TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-103b
miRNA Sequence: UCAUAGCCCUGUACAAUGCUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr822471 728 12431 ----
NM_000038chr52730 575 11926 --1467
NM_000063chr6--1288 ----
NM_000081chr111259 ------
NM_000084chrX96833 6572 6031 4876 4466 2574 1949 569 253 11202 16184 --
NM_000089chr71245 ------
NM_000090chr21683 ------
NM_000108chr721306 718 ------
NM_000109chrX12687 ------
NM_000125chr653977 3895 3471 1282 247 ------
NM_000138chr1511936 1558 ----
NM_000161chr1411777 ----11419
NM_000163chr532178 2101 574 --1305 --
NM_000168chr762985 2315 1215 1042 945 76 --22939 728 --
NM_000176chr543501 2669 2486 963 ------
NM_000189chr21893 ------
NM_000192chr1211167 ------
NM_000202chrX43157 3060 1415 295 13191 13843 --
NM_000214chr202594 196 11713 ----
NM_000217chr1213514 15269 ----
NM_000233chr2--1844 ----
NM_000242chr1032646 2071 1781 ------
NM_000259chr1584682 4589 4149 2392 2349 1727 849 193 14860 25808 4854 --
NM_000264chr942983 2408 512 96 --1612 --
NM_000267chr1773248 2977 2655 2125 1245 1172 494 ------
NM_000288chr61303 1374 ----
NM_000314chr1073152 3123 2766 2755 1022 834 209 12475 12886 --
NM_000330chrX2569 93 12302 ----
NM_000332chr655856 4555 2185 895 407 --25323 1682 --
NM_000346chr1721657 669 ------
NM_000369chr1421218 324 ------
NM_000393chr211947 ------
NM_000408chr213026 ------
NM_000430chr1731338 1233 407 ------
NM_000461chr31607 --13639 --
NM_000462chr1521611 125 ------
NM_000476chr921482 1442 ------
NM_000489chrX63299 3180 3054 2784 2488 565 22394 435 ----
NM_000503chr821831 251 ------
NM_000527chr1942302 2159 1520 751 11532 ----
NM_000533chrX11374 ------
NM_000555chrX85075 4884 1645 1197 794 557 356 88 17743 16560 --
NM_000610chr1132143 1212 282 1709 ----
NM_000615chr1132829 2174 984 --22741 1947 --
NM_000633chr1874957 3714 1858 1782 1561 1329 102 --11351 1515
NM_000721chr142276 843 330 260 ------
NM_000745chr152168 84 ------
NM_000792chr11845 ----11018
NM_000807chr4161 1533 ----
NM_000811chr52763 544 ------
NM_000813chr534550 1551 705 11471 ----
NM_000814chr1553735 2907 968 916 270 13074 ----
NM_000826chr432449 2351 43 182 ----
NM_000827chr511723 12243 ----
NM_000833chr1631528 998 550 21534 330 ----
NM_000875chr1576231 4855 2765 1842 727 562 414 --22138 2053 --
NM_000891chr1763063 2651 2450 681 515 233 ------
NM_000899chr1231698 1182 894 1860 ----
NM_000935chr311003 ------
NM_000944chr432173 959 525 ------
NM_000959chr143520 3480 2573 367 --12896 --
NM_000965chr311099 ----1427
NM_001001323chr121691 11030 12466 --
NM_001001389chr1132143 1212 282 1709 ----
NM_001001390chr1132143 1212 282 1709 ----
NM_001001391chr1132143 1212 282 1709 ----
NM_001001392chr1122189 328 1755 ----
NM_001001395chr121127 21069 595 ----
NM_001001481chr81446 --13321 --
NM_001001484chr1022279 2107 ----12408
NM_001001664chr21522 --1291 --
NM_001001787chr12105 44 ------
NM_001001890chr2143793 1711 1244 944 1353 ----
NM_001002233chr832030 2019 442 12184 --11833
NM_001003407chr1085025 4924 4356 3338 3269 1908 1249 389 13369 11607 --
NM_001003408chr1085025 4924 4356 3338 3269 1908 1249 389 13369 11607 --
NM_001003674chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_001003675chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_001003681chr222536 94 --21600 847 --
NM_001003794chr313011 32456 2074 778 --11072
NM_001003845chr21412 ------
NM_001004065chr923438 781 1545 ----
NM_001004317chr633998 3751 1463 11810 ----
NM_001005463chr102886 331 ------
NM_001005473chr536514 5437 2447 1687 ----
NM_001005474chr31149 ------
NM_001006115chr34850 814 472 102 --22507 893 --
NM_001006600chr551773 1584 1528 830 485 ------
NM_001006605chr121195 858 1275 ----
NM_001006605chr121195 858 1275 ----
NM_001006623chr22957 106 --22301 116 --
NM_001006636chr21962 1233 ----
NM_001007024chr1753876 3431 3198 1572 186 ------
NM_001007025chr1753876 3431 3198 1572 186 ------
NM_001007097chr964345 1325 1195 796 608 153 32035 1018 187 135 --
NM_001007246chr2131698 491 104 11213 ----
NM_001007257chr111064 ------
NM_001007466chr654318 3990 3704 2064 1643 --34655 3214 382 --
NM_001007553chr11154 ------
NM_001007559chr1821324 133 ------
NM_001008222chrX11307 --21237 1145 146
NM_001008401chr1911152 ------
NM_001008541chr1021811 1460 ----1380
NM_001008541chr1021811 1460 ----1380
NM_001008660chr1111373 21069 217 ----
NM_001008738chr532529 549 477 ------
NM_001008860chr15--138 ----
NM_001008892chr15--138 ----
NM_001008894chr15--138 ----
NM_001008895chr132929 100 ------
NM_001009554chr464776 3315 1190 1168 963 21 --13563 11655
NM_001009554chr464776 3315 1190 1168 963 21 --13563 11655
NM_001009958chr71228 ------
NM_001009993chr284547 4213 3574 3423 3114 2810 1631 31 11072 14127 13242
NM_001010867chr112545 15627 46451 6368 608 491 35591 2676 1086
NM_001010888chrX--24565 1139 ----
NM_001010891chr595790 5601 5580 4190 1743 1351 1116 822 803 --12040 --
NM_001010895chr921461 1340 ------
NM_001010924chr1041230 1033 471 307 ------
NM_001010986chrX31880 1539 314 ------
NM_001011666chr764198 4164 2542 990 453 189 ------
NM_001011708chr212062 12601 1846 --
NM_001011724chr131200 ------
NM_001011725chr131200 ------
NM_001012267chr91127 ------
NM_001012398chr161213 ------
NM_001012507chr61110 131 ----
NM_001012751chr1031793 1400 357 ------
NM_001012761chr572738 2573 2532 2458 2191 393 164 ------
NM_001013399chr62962 918 ------
NM_001013415chr411504 --11119 --
NM_001013620chr1258342 5236 1834 916 615 17846 ----
NM_001014380chr1345876 5860 5387 4191 25702 4090 2923 805 15664
NM_001014797chr1076243 6076 5026 2984 2967 1694 977 --36462 5438 2270 --
NM_001015877chrX33013 1935 990 1614 ----
NM_001017371chr22126 32 1391 ----
NM_001017434chr12244 171 ------
NM_001017440chr735750 5330 204 17757 16535 12905
NM_001017926chr81383 11305 ----
NM_001017977chr1----199 --
NM_001017999chr122246 424 ------
NM_001017999chr122246 424 ------
NM_001018000chr122246 424 ------
NM_001018000chr122246 424 ------
NM_001018001chr122246 424 ------
NM_001018054chr121179 436 1169 ----
NM_001018065chr945526 5195 408 92 --13845 --
NM_001018066chr945526 5195 408 92 --13845 --
NM_001018067chr133482 3467 505 14294 13538 --
NM_001018068chr133482 3467 505 14294 13538 --
NM_001018069chr133482 3467 505 14294 13538 --
NM_001018074chr543501 2669 2486 963 ------
NM_001018075chr543501 2669 2486 963 ------
NM_001018076chr543501 2669 2486 963 ------
NM_001018077chr543501 2669 2486 963 ------
NM_001018089chr1523529 338 13769 1143 13032
NM_001018090chr1542814 2664 2359 478 ------
NM_001018091chr1542924 2774 2469 588 ------
NM_001018102chr1542814 2664 2359 478 ------
NM_001023567chr15157 1423 1860 --
NM_001023587chr32332 225 ------
NM_001024094chr543501 2669 2486 963 ------
NM_001024647chr1242044 1465 582 167 11167 ----
NM_001024649chr521986 922 --1773 --
NM_001024847chr342186 307 215 133 1560 ----
NM_001024948chr163326 3024 2830 2722 2309 397 --13136 12451
NM_001025076chr1045911 2460 1812 781 21363 226 ----
NM_001025077chr1047269 2139 1245 126 34580 2721 1584 ----
NM_001025079chr374003 3822 3714 2985 2773 880 464 ------
NM_001025201chr22595 458 ------
NM_001025580chrX21311 720 1569 24259 1498 --
NM_001025780chr91406 --21532 205 --
NM_001029863chr622712 2387 2316 64 22446 706 --
NM_001029884chr622456 459 ------
NM_001030055chr1454517 3467 3184 1315 896 13163 --13775
NM_001031679chr1213119 ------
NM_001031684chr211424 ------
NM_001031690chr752621 2541 936 500 332 --53120 2586 457 264 245 153
NM_001031695chr2254682 4195 1473 1270 56 --31916 1698 527 --
NM_001031732chr443028 2316 976 781 12615 ----
NM_001031804chr1643967 743 541 236 --23117 3080 --
NM_001032380chr102653 488 ------
NM_001032394chr62777 58 1378 ----
NM_001033025chr121118 64 11299 ----
NM_001033081chr131711 757 318 --194 --
NM_001033082chr131711 757 318 --194 --
NM_001033087chr2052551 2464 2325 350 68 1909 ----
NM_001033117chr364247 3776 3519 3452 1780 36 ----11175
NM_001033503chr51100 ------
NM_001033557chr211287 1353 ----
NM_001033564chr64663 621 187 179 ------
NM_001034845chr4139 1332 ----
NM_001034853chrX2385 143 1937 ----
NM_001034954chr1023071 611 --1707 --
NM_001034955chr1023071 611 --1707 --
NM_001034956chr1023071 611 --1707 --
NM_001034957chr1023071 611 --1707 --
NM_001037132chr7--21715 352 ----
NM_001037133chr7--21715 352 ----
NM_001037164chr741769 1716 755 706 ------
NM_001037332chr532494 939 674 ------
NM_001037333chr532494 939 674 ------
NM_001037339chr121390 55 ------
NM_001037340chr121390 55 ------
NM_001037341chr121390 55 ------
NM_001037341chr121390 55 ------
NM_001037872chr22731 37 ------
NM_001038702chr541724 1717 880 549 --1760 --
NM_001039465chr141338 ------
NM_001039547chr376338 6060 3211 2430 1811 428 283 --26231 2059 --
NM_001039585chr173777 3737 2830 2661 624 147 109 --13153 --
NM_001039590chrX2936 640 1509 --12551
NM_001039591chrX2936 640 1509 --12551
NM_001039618chr1124267 2066 ----11572
NM_001039715chr11845 ----11018
NM_001039716chr11909 ----11082
NM_001039840chrX65975 5305 5295 4754 2284 90 15078 ----
NM_001039937chr1342799 2628 1229 106 --13352 14011
NM_001040113chr161988 ------
NM_001040135chr71516 ------
NM_001040152chr744681 3658 3618 3271 13118 11284 --
NM_001040181chr32906 751 ------
NM_001040182chr32906 751 ------
NM_001040183chr32906 751 ------
NM_001040199chr32906 751 ------
NM_001040200chr32906 751 ------
NM_001040214chr61543 11983 --12296
NM_001040272chr922032 1635 ------
NM_001040429chr13----11362 --
NM_001040624chr862477 2460 2214 737 548 487 1564 ----
NM_001040625chr862477 2460 2214 737 548 487 1564 ----
NM_001040626chr862477 2460 2214 737 548 487 1564 ----
NM_001040627chr862477 2460 2214 737 548 487 1564 ----
NM_001040628chr862477 2460 2214 737 548 487 1564 ----
NM_001040629chr862477 2460 2214 737 548 487 1564 ----
NM_001040630chr862477 2460 2214 737 548 487 1564 ----
NM_001040633chr7--1876 ----
NM_001040708chr821058 391 ------
NM_001040712chr933626 3327 2845 11391 ----
NM_001042361chr102306 126 ------
NM_001042364chr102306 126 ------
NM_001042365chr102306 126 ------
NM_001042387chr102306 126 ------
NM_001042393chr102306 126 ------
NM_001042396chr102306 126 ------
NM_001042397chr102306 126 ------
NM_001042404chr111978 1325 ----
NM_001042406chr62959 470 ------
NM_001042413chr943687 3334 739 291 ------
NM_001042473chr1022142 229 ------
NM_001042486chr2021357 90 ----1187
NM_001042492chr1773248 2977 2655 2125 1245 1172 494 ------
NM_001042510chr811995 --1561 --
NM_001042511chr811995 --1561 --
NM_001042537chrX41997 1807 1666 1641 1595 ----
NM_001042555chr1213727 ------
NM_001042599chr256684 6208 6015 2704 146 ------
NM_001042603chr1233995 2041 1536 ----14097
NM_001042632chr2022137 2035 1454 1912 --
NM_001042633chr2022137 2035 1454 1912 --
NM_001042683chr621740 140 ------
NM_001042749chrX21945 1616 --11496 --
NM_001042750chrX21945 1616 --11496 --
NM_001042751chrX21945 1616 --11496 --
NM_001044305chr6--1515 ----
NM_001044385chr243154 2821 1014 991 ----11550
NM_001083620chr432447 2349 43 182 ----
NM_001106chr3169108 8989 7816 7029 6826 3594 3420 3321 2972 2383 2329 2229 2164 1671 1381 266 17790 13714 --
NM_001113490chrX43322 2282 508 281 ------
NM_001121chr101696 ------
NM_001122631chr111457 ------
NM_001140chr17267 21 ------
NM_001146chr832191 278 127 ----11600
NM_001167chrX32268 1781 26 25406 4449 ----
NM_001173chr1454517 3467 3184 1315 896 13163 --13775
NM_001198chr6--139 ----
NM_001204chr227519 152 21863 249 ----
NM_001206chr911233 ------
NM_001219chr722224 684 ------
NM_001241chr222393 2347 ------
NM_001241chr222393 2347 ------
NM_001256chr1722477 307 ------
NM_001259chr734142 1465 86 1354 11522 --
NM_001278chr10------1118
NM_001304chr1712379 ------
NM_001310chr1222258 2189 1562 ----
NM_001331chr1162636 2253 792 725 698 518 ------
NM_001332chr51336 ----1125
NM_001387chr543204 1954 532 374 13086 ----
NM_001415chrX1137 --11912 1170
NM_001420chr1922129 245 --22259 714 --
NM_001429chr221210 ------
NM_001430chr21613 ------
NM_001432chr443704 2518 1324 1072 --12936 --
NM_001439chr121118 64 11299 ----
NM_001448chrX11755 --1650 --
NM_001497chr942670 2569 841 52 12438 12727 --
NM_001557chr211209 ------
NM_001564chr4129 ------
NM_001616chr233383 910 710 21137 968 ----
NM_001650chr1853977 3726 1516 1032 945 ------
NM_001660chr3184 ------
NM_001663chr1422344 2110 ------
NM_001681chr121144 ------
NM_001682chr1221078 405 1744 12180 --
NM_001688chr11280 ------
NM_001701chr9--1635 ----
NM_001742chr731640 1582 1439 --1423 --
NM_001746chr521986 922 --1773 --
NM_001753chr721191 637 21461 1197 ----
NM_001754chr2143793 1711 1244 944 1353 ----
NM_001755chr1621664 467 ------
NM_001759chr1254951 4618 3754 1564 771 1365 15312 15176
NM_001777chr374003 3822 3714 2985 2773 880 464 ------
NM_001792chr181819 ------
NM_001796chr162190 84 ------
NM_001797chr16--1320 ----
NM_001798chr122942 77 ----1871
NM_001800chr19--1450 2363 43 --
NM_001821chr163801 3394 876 220 117 100 ------
NM_001822chr22595 458 ------
NM_001858chr654874 4845 1907 1809 1730 21524 232 11649 --
NM_001859chr933150 2576 1515 12728 13429 --
NM_001884chr51462 ------
NM_001904chr331066 197 111 11037 ----
NM_001935chr22964 679 ------
NM_001938chr11419 --1615 --
NM_001946chr1241190 919 739 350 ------
NM_001951chr81563 ------
NM_001964chr5--11067 ----
NM_001968chr41866 ------
NM_002024chrX32038 1736 424 ------
NM_002025chrX57635 2123 1757 1574 605 22939 1598 21803 108 16921
NM_002040chr2142659 842 550 105 ------
NM_002048chr921333 425 ------
NM_002063chrX31266 854 342 ------
NM_002069chr721749 1330 ------
NM_002089chr4133 ----1222
NM_002092chr445074 5057 1935 1648 11569 ----
NM_002114chr6--1505 1372 --
NM_002130chr51111 ------
NM_002136chr122571 200 ------
NM_002137chr742401 2346 1710 82 ------
NM_002140chr9----1911 --
NM_002146chr1711073 ------
NM_002147chr172851 183 ------
NM_002158chr21833 ------
NM_002187chr511047 --1832 --
NM_002203chr563446 3080 2846 1330 1229 1074 ------
NM_002210chr243404 3298 1209 849 12584 --12683
NM_002223chr1263445 3399 2850 2535 1190 944 13508 ----
NM_002233chr111128 173 ----
NM_002247chr1022130 1779 ------
NM_002264chr364326 3958 3947 3837 3141 281 --1931 --
NM_002267chr134819 786 567 366 ------
NM_002268chr331898 1488 1210 1451 11535 --
NM_002270chr565376 4446 3516 3436 2047 1238 ------
NM_002310chr596527 5595 4542 4410 4379 2349 1235 1155 613 24659 697 --14633
NM_002313chr1085025 4924 4356 3338 3269 1908 1249 389 13369 11607 --
NM_002359chr1754063 3523 965 708 294 --33431 1588 580 --
NM_002380chr82245 82 ------
NM_002397chr542153 2088 1460 401 ------
NM_002399chr1521410 1282 1430 1306 --
NM_002442chr1211448 11304 ----
NM_002444chrX1427 11799 ----
NM_002451chr953708 3339 2640 759 370 ------
NM_002460chr643735 3307 1241 1114 12452 ----
NM_002518chr211015 ------
NM_002520chr5173 1229 ----
NM_002595chr1211623 --11735 --
NM_002600chr121390 55 ------
NM_002613chr1685102 5091 4753 2033 1727 630 447 400 24343 3313 24628 1894 --
NM_002645chr111369 ------
NM_002655chr845269 4032 3350 45 --13677 --
NM_002657chr2033438 3297 41 ------
NM_002710chr121159 ------
NM_002714chr62337 68 ------
NM_002715chr511103 ----11087
NM_002721chr91463 ------
NM_002731chr142460 2215 633 351 ------
NM_002736chr741879 1842 502 330 ------
NM_002737chr1756558 5426 2198 1848 135 ------
NM_002738chr1621139 53 ------
NM_002745chr2264353 4005 3353 1587 879 777 --14426 14062
NM_002748chr1521220 821 ------
NM_002763chr1--1120 ----
NM_002835chr71523 ------
NM_002839chr933626 3327 2845 11391 ----
NM_002841chr3185 ------
NM_002859chr1211761 ------
NM_002869chr1111556 1294 ----
NM_002886chr324899 3351 1841 14064 --
NM_002890chr51129 1284 ----
NM_002897chr2--1284 ----
NM_002906chr1121497 660 --12178 1556
NM_002923chr11564 1592 ----
NM_002956chr1221436 1339 ------
NM_002971chr321191 1133 ----11105
NM_002977chr242808 625 527 172 1468 ----
NM_002994chr42313 261 11877 1396 --
NM_002998chr812030 21678 234 ----
NM_003010chr1722222 1678 ------
NM_003011chr921297 514 ------
NM_003017chr61271 1439 ----
NM_003042chr312230 ------
NM_003054chr101126 ------
NM_003082chr142913 122 ------
NM_003099chr1546412 2250 1654 1147 --1365 --
NM_003108chr245456 1667 1095 1005 46928 6239 4575 1326 16689 --
NM_003111chr22126 32 1391 ----
NM_003112chr742811 2054 1086 929 ------
NM_003128chr242459 2088 1749 1084 22194 602 22656 290 --
NM_003133chr12885 103 --1781 --
NM_003136chr141408 ------
NM_003137chr641602 1516 1445 464 1328 ----
NM_003155chr81589 1452 --22709 2293
NM_003161chr1762403 2239 1057 808 684 357 23530 2812 ----
NM_003174chr102246 220 ------
NM_003182chr71219 ------
NM_003182chr71219 ------
NM_003183chr21655 ----1289
NM_003184chr81364 1378 ----
NM_003185chr2011050 --1912 --
NM_003189chr113009 --22089 709 --
NM_003194chr62534 460 ------
NM_003199chr1865312 5250 4976 4880 2158 1553 24634 134 --11142
NM_003211chr1231354 1316 1245 ----11323
NM_003214chr611337 11329 ----
NM_003221chr614148 ------
NM_003236chr22350 184 ----12610
NM_003242chr342186 307 215 133 1560 ----
NM_003246chr1531706 1351 1301 ------
NM_003253chr21--11448 ----
NM_003262chr355247 2055 1484 1344 396 24858 1055 ----
NM_003269chr61435 1162 ----
NM_003275chr931404 326 223 ------
NM_003286chr2011160 ------
NM_003298chr355370 4621 4033 1467 812 24840 3843 12383 --
NM_003304chr341193 625 404 153 ------
NM_003319chr21232 ------
NM_003339chr51446 2496 418 ----
NM_003340chr4----11299 1314
NM_003342chr1743294 2939 2783 1164 --13056 --
NM_003348chr1211332 ----11103
NM_003392chr332758 1516 308 21613 1278 11601 --
NM_003404chr2031973 1908 547 ------
NM_003410chrX32733 1951 109 --11895 --
NM_003413chrX31725 1538 439 ------
NM_003418chr31211 ------
NM_003442chr112639 358 ------
NM_003453chr13----1550 --
NM_003463chr641181 1067 775 484 22387 284 ----
NM_003468chr233970 3153 2799 21145 457 24174 2705 --
NM_003471chr362297 2216 1453 825 734 331 ------
NM_003472chr61151 ------
NM_003473chr103681 324 261 157 ----
NM_003477chr11----1545 --
NM_003483chr1212282 --1652 --
NM_003489chr2111232 1916 ----
NM_003566chr1273367 2879 2313 1063 538 467 145 1544 ----
NM_003574chr1885428 5255 4199 4133 2186 1635 1550 859 --24073 895 --
NM_003583chr1253579 3099 2564 1125 862 1905 ----
NM_003589chr132929 100 ------
NM_003590chr241517 1083 985 885 ------
NM_003618chr23530 411 213 ------
NM_003644chr1786468 6079 5902 5701 5360 4945 4518 249 --14726 --
NM_003659chr2161 ------
NM_003663chr343230 1171 249 53 ------
NM_003672chr11269 11909 ----
NM_003692chr92644 297 ------
NM_003716chr321006 141 ------
NM_003749chr1322104 529 ------
NM_003758chr1521240 127 ------
NM_003758chr1521240 127 ------
NM_003787chr1821476 270 ------
NM_003831chr1831795 243 69 11819 ----
NM_003864chr41197 ------
NM_003887chr23686 204 32 ------
NM_003895chr211549 11943 ----
NM_003909chr861978 1867 380 315 157 29 ----12078
NM_003913chr611688 1289 11528 --
NM_003924chr421586 91 --1336 --
NM_003941chr722179 697 ------
NM_003951chrX1356 ------
NM_003994chr1231698 1182 894 1860 ----
NM_003998chr41491 ------
NM_004006chrX12687 ------
NM_004007chrX12687 ------
NM_004009chrX12687 ------
NM_004010chrX12687 ------
NM_004011chrX12687 ------
NM_004012chrX12687 ------
NM_004013chrX12687 ------
NM_004014chrX12687 ------
NM_004015chrX12687 ------
NM_004016chrX12601 ------
NM_004017chrX12687 ------
NM_004018chrX12601 ------
NM_004020chrX12687 ------
NM_004021chrX12601 ------
NM_004022chrX12601 ------
NM_004023chrX12601 ------
NM_004028chr1853977 3726 1516 1032 945 ------
NM_004035chr1734926 727 355 15141 13403 --
NM_004060chr521124 1101 2435 94 ----
NM_004067chr731132 491 226 1525 11374 --
NM_004109chr112448 186 ------
NM_004136chr1532316 2043 1055 ----13081
NM_004171chr1198752 8155 7598 6479 2399 2362 1584 436 178 29003 2298 11033 23399 1328
NM_004177chr11----1702 11683
NM_004187chrX----11350 --
NM_004235chr91657 ------
NM_004236chr151119 ------
NM_004321chr243443 3335 1218 171 --42480 2328 1014 189 23140 846
NM_004338chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_004379chr211492 ------
NM_004380chr1632548 2392 2371 1967 ----
NM_004392chr1332503 2060 1725 ------
NM_004397chr1134229 3941 3185 1470 12952 --
NM_004405chr221025 257 ------
NM_004411chr71600 1108 1246 --
NM_004432chr942378 1862 927 456 ------
NM_004457chr23682 508 394 11718 ----
NM_004458chrX21664 228 ------
NM_004459chr1761994 1780 1624 1533 571 93 ------
NM_004486chr92225 207 1268 1242 --
NM_004496chr1421093 348 ------
NM_004500chr143592 461 317 11952 ----
NM_004501chr121487 649 32615 2595 2584 ----
NM_004504chr222091 350 ------
NM_004505chr1721485 661 ------
NM_004529chr911169 ------
NM_004571chr2121073 1036 1624 13046 --
NM_004580chr1521369 572 ------
NM_004598chr51380 ------
NM_004612chr944194 1240 1063 313 11575 ----
NM_004615chrX2711 346 ------
NM_004631chr121179 436 1169 ----
NM_004660chrY22159 2096 1113 ----
NM_004663chr151199 11492 130 --
NM_004708chr191115 ------
NM_004719chr121939 11842 1630 --
NM_004725chr102528 406 ------
NM_004726chrX55766 4378 2125 711 534 1111 34993 4724 4619 --
NM_004737chr2261280 882 846 403 285 219 ------
NM_004742chr341777 1577 1517 641 --11178 --
NM_004748chr152922 826 1444 ----
NM_004755chr141149 ------
NM_004768chr11124 ------
NM_004775chr1832380 1747 413 11880 187 --
NM_004781chr11586 11565 1439 1660
NM_004781chr11586 11565 1439 1660
NM_004796chr14----1735 --
NM_004801chr2----11509 --
NM_004822chr1763857 3506 3181 3011 2680 568 --23206 2489 --
NM_004834chr223205 112 ------
NM_004841chr11934 ------
NM_004845chrX43479 1447 600 362 11274 ----
NM_004869chr1811576 ----1212
NM_004871chr1753876 3431 3198 1572 186 ------
NM_004884chr1521537 1347 --11242 --
NM_004887chr521086 1074 1157 ----
NM_004904chr764198 4164 2542 990 453 189 ------
NM_004926chr1411384 ------
NM_004947chr332255 831 783 12609 ----
NM_004949chr1811688 ----12052
NM_004956chr754406 3321 2795 1255 1063 14568 ----
NM_004969chr101533 ------
NM_004976chr1164792 4414 3853 3259 1421 1009 --34666 3483 420 --
NM_004985chr1233564 3091 766 14467 ----
NM_004999chr654293 3484 1502 1164 465 ------
NM_005006chr21129 ------
NM_005010chr7--21715 352 ----
NM_005025chr31193 ------
NM_005026chr11142 ------
NM_005056chr1224239 1780 ----24341 69
NM_005065chr1445092 4908 4043 3335 --13692 --
NM_005066chr1----1589 --
NM_005068chr61176 11379 1409 --
NM_005095chr11850 21891 1398 ----
NM_005105chr171630 1570 480 462 299 216 88 ------
NM_005109chr3----12498 --
NM_005113chr141328 ------
NM_005119chr1----1956 --
NM_005121chr171158 ----1925
NM_005124chr62274 84 ------
NM_005126chr33319 217 126 ------
NM_005140chrX21061 818 ------
NM_005156chr941505 1350 1329 527 11872 ----
NM_005180chr1021225 139 ----11037
NM_005188chr11106704 6432 6411 2805 2558 2223 1900 1203 673 425 37375 7061 2480 17091 --
NM_005190chr62962 918 ------
NM_005197chr1475991 5623 5008 4615 2354 1539 898 --11408 --
NM_005235chr256684 6208 6015 2704 146 ------
NM_005241chr321345 1146 ------
NM_005254chr1511291 11112 ----
NM_005259chr231219 1157 90 170 ----
NM_005295chr7----1109 --
NM_005302chr71356 ------
NM_005324chr1731792 669 371 ----1340
NM_005328chr82314 58 ------
NM_005342chrX62435 1963 1142 611 492 360 --1465 22741 1828
NM_005359chr1866384 4250 4177 2111 1155 260 22597 1088 ----
NM_005378chr22563 272 ------
NM_005398chr102447 343 --1133 --
NM_005402chr71628 11769 21612 1271 --
NM_005407chr141119 177 ----
NM_005436chr1063629 1291 1058 648 578 115 ------
NM_005440chr1712225 12393 1556 --
NM_005455chr141711 1690 1301 250 ------
NM_005458chr9----11815 1442
NM_005461chr2021974 1388 ------
NM_005465chr11543 21942 1341 ----
NM_005487chr222536 94 --21600 847 --
NM_005493chr6------1710
NM_005497chr1725793 97 25892 5349 15128 --
NM_005499chr193594 451 66 ------
NM_005517chr121459 123 --11057 --
NM_005520chr51517 1260 ----
NM_005562chr11622 11369 ----
NM_005573chr51492 ------
NM_005578chr334682 3604 547 14006 1760 1971
NM_005594chr12190 ------
NM_005596chr976454 4843 4457 4276 4154 1895 505 12107 11709 --
NM_005599chr121174 419 11369 ----
NM_005604chr61439 --1958 --
NM_005627chr62923 845 ----1334
NM_005637chr1821324 133 ------
NM_005655chr8--1928 ----
NM_005665chr154071 3389 1317 549 437 ------
NM_005668chr534087 3898 3763 ------
NM_005707chr151133 ------
NM_005719chr121171 ------
NM_005738chr741769 1716 755 706 ------
NM_005748chr1223122 468 13320 ----
NM_005754chr521180 942 ------
NM_005756chrX--11114 ----
NM_005776chr141741 ------
NM_005779chr553066 1034 881 573 357 ------
NM_005795chr242831 2686 1994 352 22881 612 ----
NM_005801chr171772 ------
NM_005828chr1753719 1499 1401 1183 192 34968 4899 4489 23494 328 23813 3711
NM_005832chr311011 1100 ----
NM_005840chrX2741 379 37632 2201 1743 ----
NM_005853chr161471 ------
NM_005859chr521286 561 ------
NM_005906chr661668 1629 551 466 458 396 ------
NM_005907chr611150 ------
NM_005909chr534129 3795 2750 1654 ----
NM_005935chr464250 3509 1751 1408 1075 996 --1186 --
NM_005941chr853891 3214 3026 737 74 ------
NM_005955chr165007 4984 4385 3918 3593 1390 34466 3808 517 23453 651 --
NM_005962chr1021811 1460 ----1380
NM_005962chr1021811 1460 ----1380
NM_005966chr22913 631 ------
NM_005977chr131776 ------
NM_005986chr1321046 987 ------
NM_006007chr954104 3560 1576 621 376 ----12850
NM_006047chr2012160 145 ----
NM_006060chr732871 2765 451 23713 1443 --14461
NM_006095chr4104439 4346 3750 3685 1718 1353 1323 1066 346 321 1787 ----
NM_006114chr191452 ------
NM_006136chr731123 551 98 ------
NM_006148chr172591 471 12915 11168 --
NM_006158chr851734 1560 602 447 397 1163 ----
NM_006166chr121463 21872 1015 ----
NM_006203chr533902 1140 666 --13465 --
NM_006212chr165133 3284 1982 1968 1625 1016 --34686 4000 160 --
NM_006218chr31242 ------
NM_006226chr21423 ----11230
NM_006251chr521317 270 ------
NM_006265chr811524 21122 580 ----
NM_006267chr2178 ------
NM_006275chr201460 11615 ----
NM_006281chr82377 182 1263 ----
NM_006281chr82377 182 1263 ----
NM_006298chr632979 2622 894 --22542 749 --
NM_006345chr42934 260 ------
NM_006353chr631226 425 109 ------
NM_006357chr21199 ------
NM_006359chrX41997 1807 1666 1641 1595 ----
NM_006380chr1732712 1442 1273 --23413 1020 --
NM_006400chr12131 ------
NM_006408chr7----2877 113 --
NM_006415chr9----11015 --
NM_006416chr6----1126 --
NM_006420chr2033403 1065 318 12926 ----
NM_006421chr821233 497 ------
NM_006434chr1023071 611 --1707 --
NM_006451chr51113 ------
NM_006482chr1253579 3099 2564 1125 862 1905 ----
NM_006504chr103864 619 121 ------
NM_006549chr1252212 2168 2090 681 130 12297 ----
NM_006559chr11476 132 ----
NM_006561chr1045911 2460 1812 781 21363 226 ----
NM_006582chr1127 ------
NM_006595chr1111944 1781 11582 --
NM_006599chr1666459 5900 5552 5026 3069 2163 16663 13085 22623 456
NM_006603chrX21945 1616 --11496 --
NM_006609chr232614 2575 1041 ------
NM_006614chr31448 1661 ----
NM_006625chr11839 ------
NM_006625chr11839 ------
NM_006625chr11839 ------
NM_006654chr1213727 ------
NM_006670chr61148 ------
NM_006710chr22891 178 1728 ----
NM_006720chr1085025 4924 4356 3338 3269 1908 1249 389 13369 11607 --
NM_006729chrX35248 4145 787 ------
NM_006734chr641532 1326 1072 1038 ------
NM_006793chr102270 82 ------
NM_006800chrX2612 500 ------
NM_006805chr521309 31 11342 ----
NM_006813chr6--1233 ----
NM_006819chr112416 316 ------
NM_006826chr21969 ------
NM_006827chr1443189 2906 2192 2172 11177 ----
NM_006832chr14--1184 ----
NM_006838chr1241850 1478 1413 466 ------
NM_006874chr43453 326 31 ------
NM_006885chr1632989 2972 1688 --23068 1441 13264
NM_006888chr1443385 2976 1314 661 --32954 777 771 --
NM_006910chr161375 ------
NM_006920chr221309 791 ------
NM_006922chr252314 914 643 619 422 ------
NM_006924chr1731602 1400 311 13629 ----
NM_006925chr141338 ------
NM_006948chr2132380 2107 22 1348 ----
NM_006981chr931934 588 248 --1729 --
NM_007006chr1633488 3384 1215 ------
NM_007007chr1221502 267 ------
NM_007008chr23843 633 212 ------
NM_007011chr1556140 4827 2531 967 180 12019 2929 859 --
NM_007034chr11984 ------
NM_007042chr352225 1816 1035 600 579 --1433 --
NM_007045chr61576 ------
NM_007050chr2047409 7218 2640 664 28100 44 18072 11747
NM_007067chr171274 ------
NM_007073chr623872 88 1341 11535 --
NM_007124chr61480 ------
NM_007137chrX34589 2228 129 ------
NM_007158chr11154 ------
NM_007159chr341604 1423 1218 601 1505 ----
NM_007166chr1111373 21069 217 ----
NM_007203chr923438 781 1545 ----
NM_007222chr81383 11305 ----
NM_007236chr1542406 2383 2040 531 ------
NM_007249chr1326072 261 39469 9306 3168 ----
NM_007283chr313011 32456 2074 778 --11072
NM_007285chr16----1337 --
NM_007292chr1734926 727 355 15141 13403 --
NM_007345chr1841883 1705 1528 397 ------
NM_007347chr1563108 2610 1242 1102 977 631 1788 ----
NM_007350chr12----24047 1566 --
NM_007358chr131312 760 165 ------
NM_007373chr1021791 1246 ----11555
NM_012081chr543721 3068 1296 99 ----13585
NM_012082chr81228 --1234 --
NM_012110chr41240 ------
NM_012120chr632934 2722 1912 22708 54 ----
NM_012141chr1342799 2628 1229 106 --13352 14011
NM_012154chr81837 ------
NM_012156chr2023034 941 12744 ----
NM_012164chr937529 5864 243 37260 1945 426 ----
NM_012214chr275746 5243 4453 4003 1789 1268 441 ------
NM_012215chr1011874 ----11891
NM_012229chr1011412 ------
NM_012233chr241174 1123 732 168 ------
NM_012234chr352617 1289 1221 510 292 ------
NM_012242chr101295 149 --1540
NM_012249chr233544 3534 1380 12979 1872 --
NM_012259chr621342 1160 ------
NM_012262chr195200 4773 3785 1393 1336 1241 845 784 412 --11825 --
NM_012281chr722127 1794 --1617 2406 44
NM_012287chr351266 637 600 579 229 ------
NM_012290chr241449 1224 1183 642 ------
NM_012297chr44962 834 458 136 2672 602 ----
NM_012300chr5--199 ----
NM_012302chr11916 ------
NM_012330chr1011371 ------
NM_012402chr1131053 157 25 ----1264
NM_012413chr22142 92 ------
NM_012416chr921178 775 ------
NM_012419chr61132 ------
NM_012446chr52509 458 ------
NM_012463chr1231593 525 248 --11689 --
NM_012479chr742607 2297 1030 196 --1762 --
NM_013231chr1421658 1067 13468 1950 --
NM_013243chr1521454 102 ------
NM_013255chr758135 7268 3112 1697 1220 27593 7008 ----
NM_013269chr1253433 1815 1429 1323 443 21585 866 ----
NM_013281chr201349 ----1493
NM_013283chr51715 ------
NM_013286chr35758 733 668 248 108 --2531 214 --
NM_013293chr73706 248 83 ------
NM_013309chr1521808 103 1577 12260 --
NM_013316chr71997 ------
NM_013320chr12------158
NM_013341chr212062 12601 1846 --
NM_013357chr82810 158 ------
NM_013372chr1533273 2737 1051 ------
NM_013374chr32496 151 --11099 --
NM_013381chr121638 1863 ----
NM_013386chr121507 1445 ------
NM_013438chr921276 702 ------
NM_013444chrX21096 734 ------
NM_013446chr71929 ------
NM_013447chr1931190 236 139 --23506 3415 --
NM_013450chr21194 ------
NM_013996chr71219 ------
NM_013996chr71219 ------
NM_013997chr71219 ------
NM_013997chr71219 ------
NM_013998chr71219 ------
NM_013998chr71219 ------
NM_014003chr161373 --1308 --
NM_014011chr211712 22089 301 1264 --
NM_014034chr6----11220 --
NM_014043chr31148 1440 ----
NM_014048chr1644751 3690 1924 1139 ------
NM_014060chrX----197 --
NM_014071chr201534 169 ----
NM_014106chr1552915 2832 2500 289 260 ------
NM_014112chr855345 4961 3840 1874 573 ------
NM_014117chr162380 341 1587 ----
NM_014154chr311309 ------
NM_014181chr232594 1871 1805 --1797 --
NM_014243chr411487 ------
NM_014250chr222536 94 --21600 847 --
NM_014294chr81558 1173 ----
NM_014309chr2254672 4185 1463 1260 46 --31906 1688 517 --
NM_014317chr101249 ------
NM_014325chr1241556 801 252 63 ------
NM_014350chr531166 392 362 ------
NM_014363chr1311118 1144 ----
NM_014365chr121815 ------
NM_014372chr111534 12124 ----
NM_014376chr532494 939 674 ------
NM_014395chr421955 1391 21265 63 ----
NM_014415chr331487 1436 117 ----11113
NM_014423chr524681 2093 24952 253 ----
NM_014445chr321902 298 ------
NM_014458chr13901 377 362 ------
NM_014494chr1622386 1722 1658 ----
NM_014504chr721948 479 ------
NM_014608chr151540 ------
NM_014612chr921522 82 ----1286
NM_014620chr122711 290 1522 ----
NM_014655chr13890 694 594 ------
NM_014667chr331812 671 527 ------
NM_014682chr811681 12040 ----
NM_014690chr752621 2541 936 500 332 --53120 2586 457 264 245 153
NM_014705chr711417 ------
NM_014707chr71538 11574 ----
NM_014717chr19164 1888 ----
NM_014720chr10--21843 461 ----
NM_014721chr667030 6124 4734 2745 2462 746 --15680 --
NM_014730chr1235200 4353 430 24234 1824 1677 --
NM_014730chr1235200 4353 430 24234 1824 1677 --
NM_014743chr42332 215 ----1960
NM_014764chr1211204 ------
NM_014781chr821050 971 ------
NM_014787chr1--32347 1784 375 ----
NM_014797chr643035 2450 736 357 1123 1333 --
NM_014803chr10--12255 22961 2160 --
NM_014810chr132392 991 209 ------
NM_014812chr111978 1325 ----
NM_014830chr1211443 --23603 235 --
NM_014836chr102653 488 ------
NM_014840chr1232646 616 379 1558 --193
NM_014850chr364247 3776 3519 3452 1780 36 ----11175
NM_014873chr143996 1847 1767 1246 24020 3213 14718 --
NM_014892chr61413 1427 ----
NM_014893chrY11752 1626 ----
NM_014897chr1722436 1035 ----21277 389
NM_014902chr2021357 90 ----1187
NM_014906chr1753479 3354 3004 714 684 ------
NM_014912chr1032949 2921 2873 --13515 --
NM_014920chr631147 1037 438 12520 1424 --
NM_014923chr1312263 1443 ----
NM_014932chr311502 12014 1646 --
NM_014939chr18188 ------
NM_014942chr642522 875 427 68 1172 11916 --
NM_014953chr1344159 3576 3483 3290 --11301 --
NM_014961chr422224 2077 ------
NM_014969chr131061 871 774 1208 ----
NM_014977chr14----153 --
NM_014988chr432729 2035 654 ------
NM_014991chr422392 2243 11200 13141 --
NM_014997chr732065 1013 481 11158 11001 --
NM_015000chr1222645 317 ------
NM_015025chr21117 22642 1050 ----
NM_015026chr1274157 3413 3142 1871 1740 1553 904 ------
NM_015032chr1352718 2599 2213 1877 909 --1231 --
NM_015042chr1553602 1311 1235 1183 152 1255 ----
NM_015051chr922147 1347 ------
NM_015054chr12150 ------
NM_015055chr1132807 1825 30 ----11069
NM_015068chr733533 2510 2470 --21216 136 --
NM_015071chr556207 6181 5729 2147 1174 --15939 --
NM_015076chr654331 4211 3240 3176 644 ----11590
NM_015091chr142119 72 ------
NM_015092chr1634100 842 580 --1539 --
NM_015107chrX12030 --4840 834 828 515 --
NM_015110chr91904 11804 ----
NM_015125chr19175 ------
NM_015130chr4--11158 ----
NM_015132chr711554 --1692 --
NM_015155chr1082987 2791 2705 2681 941 689 523 36 ----13359
NM_015156chr141877 1598 13593 --
NM_015163chr141344 11298 ----
NM_015172chr111467 --1448 --
NM_015176chr131546 1303 58 --11581 --
NM_015180chr141601 ------
NM_015206chr1513770 ----12496
NM_015209chr122246 424 ------
NM_015215chr14986 459 415 347 --22272 1254 12734
NM_015216chr52546 310 11040 ----
NM_015252chr2--1665 1921 --
NM_015263chr151473 ----21154 992
NM_015267chr122168 125 --11742 --
NM_015268chr31608 ------
NM_015271chr464176 1549 1073 537 496 129 --13806 --
NM_015277chr1811883 1410 ----
NM_015308chr11197 ------
NM_015313chr1153852 3616 1082 1047 629 ------
NM_015328chr732354 575 135 ------
NM_015336chr1232535 2270 107 1394 ----
NM_015344chr821470 487 ------
NM_015349chr632987 858 138 1266 1582 --
NM_015355chr1761708 1620 1401 673 345 22 ------
NM_015358chr211488 --1388 --
NM_015365chrX21311 720 1569 24259 1498 --
NM_015385chr1023071 611 --1707 --
NM_015396chr3----1568 --
NM_015435chr81520 ------
NM_015460chr362076 1840 1555 1458 687 143 11500 ----
NM_015461chr181584 ------
NM_015483chr73986 363 34 ----173
NM_015508chr321443 1261 ----1375
NM_015532chr1542814 2664 2359 478 ------
NM_015548chr61775 1743 ----
NM_015550chr733101 3059 1375 13144 ----
NM_015554chr1522719 1908 --193 --
NM_015565chr21--1457 --1619
NM_015569chr144146 4124 812 321 13989 11034 --
NM_015570chr72564 393 ------
NM_015571chr632359 1959 243 ------
NM_015576chr331140 988 43 1526 --1248
NM_015584chr1711185 ------
NM_015601chr101793 ------
NM_015605chr102306 126 ------
NM_015634chr101475 ------
NM_015640chr133482 3467 505 14294 13538 --
NM_015678chr1321535 1137 ----11269
NM_015845chr181219 ------
NM_015852chr723558 3436 ------
NM_015866chr111064 ------
NM_015879chr18107010 5570 2991 2045 2018 1694 1515 1020 842 31 ------
NM_015902chr83778 192 25 ------
NM_015906chr134832 4718 3337 ------
NM_015915chr141312 ------
NM_015981chr552476 1155 996 320 31 --12261 13099
NM_015986chr173976 419 312 ------
NM_016006chr31256 ------
NM_016009chr154827 4385 4309 945 570 ------
NM_016025chr16--1777 11444 --
NM_016032chrX11307 --21237 1145 146
NM_016040chr142510 2327 1997 868 1922 ----
NM_016061chr241468 310 288 276 ------
NM_016073chr15147 1313 ----
NM_016076chr123191 272 ------
NM_016083chr623312 84 ------
NM_016087chr721264 1246 ------
NM_016096chr811995 --1561 --
NM_016100chr201135 ------
NM_016103chr51100 ------
NM_016129chr41336 ------
NM_016131chr231818 1566 624 11745 ----
NM_016132chr1522689 229 --53044 2948 2465 2112 740 --
NM_016141chr32678 313 ------
NM_016152chr311099 ----1427
NM_016201chr352113 1755 1746 764 596 32288 1669 183 32081 710 369 --
NM_016203chr7--1876 ----
NM_016205chr431463 1201 36 1542 11407 --
NM_016206chr3108999 8769 8671 8289 6149 2135 1753 1334 914 440 12720 17987 18437
NM_016231chr1731440 1340 256 11481 ----
NM_016260chr277245 5844 4812 2860 2690 1238 1153 14846 12314 --
NM_016271chr18--1194 ----
NM_016287chr111789 ------
NM_016308chr122084 212 11427 ----
NM_016316chr22731 37 ------
NM_016374chr12990 39 ------
NM_016374chr12990 39 ------
NM_016396chr1533036 1090 1031 ------
NM_016404chr11--131 ----
NM_016441chr23843 647 399 ------
NM_016488chr1221929 705 ------
NM_016506chr11186 ------
NM_016507chr1732244 1069 208 ------
NM_016513chr631147 1037 438 12520 1424 --
NM_016522chr1121206 1129 ------
NM_016529chr13--1250 ----
NM_016530chr1544070 3595 3125 275 ------
NM_016531chr473957 3367 2854 1149 882 800 690 ------
NM_016577chr374445 3973 3781 1695 1213 1140 191 ----14412
NM_016603chr522213 1676 ----12027
NM_016626chr1831606 580 160 ------
NM_016653chr211101 --1266 --
NM_016654chr1511291 11112 ----
NM_016824chr101696 ------
NM_016836chr2--1284 ----
NM_016839chr2--1284 ----
NM_016941chr192445 392 ------
NM_017412chr8------1236
NM_017415chr584446 3968 3686 3373 3286 2831 790 412 1114 --14186
NM_017420chr1411441 23123 719 12899 11238
NM_017423chr42731 474 ------
NM_017519chr621097 60 1175 ----
NM_017522chr121179 436 1169 ----
NM_017548chr332123 1979 573 --11939 1646
NM_017583chr1121620 635 11707 11392 --
NM_017610chr1511785 21653 770 ----
NM_017634chr821963 1327 ------
NM_017637chr968116 8016 3705 2284 2242 1373 ------
NM_017641chr121937 31191 901 37 ----
NM_017650chr764199 2149 1399 813 543 248 --11731 15212
NM_017658chr14114616 4364 4245 3401 3171 2983 1287 1242 1110 954 729 ------
NM_017686chr1------1998
NM_017737chr142035 1733 1539 1431 1660 11845 --
NM_017742chr1841910 1590 1262 300 ------
NM_017769chr1422426 2239 ------
NM_017770chr621017 770 12362 1695 --
NM_017813chr8--25341 299 13727 --
NM_017824chr1021801 1686 ------
NM_017831chr181116 24769 3769 ----
NM_017847chr122290 218 1588 ----
NM_017848chrX53899 1762 1152 602 434 --13505 --
NM_017896chr2043420 3087 2704 633 --2595 322 --
NM_017953chr121132 69 ------
NM_017994chr722953 113 ------
NM_018000chr231965 1880 900 21526 539 ----
NM_018028chr19--11319 ----
NM_018036chr1474206 3563 3233 3067 1657 1564 1421 11676 11590 --
NM_018048chr122155 53 1497 22039 300 --
NM_018061chr111635 --1402 1634
NM_018063chr10--1360 ----
NM_018064chr61109 ------
NM_018084chr222433 966 --1840 --
NM_018095chr11186 ------
NM_018105chr831159 871 837 ------
NM_018121chr1033006 782 458 ------
NM_018131chr102299 159 ------
NM_018133chr332095 1365 62 ------
NM_018159chrX11653 --11494 --
NM_018164chr12193 ------
NM_018181chr1831417 720 105 --11958 --
NM_018195chr11--1208 ----
NM_018266chr321026 890 1903 ----
NM_018270chr202801 282 ------
NM_018287chr1021067 399 ------
NM_018290chr41393 11107 ----
NM_018298chr11678 ----1889
NM_018299chr81446 --13321 --
NM_018313chr331749 666 582 ------
NM_018315chr411504 --11119 --
NM_018330chr1031700 1530 292 ------
NM_018339chr9178 ------
NM_018362chr1123948 3844 --13610 --
NM_018367chr1152166 1751 541 458 316 1441 ----
NM_018368chr63202 119 49 ------
NM_018383chr221470 520 2772 541 11785 --
NM_018403chr343631 1096 943 263 11357 1296 11047
NM_018409chr441027 684 80 71 ------
NM_018413chr12182 ------
NM_018416chr1221683 259 ------
NM_018439chr1842567 1931 571 150 --1847 --
NM_018442chr1----199 --
NM_018482chr812356 1970 ----
NM_018557chr241667 1594 1148 390 ------
NM_018566chr131768 1437 73 --14586 --
NM_018638chr1245309 4810 3892 108 ------
NM_018640chr121127 21069 595 ----
NM_018650chr131574 812 135 31863 1440 147 12214 --
NM_018657chr31840 ------
NM_018685chr71818 1808 --1412
NM_018695chr551773 1584 1528 830 485 ------
NM_018703chr161375 ------
NM_018718chr7--1808 11889 --
NM_018834chr521024 944 ------
NM_018844chr752028 1918 1867 268 53 --11976 --
NM_018945chr643380 2727 2717 1402 ----13529
NM_018948chr131122 895 162 ------
NM_018979chr1221701 114 --21769 1022 --
NM_019006chr151478 ----1291
NM_019027chr42510 330 ------
NM_019036chr62959 470 ------
NM_019045chrX1229 ------
NM_019063chr2------12188
NM_019072chr534288 4121 343 ----147
NM_019084chr1032593 520 52 11991 ----
NM_019117chrX42919 2235 590 324 ------
NM_019593chr2032660 2460 878 13193 12260 --
NM_019613chr172835 246 1266 11049 1219
NM_019891chr11371 --1337 --
NM_019895chr32906 751 ------
NM_019903chr101696 ------
NM_020122chr243861 1775 1198 313 --14124 --
NM_020144chr71499 --11858 --
NM_020150chr1021967 738 12097 ----
NM_020184chr22667 241 32265 2234 641 11430 --
NM_020226chr41701 ------
NM_020240chr541724 1717 880 549 --1760 --
NM_020245chr654224 3896 3610 1970 1549 --34561 3120 288 --
NM_020307chr31348 ------
NM_020338chr1033652 3320 3164 1945 2198 118 --
NM_020342chr212118 12370 22027 323 --
NM_020348chr1011776 ------
NM_020394chr121615 514 11054 ----
NM_020443chr156841 6445 6123 2350 2321 22688 2218 25946 2275 --
NM_020445chr71516 ------
NM_020455chr62777 58 1378 ----
NM_020475chr822408 665 12368 ----
NM_020476chr822408 665 12368 ----
NM_020477chr822408 665 12368 ----
NM_020478chr822471 728 12431 ----
NM_020480chr822408 665 12368 ----
NM_020532chr23843 633 212 ------
NM_020640chr331934 1896 1730 ------
NM_020647chr832344 827 498 12236 ----
NM_020673chr2057792 7194 6280 2698 500 ------
NM_020699chr155423 3617 1491 1035 1024 --24593 3700 --
NM_020732chr621097 60 1175 ----
NM_020739chr152922 826 1444 ----
NM_020742chrX32654 2258 1818 22176 640 ----
NM_020748chr1722091 1983 ------
NM_020752chr1032435 1963 1843 12729 1750 --
NM_020760chr241894 1796 266 113 ------
NM_020766chrX94620 4504 4393 3982 980 610 577 541 101 ------
NM_020768chr511234 --21212 609 12810
NM_020771chr631533 1039 327 ------
NM_020772chr1768346 7185 6681 6354 2236 241 46886 5691 3347 2963 18194 --
NM_020792chr31118 --1726 --
NM_020794chr131123 1092 1028 --2222 191 --
NM_020825chr1673768 3697 3474 2778 464 453 376 1391 ----
NM_020830chr233190 2343 406 ------
NM_020866chr132235 47 ------
NM_020870chr412007 --1511 1882
NM_020871chrX22201 779 11830 ----
NM_020872chr311788 ------
NM_020935chr254467 3926 3441 3071 1276 ------
NM_020940chr10--22522 2404 12821 --
NM_020951chr1952098 1928 1627 937 595 ------
NM_021005chr15--1880 ----
NM_021033chr1323029 2197 1278 2999 652 --
NM_021072chr541873 1828 436 126 ------
NM_021083chrX53525 3126 3079 3018 494 ----13532
NM_021090chr2233711 3378 1131 --23980 785 11790
NM_021132chr10--1912 ----
NM_021144chr9--1193 ----
NM_021148chr721880 1866 ------
NM_021159chr411061 ------
NM_021189chr11249 ------
NM_021190chr11154 ------
NM_021191chr1241973 1004 648 499 --12264 --
NM_021192chr21407 ------
NM_021215chr2012415 1310 ----
NM_021252chr102705 171 ------
NM_021255chr1423053 264 ----13651
NM_021627chr311154 --1205 --
NM_021629chr333867 3537 232 21669 68 --1752
NM_021647chr464776 3315 1190 1168 963 21 --13563 11655
NM_021648chr642564 2048 1075 584 11881 1423 --
NM_021728chr142695 237 ------
NM_021738chr102246 220 ------
NM_021813chr625667 2345 15728 ----
NM_021911chr534550 1551 705 11471 ----
NM_021912chr1553735 2907 968 916 270 13074 ----
NM_021914chr1442038 1500 897 254 12389 ----
NM_021940chr6--1515 ----
NM_021960chr132710 1943 254 21737 641 ----
NM_021961chr1111191 2535 202 16963 --
NM_021964chr375945 5168 2546 2369 2286 1855 1447 ------
NM_021998chrX31466 1425 1418 ------
NM_022062chr1111917 ----11354
NM_022073chr1421333 487 ------
NM_022075chr11203 ------
NM_022079chr101793 ------
NM_022090chr51389 1526 ----
NM_022118chr131449 ------
NM_022444chr72743 107 1760 ----
NM_022456chr1242044 1465 582 167 11167 ----
NM_022459chr1336165 2460 1552 1989 14738 --
NM_022465chr1232314 2183 2131 12769 ----
NM_022475chr41593 ------
NM_022476chr161213 ------
NM_022552chr21368 1350 ----
NM_022566chr151635 ------
NM_022650chr51129 1284 ----
NM_022652chr1241190 919 739 350 ------
NM_022730chr231016 675 344 ------
NM_022739chr17--11060 ----
NM_022763chr332678 980 848 12180 ----
NM_022771chr1211029 ------
NM_022780chr221622 418 1520 --1478
NM_022781chr922706 180 ------
NM_022810chrX1356 ------
NM_022817chr221883 79 11927 --1834
NM_022826chr211101 1322 ----
NM_022836chr11394 1541 ----
NM_022841chr1542362 463 367 195 ------
NM_022843chr131167 ------
NM_022844chr161988 ------
NM_022845chr1621618 421 ------
NM_022893chr242629 2540 992 382 ------
NM_022901chr951514 1459 624 611 71 ------
NM_022912chr222579 2212 ------
NM_022918chr1121436 667 ------
NM_022977chrX21664 228 ------
NM_023010chrX2546 111 ------
NM_023035chr191583 ------
NM_023927chr521151 546 ------
NM_023929chr832378 1011 113 2722 122 ----
NM_024017chr1721560 57 ------
NM_024061chr71228 ------
NM_024345chr994993 4881 4363 4117 2334 2088 1285 803 529 35062 4598 1148 ----
NM_024415chr51159 ------
NM_024429chr7--1876 ----
NM_024430chr18187 --1394 1253
NM_024482chr1127 ------
NM_024511chr422779 772 ----12568
NM_024524chr332135 723 414 13028 ----
NM_024529chr11295 1391 ----
NM_024545chr21697 ------
NM_024548chr311325 ------
NM_024581chr6167 ------
NM_024582chr43980 722 237 ------
NM_024590chr43781 282 126 ----11252
NM_024611chr1523529 338 13769 1143 13032
NM_024613chr83368 255 36 ------
NM_024615chr5----1199 --
NM_024617chr91784 ------
NM_024645chr8--21332 209 ----
NM_024646chr133571 877 737 --14022 --
NM_024659chr21962 1233 ----
NM_024713chr1531500 1415 280 1579 ----
NM_024742chr16183 --11649 21736 246
NM_024761chr9125031 4703 4385 4244 3813 2045 1921 1672 1555 1096 971 925 --23351 542 14392
NM_024769chr11--1739 ----
NM_024770chr246626 4792 1204 617 --15454 --
NM_024915chr872392 2232 1880 1818 1774 1119 526 12826 ----
NM_024940chr821222 403 11763 ----
NM_024949chr444971 3465 3093 335 14543 1399 14098
NM_024953chr1212019 --12030 --
NM_024989chr2107745 6678 5458 4989 3248 2987 2934 1564 922 402 13014 ----
NM_024991chr1023071 611 --1707 --
NM_025054chr823507 1283 ------
NM_025073chr154734 4184 3554 1059 156 11882 ----
NM_025074chr411062 13075 --12794
NM_025077chr1--1266 ----
NM_025134chr1612270 ------
NM_025146chr332315 2009 1083 ----1976
NM_025147chr21117 ------
NM_025151chr832030 2019 442 12184 --11833
NM_025154chr711017 ------
NM_025160chr144309 2853 2790 1278 ------
NM_025181chr23721 196 188 ------
NM_025182chr91291 ------
NM_025191chr11167 1814 --1504
NM_025208chr111236 ------
NM_025235chr101290 --1570 --
NM_025238chr1521014 628 192 ----
NM_030583chr82245 82 ------
NM_030627chr533395 1642 1404 ------
NM_030647chr735594 5357 1067 ------
NM_030648chr422117 808 35468 1440 99 ----
NM_030664chr1022279 2107 ----12408
NM_030670chr1222006 392 ----11959
NM_030671chr1222006 392 ----11959
NM_030674chr1244990 4024 1829 1092 14136 --14865
NM_030751chr1011542 197 ----
NM_030751chr1011542 197 ----
NM_030756chr101297 ------
NM_030762chr1241404 1294 474 165 ------
NM_030786chr11758 --11201 --
NM_030799chr532186 2101 2027 ------
NM_030922chr15--138 ----
NM_030939chr61949 ------
NM_030953chr521239 184 ------
NM_031157chr122571 200 ------
NM_031216chr1811665 ------
NM_031243chr742401 2346 1710 82 ------
NM_031262chr9----1854 --
NM_031263chr9----1911 --
NM_031268chr1685102 5091 4753 2033 1727 630 447 400 24343 3313 24628 1894 --
NM_031289chr123895 382 65 ----1371
NM_031314chr143592 461 317 11952 ----
NM_031371chr12990 39 ------
NM_031371chr12990 39 ------
NM_031372chr431506 1427 527 1201 --11087
NM_031419chr31149 ------
NM_031442chrX63089 2946 1284 455 448 146 --1575 --
NM_031445chr223393 3281 12888 --151
NM_031468chr735750 5330 204 17757 16535 12905
NM_031469chr631257 340 154 ----23799 3080
NM_031476chr1632360 2037 318 --11804 11110
NM_031477chr161260 ------
NM_031483chr2042458 2416 2282 1134 ------
NM_031844chr121487 649 32615 2595 2584 ----
NM_031953chr42400 170 ------
NM_032012chr973834 3384 1585 1421 305 88 66 1723 --13444
NM_032041chr862477 2460 2214 737 548 487 1564 ----
NM_032102chr1153095 2620 1166 898 717 12614 ----
NM_032105chr11421 --36967 5874 1587 11329
NM_032116chr1345876 5860 5387 4191 25702 4090 2923 805 15664
NM_032121chrX52817 2753 2427 2032 672 22068 961 ----
NM_032145chr621834 1706 ------
NM_032160chr1844288 4160 3951 1457 ------
NM_032172chr7--137 ----
NM_032199chr1043705 3621 3559 3483 ----21013 114
NM_032208chr273548 3311 2882 2868 2580 2507 674 ------
NM_032228chr112637 194 ------
NM_032281chr1922129 245 --22259 714 --
NM_032299chr111224 ------
NM_032320chr111723 ------
NM_032345chr121385 ------
NM_032373chr1055502 5365 5013 4333 267 --11718 1936
NM_032434chr241565 1336 1150 528 ----1111
NM_032435chr142242 1750 104 89 --1590 --
NM_032440chr1032418 1908 555 ------
NM_032457chr433035 2854 2734 1764 11222 --
NM_032458chrX33343 2265 1320 1944 ----
NM_032471chr611096 --11124 --
NM_032505chr322187 2035 1423 --12123
NM_032521chr2042853 1967 1196 341 13053 ----
NM_032547chr421333 1262 ------
NM_032564chr11193 ------
NM_032582chr1731508 1206 676 ------
NM_032664chr81231 --11202 --
NM_032682chr323493 2970 12250 ----
NM_032711chr1754063 3523 965 708 294 --33431 1588 580 --
NM_032804chr1032106 1980 903 --2171 61 --
NM_032810chr1011450 ------
NM_032842chr7--21572 152 ----
NM_032859chr1353349 1242 539 530 79 21346 1097 ----
NM_032947chr561093 497 328 185 125 74 --1789 --
NM_032961chr41483 ------
NM_032968chrX43445 2998 2786 1004 14282 ----
NM_032969chrX43445 2998 2786 1004 14282 ----
NM_032973chrY32993 2781 1004 14274 ----
NM_033020chr134832 4718 3337 ------
NM_033031chrX1203 ------
NM_033055chr111055 ------
NM_033083chr333390 3131 95 --12410 --
NM_033121chr1231159 60 47 --141 --
NM_033133chr1783672 2989 1383 1256 1092 867 840 662 --12881 --
NM_033135chr111236 ------
NM_033181chr623312 84 ------
NM_033211chr52640 103 ------
NM_033225chr812579 22329 669 ----
NM_033272chr2151 1341 ----
NM_033300chr121179 436 1169 ----
NM_033360chr1233685 3212 887 14588 ----
NM_033394chr221070 617 ------
NM_033426chr1432526 2366 1171 12852 12706 12569
NM_033427chr71225 ------
NM_033495chrX2993 289 ------
NM_033505chr275410 4748 4655 4636 4148 2338 961 16677 12607 --
NM_033540chr31182 ----1280
NM_033632chr411504 --11119 --
NM_033644chr5--199 ----
NM_033645chr5--199 ----
NM_033656chr2164390 4361 4059 3791 297 64 34985 2286 128 34023 2340 1246 --
NM_033666chr101366 --1884 --
NM_052827chr122942 77 ----1871
NM_052832chr812555 1680 ----
NM_052845chr1243053 2762 870 300 1909 12974 11305
NM_052864chr441851 1418 290 108 1114 ----
NM_052879chr1254096 3291 3075 743 60 --13813 --
NM_052885chr1211618 13135 ----
NM_052886chr822159 1491 --1575 --
NM_052900chr81727 1528 ----
NM_052904chr6----11111 --
NM_052923chr61108 ------
NM_052932chr1122089 1645 --12198 --
NM_052937chr831682 910 843 ------
NM_052958chr82729 108 ------
NM_052966chr133205 525 49 ------
NM_053016chr967237 6338 6047 6022 5230 426 47345 5621 2783 1506 ----
NM_053023chr111267 --13215 --
NM_053024chr321250 234 ------
NM_053042chr41503 12587 12223 --
NM_054016chr131756 198 138 ------
NM_054016chr131756 198 138 ------
NM_054016chr131756 198 138 ------
NM_057168chr721264 1246 ------
NM_057175chr421820 308 ------
NM_058172chr41511 ----11154
NM_058241chr222293 2247 --1891 --
NM_058241chr222293 2247 --1891 --
NM_078471chr1721094 786 --21200 157 --
NM_078625chr641191 1075 500 421 ------
NM_078629chrX2612 500 ------
NM_078630chrX2612 500 ------
NM_079421chr19--1450 2363 43 --
NM_080632chrX2546 111 ------
NM_080676chr2052551 2464 2325 350 68 1909 ----
NM_080717chr1211167 ------
NM_080759chr1332503 2060 1725 ------
NM_080760chr1332503 2060 1725 ------
NM_080832chrX2685 75 ------
NM_080867chr1424799 176 ------
NM_080874chr42761 386 --1704 --
NM_080927chr343037 2880 2579 177 1888 ----
NM_130385chr1133142 2636 406 ------
NM_130391chr933626 3327 2845 11391 ----
NM_130392chr933626 3327 2845 11391 ----
NM_130393chr933626 3327 2845 11391 ----
NM_130435chr103864 619 121 ------
NM_130438chr2143133 3003 2153 379 ------
NM_130439chr1021811 1460 ----1380
NM_130439chr1021811 1460 ----1380
NM_130838chr1521611 125 ------
NM_130839chr1521611 125 ------
NM_133170chr2047409 7218 2640 664 28100 44 18072 11747
NM_133265chrX43322 2282 508 281 ------
NM_133370chr443028 2316 976 781 12615 ----
NM_133372chr532529 549 477 ------
NM_133378chr21232 ------
NM_133432chr21232 ------
NM_133437chr21232 ------
NM_133445chr953711 3303 2695 2303 418 11123 ----
NM_133486chrX143 ------
NM_133642chr2261280 882 846 403 285 219 ------
NM_134442chr211492 ------
NM_138270chrX63299 3180 3054 2784 2488 565 22394 435 ----
NM_138288chr1421988 1707 1876 ----
NM_138423chr151335 ----1213
NM_138473chr1234906 3943 3569 --14944 --
NM_138479chr131962 665 414 --1790 --
NM_138638chr1442038 1500 897 254 12389 ----
NM_138694chr631446 1339 327 1880 1928 --
NM_138713chr1666459 5900 5552 5026 3069 2163 16663 13085 22623 456
NM_138714chr1666459 5900 5552 5026 3069 2163 16663 13085 22623 456
NM_138731chr1413028 11029 ----
NM_138735chr2----11491 --
NM_138773chr51850 265 57 ----
NM_138782chr52495 312 ------
NM_138927chr2121082 1000 ------
NM_138966chr18----1526 --
NM_138970chr14----1735 --
NM_139048chr321122 132 ------
NM_139242chr1511544 1351 ----
NM_139244chr6--1215 2902 759 --
NM_139283chr1242417 826 566 293 21887 481 12501 --
NM_139323chr2031973 1908 547 ------
NM_144571chr452582 1707 1632 1019 39 --15719 15757
NM_144578chr1444156 1978 1128 502 25530 5250 14825 --
NM_144625chr12398 297 ------
NM_144632chr252430 2267 2163 1954 1769 ------
NM_144949chr211712 22089 301 1264 --
NM_144963chr81290 ------
NM_144979chr42668 622 ------
NM_145049chr52672 371 ------
NM_145206chr1012884 ------
NM_145244chr441736 1703 1562 1289 ------
NM_145259chr221838 201 --15591 --
NM_145307chr1011737 11674 ----
NM_145320chr733101 3059 1375 13144 ----
NM_145321chr733101 3059 1375 13144 ----
NM_145322chr733101 3059 1375 13144 ----
NM_145686chr223205 112 ------
NM_145687chr223205 112 ------
NM_145698chr1022142 229 ------
NM_145735chr1332831 2101 901 2496 438 22032 516 --
NM_145808chr732284 2147 2025 1416 1925 --
NM_147147chr623872 88 1341 11535 --
NM_147150chr923438 781 1545 ----
NM_148170chr1125615 3656 --11378 --
NM_148894chr41143 ------
NM_148955chr1546412 2250 1654 1147 --1365 --
NM_152265chr121583 51 ------
NM_152271chr81995 ------
NM_152275chr22901 313 ----1615
NM_152277chr521682 292 ------
NM_152332chr1432247 466 116 12082 ----
NM_152388chr243154 2821 1014 991 ----11550
NM_152407chr512781 12170 ----
NM_152409chr542647 2525 295 259 12945 1450 --
NM_152414chr831630 1426 350 11553 11198 --
NM_152450chr1551961 1834 1524 1429 509 ------
NM_152495chr141172 1089 970 761 ------
NM_152517chr22515 40 1200 ----
NM_152556chr7--12369 ----
NM_152589chr121109 ------
NM_152594chr1542134 2118 248 240 11801 ----
NM_152605chr1911387 ------
NM_152608chr15377 332 309 231 150 ------
NM_152629chr943687 3334 739 291 ------
NM_152716chr11----11315 --
NM_152721chr181729 ------
NM_152734chr653983 3436 1798 1106 817 21710 145 11816 1850
NM_152737chr61765 11533 ----
NM_152754chr72688 391 ------
NM_152758chr833016 2853 2676 ----12896
NM_152826chr1546412 2250 1654 1147 --1365 --
NM_152838chr2012160 145 ----
NM_152896chr9--1266 1770 --
NM_152902chr1266 52 ------
NM_152903chr1321953 1028 11793 ----
NM_152914chr1744439 3343 3249 1607 13184 14381 14331
NM_152919chr1931190 236 139 --23506 3415 --
NM_152924chr1556140 4827 2531 967 180 12019 2929 859 --
NM_153013chr542361 2334 2058 91 1557 ----
NM_153020chr611642 ------
NM_153040chr15138 ------
NM_153050chr2233711 3378 1131 --23980 785 11790
NM_153051chr2233711 3378 1131 --23980 785 11790
NM_153181chr18----1526 --
NM_153188chr565376 4446 3516 3436 2047 1238 ------
NM_153207chr1211454 ------
NM_153251chr13--1246 ----
NM_153261chr1641097 619 455 21 ----11112
NM_153262chr1--11109 ----
NM_153273chr34850 814 472 102 --22507 893 --
NM_153331chr3--1518 ----
NM_153334chr221257 ------
NM_153377chr12--2156 95 ----
NM_153499chr1252310 2266 2188 779 228 12395 ----
NM_153500chr1252310 2266 2188 779 228 12395 ----
NM_153619chr1532446 947 908 ------
NM_153633chr122711 290 1522 ----
NM_153759chr21368 1350 ----
NM_153825chr451731 1508 1254 210 48 ------
NM_153828chr23843 633 212 ------
NM_170606chr711839 ------
NM_170665chr1253979 1635 1434 984 735 --13446 --
NM_170674chr1521410 1282 1430 1306 --
NM_170675chr1531086 958 306 1106 ----
NM_170676chr1531086 958 306 1106 ----
NM_170677chr1521410 1282 1430 1306 --
NM_170692chr11934 ------
NM_170725chr12244 171 ------
NM_171825chr552476 1155 996 320 31 --12261 13099
NM_172058chr821831 251 ------
NM_172059chr821831 251 ------
NM_172060chr821831 251 ------
NM_172070chr2--11675 ----
NM_172071chr115972 15014 11377 16962
NM_172159chr362297 2216 1453 825 734 331 ------
NM_172160chr362297 2216 1453 825 734 331 ------
NM_172216chr1252212 2168 2090 681 130 12297 ----
NM_172226chr1252310 2266 2188 779 228 12395 ----
NM_172315chr1521410 1282 1430 1306 --
NM_172316chr1521410 1282 1430 1306 --
NM_172337chr142695 237 ------
NM_172373chr1321282 845 ------
NM_173083chr111273 1916 ----
NM_173198chr931934 588 248 --1729 --
NM_173200chr931934 588 248 --1729 --
NM_173214chr1666459 5900 5552 5026 3069 2163 16663 13085 22623 456
NM_173353chr12--1613 ----
NM_173468chr454966 3812 1220 777 372 15839 ----
NM_173495chrX22216 1805 1206 ----
NM_173511chr243810 3514 3100 21 --11027 193
NM_173527chr141640 ------
NM_173552chr31689 ------
NM_173582chr1135069 4227 1773 25984 466 ----
NM_173642chr158165 6176 6121 3596 2434 22277 244 37976 6430 2400 --
NM_173654chr342190 1932 907 142 ------
NM_173694chrX31946 1605 380 ------
NM_173829chr535808 5154 4187 --15470 --
NM_173851chr843190 1584 212 58 11426 --11466
NM_174911chr853688 3435 2776 1006 492 23983 866 3957 919 159 --
NM_175623chr1242044 1465 582 167 11167 ----
NM_175629chr21368 1350 ----
NM_175852chr132720 2657 296 ------
NM_175863chr621097 60 1175 ----
NM_175866chr121376 52 ------
NM_175907chr1822241 997 ----12767
NM_176815chr342509 2149 1976 148 ------
NM_177966chr321492 126 21546 147 ----
NM_177974chr151335 ----1213
NM_177996chr2023034 941 12744 ----
NM_178011chr1053082 2919 2118 876 525 12128 ----
NM_178140chr542034 734 677 259 12468 ----
NM_178151chrX85075 4884 1645 1197 794 557 356 88 17743 16560 --
NM_178152chrX85075 4884 1645 1197 794 557 356 88 17743 16560 --
NM_178153chrX85075 4884 1645 1197 794 557 356 88 17743 16560 --
NM_178580chr20--158 ----
NM_178585chr422392 2243 11200 13141 --
NM_178815chr1032049 1106 633 ------
NM_178835chr41567 ------
NM_180989chr1322439 1576 1407 ----
NM_181054chr14--161 ----
NM_181077chr15157 1423 1860 --
NM_181332chrX32654 2258 1818 22176 640 ----
NM_181351chr1132829 2174 984 --22741 1947 --
NM_181354chr811184 ------
NM_181358chr124050 875 --170 --
NM_181361chr311011 1100 ----
NM_181457chr2--11381 ----
NM_181458chr2--11514 ----
NM_181459chr2--11280 ----
NM_181481chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_181482chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_181483chr1887053 6698 5780 5753 5651 4540 1339 1086 37020 6816 5297 ----
NM_181486chr1211167 ------
NM_181504chr574150 3480 1328 1044 808 462 182 ----23397 2903
NM_181523chr574150 3480 1328 1044 808 462 182 ----23397 2903
NM_181524chr574150 3480 1328 1044 808 462 182 ----23397 2903
NM_181527chr201135 ------
NM_181528chr201190 ------
NM_181598chr141312 ------
NM_181705chr545698 2270 1447 1048 ------
NM_181746chr11203 ------
NM_181794chr611096 --11124 --
NM_181795chr611096 --11124 --
NM_181838chr51446 2496 418 ----
NM_181874chr3167 ------
NM_181886chr4----11299 1314
NM_181887chr4----11299 1314
NM_181888chr4----11299 1314
NM_181889chr4----11299 1314
NM_181890chr4----11299 1314
NM_181891chr4----11299 1314
NM_181892chr4----11346 1361
NM_181893chr4----11299 1314
NM_182485chr41617 ------
NM_182490chr191335 1406 ----
NM_182524chr42614 485 ------
NM_182540chrX1784 ------
NM_182569chr171680 ----1231
NM_182641chr1761994 1780 1624 1533 571 93 ------
NM_182646chr41617 ------
NM_182678chr21199 ------
NM_182763chr132699 1932 243 21726 630 ----
NM_182765chr1021884 716 ------
NM_182789chr51113 ------
NM_182796chr51715 ------
NM_182830chr1431810 527 21 ----11521
NM_182895chr221257 ------
NM_182898chr764198 4164 2542 990 453 189 ------
NM_182899chr764198 4164 2542 990 453 189 ------
NM_182907chr6--139 ----
NM_182910chr141601 ------
NM_182913chr141601 ------
NM_182914chr141601 ------
NM_182943chr311003 ------
NM_182948chr142460 2215 633 351 ------
NM_182970chr2063860 3390 1573 1544 1310 786 --13715 14073
NM_182972chr162773 2458 2191 2118 786 122 12578 --1279
NM_182975chr11392 183 ----
NM_183006chr2021357 90 ----1187
NM_183043chr131776 ------
NM_183044chr131776 ------
NM_183234chr1521369 572 ------
NM_183235chr1521369 572 ------
NM_183236chr1521369 572 ------
NM_183238chr1243215 2604 2439 1180 1579 ----
NM_183323chr51113 ------
NM_183376chr1542508 2337 905 727 ------
NM_183380chr61775 1743 ----
NM_183393chr321006 141 ------
NM_183394chr321006 141 ------
NM_183419chr81520 ------
NM_194279chr142343 132 ------
NM_194283chr523768 2676 12779 ----
NM_194285chr1182533 2272 1380 1127 715 666 271 143 ------
NM_194286chr1286085 5651 5333 5146 4997 4711 3808 2314 21990 731 11526 --
NM_194291chr81473 ------
NM_194314chr145029 4892 561 37 24011 688 14001 --
NM_194317chr222660 704 --11974 --
NM_194328chr922706 180 ------
NM_194329chr922706 180 ------
NM_194330chr922706 180 ------
NM_194332chr922706 180 ------
NM_194429chr61576 ------
NM_194434chr1885428 5255 4199 4133 2186 1635 1550 859 --24073 895 --
NM_197948chr1211697 ----1215
NM_197968chr13----1550 --
NM_198123chr81727 1528 ----
NM_198124chr81727 1528 ----
NM_198128chr18--1194 ----
NM_198189chr22891 178 1728 ----
NM_198225chr102653 488 ------
NM_198240chr1221436 1339 ------
NM_198268chr124050 875 --170 --
NM_198269chr124050 875 --170 --
NM_198270chrX23388 2848 --1984 1792
NM_198273chr542567 2007 1953 975 1507 ----
NM_198391chr201349 ----1493
NM_198395chr521180 942 ------
NM_198428chr71707 ------
NM_198465chrX11813 1333 --12464
NM_198549chr132585 2270 1186 21198 36 ----
NM_198581chr257196 4577 2117 985 733 25989 5873 ----
NM_198715chr166190 5366 1729 1161 767 406 ----15805
NM_198793chr373999 3818 3710 2981 2769 876 460 ------
NM_198834chr1711776 --1145 --
NM_198836chr1711776 --1145 --
NM_198837chr1711776 --1145 --
NM_198838chr1711776 --1145 --
NM_198839chr1711776 --1145 --
NM_198896chr1111556 1294 ----
NM_198935chr2023196 215 11257 ----
NM_198990chr733192 2552 281 1727 --1828
NM_199003chr831443 1155 1121 --1237 --
NM_199133chr5167 --1267 --
NM_199185chr5173 1229 ----
NM_199188chr1254096 3291 3075 743 60 --13813 --
NM_199189chr521024 944 ------
NM_199190chr1254096 3291 3075 743 60 --13813 --
NM_199246chr521124 1101 2435 94 ----
NM_199320chr462601 2204 1797 1128 1067 485 ------
NM_199320chr462601 2204 1797 1128 1067 485 ------
NM_199324chr452456 2443 1371 805 736 ------
NM_199355chr1631297 1107 551 1119 ----
NM_199421chr1424799 176 ------
NM_199478chrX11374 ------
NM_201432chr1786468 6079 5902 5701 5360 4945 4518 249 --14726 --
NM_201433chr1786468 6079 5902 5701 5360 4945 4518 249 --14726 --
NM_201999chr43453 326 31 ------
NM_203318chr1721094 786 --21200 157 --
NM_203350chr141606 1585 1196 145 ------
NM_203364chr1111046 --1922 --
NM_203372chr23682 508 394 11718 ----
NM_203406chr541102 883 567 501 ------
NM_203413chr172453 218 ------
NM_203458chr153658 3640 3599 875 856 ------
NM_203486chr192201 148 ------
NM_203504chr44962 834 458 136 2672 602 ----
NM_203505chr44962 834 458 136 2672 602 ----
NM_206907chr521317 270 ------
NM_206921chr6----145 --
NM_206933chr132696 2437 65 --11794 --
NM_206996chr11379 ------
NM_207015chr3------1569
NM_207303chr1033525 2846 799 ----11465
NM_207306chr134525 3208 147 13928 --13642
NM_207317chr51293 --1397 --
NM_207325chr1921751 1484 2384 110 ----
NM_207380chr1552859 2841 1230 1106 984 --22642 1333 --
NM_207396chr11696 ------
NM_207404chr332261 1861 320 11507 ----
NM_207406chr455262 4277 2228 1415 1090 --25946 4980 --
NM_207517chr1521700 545 2763 30 11295 --
NM_207520chr23843 633 212 ------
NM_207521chr23843 633 212 ------
NM_212460chr741769 1716 755 706 ------
NM_212558chr931718 1246 652 --1681 --
NM_213593chr11845 ----11018
NM_213609chr31814 ------
NM_213651chr121507 1445 ------
NM_213654chr311309 ------