 1362 --
NM_015317chr21270 --4989 955 545 29 --
NM_015323chr621133 268 11090 ----
NM_015336chr1262570 2237 940 674 636 222 --11923 --
NM_015347chr1232440 2167 1844 32048 1066 171 ----
NM_015349chr672495 2429 2030 1179 933 775 320 13025 ----
NM_015359chr862882 2017 1951 426 379 190 11072 ----
NM_015365chrX83799 3689 1718 1537 1480 1246 241 163 24106 889 21409 1157 --
NM_015375chr184818 4208 4033 3326 1787 1180 478 179 13295 1153 --
NM_015379chr7170 ------
NM_015387chr242012 1412 573 95 2520 37 21617 1357 --
NM_015394chr1232436 2295 34 1701 1627 --
NM_015423chr1161532 1462 705 561 544 477 1511 1165 1322
NM_015424chr11126 ------
NM_015431chr162895 2434 1277 606 304 194 11385 ----
NM_015435chr851396 1221 1186 987 219 125 ----
NM_015436chr442529 1154 508 184 --13283 --
NM_015446chr181683 1439 1203 1099 1053 425 146 88 1351 ----
NM_015455chr553883 3797 3419 2886 2571 11390 13322 --
NM_015458chr8105150 4876 4508 4260 3401 3331 1410 1103 1067 263 --25131 3430 11165
NM_015483chr71218 1781 --11004
NM_015484chr12839 807 1852 ----
NM_015525chr641077 326 197 123 135 1342 --
NM_015548chr61163 ------
NM_015549chr141449 ------
NM_015555chr641635 1228 643 51 21714 1594 21680 1652 --
NM_015564chr532446 2239 1089 22947 716 21305 460 --
NM_015565chr2131823 1769 1470 21762 1748 ----
NM_015569chr1113382 3340 3021 2940 1629 1041 992 776 466 420 63 33849 3472 860 13353 --
NM_015571chr652439 1817 1793 1681 45 21040 211 12063 1135
NM_015575chr253713 3650 3492 3465 920 --12921 --
NM_015576chr352215 1155 803 356 95 12100 ----
NM_015602chr131784 1352 1338 11761 ----
NM_015605chr1021373 252 31547 1392 1367 11487 --
NM_015630chr21293 2880 426 ----
NM_015640chr173342 3336 2127 2007 1720 707 242 --44993 4940 3418 589 --
NM_015652chr10--1564 ----
NM_015713chr862727 1287 606 515 464 158 1773 ----
NM_015840chr172686 1677 964 957 789 616 127 --1418 --
NM_015841chr172686 1677 964 957 789 616 127 --1418 --
NM_015844chr181943 ------
NM_015846chr181943 ------
NM_015847chr181943 ------
NM_015852chr743040 2400 1038 366 22434 1256 21452 786 --
NM_015872chr111829 ------
NM_015878chr881928 1732 1492 435 198 182 169 78 1133 32167 1966 274 --
NM_015879chr1887466 5567 5521 1889 1584 1049 812 545 33205 2050 1845 1622 --
NM_015886chr8135774 4959 4929 4686 4479 4261 3814 3546 1748 638 572 424 245 24918 1821 1534 1769
NM_015888chr172963 1329 914 589 329 277 218 1349 --12937
NM_015891chr6101804 1570 1521 1407 1389 408 240 154 109 100 1344 185 --
NM_015906chr134746 3245 1900 --2691 138 --
NM_015913chr11531 ------
NM_015975chrX41814 1369 1166 348 ------
NM_015976chr11277 ------
NM_015984chr11530 ------
NM_015995chr1515355 ------
NM_016009chr194816 4790 3971 3909 1977 1347 1277 763 35 --24681 3200 --
NM_016018chr82972 648 --183 --
NM_016021chr652510 1073 1037 548 248 --12410 --
NM_016023chr851751 1465 1434 704 576 32150 814 570 ----
NM_016035chr91127 ------
NM_016072chr1251985 962 953 806 95 1663 11818 --
NM_016075chr1363157 2934 966 594 522 380 22430 2130 ----
NM_016081chr452044 1801 1645 693 380 ----1509
NM_016083chr673714 3633 1487 1114 783 586 366 12720 ----
NM_016093chr51150 ------
NM_016103chr52471 73 1428 ----
NM_016120chrX1971 --1258 --
NM_016131chr262080 2042 880 435 398 178 12103 1675 --
NM_016132chr1583007 2470 2128 1118 716 644 620 596 32558 2196 1082 ----
NM_016133chr241555 1532 1061 231 ------
NM_016144chr51695 ------
NM_016201chr322016 649 11825 ----
NM_016206chr3198878 8858 8798 8614 7909 7316 7046 6946 6378 6182 5611 3473 2869 2016 1986 1390 797 747 724 28196 277 48954 2362 2124 1731 16212
NM_016217chr653341 2779 1022 894 747 126 11288 --
NM_016224chr642223 473 351 317 11380 --1399
NM_016227chr131215 1087 438 11510 21242 409 --
NM_016242chr41177 2568 38 ----
NM_016248chr1353826 2944 2892 381 130 33764 868 420 ----
NM_016255chr683326 2349 1067 996 783 612 483 407 ------
NM_016260chr2137565 7056 6832 5550 5054 2305 2233 2193 1738 1702 830 581 424 45423 5163 1996 994 51745 1206 715 521 132 --
NM_016271chr1842214 1771 577 83 --1682 --
NM_016275chr362668 2031 2012 985 307 229 --1840 --
NM_016300chr31420 ------
NM_016316chr23739 179 99 --134 --
NM_016322chr983232 3188 2692 2671 2525 1216 600 471 12921 12987 --
NM_016356chr672794 2357 2099 746 500 465 351 12124 22574 159 1184
NM_016396chr1543048 3021 2908 332 2777 143 12462 --
NM_016422chr1172396 765 640 572 538 284 260 12644 1744 12604
NM_016447chr72227 195 ------
NM_016448chr12468 99 ----11844
NM_016467chr241415 1401 973 89 11146 11062 --
NM_016485chr662285 1973 1630 552 417 402 ----1819
NM_016513chr693624 3466 3056 2757 1525 1378 923 616 352 1983 13611 --
NM_016519chr42469 390 ------
NM_016530chr1543626 3529 3280 3172 33931 2696 1497 ----
NM_016531chr464240 3155 1505 1098 1034 427 22926 1245 ----
NM_016542chrX21522 201 21703 441 11570 11226
NM_016562chrX11237 --11026 1304
NM_016578chr114583 520 186 110 1626 ----
NM_016631chr21------11003
NM_016824chr1091719 1526 1434 615 578 505 386 374 255 ------
NM_016937chrX1707 ------
NM_016950chr431139 484 57 1125 1360 --
NM_016953chr224916 3825 35621 1072 33 14143 --
NM_017412chr871234 1222 872 362 218 84 71 --178 1247
NM_017420chr1493657 3419 3349 2866 2491 2398 1348 576 290 --1366 --
NM_017423chr452035 1727 1643 407 105 12004 ----
NM_017426chr4--1247 ----
NM_017440chr122244 43 --1480 --
NM_017447chr2154354 3770 3718 3010 662 13516 33657 3460 346 --
NM_017519chr631230 908 54 1159 --1882
NM_017549chr731480 390 110 11043 21061 545 --
NM_017563chr3156320 6304 6244 6085 5527 5283 5235 5079 4830 4777 4152 1677 1071 618 483 16329 ----
NM_017577chr321400 384 ----2641 162
NM_017580chr1032261 536 161 22420 2190 11768 --
NM_017599chr1261726 1601 1438 403 372 145 21403 1347 1780 11992
NM_017610chr1562081 1627 1516 1346 462 78 21656 1548 --1377
NM_017628chr4135019 4585 4329 3862 3658 3211 1988 1773 1364 1177 961 721 413 15040 ----
NM_017632chr41165 ------
NM_017637chr9129344 7742 7301 3732 3597 2887 2864 1911 1409 1231 399 358 16518 39147 8660 6404 --
NM_017643chr1763106 3083 2391 1180 361 309 12359 12936 --
NM_017644chr3144461 4406 4294 4000 3253 1987 1944 1832 1802 1553 1478 396 181 121 ------
NM_017650chr785786 5762 5497 5201 4390 2282 1866 146 45588 5455 3725 644 14742 --
NM_017651chr61141 1271 21631 1468 --
NM_017655chr141503 1058 346 143 --21621 1289 --
NM_017657chr21961 ------
NM_017658chr1484332 3990 3858 3642 3016 958 875 368 23470 3138 44221 3348 1593 1270 --
NM_017661chr15------1239
NM_017672chr152520 241 ----1229
NM_017694chr271974 1613 1540 1332 1322 641 370 ------
NM_017709chr183971 3876 3385 2980 1344 714 601 447 --2949 785 --
NM_017719chr362412 2390 2173 2006 1654 230 12323 ----
NM_017738chr91469 1146 ----
NM_017747chr51312 ------
NM_017758chr17--11435 ----
NM_017762chr1531915 691 93 22268 980 12426 1636
NM_017768chr12679 238 1149 1899 --
NM_017769chr1462321 2284 2104 1242 800 567 --2211 51 --
NM_017791chr1421640 1126 ------
NM_017793chr15----1218 --
NM_017801chr372380 1840 1781 1683 583 358 210 12490 ----
NM_017813chr8125760 5032 4786 4630 4580 4277 3825 3758 2250 1100 636 401 45785 4669 3714 1226 13569 --
NM_017831chr18104629 4288 3355 3311 1248 1149 965 925 798 306 23834 338 14148 1363
NM_017848chrX44437 3635 3180 1782 24065 4058 14144 --
NM_017849chr212899 --12439 --
NM_017905chr132559 543 1660 1641 --
NM_017915chr12--2454 170 ----
NM_017919chr9115481 5321 4582 4395 4026 3981 3643 1539 1130 445 291 34745 4020 1657 14761 11800
NM_017923chr4--1677 ----
NM_017954chr721469 467 11066 11149 --
NM_017998chr941192 1160 451 394 --1543 1961
NM_018051chr71124 --166 --
NM_018056chr1----1151 --
NM_018079chr22479 103 ------
NM_018084chr243085 2789 2494 1328 1959 11019 --
NM_018098chr331168 843 259 1927 ----
NM_018105chr831188 903 439 ----11204
NM_018121chr1082801 2524 2480 2079 888 808 525 358 --12926 --
NM_018155chr373059 2941 2769 2726 2677 2511 386 43319 675 350 114 12358 --
NM_018157chr1263193 3108 2086 2069 1989 986 12609 ----
NM_018196chrX3332 319 265 --21179 1137 --
NM_018206chr163701 658 229 ------
NM_018211chr141767 1716 663 295 --11405 11808
NM_018221chr21393 ------
NM_018227chr443002 2912 2883 618 23022 2635 33149 2101 2058 --
NM_018237chr101218 ------
NM_018254chr142275 765 538 29 12437 ----
NM_018279chr1252843 2369 1148 702 81 22766 171 --12328
NM_018287chr104826 374 348 200 --1307 --
NM_018293chr322615 979 22201 2126 11095 --
NM_018299chr883413 3209 3042 2977 2299 834 323 249 23327 3129 ----
NM_018300chr192564 51 2552 405 ----
NM_018313chr331043 444 254 --1100 12615
NM_018330chr1031641 1409 471 ----11509
NM_018348chr16142 ------
NM_018351chr1284671 3934 3866 3039 1533 1118 974 545 23616 958 14123 --
NM_018361chr8103719 3393 3343 3165 3143 3070 2991 1408 1237 130 12724 ----
NM_018362chr1173935 3804 3109 2737 1000 732 571 13059 ----
NM_018364chr183214 2886 2784 2608 753 252 108 67 --23408 812 --
NM_018369chr53661 321 239 ----1532
NM_018374chr775207 3648 516 351 333 309 160 34480 3747 293 ----
NM_018400chr1153160 2923 1625 757 330 --11300 11398
NM_018409chr483299 2894 2547 2346 2310 2105 960 648 12528 12446 --
NM_018416chr1231608 900 165 ----1354
NM_018426chr6177 ------
NM_018429chr522161 1013 21168 999 --11979
NM_018439chr1842493 1907 1610 260 139 1587 --
NM_018440chr8128241 7834 7808 6824 6622 5297 3136 2232 2188 1851 1593 1467 ----13235
NM_018456chr3145 ------
NM_018460chr21173 ------
NM_018466chrX--1104 ----
NM_018469chr1731445 1382 1209 11397 21150 1140 --
NM_018490chr1151728 1259 642 396 242 11367 ----
NM_018557chr241368 1285 605 503 ----2625 167
NM_018559chr13178 ------
NM_018566chr1135110 4889 4492 4177 3665 2003 1780 1713 1430 1119 862 510 78 13689 23809 3802 --
NM_018569chr471592 1418 1087 1001 618 591 479 --1531 --
NM_018590chr1031498 1411 217 11534 1467 1503
NM_018593chr61122 ------
NM_018602chr1561428 1111 476 317 178 166 ------
NM_018638chr1275503 5354 3904 1516 1052 631 537 22073 1110 55119 5076 1990 513 266 --
NM_018640chr1242138 987 734 457 11952 ----
NM_018682chr71562 ------
NM_018691chr551007 391 365 345 254 ------
NM_018695chr572176 2127 1796 919 688 386 312 32480 2051 891 ----
NM_018698chrX41971 1903 1360 737 31823 1813 494 11314 11796
NM_018700chr521334 1131 2561 72 11666 11117
NM_018710chr831072 519 463 --11012 11025
NM_018712chr1131015 298 147 1403 ----
NM_018841chr163590 2747 2555 1071 747 90 63680 3097 2829 1493 288 105 --1226
NM_018844chr751937 1642 1481 710 246 1650 2465 45 2581 569
NM_018945chr633350 2447 1461 12437 13720 --
NM_018958chr1583599 2914 2761 2535 2508 933 835 530 --13120 --
NM_018970chr783069 2982 2573 2562 2164 2149 893 266 12211 ----
NM_018976chr1242368 1798 846 636 22504 877 ----
NM_018993chr2031509 1492 546 1565 ----
NM_018999chr1064507 3829 3456 1604 1164 781 24969 923 ----
NM_019001chr374585 3375 1325 1303 1114 852 442 21621 408 --13055
NM_019003chrX146 ----1109
NM_019008chr2283030 2999 2805 2772 2632 2535 2297 485 11502 11433 --
NM_019022chr1853114 2502 2162 628 472 --1913 --
NM_019030chr51166 ------
NM_019035chr441762 1596 839 450 1758 --1613
NM_019036chr64814 270 227 145 --1874 --
NM_019045chrX1611 1252 ----
NM_019050chr492183 1813 1689 1506 645 630 545 345 255 11472 197 --
NM_019057chr5168 ------
NM_019072chr594260 3742 3133 1280 1083 996 846 728 211 33998 2892 1075 23220 1048 --
NM_019074chr151950 ------
NM_019083chr141408 1330 1283 144 31575 1076 310 1666 --
NM_019084chr1062214 1684 976 852 657 570 --12050 --
NM_019094chr1253452 2709 677 649 532 11055 12838 --
NM_019114chr951766 1681 576 544 422 21696 932 1656 --
NM_019116chr1633746 993 978 --23797 2556 11490
NM_019117chrX53395 2485 1196 434 229 --22565 40 --
NM_019556chrX31070 152 119 ------
NM_019558chr21324 ------
NM_019593chr2042421 1150 321 186 2398 388 ----
NM_019600chr15----1756 --
NM_019903chr1091719 1526 1434 615 578 505 386 374 255 ------
NM_020066chr11761 ------
NM_020116chr421372 320 2726 532 --11351
NM_020139chr471955 1915 1710 1672 1334 754 603 12050 ----
NM_020143chr241051 433 356 237 --1191 --
NM_020147chr154922 387 174 122 160 198 --
NM_020157chr201982 11025 ----
NM_020159chr461219 485 369 111 101 75 1654 ----
NM_020177chr583099 2432 2345 2134 2127 694 77 44 --73054 2907 2871 2336 2315 2117 1193 11099
NM_020193chr1121275 944 1492 --177
NM_020198chr1751575 1294 598 363 219 21441 1406 ----
NM_020199chr54522 513 437 160 1320 1502 --
NM_020204chr13884 792 278 ------
NM_020205chr122815 1159 11194 11320 12860
NM_020243chr22----170 --
NM_020245chr674661 4443 3348 1985 1725 1432 834 ----12026
NM_020341chr2051509 614 319 130 50 21534 1292 1472 --
NM_020381chr631653 1630 89 1249 --12052
NM_020390chr384868 4850 3627 3369 3098 1772 1475 187 24576 1465 33176 268 160 --
NM_020424chr161686 ------
NM_020432chr741417 878 601 289 ------
NM_020449chrX1642 ------
NM_020452chr112101 ------
NM_020456chr1322296 776 1269 1406 --
NM_020466chr664878 4341 3122 1833 1569 986 ----13871
NM_020526chr111505 ------
NM_020640chr341659 800 720 226 22163 2118 1621 --
NM_020644chr1121015 837 --2966 341 --
NM_020652chr173578 571 462 1238 --1185
NM_020654chr351067 1045 487 313 96 21413 1228 ----
NM_020666chr51181 1152 1851 --
NM_020673chr20116736 6376 5172 4939 3068 2678 1651 1593 600 393 265 26092 760 --12935
NM_020708chr2012532 ----12210
NM_020727chr2183852 3349 3260 2833 2752 1546 1517 1306 ----1152
NM_020731chr513177 32363 2224 970 ----
NM_020732chr631230 908 54 1159 --1882
NM_020734chr1253298 2915 2663 2652 380 --11165 --
NM_020739chr1594186 3371 2603 1617 1476 1355 1209 536 391 1462 13411 --
NM_020747chr52946 716 ------
NM_020748chr1721696 694 ------
NM_020751chr1351261 1002 955 494 87 21146 371 1136 --
NM_020752chr10102639 2452 1115 975 719 579 566 445 389 221 12921 ----
NM_020760chr221940 1407 1719 ----
NM_020762chr125846 431 199 104 80 ------
NM_020766chrX64262 4000 3696 3170 1239 1232 11312 33300 2977 1032 --
NM_020771chr661566 1550 1423 1342 596 332 1270 ----
NM_020772chr17158483 8328 7985 7936 7787 7691 6848 5882 5373 2825 2103 1817 1095 874 126 45845 3344 1693 1552 ----
NM_020774chr18135835 5299 4662 2258 2123 1651 604 533 397 342 310 225 126 24484 4093 1237 --
NM_020779chr242821 717 160 24 1877 2685 325 --
NM_020783chr1862326 2296 1619 660 573 156 21538 255 21983 178 --
NM_020792chr352501 2379 303 154 137 22627 1072 --12124
NM_020794chr151402 1079 596 579 301 --11366 --
NM_020795chr1711506 ------
NM_020809chr1122266 143 21714 63 ----
NM_020819chr61930 3957 835 784 2877 127 --
NM_020830chr263052 2580 2167 1074 808 501 1999 ----
NM_020841chr1243999 2723 1380 1132 42905 2486 1546 483 1877 --
NM_020854chr1831463 260 115 21036 607 ----
NM_020860chr46998 950 902 765 431 103 ------
NM_020870chr412211 1278 11972 --
NM_020871chrX42517 2454 1744 251 12427 1601 --
NM_020872chr341488 1374 1175 637 21540 142 ----
NM_020918chr1083570 3025 2349 2260 1224 1140 450 201 21258 1201 ----
NM_020921chr1493635 3465 3373 2647 2414 2383 1290 1189 497 43243 807 752 133 ----
NM_020935chr243488 1371 1212 917 23333 2913 ----
NM_020940chr10102880 2536 2482 2024 2002 920 866 442 316 283 32475 2246 1927 ----
NM_020948chr1133395 3376 3357 3179 3049 2704 2345 2320 1440 1297 1024 744 148 13227 --13157
NM_020964chr1884538 4506 4463 1824 1218 1100 611 72 34480 3959 1693 1157 --
NM_020993chr1212796 ------
NM_021003chr141226 ------
NM_021007chr232340 538 339 2894 663 --12398
NM_021033chr1383484 3301 2457 2309 2260 1103 781 491 21326 183 12802 --
NM_021038chr343128 2703 2334 409 12523 ----
NM_021061chr874556 4030 3308 3124 1140 269 131 33613 1391 767 11255 --
NM_021083chrX62791 2740 1121 1057 373 229 --43380 2601 2459 1414 --
NM_021090chr2274016 3586 3505 1919 1909 1098 297 14427 ----
NM_021111chr921398 319 --1339 1430
NM_021116chr758971 8838 8589 6708 1691 16831 28856 5777 --
NM_021127chr1841217 1120 970 355 21312 1243 11098 --
NM_021140chrX1224 ------
NM_021174chr81680 ------
NM_021191chr12132532 2504 2431 2404 2252 2162 2027 1663 1635 791 619 431 52 31012 996 863 12230 --
NM_021201chr1132042 1496 174 1429 --11944
NM_021215chr20--11988 ----
NM_021255chr1493915 3766 3047 1627 1555 1248 688 596 247 11186 11136 --
NM_021572chr651214 1179 1167 394 277 148 ----
NM_021622chr1062104 830 381 352 266 179 --11644 --
NM_021629chr384460 1484 1436 1362 1356 786 628 64 23884 694 1506 --
NM_021644chr105849 802 416 343 101 1408 1864 --
NM_021645chr1352066 1996 1604 236 146 12259 --12127
NM_021648chr642793 2516 2391 393 12562 ----
NM_021813chr695483 4780 4239 4155 3720 3598 915 904 236 25689 416 21697 598 1995
NM_021815chr232394 1237 429 21132 696 12385 --
NM_021818chr1411475 21322 1270 ----
NM_021911chr5105143 4699 4390 4112 3941 1504 1095 941 483 298 25176 4073 34435 2233 1735 --
NM_021922chr61723 ------
NM_021942chr42850 695 ------
NM_021960chr142365 879 451 86 11044 22707 1077 32274 2084 918
NM_021961chr1146844 6670 6291 5258 21184 516 37311 6983 5054 --
NM_021964chr3106142 6117 5014 4771 4277 2408 1649 314 150 141 44264 2007 1756 1245 15984 25112 1120
NM_021998chrX2348 110 11255 ----
NM_022037chr2----1672 --
NM_022041chr16102530 2374 2358 2293 2135 2044 623 385 181 54 --22641 117 --
NM_022048chr1576322 5762 4849 3991 1779 1382 1204 ----14410
NM_022058chr261754 1350 567 500 373 95 1630 1446 --
NM_022123chr141582 ------
NM_022130chr551407 931 586 327 103 ----11176
NM_022160chr9--1439 ----
NM_022173chr2----1672 --
NM_022351chr873707 3354 1506 688 441 241 153 43659 979 877 507 ----
NM_022444chr761974 1806 693 284 277 156 182 ----
NM_022454chr81136 ------
NM_022456chr12127572 7195 7066 5059 2572 2402 2023 1876 1358 1109 557 39 27566 2393 47532 6635 1734 1409 --
NM_022459chr13106145 6047 5878 5590 4983 2111 1669 1569 1201 637 24669 1135 ----
NM_022474chr1472734 2527 1948 1015 964 914 411 12474 ----
NM_022475chr42297 129 1635 ----
NM_022658chr1211262 ------
NM_022728chr72733 635 ----1575
NM_022763chr332903 718 617 32605 2080 809 ----
NM_022766chr2212602 --12461 156
NM_022780chr221234 372 1430 ----
NM_022841chr1552501 2489 1053 753 452 1408 ----
NM_022843chr1341483 1387 132 111 --11152 --
NM_022845chr1631512 218 68 11692 196 --
NM_022893chr273048 2923 2412 876 833 580 328 ------
NM_022898chr1484662 4437 1557 641 499 416 372 223 ------
NM_022913chr5186 ------
NM_022915chr21618 1578 ----
NM_022965chr411295 ------
NM_022970chr1051111 1020 542 326 125 1513 ----
NM_022977chrX72467 2442 2408 2327 943 712 554 31957 731 600 ----
NM_023000chr1421311 227 ------
NM_023001chr1421311 227 ------
NM_023016chr252781 2588 2342 2240 1088 2969 743 ----
NM_023071chr12--11085 153 --
NM_023079chr171543 ------
NM_023927chr541060 992 940 169 ----1298
NM_023929chr872751 2733 2339 1736 977 779 551 1281 ----
NM_024007chr542747 2268 2142 121 --12942 12463
NM_024019chr41755 ------
NM_024061chr72596 565 1627 ----
NM_024082chrX1120 ------
NM_024090chr441573 1460 507 28 ----1147
NM_024293chr21215 ------
NM_024336chr16155 ------
NM_024345chr9145778 5769 5590 5203 5081 4780 4556 4040 4013 2110 1995 880 572 554 --14023 14665
NM_024416chr921382 1064 --11074 11467
NM_024430chr181126 ------
NM_024512chr343531 3268 1371 1097 33396 3361 298 ----
NM_024520chr21271 ------
NM_024524chr363163 3068 2801 2420 926 33 --11289 12518
NM_024529chr12796 364 ------
NM_024563chr521765 470 --11511 --
NM_024586chr12564 50 ------
NM_024596chr895360 4931 4202 4049 3886 3291 1437 1207 512 --54224 3606 767 174 111 --
NM_024604chr12123 ------
NM_024631chr112527 455 ------
NM_024640chr1--1915 ----
NM_024665chr373103 3082 1295 1163 694 174 56 24104 939 24053 3119 --
NM_024692chr221670 1559 --1557 1485
NM_024697chr3133 ------
NM_024704chr2031067 1004 391 ------
NM_024713chr1551528 1494 335 288 58 21459 1372 ----
NM_024721chr822448 791 ------
NM_024743chr45982 885 858 524 258 ------
NM_024761chr985131 5097 4340 3986 3297 1718 1457 1152 21450 850 --11886
NM_024770chr265414 5223 4437 4105 2148 318 12575 45250 4814 4657 4137 --
NM_024834chr1061449 1340 1217 278 138 48 31356 500 220 ----
NM_024884chr1494444 4002 3678 3240 1704 1612 329 157 117 13320 ----
NM_024921chrX61984 1955 1925 1520 290 162 21973 623 1314 1521
NM_024930chr521959 167 --2571 544 1183
NM_024941chr541279 1042 242 75 11418 ----
NM_024947chr3178646 8462 7046 7013 6719 5940 3438 3339 2769 2271 1366 1085 1005 983 444 165 107 28539 186 21940 289 19201
NM_024949chr4104784 4571 4445 4327 1651 1077 1048 231 110 104 14775 --23755 1746
NM_024953chr1262595 915 832 804 713 594 --22107 29 --
NM_024989chr2178187 7441 7404 6814 6672 6432 6202 5309 5106 3155 3055 2063 1239 957 607 467 451 57995 7238 7225 5798 874 34944 3279 30 --
NM_024996chr321096 728 1255 ----
NM_025004chr111648 1130 ----
NM_025054chr883516 3146 2574 399 164 142 107 72 23176 2686 23695 233 --
NM_025073chr174697 4424 4342 4086 3845 3377 1889 21549 1391 ----
NM_025134chr1692364 2155 1859 1009 697 410 385 246 93 157 ----
NM_025146chr362660 2202 2025 1934 1080 298 12336 ----
NM_025154chr7--21022 541 1397 --
NM_025160chr183810 3565 2940 2847 1097 783 765 635 24300 1595 193 --
NM_025184chrX3323 292 73 1673 1275 --
NM_025189chr19----1139 --
NM_025191chr173180 2928 2574 2485 2314 1241 371 53522 3504 2747 1234 1053 1584 --
NM_025221chr411146 ------
NM_025222chr322632 74 22840 167 ----
NM_025235chr1032108 1813 1550 21804 1709 12042 --
NM_030579chr1643602 2921 2901 1147 11019 --12289
NM_030621chr1494231 2859 1053 976 798 302 278 148 136 23643 1460 --13012
NM_030627chr5104122 3726 3642 2976 2541 1471 1235 1098 648 114 54099 3714 2988 2798 618 13303 --
NM_030634chr162511 2043 1661 568 245 136 12500 --11928
NM_030637chr142615 546 ------
NM_030647chr785334 5301 4336 3903 2098 1622 738 332 34159 1004 510 ----
NM_030648chr485582 5393 4785 4247 2149 1641 1358 468 13524 --25094 872
NM_030650chr233834 3461 933 2693 578 --11642
NM_030652chr6------1304
NM_030667chr1221254 359 21149 1116 1131 --
NM_030668chr1221254 359 21149 1116 1131 --
NM_030669chr1221254 359 21149 1116 1131 --
NM_030674chr12155859 5119 4548 4450 4280 4114 2096 1853 1525 1461 1023 518 483 373 133 --12074 --
NM_030755chr141377 12675 1712 --
NM_030790chr16--1331 ----
NM_030791chr1441749 1542 1153 715 21519 117 ----
NM_030806chr1139453 9068 6830 5727 3766 3444 3428 2948 2599 1318 1023 952 371 27770 6129 23200 1347 1861
NM_030920chr151730 1607 525 107 99 1296 11925 182
NM_030935chr7--1419 ----
NM_030963chr63643 525 426 1140 ----
NM_031229chr20--1519 ----
NM_031243chr741511 506 327 64 1572 1673 11924
NM_031262chr9----1899 --
NM_031263chr9----1956 --
NM_031267chr7196 ------
NM_031296chr442232 1729 1675 678 42576 2084 2049 1912 11858 12477
NM_031298chr171130 ------
NM_031314chr1421452 258 1544 ----
NM_031362chr252662 2583 2399 1085 733 --22424 40 --
NM_031365chr242798 2719 2535 869 --22560 176 --
NM_031366chr242798 2719 2535 869 --22560 176 --
NM_031422chr18175 ------
NM_031423chr11192 1184 ----
NM_031427chr14115900 4266 4067 3985 3930 3681 2329 2229 735 708 69 15909 14056 --
NM_031435chr1283477 2962 2600 2163 813 708 678 441 12862 1980 160
NM_031469chr673827 1420 670 663 284 113 21 12898 13294 --
NM_031483chr2073381 3270 2928 1282 1162 978 634 23581 198 1372 --
NM_031844chr1103998 3684 3295 3165 3126 3026 1113 715 587 545 21227 867 --12592
NM_031845chr233197 2607 407 11417 13581 1548
NM_031847chr233197 2607 407 11417 13581 1548
NM_031858chr1781358 1220 1185 564 442 427 273 24 ------
NM_031862chr1781358 1220 1185 564 442 427 273 24 ------
NM_031990chr1911203 ------
NM_031991chr1911203 ------
NM_032012chr985252 5107 4972 2011 1794 1070 930 731 11838 25037 4915 11832
NM_032047chr32943 330 22402 1800 11636 --
NM_032050chr22--1846 ----
NM_032052chr22--11231 ----
NM_032102chr1193125 2816 2206 1904 1134 1075 814 324 212 --32785 460 294 --
NM_032116chr1395547 5489 4722 4390 3740 2013 1392 505 167 --24237 1558 --
NM_032121chrX42802 2173 2129 912 1206 32519 2109 957 1425
NM_032132chr11216 ------
NM_032138chr133597 226 175 ------
NM_032144chr251786 1733 1710 685 148 --193 --
NM_032145chr671927 1676 1629 1225 736 246 46 ------
NM_032153chr352497 2448 2031 1774 360 ------
NM_032160chr1884062 3738 3372 3171 2745 1718 1682 333 23246 2777 33468 2988 2894 --
NM_032208chr233455 3131 2904 23248 3144 13533 --
NM_032217chr43984 547 263 ------
NM_032221chr2061891 1869 1673 1591 609 146 21475 543 ----
NM_032228chr1173318 2910 2280 1380 1087 307 231 --13109 --
NM_032239chr41416 1196 ----
NM_032246chr15--1402 ----
NM_032303chr92646 520 ----1537
NM_032310chr91113 ------
NM_032321chr2103309 2892 2868 2682 1215 1175 1013 914 643 121 43141 704 559 92 12528 --
NM_032373chr10115946 5840 5656 5559 5074 5030 4845 4709 4535 2194 595 34973 1636 431 ----
NM_032440chr1052757 2497 1879 1128 600 1570 22888 1938 --
NM_032446chr593702 3363 3219 1291 915 842 558 519 251 12784 12967 --
NM_032457chr483866 3606 2830 2552 2377 1563 766 330 13150 ----
NM_032466chr841380 1364 1077 240 1336 ----
NM_032468chr841380 1364 1077 240 1336 ----
NM_032491chr123427 303 104 144 11245 --
NM_032492chr31172 ------
NM_032505chr362759 2244 388 274 256 195 22512 750 21016 651 --
NM_032521chr2033008 2813 2220 13119 1157 --
NM_032539chrX1854 ------
NM_032632chr1471950 1827 1587 1298 622 281 98 11309 ----
NM_032711chr1713489 ------
NM_032778chr373331 3042 2636 2626 2453 2150 1126 33285 1246 864 ----
NM_032796chrX2323 101 ------
NM_032801chr1112383 1911 ----
NM_032804chr1062594 2492 2339 2220 2135 815 1595 ----
NM_032810chr1031435 1349 957 21526 1034 ----
NM_032833chr152608 2548 580 190 115 32667 2620 842 ----
NM_032859chr1363868 3710 2632 1355 794 414 23718 319 13125 13294
NM_032869chr851671 545 535 437 388 11734 --11826
NM_032873chr1164018 3870 3677 1539 1101 109 --23279 1157 14082
NM_032892chr152340 119 --1276 --
NM_032901chr121227 ------
NM_032906chr42697 312 --2688 354 1593
NM_032967chrX1888 1365 ----
NM_032968chrX72910 1671 1605 1231 1045 727 429 23584 101 ----
NM_032969chrX72910 1671 1605 1231 1045 727 429 23584 101 ----
NM_032971chrY2915 29 1392 ----
NM_032972chrY2915 29 1392 ----
NM_032973chrY72905 1665 1604 1231 1045 727 429 23580 101 ----
NM_032975chr1843637 3146 2823 2421 33410 2441 473 --1208
NM_032980chr1843637 3146 2823 2421 33410 2441 473 --1208
NM_033012chr131901 ------
NM_033014chr921382 1064 --11074 11467
NM_033020chr134746 3245 1900 --2691 138 --
NM_033088chr11652 ------
NM_033105chr81151 ------
NM_033132chr1311549 --22064 1975 --
NM_033133chr1753473 1228 745 148 125 1739 --1758
NM_033138chr772230 2128 1924 1509 1466 892 270 21612 782 1681 --
NM_033139chr772230 2128 1924 1509 1466 892 270 21612 782 1681 --
NM_033140chr772230 2128 1924 1509 1466 892 270 21612 782 1681 --
NM_033143chr4103859 3775 3710 3654 3174 1494 1331 951 867 332 43109 2962 1763 36 23923 1575 --
NM_033157chr772230 2128 1924 1509 1466 892 270 21612 782 1681 --
NM_033181chr673714 3633 1487 1114 783 586 366 12720 ----
NM_033224chr7167340 7311 7190 7031 6427 5404 5333 4940 3099 3059 2345 1868 737 577 378 308 57054 6250 6012 2596 2523 25486 1585 --
NM_033227chr53527 233 86 ------
NM_033228chr52567 126 ------
NM_033285chr844205 4038 434 104 2764 248 ----
NM_033305chr92347 257 ------
NM_033342chr52112 79 ------
NM_033360chr12124152 4032 4002 3981 3839 2997 2888 2829 1087 1002 918 825 14100 23920 1248 --
NM_033379chr102180 142 ------
NM_033407chr14625 513 227 195 1269 1537 1643
NM_033425chr1183463 3301 2310 2301 1392 1173 871 492 13218 ----
NM_033428chr9101705 1559 1375 1318 798 486 390 332 284 267 ------
NM_033429chr1542961 2605 2059 612 13186 22799 407 --
NM_033430chr452775 1302 932 498 339 --14042 --
NM_033437chr452775 1302 932 498 339 --14042 --
NM_033480chr672949 2373 2258 2030 782 693 599 12087 ----
NM_033481chr672949 2373 2258 2030 782 693 599 12087 ----
NM_033484chr51492 ------
NM_033505chr296512 4985 4208 2642 2086 1455 1091 807 355 25367 1373 25428 2335 26738 1720
NM_033512chr832981 2927 2907 12975 ----
NM_033515chr64437 125 46 24 11311 ----
NM_033642chrX21132 288 ------
NM_033656chr2165731 4493 2318 2305 1170 147 24297 1027 11816 --
NM_052818chr1362088 1916 1380 731 461 107 21467 641 ----
NM_052832chr8132984 2812 2717 2151 2046 878 842 809 717 564 398 138 103 21199 407 11032 13047
NM_052879chr1253794 2699 1344 1121 254 33304 2609 1417 23725 3117 12891
NM_052885chr1294992 4207 4181 3809 3379 3160 1001 957 227 24049 328 21325 166 --
NM_052898chr821483 760 11593 ----
NM_052900chr841631 1324 530 165 --21831 1398 --
NM_052913chr621138 450 1786 11072 1413
NM_052923chr62242 201 ------
NM_052934chr132241 2195 2189 ----1584
NM_052937chr842670 749 542 348 12369 32552 2490 34 --
NM_052940chr11169 ------
NM_053016chr995954 5134 5077 4912 4901 2211 1933 1778 1237 12750 46327 6155 2354 1112 16380
NM_053023chr1152828 2694 1019 337 102 12452 --11130
NM_053024chr341416 1062 511 188 11537 ----
NM_053064chr1442608 2446 2287 625 12465 1691 --
NM_054012chr9----177 --
NM_054016chr121422 296 1143 --1804
NM_054016chr121422 296 1143 --1804
NM_054016chr121422 296 1143 --1804
NM_057159chr941268 1123 1028 488 ------
NM_058172chr431743 1250 53 21630 509 1224 --
NM_058241chr292335 2022 2010 1799 1771 1651 929 562 87 --11664 12232
NM_058241chr292335 2022 2010 1799 1771 1651 929 562 87 --11664 12232
NM_080283chr1751247 1066 926 454 53 21184 122 ----
NM_080546chr952286 1814 699 622 323 31903 1895 59 ----
NM_080552chr20--1704 ----
NM_080629chr1----31402 1118 537 --
NM_080630chr1----31402 1118 537 --
NM_080651chr81243 ------
NM_080655chr91227 ------
NM_080664chr1442001 757 137 25 41818 1727 712 59 1160 --
NM_080682chr13478 255 197 --1749 --
NM_080743chr652465 2443 2099 1685 396 31943 1917 383 ----
NM_080764chr2232143 1298 127 ----12100
NM_080832chrX41735 1483 448 171 11355 ----
NM_080867chr14154781 4638 4507 4446 3697 3124 2046 1610 1599 1419 1185 986 823 546 29 34579 1288 1112 24392 4269 --
NM_080872chr853845 3530 2466 499 312 23680 732 23517 1324 --
NM_080927chr342182 1233 1095 96 1490 ----
NM_130391chr973430 3369 2852 2568 2542 2405 614 11264 --1828
NM_130392chr973430 3369 2852 2568 2542 2405 614 11264 --1828
NM_130393chr973430 3369 2852 2568 2542 2405 614 11264 --1828
NM_130434chr1531167 464 442 ----1743
NM_130435chr1012839 12720 ----
NM_130438chr2193216 2498 946 484 430 307 203 163 97 --22513 792 --
NM_130439chr1021539 1486 11981 1910 1469
NM_130439chr1021539 1486 11981 1910 1469
NM_130838chr1531704 1654 1590 21409 246 ----
NM_130839chr1531704 1654 1590 21409 246 ----
NM_133170chr20107472 7301 6902 6810 4979 4961 3087 2973 1134 76 16876 45297 4927 3226 1587 --
NM_133265chrX42246 1372 1103 1032 --23515 2505 1713
NM_133329chr291911 1880 1797 1500 1179 740 683 419 204 21289 1206 ----
NM_133334chr475081 4611 4550 1512 356 148 99 ----1176
NM_133370chr441240 1188 1012 985 --23383 352 --
NM_133372chr562872 2516 2395 2146 1016 236 ------
NM_133378chr23966 666 163 ------
NM_133432chr23966 666 163 ------
NM_133433chr51771 ------
NM_133437chr23966 666 163 ------
NM_133445chr963793 3279 2712 2648 2497 268 32982 797 80 13157 --
NM_133477chr423290 300 --1697 12627
NM_133493chr6104207 3968 3332 3221 3185 3179 1542 1135 954 160 --14360 --
NM_133631chr331602 1351 67 11011 11498 --
NM_133638chr52206 104 1891 ----
NM_133646chr224045 54 33519 1645 518 23493 2036 14415
NM_134424chr1221015 22 ------
NM_134428chr9--1283 ----
NM_134442chr251746 1496 1314 1190 277 ------
NM_138285chr22532 79 1391 --1102
NM_138286chr1974366 3429 3090 2763 2687 1604 1454 1757 2607 62 11583
NM_138316chr1021127 133 --11185 --
NM_138333chr922213 296 1693 32492 2335 1750 --
NM_138348chr575140 4261 2567 2520 2222 1791 525 25532 1451 ----
NM_138357chr1031221 608 597 --1580 --
NM_138444chr1333520 1775 437 1601 23745 1540 13179
NM_138448chr22391 160 ------
NM_138459chr693282 2994 2888 1249 755 684 613 400 117 12882 ----
NM_138468chr2106191 6018 5811 5517 5475 5421 1829 409 392 309 1996 26182 5853 26089 688
NM_138494chr72824 115 --1141 --
NM_138576chr1484662 4437 1557 641 499 416 372 223 ------
NM_138621chr284156 3882 3809 2848 1674 1507 1263 375 11559 ----
NM_138713chr16137948 7490 7167 7038 6685 6614 5920 5054 2137 1505 744 701 538 76977 6013 5962 3291 720 447 176 48198 6556 5581 228 --
NM_138714chr16137948 7490 7167 7038 6685 6614 5920 5054 2137 1505 744 701 538 76977 6013 5962 3291 720 447 176 48198 6556 5581 228 --
NM_138731chr1464118 3238 1548 1438 1118 573 2734 258 --13490
NM_138771chr751510 1274 577 426 70 11369 ----
NM_138782chr532430 1507 548 --31797 1595 395 --
NM_138785chr6167 ------
NM_138794chr1------181
NM_138806chr33879 301 161 153 1740 --
NM_138819chrX3460 444 292 ------
NM_138927chr21------1861
NM_138992chr21--1406 ----
NM_139035chrX1635 ------
NM_139207chr1272073 1876 1517 854 526 239 29 12048 11492 --
NM_139279chr233522 81 49 --33125 2870 2487 --
NM_144567chr142687 526 333 156 22482 2149 12524 --
NM_144571chr4116894 6328 6299 5352 5184 4859 2614 1969 1865 1036 461 16263 15299 --
NM_144574chr141130 --1172 --
NM_144578chr1495187 5163 2178 2061 2040 1447 1065 801 24 34812 3707 2082 31955 721 141 11617
NM_144599chr15105536 5176 4364 1895 1387 1354 1128 644 356 137 14344 33508 1347 633 15265
NM_144600chr1631566 675 53 ------
NM_144632chr252019 801 451 297 103 21729 397 ----
NM_144642chr31389 ------
NM_144643chr41300 ------
NM_144664chr1172221 2122 1820 1784 1670 858 203 ------
NM_144672chr16--1167 ----
NM_144709chr22267 136 ------
NM_144721chr492781 2756 2232 2217 1112 1058 1031 903 674 1756 ----
NM_144778chr1342624 2346 1726 919 2334 48 ----
NM_144949chr261987 990 971 929 874 723 42097 1655 923 882 ----
NM_144979chr42587 147 1549 ----
NM_145011chr103786 582 213 1863 2458 55 --
NM_145025chr64903 477 138 83 11071 ----
NM_145029chr61255 ------
NM_145055chr1853620 2870 922 681 82 33104 2537 675 1608 13444
NM_145115chr731544 386 167 31646 1455 866 12319 --
NM_145117chr1123064 2758 --179 --
NM_145206chr1073251 2948 2147 2056 1184 932 604 11331 ----
NM_145234chrX4911 801 681 142 ------
NM_145239chr16--1984 ----
NM_145251chr1461588 1280 558 550 466 184 --11416 --
NM_145259chr2177077 6977 6895 5859 5759 5367 5221 5052 4950 4539 4317 2562 2467 1524 1330 744 37 47005 6266 6171 4346 24792 151 --
NM_145263chr441613 418 171 102 22371 2160 1552 --
NM_145291chr41437 ------
NM_145307chr1093765 3460 1589 1533 1509 1442 1408 868 40 54666 4622 4535 4063 116 12840 --
NM_145697chr11192 1184 ----
NM_145698chr1071997 1698 1523 365 300 176 44 --12162 11982
NM_145735chr1342659 2404 264 182 ----11856
NM_145753chr361565 1530 1412 565 359 206 ------
NM_145808chr732641 1985 35 12194 2612 21 --
NM_145858chr211426 ------
NM_145913chr122781 245 1261 163 1991
NM_147181chr411146 ------
NM_147182chr411146 ------
NM_147183chr411146 ------
NM_148174chr881928 1732 1492 435 198 182 169 78 1133 32167 1966 274 --
NM_148894chr411101 11146 ----
NM_148904chr12564 50 ------
NM_148905chr12564 50 ------
NM_148906chr12564 50 ------
NM_148907chr12564 50 ------
NM_148908chr12564 50 ------
NM_148909chr12564 50 ------
NM_148955chr1565789 5519 1915 1692 901 398 56485 6362 4852 2300 833 35841 5714 1755 26222 4995
NM_148957chr1332500 1041 421 11674 22153 631 --
NM_148977chr1021127 133 --11185 --
NM_148978chr1021127 133 --11185 --
NM_152238chr11277 ------
NM_152261chr1272528 2517 2194 1652 919 544 243 11881 2358 133 --
NM_152263chr166004 5877 5687 5075 4571 1296 25996 5115 14442 --
NM_152275chr242159 1671 649 388 11711 12025 --
NM_152305chr322235 2116 12092 ----
NM_152312chr11--1236 ----
NM_152332chr14132896 2711 2552 2368 2084 2066 1888 1050 988 867 825 642 549 1121 22490 2483 1257
NM_152344chr1731493 1385 186 ------
NM_152347chr17188 ------
NM_152407chr553298 2662 2429 2267 2150 ------
NM_152409chr552852 2700 786 622 85 ------
NM_152410chr61313 ------
NM_152418chr821990 1828 11983 1737 1225
NM_152437chr1252425 2146 843 760 605 22377 1834 ----
NM_152470chr1844004 3903 3829 1362 13837 ----
NM_152520chr241035 985 421 195 2772 766 ----
NM_152529chr2114197 3994 3821 3752 3515 2988 2871 1680 1095 987 239 1657 11772 --
NM_152556chr752409 1813 1669 699 298 12466 2562 396 --
NM_152594chr1532108 2095 2069 ----11789
NM_152608chr142324 2280 1957 785 1835 1386 --
NM_152622chr563304 3188 2804 2436 2298 763 12456 1871 --
NM_152624chr586974 6750 6214 5475 2637 1812 1178 1091 27146 1292 25803 2146 --
NM_152636chr1162867 2280 1246 1172 591 428 1937 ----
NM_152641chr1262791 2725 2494 2394 2237 446 ------
NM_152678chr362389 2240 2171 1981 1935 1838 --12536 --
NM_152688chr63894 876 694 --1122 --
NM_152713chr111182 ------
NM_152727chr161266 ------
NM_152734chr644604 3575 2082 633 14706 31258 646 540 --
NM_152737chr642078 1737 1490 69 --162 --
NM_152740chr7------1712
NM_152745chr71196 ------
NM_152754chr753869 3772 3611 3530 3226 13816 13438 12382
NM_152756chr594216 4150 3819 3686 3222 1747 1512 1052 487 12783 23746 3033 --
NM_152758chr81207 21195 815 12185 --
NM_152774chr761805 1089 512 387 265 211 11928 22719 1859 --
NM_152789chr731494 1369 232 21476 919 31334 367 220 --
NM_152826chr1565789 5519 1915 1692 901 398 56485 6362 4852 2300 833 35841 5714 1755 26222 4995
NM_152903chr1361779 1078 783 478 330 209 2907 33 12652 12329
NM_152995chr45857 334 307 213 27 ------
NM_152999chr7105048 4747 4718 3925 3769 3386 647 495 365 60 --13503 --
NM_153013chr562124 986 662 587 527 250 1560 22476 2051 --
NM_153050chr2274016 3586 3505 1919 1909 1098 297 14427 ----
NM_153051chr2274016 3586 3505 1919 1909 1098 297 14427 ----
NM_153182chr373331 3042 2636 2626 2453 2150 1126 33285 1246 864 ----
NM_153183chrX2857 200 1159 11188 --
NM_153184chr31793 1677 ----
NM_153188chr595338 5306 4806 4790 4262 4236 4190 798 757 25195 5177 24673 4414 --
NM_153207chr1251095 1073 1034 825 142 23509 751 1501 --
NM_153226chr101448 2461 165 1478 --
NM_153235chr682305 2189 1775 836 286 256 225 183 22425 2360 11486 --
NM_153261chr1631625 1165 992 --11082 --
NM_153262chr132124 1135 758 22662 1143 12506 13031
NM_153331chr31664 ------
NM_153332chr852765 2699 2683 562 258 ------
NM_153333chrX1503 ------
NM_153346chrX51758 572 535 362 207 --2684 277 --
NM_153367chr1063277 3219 3022 2731 2460 1319 --1802 --
NM_153371chr1342259 1619 937 341 --1464 --
NM_153374chr152410 183 1123 ----
NM_153634chr1261485 1297 1109 572 510 419 31527 1475 478 ----
NM_153682chr21162 ------
NM_153686chr462257 2129 1787 948 497 357 1822 22233 755 --
NM_153689chr2112362 2068 2002 1987 1898 1551 703 466 332 91 73 ----1308
NM_153702chr41102 ------
NM_153810chr1043828 1848 1723 1500 --24766 3528 11040
NM_170664chr16--1167 ----
NM_170665chr1274570 4414 4181 3927 1735 1557 858 1190 11388 --
NM_170679chr52993 71 ------
NM_170709chr831742 562 389 31891 528 93 ----
NM_170710chr483154 3143 2906 2015 1961 1286 792 179 32682 2390 221 ----
NM_170731chr114472 325 234 99 12778 --1704
NM_170732chr114472 325 234 99 12778 --1704
NM_170733chr114472 325 234 99 12778 --1704
NM_170734chr114472 325 234 99 12778 --1704
NM_170735chr114472 325 234 99 12778 --1704
NM_170780chr33879 301 161 153 1740 --
NM_172057chr7--3393 357 338 --1376
NM_172058chr82566 533 --1757 --
NM_172059chr82566 533 --1757 --
NM_172060chr82566 533 --1757 --
NM_172069chr252224 1923 1801 590 580 22003 429 11938 --
NM_172070chr272039 1767 1594 1517 644 635 173 12199 21556 663 --
NM_172071chr1156968 6497 6240 6009 5888 5803 5267 5073 4625 2567 822 417 408 282 74 11791 12488 --
NM_172103chr662203 894 885 716 692 506 12695 ----
NM_172105chr662203 894 885 716 692 506 12695 ----
NM_172193chr1421177 346 31324 1005 459 ----
NM_172311chr21144 ------
NM_172344chr291911 1880 1797 1500 1179 740 683 419 204 21289 1206 ----
NM_172373chr1341117 1053 879 27 ------
NM_173082chr631414 1170 247 21248 635 ----
NM_173163chr16----1508 --
NM_173165chr16----1389 --
NM_173177chr23433 222 71 --1652 --
NM_173198chr992740 2623 2232 2121 1061 929 867 333 327 --12333 --
NM_173199chr9198 ------
NM_173200chr992740 2623 2232 2121 1061 929 867 333 327 --12333 --
NM_173206chr18122 ------
NM_173214chr16137948 7490 7167 7038 6685 6614 5920 5054 2137 1505 744 701 538 76977 6013 5962 3291 720 447 176 48198 6556 5581 228 --
NM_173354chr2122123 48 --1216 --
NM_173468chr4115428 4950 4924 4598 4426 4379 3905 2223 1864 1355 1303 25812 5055 ----
NM_173471chr341104 958 383 369 ----1944
NM_173482chr191149 1134 ----
NM_173496chr1072743 1874 1162 614 575 560 21 --22355 1954 --
NM_173511chr273815 3483 3194 3009 2992 2541 742 43350 2948 598 422 ----
NM_173519chr841905 1612 1372 1327 ------
NM_173527chr143758 680 299 ------
NM_173531chr1973681 3646 3005 2680 1520 1502 939 --1139 12445
NM_173576chr1082305 2231 2114 1987 1658 785 421 90 22054 893 11555 --
NM_173582chr11112419 2110 2101 2093 1883 1845 1709 1211 760 398 219 11179 --1785
NM_173602chr1293603 2984 2749 2622 1271 1048 932 579 484 11178 1519 1693
NM_173607chr1431743 846 529 21394 639 1368 11642
NM_173642chr1117786 7489 6635 6480 6137 5599 3668 3273 1313 1245 636 --15838 --
NM_173644chr2051978 1860 1821 787 411 1244 ----
NM_173645chr22517 449 1201 ----
NM_173647chr23402 305 83 --1415 --
NM_173658chr31308 1114 ----
NM_173665chr51162 2643 591 ----
NM_173694chrX92548 2371 2217 2208 2111 1877 932 906 308 1530 ----
NM_173698chrX41631 757 257 249 11446 ----
NM_173794chrX1405 1522 ----
NM_173829chr5186223 6004 5719 5668 5575 5319 4862 4401 3992 3893 2215 2096 1541 1397 975 447 210 176 46127 1935 682 229 --1855
NM_173848chr82902 828 ------
NM_174907chr3----1136 --
NM_174916chr1521628 255 22163 1477 12346 --
NM_174921chr45843 831 306 294 61 --1318 --
NM_174938chr92151 116 ------
NM_174963chr1----1362 --
NM_174964chr1----1362 --
NM_174966chr1----1362 --
NM_174968chr1----1362 --
NM_174969chr1----1362 --
NM_174971chr1----1362 --
NM_175056chr352211 2180 1634 1498 133 21487 1406 11565 1801
NM_175623chr12127572 7195 7066 5059 2572 2402 2023 1876 1358 1109 557 39 27566 2393 47532 6635 1734 1409 --
NM_175624chr12127667 7290 7161 5154 2667 2497 2118 1971 1453 1204 652 134 27661 2488 47627 6730 1829 1504 --
NM_175625chr12127667 7290 7161 5154 2667 2497 2118 1971 1453 1204 652 134 27661 2488 47627 6730 1829 1504 --
NM_175847chr1911203 ------
NM_175854chr1351119 1062 703 685 479 --11736 --
NM_175861chr12105464 5077 4941 4370 4093 3823 1576 1227 507 32 --15520 --
NM_175863chr631230 908 54 1159 --1882
NM_175921chr553880 3781 3179 2963 993 23810 477 11000 --
NM_176081chr1075998 5659 5555 5012 2344 2116 881 42210 1923 1912 1902 15024 --
NM_176083chr1075998 5659 5555 5012 2344 2116 881 42210 1923 1912 1902 15024 --
NM_176815chr332836 645 184 22499 2256 --32699 2386 106
NM_176823chr153755 3735 3285 2515 1254 23148 3141 ----
NM_176871chr81598 ------
NM_177438chr1494231 2859 1053 976 798 302 278 148 136 23643 1460 --13012
NM_177952chr141226 ------
NM_177968chr21723 ------
NM_177990chr2051509 614 319 130 50 21534 1292 1472 --
NM_178011chr1073147 3046 2752 2330 993 796 365 ------
NM_178123chr21294 2934 172 ----
NM_178140chr522606 1748 32346 2048 610 ----
NM_178151chrX177346 7053 6803 6626 6512 6059 6034 5874 2931 2918 2564 2365 2161 1212 747 590 224 27355 2509 26268 1183 --
NM_178152chrX177346 7053 6803 6626 6512 6059 6034 5874 2931 2918 2564 2365 2161 1212 747 590 224 27355 2509 26268 1183 --
NM_178153chrX177346 7053 6803 6626 6512 6059 6034 5874 2931 2918 2564 2365 2161 1212 747 590 224 27355 2509 26268 1183 --
NM_178505chr1053493 2797 1398 1362 96 13515 33182 2781 2481 --
NM_178509chr1742982 2795 1546 350 2285 249 1404 --
NM_178558chr7--21262 804 1108 --
NM_178566chr94692 301 291 65 11488 ----
NM_178578chr2082429 2300 2285 918 626 479 428 136 --21846 198 --
NM_178585chr472952 2762 2734 2068 1018 889 262 32337 1209 413 ----
NM_178812chr8172 21261 1189 ----
NM_180989chr1362473 2327 2131 1790 962 134 3841 327 276 11892 --
NM_181054chr1431152 962 487 ------
NM_181077chr1562073 1889 1607 609 464 239 ------
NM_181265chr483154 3143 2906 2015 1961 1286 792 179 32682 2390 221 ----
NM_181302chr141130 --1172 --
NM_181308chr141130 --1172 --
NM_181351chr1152574 1897 802 780 518 ------
NM_181353chr201664 ------
NM_181354chr841154 632 445 144 --11674 11439
NM_181358chr173435 3027 2755 2737 1641 1082 453 11258 1725 --
NM_181361chr341061 574 193 23 ------
NM_181443chr2062015 2008 823 647 476 378 12679 1319 --
NM_181453chr231654 1390 194 31545 1155 557 11196 --
NM_181457chr2------1893
NM_181458chr21937 ----11026
NM_181481chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_181482chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_181483chr1896876 6820 6654 2734 2624 2567 1893 1792 1625 1380 --12617
NM_181504chr584063 3720 3389 2641 1573 1365 768 190 --23294 3004 1729
NM_181521chr16127231 6810 6776 6582 6152 5904 5179 5119 5079 2163 1462 1086 47257 6137 5762 2239 ----
NM_181523chr584063 3720 3389 2641 1573 1365 768 190 --23294 3004 1729
NM_181524chr584063 3720 3389 2641 1573 1365 768 190 --23294 3004 1729
NM_181659chr2033380 660 271 --22983 2538 --
NM_181659chr2033380 660 271 --22983 2538 --
NM_181705chr5125756 4983 4759 4594 4272 3789 3664 3505 1381 1331 521 127 2315 182 --15582
NM_181706chr114751 381 330 189 1170 11899 --
NM_181723chr851803 1559 878 370 363 --1523 --
NM_181782chr642195 1567 768 371 --1315 --
NM_181783chr1241972 591 330 311 1655 --11477
NM_181787chr833248 1246 403 43728 3608 668 384 ----
NM_181789chr1533148 1978 513 --22750 2717 --
NM_181836chr582612 2440 2144 2026 1932 860 714 582 22581 1831 ----
NM_181839chr8--11201 ----
NM_181861chr1272776 2718 2546 2246 1985 1911 1722 21750 310 11953 --
NM_181868chr1272776 2718 2546 2246 1985 1911 1722 21750 310 11953 --
NM_181869chr1282861 2803 2631 2331 2070 1996 1807 49 21835 395 12038 --
NM_182485chr463297 3242 2735 2337 1507 545 12329 ----
NM_182493chr1655298 3749 3731 1072 84 15087 25247 67 --
NM_182503chr685581 5192 5122 5067 3905 1942 1423 1318 44475 3831 1013 516 ----
NM_182515chr1976601 5852 4451 2393 1504 396 229 56391 6055 5350 4387 1540 1564 --
NM_182524chr4--1647 ----
NM_182551chr283508 2740 2700 2455 2253 2241 1081 235 188 ----
NM_182559chr12--1309 ----
NM_182607chrX21305 163 --11459 --
NM_182646chr463297 3242 2735 2337 1507 545 12329 ----
NM_182697chr721530 1197 ------
NM_182715chr71254 ------
NM_182757chr693355 2904 2401 1381 1254 1219 1159 1134 376 --12933 --
NM_182758chr1543275 3136 2459 1166 43209 1385 1207 1021 ----
NM_182762chr7115751 5728 5648 4948 4276 4056 3984 3971 1689 811 238 94880 4611 4107 4094 4070 4028 4009 2328 395 25762 1428 --
NM_182763chr142354 868 440 75 11033 22696 1066 32263 2073 907
NM_182765chr1031933 891 169 21951 556 11819 --
NM_182797chr203727 486 268 1215 ----
NM_182830chr1462187 1799 1437 846 211 184 --1647 --
NM_182848chr1311478 186 11241 --
NM_182898chr796145 5903 5767 4662 4390 2240 2150 2061 1068 46205 5619 5219 2039 1405 --
NM_182899chr796145 5903 5767 4662 4390 2240 2150 2061 1068 46205 5619 5219 2039 1405 --
NM_182907chr692045 882 689 654 536 420 367 356 41 31944 402 340 1486 --
NM_182931chr71562 ------
NM_182943chr331270 1030 46 ------
NM_182948chr143160 2641 2067 1259 22475 450 ----
NM_182964chr1123064 2758 --179 --
NM_182975chr121049 994 2361 28 --1207
NM_182976chr14279 237 137 74 1203 ----
NM_183004chr1473105 2403 2393 1503 567 344 329 --11306 --
NM_183043chr132804 661 --1678 --
NM_183044chr132804 661 --1678 --
NM_183234chr1511397 ------
NM_183235chr1511397 ------
NM_183236chr1511397 ------
NM_183237chr341094 1075 760 370 --1268 --
NM_183353chrX1971 --1258 --
NM_183380chr61163 ------
NM_183419chr851396 1221 1186 987 219 125 ----
NM_194247chr243835 3781 2775 1215 14169 24437 628 --
NM_194282chr463125 2242 2141 813 341 317 ----12941
NM_194291chr852322 2278 1092 499 114 1734 12117 --
NM_194301chr1451143 1118 392 151 141 ----1273
NM_194314chr195426 4581 4569 3747 3644 2265 1296 881 552 24286 1925 3659 428 61 --
NM_194356chr122928 897 ----11468
NM_194434chr1835404 5367 827 23570 1837 64839 4318 4248 2058 1709 618 --
NM_197941chr551222 1025 530 453 405 --23066 333 --
NM_198120chr82590 397 ------
NM_198123chr841631 1324 530 165 --21831 1398 --
NM_198124chr841631 1324 530 165 --21831 1398 --
NM_198128chr1842214 1771 577 83 --1682 --
NM_198129chr181385 ------
NM_198158chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_198159chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_198177chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_198178chr393060 2982 2915 2738 2605 2049 1986 618 64 --190 --
NM_198181chr1582598 2477 2452 2084 1829 866 820 237 62846 2437 2040 2028 1810 960 --22279 326
NM_198196chr322369 2329 --12230 32392 652 434
NM_198216chr201119 ------
NM_198240chr1251244 1079 912 551 329 ------
NM_198268chr173435 3027 2755 2737 1641 1082 453 11258 1725 --
NM_198269chr173435 3027 2755 2737 1641 1082 453 11258 1725 --
NM_198273chr5103075 2242 2154 2138 1978 1015 822 548 357 77 12307 ----
NM_198279chrX71218 1116 519 477 461 121 105 ------
NM_198281chr472279 2260 1055 852 543 433 340 12553 23404 1170 --
NM_198320chr1284776 4599 4565 4513 3494 3233 1028 174 45199 5135 1265 769 24801 1014 --
NM_198391chr2021435 138 --21022 317 --
NM_198400chr1552666 2216 1074 1036 299 --1383 --
NM_198463chr32273 116 --1292 --
NM_198468chr674643 4441 3350 1150 844 336 108 14008 ----
NM_198503chr131592 1532 1489 32298 2143 2111 32217 950 682 --
NM_198506chr441160 1113 219 55 --175 --
NM_198513chr861985 1977 1886 1711 1351 687 21375 471 --1162
NM_198549chr153111 2674 2315 2019 227 --12696 154
NM_198581chr2257453 7213 6428 4802 4753 4692 4685 2500 2456 2446 2224 2192 1645 1321 1290 1267 1201 1194 1124 902 836 785 686 186 66 26099 1883 11935 --
NM_198715chr186104 4156 4114 3888 1993 1307 376 40 46178 6089 5414 1060 --26145 592
NM_198793chr364087 3932 3577 3386 330 116 32679 874 198 13396 1359
NM_198794chr141393 11267 1319 --
NM_198859chr374460 3644 3482 2042 1840 1608 663 13731 ----
NM_198867chr191398 ------
NM_198889chr43984 547 263 ------
NM_198896chr1141930 1877 1854 298 --1243 --
NM_198904chr581697 1686 1504 1480 807 556 448 99 41678 1667 1296 847 ----
NM_198965chr12--1384 ----
NM_198966chr12--1384 ----
NM_198968chr1353538 3168 3143 2652 1010 1670 33673 2870 577 --
NM_199003chr821472 1187 1256 --11488
NM_199040chr1253452 2709 677 649 532 11055 12838 --
NM_199044chr142782 1189 1059 610 21985 539 22129 832 --
NM_199053chr42872 717 ------
NM_199069chr31101 ------
NM_199070chr31101 ------
NM_199072chr742967 2814 2154 233 22694 2586 ----
NM_199073chr31101 ------
NM_199074chr31101 ------
NM_199136chr71187 1153 ----
NM_199167chr182379 83 ------
NM_199188chr1253794 2699 1344 1121 254 33304 2609 1417 23725 3117 12891
NM_199190chr1253794 2699 1344 1121 254 33304 2609 1417 23725 3117 12891
NM_199205chr81680 ------
NM_199320chr411848 --32360 2028 1895 12804
NM_199320chr411848 --32360 2028 1895 12804
NM_199324chr463469 2758 1277 1138 1117 1047 ----13246
NM_199417chr31101 ------
NM_199421chr14154781 4638 4507 4446 3697 3124 2046 1610 1599 1419 1185 986 823 546 29 34579 1288 1112 24392 4269 --
NM_199436chr2102646 2584 2438 2297 2272 2064 1915 662 541 308 11014 12191 1975
NM_199462chr184818 4208 4033 3326 1787 1180 478 179 13295 1153 --
NM_199482chr242012 1412 573 95 2520 37 21617 1357 --
NM_201428chr111560 --21493 580 --
NM_201429chr111560 --21493 580 --
NM_201430chr111486 --21419 506 --
NM_201434chr171141 ------
NM_201437chr85989 943 507 440 195 2587 54 ----
NM_201570chr1021734 1379 21810 52 ----
NM_201571chr1021734 1379 21810 52 ----
NM_201572chr1021734 1379 21810 52 ----
NM_201590chr1021734 1379 21810 52 ----
NM_201591chr431427 428 378 11477 21745 485 1411
NM_201592chr431427 428 378 11477 21745 485 1411
NM_201593chr1021734 1379 21810 52 ----
NM_201596chr1021734 1379 21810 52 ----
NM_201597chr1021734 1379 21810 52 ----
NM_203303chrX----154 --
NM_203327chr2094224 3922 3408 3374 3307 3253 1482 1248 483 1889 ----
NM_203341chr11145 --1364 --
NM_203349chr1532027 1996 276 1422 2365 68 --
NM_203350chr131610 1384 651 ------
NM_203354chr144619 353 117 60 2909 204 1774 --
NM_203355chr144619 353 117 60 2909 204 1774 --
NM_203356chr144619 353 117 60 2909 204 1774 --
NM_203394chr12102757 2665 2509 2431 2290 2068 2021 776 666 588 12652 ----
NM_203403chr951180 873 398 365 99 1279 11073 --
NM_203406chr592909 2685 2647 2495 2451 1149 797 577 338 22927 551 ----
NM_203437chr21961 ------
NM_203446chr2142599 2423 811 536 22940 2780 1652 --
NM_203451chr1342344 921 872 808 11746 ----
NM_203458chr1123395 3277 3157 3021 2811 2797 2775 2716 1298 1003 914 217 11081 ----
NM_203459chr162416 1639 1014 947 786 499 --11838 12297
NM_203504chr412137 ------
NM_203505chr412137 ------
NM_205768chr122020 1829 ------
NM_205836chr5----1261 --
NM_205842chr22284 225 --1623 --
NM_206594chr193628 3605 3453 3212 2876 2550 2536 883 406 1652 1124 --
NM_206595chr193628 3605 3453 3212 2876 2550 2536 883 406 1652 1124 --
NM_206819chr12182 ------
NM_206820chr12182 ------
NM_206821chr12182 ------
NM_206853chr674140 3063 1620 1559 1138 503 382 23525 3162 23643 1382 --
NM_206854chr675401 4324 3477 1764 1643 1074 616 34786 4423 3616 14904 11206
NM_206855chr686366 5289 4442 3846 2039 1581 686 151 35751 5388 4581 25869 186 12171
NM_206866chr2173115 2791 2709 2133 398 275 263 12278 11238 --
NM_206907chr543339 3263 2924 1161 2444 93 1478 --
NM_206909chr8108262 7721 7253 7125 6202 6058 5197 5082 1996 1202 32093 1865 1736 27667 2630 25543 212
NM_206938chr1132042 1496 174 1429 --11944
NM_206939chr1132042 1496 174 1429 --11944
NM_206940chr1132042 1496 174 1429 --11944
NM_207012chr1052737 2313 1216 1129 312 ----13360
NM_207170chr12839 807 1852 ----
NM_207292chr343128 2703 2334 409 12523 ----
NM_207293chr343128 2703 2334 409 12523 ----
NM_207294chr343128 2703 2334 409 12523 ----
NM_207295chr343128 2703 2334 409 12523 ----
NM_207296chr343128 2703 2334 409 12523 ----
NM_207297chr343153 2728 2359 434 12548 ----
NM_207303chr1083446 3318 3140 2788 2598 1581 1376 995 1239 1836 --
NM_207304chr1352511 2233 1613 1015 806 1221 ----
NM_207506chr86567 532 509 457 297 33 ----1907
NM_207578chr11198 1312 ----
NM_207647chr961957 1824 1723 1636 578 322 1854 --12511
NM_212471chr1742309 2094 807 370 ------
NM_212472chr1742309 2094 807 370 ------
NM_212558chr984060 3621 3233 2614 1525 970 582 129 141 --1898
NM_213589chr263831 3386 1689 1338 901 810 21241 437 13898 2799 628
NM_213594chr123427 303 104 144 11245 --
NM_213611chr12--1114 ----
NM_213651chr131600 1288 130 --130 --
NM_213654chr351608 1565 1276 157 69 11631 ----