TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-105-3p
miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX63368 3334 2931 2884 567 479 ------
NM_000084chrX86732 6410 5721 5029 4823 4730 2488 1033 --25046 4707 --
NM_000091chr262823 2223 2012 1826 1785 270 ------
NM_000109chrX52212 1058 780 539 523 ------
NM_000151chr1731845 1206 1185 11705 ----
NM_000165chr641614 1474 483 424 ------
NM_000176chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_000216chrX43474 3138 2693 163 1844 13003 --
NM_000245chr752258 2051 2018 819 504 ------
NM_000267chr1753296 2930 2797 2311 126 12672 ----
NM_000314chr1051199 746 479 404 159 ----1622
NM_000318chr842929 2675 2389 1183 11899 22400 521 --
NM_000337chr5116229 5805 5314 4234 2643 2514 1512 1442 329 259 203 12273 25734 318 --
NM_000382chr173766 188 180 --11884 --
NM_000408chr273469 2604 2502 921 288 259 129 ------
NM_000448chr1142341 1101 691 589 --12270 --
NM_000555chrX85831 5596 5261 3134 2402 1703 1232 947 11573 ----
NM_000615chr1152867 1174 1043 682 126 ------
NM_000618chr12106385 6109 4237 4218 2317 2282 1485 1284 591 156 --26394 1206 --
NM_000618chr12106385 6109 4237 4218 2317 2282 1485 1284 591 156 --26394 1206 --
NM_000633chr1864616 4581 4053 3374 1635 1571 1402 14358 13173
NM_000793chr1444385 3839 1787 637 ----1308
NM_000809chr479269 7165 6304 6158 5737 3577 2037 18681 ----
NM_000814chr1583246 3104 1532 1229 888 862 520 453 --13326 --
NM_000826chr462224 2192 1697 1605 335 242 ------
NM_000831chr185829 5544 5517 4949 4242 4194 1700 72 14868 24347 4167 24320 4137
NM_000860chr421571 562 ----11393
NM_000868chrX2883 459 --1520 12099
NM_000875chr1586577 6103 5854 5373 5338 2668 1975 1470 1713 ----
NM_000899chr1263943 3220 1306 792 635 119 --13047 11341
NM_000933chr2031752 1503 487 ----1661
NM_000950chrX73150 3073 3044 2871 2595 756 644 ------
NM_001001323chr1242827 2611 101 66 --11036 --
NM_001001890chr2174185 4072 3963 3868 3233 1463 1172 11225 --13350
NM_001001938chr954047 3907 3431 3221 3110 13230 13420 --
NM_001001971chr1031362 1164 873 ------
NM_001001974chr104887 411 257 231 ----12229
NM_001002233chr841859 1418 193 128 ------
NM_001002257chr243577 2328 947 849 ------
NM_001002860chr1464191 3387 800 750 199 42 --24310 3459 --
NM_001002909chr1751990 897 665 420 285 11938 ----
NM_001003652chr1878613 8329 6887 5498 3320 1607 1218 ------
NM_001003665chr163178 2793 2751 932 812 160 ------
NM_001003674chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_001003675chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_001003760chr693590 3457 3280 2561 2387 2377 1216 665 564 ------
NM_001003800chr953452 3213 1146 854 265 11267 136 --
NM_001004303chr13806 684 297 ------
NM_001004303chr13806 684 297 ------
NM_001004317chr674402 4111 4044 3843 3623 1328 561 --11484 --
NM_001005474chr321320 1049 ----1234
NM_001005502chr1255255 4228 3937 1082 859 ------
NM_001005753chr262301 1448 865 857 848 248 ------
NM_001006605chr161190 1000 840 741 232 219 ------
NM_001006605chr161190 1000 840 741 232 219 ------
NM_001006657chr242645 2050 2018 700 12290 ----
NM_001007023chr1444385 3839 1787 637 ----1308
NM_001008239chr1833694 3003 440 1754 --1967
NM_001009554chr443394 3158 1786 1370 11730 11533 --
NM_001009554chr443394 3158 1786 1370 11730 11533 --
NM_001009555chr431670 266 233 --1319 --
NM_001009899chr356388 5879 5502 4873 4439 11258 ----
NM_001009993chr264378 3235 3041 1818 658 136 23532 478 ----
NM_001010854chr141713 ----1272
NM_001010891chr5106306 5988 5730 4672 2307 1720 1488 1365 905 753 --26716 1732 1632
NM_001011666chr776523 4293 4093 2399 1762 1414 428 --16025 15115
NM_001011885chr1541801 1724 1296 223 ------
NM_001012393chr1164668 3539 634 557 431 318 --11429 --
NM_001012755chrX85064 5022 4884 4471 3302 3194 1709 995 --13500 --
NM_001014380chr1385449 5236 4742 2204 1396 1288 1042 429 11590 ----
NM_001014797chr10118155 7883 7858 7709 7263 6039 5779 5636 3140 2405 29 --12852 --
NM_001017992chr531101 497 71 --1175 --
NM_001018065chr985422 5341 4032 3787 2217 2155 1218 118 11939 15666 --
NM_001018066chr985422 5341 4032 3787 2217 2155 1218 118 11939 15666 --
NM_001018074chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_001018075chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_001018076chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_001018077chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_001024094chr592951 2510 1279 1257 1174 1167 664 244 115 ------
NM_001024649chr552059 449 281 162 94 ------
NM_001024855chr341210 559 367 27 ------
NM_001025079chr363552 2563 2539 1243 1095 628 ------
NM_001025108chr273877 3473 3285 3178 2566 1613 1317 1652 ----
NM_001025252chr883101 2726 2365 2052 771 585 261 61 ------
NM_001025253chr883101 2726 2365 2052 771 585 261 61 ------
NM_001025366chr641760 1543 1515 1243 ------
NM_001025366chr641760 1543 1515 1243 ------
NM_001025367chr641760 1543 1515 1243 ------
NM_001025367chr641760 1543 1515 1243 ------
NM_001025368chr641760 1543 1515 1243 ------
NM_001025368chr641760 1543 1515 1243 ------
NM_001025369chr641776 1559 1531 1259 ------
NM_001025369chr641776 1559 1531 1259 ------
NM_001025370chr641760 1543 1515 1243 ------
NM_001025370chr641760 1543 1515 1243 ------
NM_001029858chr663002 2541 2220 2114 1181 1150 12451 ----
NM_001030007chr1653802 2948 2912 489 291 --1482 --
NM_001030055chr1464099 3901 3478 1020 436 108 ------
NM_001031679chr1263281 3230 2894 2348 2257 2211 ------
NM_001031700chr421941 1636 ----2680 260
NM_001031804chr1633756 3455 1165 13733 ----
NM_001031806chr173822 244 236 --11940 --
NM_001031812chr552316 940 554 158 46 --1500 --
NM_001033045chr253948 3890 1002 860 697 ------
NM_001033057chr312066 198 --1761
NM_001033756chr641694 1477 1449 1177 ------
NM_001033756chr641694 1477 1449 1177 ------
NM_001034841chr1695456 5246 4974 4741 1759 1486 853 230 186 1735 ----
NM_001037954chr1133172 1396 216 --11307 --
NM_001039395chr932166 1517 66 11654 --11620
NM_001039459chr751153 1136 937 455 123 ------
NM_001039538chr273144 2957 2328 2289 753 645 327 ------
NM_001039547chr387830 7334 7190 7126 6352 1747 1664 530 ------
NM_001039580chr454931 3398 1232 1139 989 ------
NM_001039618chr1195960 5899 4150 2206 1332 990 354 81 25 ------
NM_001039693chr253637 2669 1404 539 192 12858 ----
NM_001039762chr1062050 1741 1674 823 639 606 ------
NM_001039840chrX75733 4602 4435 4074 1015 680 166 ----1913
NM_001040151chr1174116 3358 1733 1484 153 121 53 11506 ----
NM_001040152chr754381 4294 1829 1318 1267 1119 --14507
NM_001040202chr431679 866 535 ----1250
NM_001040214chr642194 1974 1595 433 ------
NM_001040284chr1655116 3881 3731 3612 646 ------
NM_001040402chr463219 3104 2690 2535 755 237 ------
NM_001040429chr1352618 2548 1346 653 594 ----1135
NM_001040441chr145495 4119 1959 538 ----12022
NM_001040446chr542053 1933 951 198 ------
NM_001040712chr973322 3075 1299 1172 1032 905 47 2584 236 ----
NM_001042355chr1675272 5253 5122 5103 4771 3299 84 15129 11831 --
NM_001042412chr1675272 5253 5122 5103 4771 3299 84 15129 11831 --
NM_001042440chr551865 1333 439 350 146 1805 ----
NM_001042441chr551865 1333 439 350 146 1805 ----
NM_001042442chr551865 1333 439 350 146 1805 ----
NM_001042443chr551865 1333 439 350 146 1805 ----
NM_001042444chr551865 1333 439 350 146 1805 ----
NM_001042445chr551865 1333 439 350 146 1805 ----
NM_001042446chr551865 1333 439 350 146 1805 ----
NM_001042492chr1753296 2930 2797 2311 126 12672 ----
NM_001042494chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_001042495chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_001042496chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_001042497chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_001042533chr343273 2706 2457 670 ----13150
NM_001042555chr1264652 3960 3530 2906 1658 1087 ------
NM_001042599chr277292 6914 2193 1600 1521 1467 444 ------
NM_001042603chr1254332 4042 600 172 80 12065 ----
NM_001042604chr344766 2960 1662 341 --24850 1833 --
NM_001042749chrX41980 1821 645 408 ------
NM_001042750chrX41980 1821 645 408 ------
NM_001042751chrX41980 1821 645 408 ------
NM_001043318chr1493943 3288 3274 3250 3149 2574 1667 1593 1440 ------
NM_001044385chr263633 3144 2828 1250 928 127 --1764 --
NM_001044722chr552316 940 554 158 46 --1500 --
NM_001044723chr552316 940 554 158 46 --1500 --
NM_001071775chr132741 204 11332 1327 --
NM_001083620chr462222 2190 1696 1604 334 241 ------
NM_001106chr389502 7712 7391 7139 3616 1358 950 707 38375 7914 7549 1696 18288
NM_001113490chrX53017 2528 2362 2336 673 ------
NM_001116chr1643033 2631 383 226 ----1865
NM_001128chr1653802 2948 2912 489 291 --1482 --
NM_001153chr23905 696 576 --1669 --
NM_001173chr1464099 3901 3478 1020 436 108 ------
NM_001186chr2142947 2763 351 80 ------
NM_001204chr236282 3079 484 12599 ----
NM_001219chr762306 1731 1686 890 831 539 ------
NM_001256chr1772433 2325 1149 962 777 599 107 ------
NM_001259chr796396 6090 5393 4986 4904 4557 4103 2512 2457 12286 ----
NM_001310chr1253002 2000 1887 1118 207 ------
NM_001329chr1031210 1017 251 ----1563
NM_001364chr1174170 3349 1689 1250 968 555 444 1888 1406 --
NM_001412chrX73460 3343 3192 2593 2390 965 23 --12490 --
NM_001422chr112347 136 1861 --172
NM_001460chr142679 2529 2306 279 11264 11150 --
NM_001609chr1034382 3310 3043 33263 631 110 ----
NM_001655chr1142159 807 785 183 --11784 --
NM_001656chr531690 239 79 ------
NM_001668chr152139 1851 828 750 334 --12256 --
NM_001709chr1172446 2053 1769 853 759 395 225 12213 ----
NM_001746chr552059 449 281 162 94 ------
NM_001750chr551865 1333 439 350 146 1805 ----
NM_001754chr2174185 4072 3963 3868 3233 1463 1172 11225 --13350
NM_001759chr1294854 4696 3952 3508 2089 1962 1182 1168 700 1964 14586 --
NM_001777chr363552 2563 2539 1243 1095 628 ------
NM_001874chr1255255 4228 3937 1082 859 ------
NM_001918chr1118763 8504 8434 6788 6739 5680 2711 2696 1323 1151 781 1820 ----
NM_001938chr131897 1737 562 11850 ----
NM_001969chr1453079 2655 587 537 170 ----13718
NM_001987chr1244092 3286 787 267 1809 --1383
NM_002006chr4105571 5540 4949 3916 3832 2308 1407 650 396 214 ------
NM_002015chr1352917 2795 2433 1136 389 ------
NM_002025chrX168905 8760 7962 7924 7772 7333 6781 6481 3448 2541 2227 1942 1859 1726 1418 638 12825 16355 --
NM_002074chr131538 427 74 ----11375
NM_002126chr1754053 3527 1052 1040 142 13859 ----
NM_002203chr594063 3617 2589 1554 1258 1103 775 279 38 ------
NM_002242chr251587 806 443 366 165 ------
NM_002264chr365013 4905 4566 1662 1133 853 --24053 161 --
NM_002270chr555447 5005 3849 3571 761 --1214 --
NM_002285chr273877 3473 3285 3178 2566 1613 1317 1652 ----
NM_002293chr1102259 2090 779 610 523 478 451 276 174 27 ------
NM_002310chr5106630 5720 5413 5246 4602 4528 4288 2110 1777 1264 11492 ----
NM_002374chr273144 2957 2328 2289 753 645 327 ------
NM_002460chr643587 3254 2384 1259 ----1359
NM_002545chr1164668 3539 634 557 431 318 --11429 --
NM_002577chr353863 3595 3391 3347 396 ------
NM_002581chr962178 1967 1831 786 329 49 --1372 --
NM_002613chr1674614 3745 3590 1979 1174 588 68 --11130 --
NM_002645chr1142962 2898 1103 911 --1166 --
NM_002667chr631092 943 172 --1504 --
NM_002709chr293023 2882 2709 2455 846 489 339 286 251 --12738 --
NM_002718chr372450 2228 788 592 491 346 120 --12075 --
NM_002731chr152344 1927 673 267 162 ----22527 22
NM_002734chr1732038 1489 850 --2755 502 --
NM_002839chr973322 3075 1299 1172 1032 905 47 2584 236 ----
NM_002886chr344591 4075 2050 1101 31705 199 53 --1690
NM_002998chr822245 1849 --22125 193 --
NM_003028chr973848 3796 3291 2789 2731 2689 353 ------
NM_003034chr1287201 5663 5564 5163 5116 2788 2283 191 --16728 --
NM_003108chr276695 5740 5496 4495 1654 1459 997 24812 685 ----
NM_003155chr881799 1134 1101 893 649 311 173 165 ------
NM_003161chr1783399 3244 3005 2441 1035 572 246 62 ----13412
NM_003189chr183072 2975 2886 2871 1294 1162 914 371 1364 ----
NM_003221chr653560 2626 1210 838 240 ----13677
NM_003246chr1542020 1724 424 217 ------
NM_003262chr375071 3831 3236 1180 1011 910 129 --1871 --
NM_003286chr2041103 829 809 124 ------
NM_003298chr374409 4065 2144 1655 887 768 457 --1901 --
NM_003326chr132518 876 825 ----11876
NM_003342chr1742748 2628 2559 308 12582 ----
NM_003376chr641760 1543 1515 1243 ------
NM_003376chr641760 1543 1515 1243 ------
NM_003387chr262502 2054 710 601 317 287 --12931 --
NM_003412chr342851 2669 2202 882 ------
NM_003439chr793372 3206 3031 2963 2903 2764 1240 718 425 ------
NM_003458chr373153 1324 1267 795 532 218 109 12706 12958 --
NM_003463chr683123 2836 2742 2348 1253 1040 520 511 ------
NM_003474chr1052392 2157 1764 1742 318 ------
NM_003489chr2163006 2464 1356 1312 1056 965 ------
NM_003583chr1263569 2444 612 514 364 335 --12921 --
NM_003617chr144413 4263 3979 1682 ------
NM_003659chr251207 1154 825 222 163 ------
NM_003681chr2196212 6178 5695 4743 4074 2405 1271 839 133 1511 ----
NM_003800chr682394 2126 696 663 454 268 214 175 ------
NM_003887chr231921 1701 485 --11583 --
NM_003913chr654156 3946 3516 553 283 11628 ----
NM_003983chr1674091 4001 3331 1741 1142 1008 889 --14024 --
NM_003994chr1263943 3220 1306 792 635 119 --13047 11341
NM_004006chrX52212 1058 780 539 523 ------
NM_004007chrX52212 1058 780 539 523 ------
NM_004009chrX52212 1058 780 539 523 ------
NM_004010chrX52212 1058 780 539 523 ------
NM_004011chrX52212 1058 780 539 523 ------
NM_004012chrX52212 1058 780 539 523 ------
NM_004013chrX52212 1058 780 539 523 ------
NM_004014chrX52212 1058 780 539 523 ------
NM_004015chrX52212 1058 780 539 523 ------
NM_004016chrX52126 972 694 453 437 ------
NM_004017chrX52212 1058 780 539 523 ------
NM_004018chrX52126 972 694 453 437 ------
NM_004020chrX52212 1058 780 539 523 ------
NM_004021chrX52126 972 694 453 437 ------
NM_004022chrX52126 972 694 453 437 ------
NM_004023chrX52126 972 694 453 437 ------
NM_004035chr1754880 4730 4013 3809 1148 ------
NM_004093chr1353233 2037 354 239 179 --23241 558 --
NM_004100chr662381 2242 1987 1808 919 358 ------
NM_004113chr341762 1494 492 470 ------
NM_004124chr1432227 1106 1099 ------
NM_004171chr11129338 8972 8717 8489 7459 7294 6412 5975 3852 3057 2247 643 --11209 --
NM_004229chrX4852 703 665 578 ------
NM_004274chr1442580 2307 1057 661 ------
NM_004296chr14103706 3341 3145 2932 2776 1379 986 578 482 431 12870 169 --
NM_004319chr182878 2649 1179 883 801 747 183 59 ------
NM_004331chr841731 1667 552 122 ------
NM_004337chr862219 1698 1556 1540 764 255 --1436 --
NM_004338chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_004342chr722268 127 --11680 1303
NM_004384chr552316 940 554 158 46 --1500 --
NM_004389chr24653 239 200 174 ------
NM_004397chr1153318 2906 2805 712 415 ------
NM_004438chr262955 2386 2062 1057 409 342 ------
NM_004464chr453851 3578 2963 2892 1405 ------
NM_004501chr133599 3150 91 13574 ----
NM_004504chr272984 2694 2123 787 704 266 52 12142 ----
NM_004516chr1921137 1049 ----1483
NM_004612chr944878 3672 1450 412 ------
NM_004660chrY32069 1527 554 --12182 --
NM_004686chr821205 718 1423 1360 --
NM_004713chr141665 --2532 241 --
NM_004726chrX34613 4215 4026 ----14776
NM_004745chr8116950 6447 5794 5080 2824 2630 2026 1685 702 409 106 16901 14721 --
NM_004760chr751721 736 499 472 259 ------
NM_004788chr1132690 2081 781 ----12764
NM_004815chr1104913 4642 4546 4249 3862 3447 3383 3334 1107 310 --11375 --
NM_004863chr1465220 4031 3225 1176 783 738 12007 15116 1815
NM_004866chr554964 3387 1877 1820 257 --11313 --
NM_004898chr442173 1084 1065 872 ------
NM_004904chr776523 4293 4093 2399 1762 1414 428 --16025 15115
NM_004929chr851195 1161 1147 956 392 ----11091
NM_004992chrX118034 7907 7774 7739 7259 5338 3408 2956 2834 2045 758 12707 16482 --
NM_004992chrX118034 7907 7774 7739 7259 5338 3408 2956 2834 2045 758 12707 16482 --
NM_004999chr674323 3777 3521 1425 919 404 297 ------
NM_005044chrX41820 1137 773 112 1788 --1532
NM_005045chr71362 ----179
NM_005056chr1254576 4286 844 416 324 --1135 --
NM_005079chr883101 2726 2365 2052 771 585 261 61 ------
NM_005116chr2084089 3829 3692 3671 3536 1567 974 104 --21361 617 --
NM_005121chr1763509 3309 2722 2613 2399 817 ------
NM_005126chr332148 1482 282 ------
NM_005135chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_005197chr1466073 4932 2375 2004 1212 649 25587 553 1375 --
NM_005235chr277292 6914 2193 1600 1521 1467 444 ------
NM_005259chr231501 1196 622 1423 ----
NM_005359chr1885611 5257 4897 3961 2585 2423 1947 237 ------
NM_005373chr121517 1252 ----11355
NM_005400chr252406 2168 2121 1954 1919 ------
NM_005504chr12136570 6498 6468 6347 5199 4480 4352 4216 2436 2007 1049 966 343 --12429 --
NM_005509chr551867 1454 623 480 418 ------
NM_005578chr384953 4050 3974 1584 923 508 314 108 ------
NM_005587chr153884 768 117 ------
NM_005638chrX31177 541 401 --11575 --
NM_005665chr124824 4766 ----1468
NM_005715chr682626 2292 2031 1000 839 772 372 119 ------
NM_005795chr241157 724 656 163 ------
NM_005822chr661854 1821 540 465 457 427 ----11976
NM_005840chrX97601 7595 6903 6300 5223 2916 2820 2604 154 17500 17678 --
NM_005885chr531219 448 271 --11023 --
NM_005895chr1223304 2948 ----1172
NM_005901chr1878613 8329 6887 5498 3320 1607 1218 ------
NM_005909chr554250 3010 2836 1018 677 ------
NM_005935chr464605 3762 2086 2019 1633 520 ------
NM_005941chr853568 3007 1448 1141 704 ------
NM_005955chr175028 4927 4318 4082 1302 160 149 ------
NM_006007chr943506 3450 1257 592 1826 ----
NM_006073chr651529 1462 1389 882 686 ------
NM_006095chr433102 1601 137 ----11313
NM_006166chr1252513 2488 1793 1749 1637 ------
NM_006197chr832277 662 556 ----178
NM_006203chr5115340 4397 4195 3698 3546 1768 1581 1400 655 207 101 25148 192 15261 --
NM_006237chr1352027 1853 724 395 250 ------
NM_006246chr144849 515 498 465 ------
NM_006306chrX84628 4434 4395 3708 1266 914 349 242 --12304 --
NM_006371chr3115033 4955 4817 4613 3934 3906 3248 1148 782 706 453 --1546 --
NM_006386chr2262342 1925 1634 812 765 443 ------
NM_006419chr43767 680 485 1576 ----
NM_006469chr121448 1151 ----11261
NM_006482chr1263569 2444 612 514 364 335 --12921 --
NM_006599chr16107386 6058 5320 3185 2519 2213 1297 770 542 195 ------
NM_006603chrX41980 1821 645 408 ------
NM_006606chr2051158 594 134 86 28 1264 ----
NM_006628chr1594185 4154 3953 3579 3366 3214 1241 959 950 12874 ----
NM_006629chr1831860 1802 890 --12138 --
NM_006646chr1343057 2460 256 135 ------
NM_006654chr1264652 3960 3530 2906 1658 1087 ------
NM_006726chr411199 ----178
NM_006729chrX74518 4502 4348 3638 3589 1603 593 21700 1511 ----
NM_006774chr751233 176 146 115 52 ------
NM_006775chr642820 2126 1894 297 ------
NM_006814chr2052361 1777 723 307 22 --12472 --
NM_006827chr1473019 2470 2434 2314 1183 777 78 ------
NM_006873chr253377 2473 2428 2301 1402 ------
NM_006924chr1783902 3690 3259 1570 1303 158 152 135 ------
NM_006930chr561925 1890 1654 1509 648 552 11245 ----
NM_006955chr1063096 2695 2609 862 847 86 --1933 --
NM_006999chr521315 191 11388 --11501
NM_007007chr1254457 4339 4144 3953 3225 --11089 --
NM_007011chr15126558 6501 6120 5734 2445 2031 1462 1083 922 779 295 271 36253 5772 1782 16291 --
NM_007036chr51173 ----1922
NM_007038chr2196033 5058 4919 4473 993 443 422 397 230 25111 928 ----
NM_007114chr342591 2355 2343 2257 ------
NM_007172chr2262503 2485 2045 1322 1111 93 1832 ----
NM_007175chr853617 2703 2357 1283 1100 ------
NM_007249chr13148682 7990 7876 6995 6394 6199 6147 5913 3670 3250 1837 1454 695 465 18754 ----
NM_007292chr1754880 4730 4013 3809 1148 ------
NM_007350chr12104543 4444 4294 4179 3725 3198 3084 1698 803 773 ------
NM_007375chr13991 697 368 22441 2408 1998 --
NM_012092chr241828 689 399 113 --1287 --
NM_012096chr372764 2408 1504 1044 694 365 217 --12660 --
NM_012104chr1163462 3426 2895 1117 929 700 12997 ----
NM_012104chr1163462 3426 2895 1117 929 700 12997 ----
NM_012137chr142383 1949 834 718 --21180 605 --
NM_012156chr2043233 1006 199 99 23179 2162 --1256
NM_012164chr996984 6704 6688 5727 5019 2351 1995 1820 1305 --16155 16717
NM_012214chr266247 6130 5627 3949 2484 297 15550 ----
NM_012218chr1942946 2687 2386 1011 11083 --1496
NM_012234chr372993 2686 1234 680 415 151 78 ------
NM_012249chr233434 2341 438 1193 --12407
NM_012262chr154835 4409 3796 1530 1420 --24375 3585 --
NM_012316chr185587 5349 5222 4919 3932 1960 1895 1473 1191 14609 --
NM_012334chr564228 3826 3681 3514 2879 840 ------
NM_013231chr1484324 3858 3479 3457 3298 3233 1257 835 ------
NM_013233chr21310 ----1442
NM_013255chr777621 6941 6051 3542 2661 2334 1580 1738 36536 3096 1247 --
NM_013261chr493305 3161 2770 2516 1406 1360 1061 739 225 ------
NM_013372chr1553176 2615 2115 461 292 1427 ----
NM_013989chr1444385 3839 1787 637 ----1308
NM_014021chr153152 2474 2117 216 51 --1656 --
NM_014043chr341352 1268 631 565 --1508 --
NM_014048chr1664836 4427 4000 3637 1099 1050 --14192 --
NM_014112chr865491 5211 4579 4455 1897 1680 ------
NM_014157chr1653700 3330 636 621 337 --1149 --
NM_014325chr1242186 565 152 116 21787 571 ----
NM_014388chr1125996 5833 4791 4660 4527 4383 2224 1408 1208 792 684 141 --14473 --
NM_014423chr534081 3990 3879 15242 15421 --
NM_014554chr1251782 640 623 595 228 --22004 156 --
NM_014586chr2131616 1599 103 13233 24512 64 14709
NM_014615chr1653637 2978 2937 2765 1164 ------
NM_014636chr974361 3875 1528 1254 741 574 281 --13102 --
NM_014702chr633288 1143 566 --12931 --
NM_014711chr1651933 1539 1468 741 571 ------
NM_014739chr673849 3449 3312 2600 2563 831 678 --1442 --
NM_014743chr442930 2477 1061 437 --23123 2862 --
NM_014746chr261687 1418 746 222 89 26 --13088 --
NM_014755chr253870 2901 2774 1441 1249 --13113 21166 1148
NM_014776chr1243084 2744 705 266 32462 2087 1046 ----
NM_014800chr751153 1136 937 455 123 ------
NM_014820chr342099 2039 1821 622 --1137 --
NM_014830chr1243528 2870 2472 833 --1783 13876
NM_014877chr1744759 2946 2360 1917 27111 2495 --11999
NM_014906chr1744025 3461 3295 2884 ------
NM_014932chr331689 1448 239 --11262 --
NM_014936chr662523 2034 861 335 225 58 ------
NM_014953chr1354169 3868 3852 3674 227 --1130 --
NM_014962chr2042624 2086 1805 75 12290 144 --
NM_014982chr1494661 4535 4178 3966 3612 1409 1104 867 271 ------
NM_014991chr452752 2565 2546 532 100 ------
NM_014997chr772963 2334 2238 1879 965 414 170 ------
NM_015000chr1233115 3085 259 --1502 --
NM_015026chr1223108 447 ----1725
NM_015042chr1574065 3702 3538 3201 1726 1265 671 11072 ----
NM_015045chr104438 161 117 103 ------
NM_015049chr233183 3056 2479 --11150 12311
NM_015051chr933039 1260 434 ------
NM_015055chr1132592 2520 2483 --12846 --
NM_015068chr773233 3146 1191 1081 681 170 119 ----13359
NM_015090chr175938 5866 5595 5205 4753 3895 1485 14025 ----
NM_015115chr463219 3104 2690 2535 755 237 ------
NM_015124chr2231791 816 95 11006 32274 2123 857 --
NM_015156chr1473891 556 258 152 93 83 46 ------
NM_015170chr861895 876 543 472 395 71 ------
NM_015199chr332545 2368 2275 ----22825 608
NM_015205chr13164600 4362 4186 3870 3538 3501 1271 1247 1189 1160 1139 970 717 691 378 356 ------
NM_015206chr1572940 2701 2383 1544 946 603 161 11355 13185 --
NM_015247chr1675272 5253 5122 5103 4771 3299 84 15129 11831 --
NM_015271chr464030 3454 2819 2704 1523 1262 --1240 --
NM_015272chr1641966 1453 1327 534 --21710 1510 --
NM_015291chr183262 3236 3072 2590 717 711 492 361 ------
NM_015299chr1473980 3464 3397 3371 1427 1357 818 ------
NM_015315chr5103244 2511 2345 1301 1147 1117 522 321 228 193 ------
NM_015349chr642574 2555 450 439 --171 --
NM_015393chr463541 3491 2814 1378 1303 932 13444 --12717
NM_015455chr553358 2956 999 836 372 --13566 --
NM_015458chr811334 13479 --13674
NM_015535chr273623 3609 3540 3244 3022 2983 2766 --1429 --
NM_015553chr694729 4438 4387 1922 1626 839 706 373 194 1883 ----
NM_015560chr342216 1064 701 205 ----139
NM_015569chr154068 1855 1000 750 407 ------
NM_015879chr1847763 6135 3329 3217 --1870 --
NM_015888chr133085 2975 2882 --32585 2505 2144 --
NM_015912chr862421 2268 2168 1704 968 775 ------
NM_016009chr154847 4532 4199 3992 1358 13418 ----
NM_016021chr65589 532 181 157 50 12141 ----
NM_016076chr1113036 2817 2778 2073 1982 1976 900 862 618 77 22 --1661 --
NM_016079chr262301 1448 865 857 848 248 ------
NM_016083chr643923 3387 1362 847 --13016 --
NM_016089chr351691 1360 641 137 53 ------
NM_016248chr1353576 3567 3321 2948 305 --13654 --
NM_016260chr225957 5608 ----1657
NM_016271chr1841898 1850 1802 1618 ------
NM_016308chr14704 322 268 103 ------
NM_016322chr941226 689 567 90 ------
NM_016353chr832473 797 266 32438 1579 360 ----
NM_016395chr1551867 1627 1534 589 144 ----21707 566
NM_016531chr443031 2886 1184 406 1566 ----
NM_016544chr242516 1424 827 261 --11203 12735
NM_016603chr551806 1435 764 566 274 ------
NM_017423chr462044 1620 722 450 231 177 ------
NM_017628chr454983 3604 1237 1227 1119 ------
NM_017637chr9119083 8001 7988 7865 7436 6450 6210 2676 1987 1141 611 13529 ----
NM_017644chr354400 4245 3629 1741 491 --11923 --
NM_017650chr765928 4205 4139 4002 944 277 ------
NM_017658chr1464206 4158 3921 1473 1082 867 1555 157 --
NM_017737chr16748 696 629 564 446 405 ------
NM_017754chr644179 3115 1642 21 --1913 --
NM_017778chr831491 1453 1390 --1329 --
NM_017811chr943115 2463 2395 530 --1942 --
NM_017902chr1085251 5141 5061 4740 3586 1488 1186 479 11657 ----
NM_017919chr995577 4965 4949 4727 4402 1257 1179 1113 1081 15219 ----
NM_017943chr1431015 790 318 ------
NM_017982chr12333 313 --1404 1983
NM_018157chr1252308 1281 1188 789 726 ------
NM_018172chr1181455 1143 582 530 478 426 374 315 ------
NM_018200chr1551879 1801 1675 807 479 --1333 --
NM_018243chr474010 3647 3523 3413 1348 1090 714 1634 ----
NM_018247chr641928 1053 885 27 12716 12067 --
NM_018254chr152464 1950 1487 736 546 162 1885 --
NM_018266chr35958 721 286 271 154 ------
NM_018313chr331811 672 474 12598 1746 --
NM_018362chr1141404 977 748 324 ------
NM_018364chr153362 2646 791 475 129 --13496 --
NM_018374chr732051 658 544 --13923 --
NM_018400chr1174116 3358 1733 1484 153 121 53 11506 ----
NM_018409chr442658 2274 964 620 ------
NM_018440chr8108561 7966 7885 5837 3210 2936 2281 926 644 239 2791 688 11793 --
NM_018482chr872486 1010 1001 980 252 156 32 11867 ----
NM_018553chr173447 149 42 ----11676
NM_018590chr101377 11356 --1517
NM_018638chr1254528 584 560 419 195 ------
NM_018704chr191996 1981 1656 1575 1561 739 193 112 32 ------
NM_018710chr83536 236 68 11206 ----
NM_018717chr462889 2366 1168 820 805 707 ----11154
NM_018947chr774717 4687 3738 3246 1685 1505 609 ------
NM_018958chr1553642 2855 343 226 161 ------
NM_018970chr772866 2700 2536 1175 1111 356 128 ----12791
NM_018999chr1054599 1399 891 608 475 --23658 40 --
NM_019001chr344766 2960 1662 341 --24850 1833 --
NM_019008chr2263798 2727 1447 1288 806 153 ------
NM_019041chr672532 1890 1697 621 439 384 54 12381 ----
NM_019080chr1381456 1301 1253 1125 468 445 58 22 ------
NM_019084chr1061932 1926 1662 945 338 144 ------
NM_019087chr51567 ----1635
NM_019094chr122737 409 ----178
NM_019610chr131925 1899 353 --11454 --
NM_020122chr255485 914 686 271 127 15102 24320 1793 --
NM_020123chr1051431 1232 1060 554 153 ------
NM_020133chr6176140 5618 5608 5187 4814 4761 4577 4562 4553 4533 4372 4075 2219 1968 1019 470 59 25822 23 11687 --
NM_020144chr731792 1420 757 --1522 --
NM_020148chr1852022 1933 1918 934 44 ----1599
NM_020177chr533365 2222 226 ----1738
NM_020228chr1142508 2081 1668 1009 ------
NM_020443chr186993 6964 5456 2137 1380 1323 1254 1045 12070 ----
NM_020546chr572604 2267 1983 1968 548 375 290 1384 ----
NM_020673chr20106270 5298 2950 2458 2203 1934 1915 1271 1135 967 16702 --16847
NM_020699chr175310 4693 4470 4238 2135 1450 483 24926 4719 ----
NM_020714chr1984585 4339 3204 3037 2796 1687 1590 334 --22957 1603 --
NM_020728chr722975 2036 ----12047
NM_020748chr1752171 1945 1574 738 190 ------
NM_020772chr1768212 3080 2528 2490 2052 1445 ------
NM_020774chr1885776 5689 5663 5038 4743 4198 1154 277 ----26102 1783
NM_020779chr242645 2050 2018 700 12290 ----
NM_020796chr542927 2673 2667 2411 ----12939
NM_020805chr1821579 35 ----11265
NM_020810chr1473071 2623 1316 658 554 429 176 --13252 --
NM_020935chr223790 1713 --1197 13852
NM_020948chr163487 2949 2237 1459 1369 648 ------
NM_021032chr341762 1494 492 470 ------
NM_021083chrX53370 2784 2335 1177 636 ------
NM_021133chr12224 68 ----11296
NM_021183chrX41650 921 589 146 --12588 --
NM_021252chr1061465 1409 1386 810 244 48 ------
NM_021622chr104887 411 257 231 ----12229
NM_021629chr364814 4808 3563 1867 912 887 24772 881 ----
NM_021647chr443394 3158 1786 1370 11730 11533 --
NM_021813chr6104945 4029 1529 1498 1489 1308 1180 558 475 78 --11420 --
NM_021814chr631633 1519 1232 138 11448 --
NM_021912chr1583246 3104 1532 1229 888 862 520 453 --13326 --
NM_021914chr1442191 1674 532 22 ------
NM_021961chr11146917 6835 6612 5895 5824 5298 5201 2662 2421 1728 1346 1331 1140 1118 ------
NM_021964chr364016 2506 1772 1556 830 325 ------
NM_022170chr741709 1606 1151 174 ------
NM_022459chr1395856 5608 5584 5534 5073 4346 4155 1727 1615 11606 15010 --
NM_022716chr182729 2589 2398 2380 907 684 387 80 --1615 11283
NM_022802chr1031210 1017 251 ----1563
NM_022828chr511674 ----1379
NM_022898chr1463800 3459 3160 3085 1832 1703 ------
NM_022912chr233074 800 671 ----11134
NM_023112chr1462982 2232 1139 537 327 63 ------
NM_024312chr1221567 119 ----1637
NM_024332chrX51578 1308 488 345 35 ------
NM_024524chr343171 3157 1957 1201 ------
NM_024551chr1242528 1589 1011 958 ----1419
NM_024551chr1242528 1589 1011 958 ----1419
NM_024563chr541945 1391 604 598 ------
NM_024569chr142964 2019 380 98 --11824 168
NM_024744chr222197 2183 --1567 11048
NM_024761chr984570 4297 4224 4087 3364 1757 1241 147 ------
NM_024770chr2106638 5653 5269 4698 4578 4466 4167 2438 1070 237 1411 ----
NM_024947chr3148377 7989 7799 7734 7017 6642 3740 3591 3490 2720 2649 2264 1287 804 --1702 --
NM_024953chr1241826 643 294 207 --175 --
NM_024989chr245404 1876 1453 560 ------
NM_025057chr1451266 1173 494 250 213 ------
NM_025073chr153148 1565 1471 837 298 11376 23716 3566 --
NM_025134chr1642328 2165 2091 663 --1619 --
NM_025146chr322385 765 --11097 12742
NM_025151chr841859 1418 193 128 ------
NM_025160chr163497 3423 3404 3150 3077 262 ------
NM_025176chr202463 39 129 --1106
NM_025191chr143266 2358 845 68 1441 12534 --
NM_025222chr341221 1159 362 112 --21106 149 --
NM_025235chr1052237 1472 1385 718 146 ----11720
NM_030625chr1052073 912 807 472 417 ------
NM_030648chr484863 4776 4679 3855 2187 444 207 109 --1289 --
NM_030650chr2104070 3685 3533 3220 3108 2967 2863 1594 325 146 --11490 --
NM_030674chr1295106 4880 4576 1935 1881 657 637 357 25 25673 525 ----
NM_030755chr1452293 2190 2020 915 142 ----11926
NM_030786chr151750 1668 1450 766 223 --1333 --
NM_030796chr7102112 1437 677 565 519 463 374 361 264 121 ------
NM_030806chr1139207 8945 8737 8653 6339 6306 6237 3318 2353 2307 1595 1388 945 13182 16261 --
NM_030881chr2262342 1925 1634 812 765 443 ------
NM_031268chr1674614 3745 3590 1979 1174 588 68 --11130 --
NM_031362chr262749 2149 1938 1752 1133 196 ------
NM_031365chr262885 2285 2074 1888 1847 332 ------
NM_031366chr262885 2285 2074 1888 1847 332 ------
NM_031419chr321320 1049 ----1234
NM_031442chrX83106 2963 2610 2222 2096 1279 539 172 ------
NM_031445chr253221 2944 2522 2398 994 ------
NM_031453chr103873 705 684 ----12293
NM_031483chr2063249 2441 1291 1166 341 74 ------
NM_031844chr133599 3150 91 13574 ----
NM_031845chr273144 2957 2328 2289 753 645 327 ------
NM_031847chr273144 2957 2328 2289 753 645 327 ------
NM_031992chr741709 1606 1151 174 ------
NM_032012chr944405 3729 1809 831 --24847 1440 --
NM_032116chr1385449 5236 4742 2204 1396 1288 1042 429 11590 ----
NM_032139chr194787 700 378 245 ----177
NM_032199chr1053370 2367 1358 751 290 1317 ----
NM_032373chr1075563 4297 1884 1236 615 605 208 15423 ----
NM_032491chr122506 454 ----1941
NM_032682chr363453 3017 2287 1081 901 825 ------
NM_032689chr191348 --1475 11157
NM_032778chr343273 2706 2457 670 ----13150
NM_032784chr63314 247 124 --1300 --
NM_032813chr132769 752 --2905 793 --
NM_032833chr152126 910 720 166 151 ------
NM_032838chr194829 432 423 375 ------
NM_032873chr1143813 1508 1204 1040 13084 ----
NM_032876chr1421743 1393 ----1280
NM_032932chr1795379 5347 5275 5228 4247 1356 658 539 199 --35935 5562 372 --
NM_032961chr41528 ----11192
NM_033138chr722268 127 --11680 1303
NM_033139chr722268 127 --11680 1303
NM_033140chr722268 127 --11680 1303
NM_033143chr454182 3909 3294 3223 1736 ------
NM_033157chr722268 127 --11680 1303
NM_033181chr643923 3387 1362 847 --13016 --
NM_033224chr7106268 6081 5849 3195 3041 1750 1379 1338 1111 337 --12116 --
NM_033225chr862711 2298 2284 2011 770 238 ------
NM_033290chrX73642 3337 3131 3019 1184 1057 412 ------
NM_033326chr1151626 1578 914 884 372 ------
NM_033425chr1133172 1396 216 --11307 --
NM_033426chr1442101 1848 1055 480 1613 1709 --
NM_033430chr443517 1172 431 230 ------
NM_033437chr443517 1172 431 230 ------
NM_033551chr5103244 2511 2345 1301 1147 1117 522 321 228 193 ------
NM_033656chr2165855 4884 2036 2020 957 290 --14310 --
NM_052879chr1274056 3950 3866 3136 1619 356 118 ------
NM_052886chr862008 1807 1705 1461 210 97 --11976 --
NM_052905chr271656 1589 1164 731 572 422 369 ------
NM_052910chr1351996 1822 369 363 45 --11689 --
NM_053016chr997642 7591 7484 5972 5583 5281 2419 1569 1063 ------
NM_053024chr331379 1162 1046 11505 11483 --
NM_057169chr1243084 2744 705 266 32462 2087 1046 ----
NM_057170chr1243084 2744 705 266 32462 2087 1046 ----
NM_080546chr962149 2059 1961 1832 763 35 ------
NM_130391chr973322 3075 1299 1172 1032 905 47 2584 236 ----
NM_130392chr973322 3075 1299 1172 1032 905 47 2584 236 ----
NM_130393chr973322 3075 1299 1172 1032 905 47 2584 236 ----
NM_130438chr2172913 2101 2072 837 438 289 256 --12093 1497
NM_130442chr751153 1136 937 455 123 ------
NM_130768chr73259 96 35 ------
NM_130831chr342216 1064 701 205 ----139
NM_130832chr342216 1064 701 205 ----139
NM_130833chr342216 1064 701 205 ----139
NM_130834chr342216 1064 701 205 ----139
NM_130835chr342216 1064 701 205 ----139
NM_130836chr342216 1064 701 205 ----139
NM_130837chr342216 1064 701 205 ----139
NM_133265chrX53017 2528 2362 2336 673 ------
NM_133334chr444409 2461 2008 203 25527 4364 ----
NM_133496chr154476 3608 3256 1231 1024 --11262 13852
NM_133647chr1583636 3394 3328 1038 998 619 593 50 1174 ----
NM_134325chr161595 1157 1112 671 368 362 ------
NM_138328chr1773363 3007 2695 1231 1003 889 183 ------
NM_138426chr742346 905 658 651 --162 --
NM_138444chr1344986 4535 1696 1091 14596 ----
NM_138473chr1244720 3363 1233 173 1743 ----
NM_138576chr1463800 3459 3160 3085 1832 1703 ------
NM_138638chr1442191 1674 532 22 ------
NM_138713chr16107386 6058 5320 3185 2519 2213 1297 770 542 195 ------
NM_138714chr16107386 6058 5320 3185 2519 2213 1297 770 542 195 ------
NM_138731chr1451662 1530 1271 609 129 --139 --
NM_138959chr1166634 6611 5742 5189 5174 4989 4518 4318 2411 2206 1679 1396 1258 424 389 147 15796 15943 1209
NM_138971chr1163462 3426 2895 1117 929 700 12997 ----
NM_138971chr1163462 3426 2895 1117 929 700 12997 ----
NM_138972chr1163462 3426 2895 1117 929 700 12997 ----
NM_138972chr1163462 3426 2895 1117 929 700 12997 ----
NM_138973chr1163462 3426 2895 1117 929 700 12997 ----
NM_138973chr1163462 3426 2895 1117 929 700 12997 ----
NM_139057chr1572785 2514 2107 1107 944 890 378 ------
NM_139136chr124940 812 363 229 ------
NM_139279chr262911 2466 1300 947 244 186 1723 ----
NM_139281chr553619 3410 3220 2494 2209 ------
NM_139321chr20103891 3429 2711 2674 2645 2594 1181 866 176 59 2445 130 1384 --
NM_144570chr1662287 2204 2017 579 527 474 1646 ----
NM_144571chr456633 5810 4548 2025 1624 ------
NM_144578chr1465498 5174 3934 1662 969 212 ----14169
NM_144582chr272064 2029 1839 1786 963 810 801 ------
NM_144599chr1584437 4322 1544 1298 1292 829 472 197 --44960 4217 4003 3442 --
NM_144664chr112222 173 ----12546
NM_144963chr862309 2210 635 474 176 86 22432 1973 ----
NM_144973chr1234279 3603 2046 25228 4913 ----
NM_145055chr1833694 3003 440 1754 --1967
NM_145259chr296985 5869 5826 5669 4721 4412 1412 1383 670 ----15448
NM_145263chr442338 1926 955 66 1265 ----
NM_145267chr6------149
NM_145307chr1044441 4042 718 239 ------
NM_145799chrX73005 2450 1025 343 307 256 249 11148 --12538
NM_145808chr742617 2443 2078 947 ----13096
NM_147175chrX31628 1600 88 --12130 --
NM_147223chr272483 2185 1966 1688 1654 1511 46 --12428 --
NM_152253chr2273844 3207 1374 1335 1033 932 647 1956 13899 --
NM_152277chr56822 641 621 330 154 30 ------
NM_152388chr263633 3144 2828 1250 928 127 --1764 --
NM_152409chr542842 2509 2479 516 12734 13460 --
NM_152475chr1952760 2054 990 441 37 ------
NM_152519chr251958 1915 827 691 602 ----1596
NM_152529chr253948 3890 1002 860 697 ------
NM_152542chr432059 1895 1350 1642 ----
NM_152563chr1181455 1143 582 530 478 426 374 315 ------
NM_152624chr555718 5575 5347 4882 2278 11230 1449 --
NM_152734chr695068 4991 4894 4487 4420 3681 2033 1985 1742 1251 14629 --
NM_152754chr792921 2826 2335 1468 1343 986 890 805 67 ------
NM_152758chr8102921 2785 2095 1212 1127 985 669 271 167 110 ------
NM_152793chr795187 4848 3912 1577 1320 1255 1211 840 121 15169 2313 108 --
NM_152890chr141110 904 839 470 ------
NM_152903chr1352709 2450 1762 298 84 ------
NM_152924chr15126558 6501 6120 5734 2445 2031 1462 1083 922 779 295 271 36253 5772 1782 16291 --
NM_153182chr343273 2706 2457 670 ----13150
NM_153188chr555447 5005 3849 3571 761 --1214 --
NM_153207chr1231331 218 165 --13358 --
NM_153456chr13145900 5473 4476 4373 4145 3852 3820 1928 1705 1519 620 232 169 125 15365 35683 4821 99 --
NM_153464chr192730 642 ----176
NM_153605chr341582 1370 375 296 --156 --
NM_153619chr1562737 2718 1209 1079 717 489 1675 ----
NM_153645chr2262503 2485 2045 1322 1111 93 1832 ----
NM_153748chr124940 812 363 229 ------
NM_153810chr1084480 4051 3356 1762 1727 1634 1362 1158 ------
NM_170665chr1283908 3731 3123 3089 2883 2784 1311 1036 ------
NM_170731chr1172446 2053 1769 853 759 395 225 12213 ----
NM_170732chr1172446 2053 1769 853 759 395 225 12213 ----
NM_170733chr1172446 2053 1769 853 759 395 225 12213 ----
NM_170734chr1172446 2053 1769 853 759 395 225 12213 ----
NM_170735chr1172446 2053 1769 853 759 395 225 12213 ----
NM_172103chr662381 2242 1987 1808 919 358 ------
NM_172105chr662381 2242 1987 1808 919 358 ------
NM_173054chr71362 ----179
NM_173060chr551865 1333 439 350 146 1805 ----
NM_173061chr551865 1333 439 350 146 1805 ----
NM_173063chr551865 1333 439 350 146 1805 ----
NM_173075chr421521 1456 177 11701 11534
NM_173214chr16107386 6058 5320 3185 2519 2213 1297 770 542 195 ------
NM_173469chr1511447 1143 --11219
NM_173552chr341771 704 146 102 ------
NM_173582chr1196196 5750 5571 5412 4432 2227 1144 1075 103 25158 4363 11608 --
NM_173642chr1149032 8802 7468 7171 6989 6970 6920 6545 6463 2989 1710 1671 210 115 --12287 27925 2660
NM_173808chr144041 3943 3636 1226 11150 ----
NM_173851chr853909 3814 2553 1323 1001 ----1763
NM_174911chr853813 3615 1513 927 108 ------
NM_175624chr1297607 7122 7008 6888 5822 5088 4986 2789 1173 12691 12928 --
NM_175625chr1297607 7122 7008 6888 5822 5088 4986 2789 1173 12691 12928 --
NM_175733chr1171723 1582 825 798 427 351 90 --1842 --
NM_175736chr1286803 5718 5585 5518 5340 4980 2364 986 ------
NM_175861chr1265093 4578 4425 3908 3880 573 15510 23927 144 15328
NM_175921chr564085 3888 1069 918 727 122 ------
NM_176814chr731056 549 82 1436 ----
NM_177452chr1452126 1832 820 755 161 1865 ----
NM_177996chr2043233 1006 199 99 23179 2162 --1256
NM_178011chr1043227 2319 1269 951 ------
NM_178013chr1492901 2838 2371 2254 825 540 496 457 254 --1524 --
NM_178140chr562738 2568 2221 1703 815 481 ------
NM_178151chrX85831 5596 5261 3134 2402 1703 1232 947 11573 ----
NM_178152chrX85831 5596 5261 3134 2402 1703 1232 947 11573 ----
NM_178153chrX85831 5596 5261 3134 2402 1703 1232 947 11573 ----
NM_178426chr152239 1951 928 850 434 --12356 --
NM_178427chr152139 1851 828 750 334 --12256 --
NM_178505chr1063391 3237 2661 2444 2389 434 ----13415
NM_178578chr2052361 1777 723 307 22 --12472 --
NM_178585chr452752 2565 2546 532 100 ------
NM_181351chr1152867 1174 1043 682 126 ------
NM_181443chr2042624 2086 1805 75 12290 144 --
NM_181457chr251172 1002 921 197 158 ------
NM_181458chr251305 1135 1054 330 291 ------
NM_181459chr251071 901 820 96 57 ------
NM_181460chr251118 948 867 143 104 ------
NM_181481chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_181482chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_181483chr18126218 6046 5906 5595 5022 4776 2041 2018 1215 706 683 197 16094 16855 --
NM_181784chr292643 2057 1882 1836 782 700 467 213 30 ------
NM_181897chr372450 2228 788 592 491 346 120 --12075 --
NM_182485chr442848 2566 1161 187 ------
NM_182503chr685034 4650 4468 4367 3993 3497 2210 1170 --13447 --
NM_182551chr243577 2328 947 849 ------
NM_182646chr442848 2566 1161 187 ------
NM_182762chr755047 4509 2457 2341 1300 14410 ----
NM_182797chr2031772 1523 507 ----1681
NM_182898chr776523 4293 4093 2399 1762 1414 428 --16025 15115
NM_182899chr776523 4293 4093 2399 1762 1414 428 --16025 15115
NM_182948chr152344 1927 673 267 162 ----22527 22
NM_183004chr1453079 2655 587 537 170 ----13718
NM_183050chr622308 1554 --12418 --
NM_194071chr784372 4154 3571 1579 1213 689 215 49 --14986 --
NM_194247chr253523 1759 1732 829 261 11497 13289 --
NM_194278chr1493943 3288 3274 3250 3149 2574 1667 1593 1440 ------
NM_194286chr12106098 5793 5264 4102 3784 1548 1392 913 903 580 ------
NM_194291chr842843 2065 525 170 11012 ----
NM_194314chr155142 4624 4382 4242 2235 --11602 --
NM_198066chr1462821 2710 2493 1214 727 425 --21075 516 --
NM_198086chr1421743 1393 ----1280
NM_198128chr1841898 1850 1802 1618 ------
NM_198273chr552069 1151 717 67 43 ------
NM_198320chr1255255 4228 3937 1082 859 ------
NM_198381chr112347 136 1861 --172
NM_198450chrX52040 1668 1418 775 697 ------
NM_198793chr363548 2559 2535 1239 1091 624 ------
NM_198859chr364646 4569 3214 1822 1666 514 11966 ----
NM_198900chr1286803 5718 5585 5518 5340 4980 2364 986 ------
NM_199000chr741810 1581 728 145 ------
NM_199040chr122737 409 ----178
NM_199188chr1274056 3950 3866 3136 1619 356 118 ------
NM_199190chr1274056 3950 3866 3136 1619 356 118 ------
NM_199324chr452995 2730 1256 1149 1142 ------
NM_199437chr1142508 2081 1668 1009 ------
NM_199438chr1142508 2081 1668 1009 ------
NM_199439chr1142508 2081 1668 1009 ------
NM_203301chr1451166 695 475 418 382 ------
NM_203327chr2084089 3829 3692 3671 3536 1567 974 104 --21361 617 --
NM_203446chr2152999 2988 2553 2158 1914 ------
NM_206854chr644715 3702 1098 597 ------
NM_206855chr655680 4667 4099 2063 1562 ------
NM_206866chr2142947 2763 351 80 ------
NM_206876chr293023 2882 2709 2455 846 489 339 286 251 --12738 --
NM_207303chr10113966 3538 3086 2916 1442 1241 1096 984 882 664 326 ------
NM_207406chr4146429 5935 5521 4101 3993 2084 1916 1881 1584 1391 1278 693 414 115 14864 1562 1228
NM_207481chr241165 489 274 160 ------
NM_207517chr1552029 1920 1410 357 304 ----11686
NM_212471chr1732038 1489 850 --2755 502 --
NM_212472chr1732038 1489 850 --2755 502 --
NM_213589chr274791 3435 1806 1569 1027 663 66 --11936 --
NM_213594chr122506 454 ----1941