TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-105-5p
miRNA Sequence: UCAAAUGCUCAGACUCCUGUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541694 1518 401 255 21945 150 11747 1760
NM_000052chrX53013 2677 2572 1313 136 62793 2785 2772 2507 316 127 ----
NM_000055chr33336 167 155 ------
NM_000067chr81671 ------
NM_000074chrX1872 ----1375
NM_000084chrX135933 5914 5639 5161 5017 4561 4277 2262 2131 2021 495 268 93 46266 6135 4500 2675 1759 --
NM_000091chr262912 2366 1847 352 330 80 12690 1952 --
NM_000092chr2124551 4351 4066 3641 3394 2929 1759 1733 1508 1335 1323 711 21818 1809 ----
NM_000096chr33774 287 142 1927 --1866
NM_000108chr731620 189 130 --1544 --
NM_000109chrX42597 2375 2129 358 22345 632 ----
NM_000110chr151229 1177 995 378 146 1349 ----
NM_000112chr585553 5344 4827 3811 1497 1134 911 323 14273 31711 1683 148 --
NM_000125chr663675 2610 1000 327 145 45 14283 12835 --
NM_000129chr631539 1449 1102 --31409 1150 34 --
NM_000142chr411168 --11321 --
NM_000151chr1721876 1719 21768 67 188 --
NM_000161chr1451904 1877 1626 1411 305 --11310 --
NM_000163chr542060 1938 1680 32 --2836 809 --
NM_000176chr553873 2867 1468 990 430 ------
NM_000189chr241966 1888 875 778 1798 2585 564 --
NM_000208chr1973841 1850 1391 1007 873 867 160 13251 ----
NM_000214chr2021220 496 1632 --1423
NM_000217chr1265350 4446 3666 1043 979 248 11126 ----
NM_000252chrX71157 1123 1062 972 577 91 59 --168 --
NM_000253chr461103 992 961 256 110 92 1748 ----
NM_000259chr15115920 5813 5646 5467 2304 2206 2128 626 604 540 315 25727 5568 ----
NM_000276chrX4570 262 139 56 --1563 --
NM_000280chr112993 260 1740 2681 274 --
NM_000321chr1311304 ------
NM_000325chr41213 ------
NM_000329chr12825 195 ------
NM_000332chr687006 4767 2390 1990 1944 1121 86 44 12266 26588 6045 16447
NM_000337chr575819 4723 4474 2592 2263 2210 1612 15322 21671 1652 1495
NM_000346chr1741850 1470 590 92 --1798 --
NM_000361chr2052097 1686 844 706 375 ------
NM_000362chr2233237 2467 1012 1338 13509 --
NM_000390chrX83062 2926 2820 2668 1072 787 613 386 1401 1496 1702
NM_000393chr252133 1980 1653 644 344 --11427 --
NM_000408chr2123398 3251 3242 3170 3146 2576 2254 1295 826 703 183 169 --33443 189 156 --
NM_000411chr2183193 3124 2426 2317 2188 2107 958 99 12932 ----
NM_000439chr542487 2308 1716 205 22571 1773 1464 11010
NM_000448chr1163128 2849 2490 1092 580 540 33303 3169 1242 12440 --
NM_000452chr1342062 1390 566 68 --21447 767 --
NM_000454chr211228 ------
NM_000461chr394553 4296 3996 3823 3065 2951 557 187 106 13612 13524 --
NM_000462chr1551867 1360 503 432 378 ------
NM_000480chr1161599 1140 1059 266 183 22 11407 ----
NM_000489chrX63256 2658 2296 2168 904 181 ------
NM_000492chr771550 1250 1198 1171 961 149 32 11221 ----
NM_000522chr761045 930 919 908 316 130 1898 11214 --
NM_000553chr83600 517 87 ------
NM_000555chrX147860 7530 7110 6665 6318 6300 6115 5645 5444 2983 2518 2303 974 310 47360 7222 4891 1379 27213 2678 --
NM_000574chr161327 1301 856 489 388 284 ------
NM_000594chr61510 ------
NM_000598chr721463 1436 ------
NM_000599chr264620 4487 1692 1436 1143 950 1130 ----
NM_000603chr71348 ------
NM_000618chr12126287 6273 4910 4302 4282 4197 2456 1030 625 516 421 127 12481 21619 600 26444 1589
NM_000618chr12126287 6273 4910 4302 4282 4197 2456 1030 625 516 421 127 12481 21619 600 26444 1589
NM_000633chr18124864 4289 4241 4008 3627 2032 1874 1851 1831 750 716 495 11516 ----
NM_000641chr1921576 1547 ------
NM_000683chr41465 ------
NM_000684chr1011270 ------
NM_000693chr1531698 1512 1422 11849 --1315
NM_000702chr132253 2015 110 1663 12158 --
NM_000719chr12106668 5092 4113 1930 1601 1508 1464 1378 376 34 11319 11726 --
NM_000724chr10----11315 --
NM_000726chr251285 1264 1024 505 97 ------
NM_000773chr10------1104
NM_000791chr541043 1036 888 58 --32722 2181 546 --
NM_000793chr14125133 3820 3690 3454 3445 1850 1691 938 877 777 588 410 11433 ----
NM_000809chr4119282 8074 6884 6843 6769 6534 5974 3136 2444 2211 939 28832 312 --17296
NM_000813chr5145222 4959 4617 4006 3900 3602 3543 1976 1530 1286 1121 639 342 154 15088 ----
NM_000817chr251208 902 865 812 454 --1823 --
NM_000818chr101510 ------
NM_000824chr45771 755 623 374 108 1122 ----
NM_000826chr482156 1886 1856 1712 1674 1626 793 568 1832 ----
NM_000827chr532544 2485 2338 --12597 --
NM_000842chr111556 ------
NM_000845chr71330 ------
NM_000866chr311867 21287 1230 11781 1712
NM_000868chrX82542 2337 2216 1904 923 637 603 425 11721 1349 11696
NM_000875chr15136745 6550 6525 6342 6249 5663 5574 5472 5153 4860 1186 782 169 24349 680 25348 1817 --
NM_000876chr621376 367 ----1346
NM_000880chr81836 ----1139
NM_000882chr31141 ----1413
NM_000891chr1773605 2839 2822 2715 1456 563 417 23306 2690 1510 1302
NM_000899chr1273880 3733 3496 3473 3012 1580 333 ------
NM_000901chr42939 822 ------
NM_000902chr363138 3091 2112 1175 712 454 --12794 --
NM_000908chr51729 ------
NM_000919chr5186 ------
NM_000926chr11128733 6589 6103 5988 3316 2029 1960 1838 1829 1497 512 466 49096 3331 2746 1190 18206 17311
NM_000944chr441914 1503 847 117 12423 11939 --
NM_000945chr23808 105 91 12100 21827 565 --
NM_000950chrX73585 3531 3242 2474 1357 1188 1175 --1634 --
NM_000958chr52475 466 11197 1331 --
NM_000963chr122460 2190 ------
NM_000990chr1163863 3666 3423 2697 1345 602 ------
NM_001001323chr1263179 3166 3158 2646 2200 835 --12172 --
NM_001001344chrX62095 2036 750 743 722 690 1396 2967 152 --
NM_001001395chr1292816 2491 1933 1843 564 430 382 361 350 1312 --11079
NM_001001396chr154321 4274 4125 3306 3236 ------
NM_001001419chr5105065 4915 4839 4164 4081 3516 2004 982 165 141 44615 3364 521 316 15071 --
NM_001001420chr5105065 4915 4839 4164 4081 3516 2004 982 165 141 44615 3364 521 316 15071 --
NM_001001433chr2062983 2806 2469 2039 1148 722 ----12511
NM_001001481chr8103115 2776 2643 2624 2483 1393 1212 849 513 136 ------
NM_001001485chr31182 ----1439
NM_001001486chr31124 ----1381
NM_001001487chr31124 ----1381
NM_001001549chr782816 2311 2146 2070 2049 1786 928 458 12294 22041 660 --
NM_001001550chr782816 2311 2146 2070 2049 1786 928 458 12294 22041 660 --
NM_001001555chr782816 2311 2146 2070 2049 1786 928 458 12294 22041 660 --
NM_001001560chr221825 ------
NM_001001664chr254108 3636 2805 2766 143 11508 12977 --
NM_001001890chr2153929 3796 3510 3460 3388 --2533 527 --
NM_001001924chr852089 1595 1519 1400 37 ------
NM_001001925chr852089 1595 1519 1400 37 ------
NM_001001931chr852089 1595 1519 1400 37 ------
NM_001001971chr1041243 1118 993 269 21344 466 ----
NM_001001974chr1062272 2264 1519 789 721 661 11831 12024 --
NM_001001995chrX41838 1475 1436 32 --1774 --
NM_001002233chr872170 2014 1810 1672 1610 1475 324 ------
NM_001002257chr273549 3062 3009 1177 545 120 77 ------
NM_001002800chr35988 865 719 140 58 ------
NM_001002860chr14154701 4533 4350 3935 2869 1782 1695 1615 1604 1457 1289 444 392 374 237 11598 14133 23166 1570
NM_001002909chr1762206 2129 1749 1381 867 616 ------
NM_001003652chr18138600 8037 7536 7188 6666 6339 5382 2774 2727 2253 1688 1649 1060 28716 167 16256 --
NM_001003674chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_001003675chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_001003679chr141809 1429 568 473 21678 1498 32139 1793 1439 --
NM_001003712chr1283651 3167 2645 2501 1396 967 654 512 33720 3366 187 --1864
NM_001003927chr17164 ----1235
NM_001004065chr94903 525 512 75 --21499 1469 --
NM_001004106chr51248 --1257 --
NM_001004303chr12645 566 ----1273
NM_001004303chr12645 566 ----1273
NM_001004317chr6144548 4382 4272 3978 3825 3738 3576 3385 2859 1245 1171 836 326 75 1166 ----
NM_001004346chr45841 419 163 106 41 150 1251 --
NM_001004356chr411296 ------
NM_001004358chr411296 ------
NM_001004360chr221498 507 21982 728 12003 21637 152
NM_001004419chr1234444 3276 1738 23440 2819 ----
NM_001005375chrY81752 1322 694 578 527 469 378 77 11338 ----
NM_001005386chr262105 1965 1957 772 453 264 12293 ----
NM_001005404chr1764368 3367 3247 3176 3042 2803 14514 24440 4333 --
NM_001005473chr5136626 6391 5695 5283 4458 4200 2635 2578 2486 2231 1993 741 635 21498 203 ----
NM_001005746chr251285 1264 1024 505 97 ------
NM_001005747chr251285 1264 1024 505 97 ------
NM_001005751chr101143 ------
NM_001006600chr562292 1912 1523 819 743 694 ------
NM_001006605chr11885 --1940 --
NM_001006605chr11885 --1940 --
NM_001006612chrX4399 298 158 60 ------
NM_001006613chrX4399 298 158 60 ------
NM_001006614chrX4399 298 158 60 ------
NM_001007023chr14125133 3820 3690 3454 3445 1850 1691 938 877 777 588 410 11433 ----
NM_001007024chr1734376 3210 2748 14053 24342 4154 12946
NM_001007025chr1734376 3210 2748 14053 24342 4154 12946
NM_001007075chr41791 ------
NM_001007102chr641564 1285 612 335 --11508 --
NM_001007237chr162839 2623 2388 2363 2186 197 1485 ----
NM_001007245chr73639 429 60 --1214 --
NM_001007246chr2131693 350 126 1357 11309 --
NM_001007257chr141517 999 523 498 --11099 --
NM_001007466chr6115040 5021 5000 4780 4333 4014 1734 1697 1691 887 267 14395 44712 4445 634 329 24662 579
NM_001007538chr1381713 1634 1295 1211 590 159 121 90 ------
NM_001008225chr71168 ------
NM_001008239chr18103865 3725 3355 3334 3068 2698 1001 716 490 359 12654 2994 111 --
NM_001008388chr41318 --1422 21035 128
NM_001008392chr363216 3149 2884 2748 851 216 23471 2354 12947 13083
NM_001008401chr1921435 1290 ------
NM_001008405chr751498 579 552 461 246 ------
NM_001008408chr7116357 6173 5011 4789 4674 4477 4392 4381 1850 1835 1170 21230 396 11548 --
NM_001008495chr852194 1929 691 555 277 11805 11957 --
NM_001008539chr875395 5139 4569 3416 2037 1601 1346 12103 11612 --
NM_001008541chr1032135 889 157 --12207 --
NM_001008541chr1032135 889 157 --12207 --
NM_001008660chr1151471 1396 1194 382 317 --2541 339 --
NM_001008723chr101335 ------
NM_001008726chr144563 477 463 340 ------
NM_001008738chr572945 1069 975 783 495 440 71 ----1249
NM_001008925chr442977 1406 963 214 21425 1079 12600 --
NM_001009552chr85581 555 241 172 65 ------
NM_001009554chr4114740 4556 4548 4277 4088 3903 3685 3061 2929 1481 609 --13360 --
NM_001009554chr4114740 4556 4548 4277 4088 3903 3685 3061 2929 1481 609 --13360 --
NM_001009571chr741292 1229 321 119 ------
NM_001009881chr11213 ----1615
NM_001009882chr11213 ----1615
NM_001009899chr3156547 6521 6499 6207 5693 4252 4235 4145 2613 2500 2371 1040 1021 888 765 1970 151 --
NM_001009955chr11239 ------
NM_001009955chr11239 ------
NM_001009959chr252443 1840 1002 376 215 52296 2230 360 347 87 ----
NM_001009960chr772378 2236 2082 672 506 304 284 --12810 12184
NM_001009993chr274191 3893 3730 2925 2824 1669 389 23948 3487 23755 1387 --
NM_001010000chr1873528 3326 3126 3105 2332 289 115 --192 --
NM_001010853chr683175 3140 2522 2303 841 699 681 369 1494 ----
NM_001010861chr162790 2660 1790 967 764 702 --2980 356 --
NM_001010867chr146200 4688 2153 896 11572 26531 1128 --
NM_001010888chrX94667 4353 4201 3384 3356 1814 1659 991 585 11165 ----
NM_001010891chr586135 6099 5758 5254 5013 2263 1385 187 24821 358 15612 26161 1805
NM_001010895chr941836 1707 1642 445 --12038 --
NM_001010922chr183568 3303 2881 2704 871 808 658 362 ------
NM_001010942chr1221132 902 --1874 --
NM_001010984chr172633 2584 2318 2293 2065 954 476 1266 ----
NM_001010986chrX52095 910 597 379 135 1896 --11559
NM_001011513chr4133933 3825 3394 3300 3021 2989 2700 2579 1642 424 216 194 162 12607 13836 12562
NM_001011666chr7106413 6341 5634 4828 4706 4211 4171 2281 1906 70 24100 1831 36559 6323 6305 --
NM_001011708chr232529 2491 136 3958 411 319 ----
NM_001011713chr1461649 1485 597 263 172 148 11420 11448 --
NM_001012393chr1185039 4755 4679 4547 4075 716 352 144 --11590 --
NM_001012420chr1572808 2231 994 691 312 150 120 194 1891 --
NM_001012421chr94880 857 704 586 ------
NM_001012423chr1572808 2231 994 691 312 150 120 194 1891 --
NM_001012755chrX94335 4172 3623 3563 3225 1986 1627 1355 691 21892 765 ----
NM_001012756chr1953267 2880 2642 2508 407 12262 ----
NM_001012968chrX102784 2543 2413 2389 2369 2297 1812 1764 1709 1045 ----12276
NM_001013031chr1093508 3335 3229 3132 2340 2250 1331 765 321 ------
NM_001013398chr721463 1436 ------
NM_001013406chr731734 1139 665 --11120 --
NM_001013415chr4----11226 --
NM_001013620chr12188398 8380 7887 7756 7138 7018 5851 5790 5512 5502 5135 5116 3388 3250 2697 2225 2188 1756 108267 7633 7229 7112 7079 6709 6248 5638 1408 1383 11652 --
NM_001013699chr122512 24 --199 --
NM_001014431chr144929 903 656 71 ----1100
NM_001014432chr144929 903 656 71 ----1100
NM_001014797chr10128230 7030 5902 5443 5146 5007 2727 2632 684 614 374 307 --38257 5233 2418 --
NM_001014972chr2160 ------
NM_001015048chr1483062 2740 2617 1988 1261 580 251 109 12898 ----
NM_001015049chr1483062 2740 2617 1988 1261 580 251 109 12898 ----
NM_001015053chr1711568 ------
NM_001015877chrX82542 2304 1169 1117 916 725 549 333 12359 ----
NM_001015882chr94911 432 407 209 11008 --1121
NM_001015885chr201332 ------
NM_001017369chr42941 916 --11086 --
NM_001017395chr373171 2919 2843 2588 2392 662 170 12770 13194 --
NM_001017923chr1461705 1575 429 384 263 125 1469 ----
NM_001017969chr92665 590 ------
NM_001017995chr543615 1579 778 58 14806 11437 --
NM_001018037chr911369 --1304 --
NM_001018038chr9187 ------
NM_001018053chr151898 1651 1619 472 303 ------
NM_001018067chr1145314 4843 4657 4473 3470 3408 1203 1082 951 657 528 360 301 207 13368 ----
NM_001018068chr1145314 4843 4657 4473 3470 3408 1203 1082 951 657 528 360 301 207 13368 ----
NM_001018069chr1145314 4843 4657 4473 3470 3408 1203 1082 951 657 528 360 301 207 13368 ----
NM_001018074chr553873 2867 1468 990 430 ------
NM_001018075chr553873 2867 1468 990 430 ------
NM_001018076chr553873 2867 1468 990 430 ------
NM_001018077chr553873 2867 1468 990 430 ------
NM_001018090chr1572566 2235 2189 2131 2106 908 346 1190 22354 1918 --
NM_001018091chr1572676 2345 2299 2241 2216 1018 456 1300 22464 2028 --
NM_001018102chr1572566 2235 2189 2131 2106 908 346 1190 22354 1918 --
NM_001020658chr151445 1438 1216 527 408 ------
NM_001020658chr151445 1438 1216 527 408 ------
NM_001023567chr1551582 1002 218 150 120 194 1894 --
NM_001024024chr144958 931 680 224 --1364 --
NM_001024070chr144954 927 676 220 --1360 --
NM_001024071chr144926 899 648 192 --1332 --
NM_001024094chr553873 2867 1468 990 430 ------
NM_001024649chr582915 2686 2633 1865 927 745 601 499 12946 12929 --
NM_001024666chrX----1629 --
NM_001024948chr153346 2725 1197 954 789 22866 840 12644 --
NM_001024956chr11125891 5841 5793 5745 5591 4810 4778 3836 2010 1422 119 54 24967 3571 35827 1958 340 --
NM_001025068chr331803 1787 246 11145 11579 --
NM_001025069chr331803 1787 246 11145 11579 --
NM_001025076chr10106165 5064 4928 4596 4478 1384 1161 666 160 74 ------
NM_001025077chr10147523 6422 6286 5954 5836 4806 2742 2519 2024 1518 1432 1142 856 843 14696 14723 --
NM_001025079chr374066 3768 3277 3271 3058 2777 1539 21426 1413 13524 --
NM_001025108chr294043 3381 3248 1396 1123 1058 873 579 94 13235 1922 --
NM_001025252chr883238 2986 2802 2745 2525 1157 677 466 1402 11254 --
NM_001025253chr883238 2986 2802 2745 2525 1157 677 466 1402 11254 --
NM_001025266chr354061 3887 1916 1754 1099 14045 --1869
NM_001025356chr1263014 2986 2944 794 656 522 1583 12159 --
NM_001025366chr641895 1726 1563 1371 --11577 1482
NM_001025366chr641895 1726 1563 1371 --11577 1482
NM_001025367chr641895 1726 1563 1371 --11577 1482
NM_001025367chr641895 1726 1563 1371 --11577 1482
NM_001025368chr641895 1726 1563 1371 --11577 1482
NM_001025368chr641895 1726 1563 1371 --11577 1482
NM_001025369chr641911 1742 1579 1387 --11593 1498
NM_001025369chr641911 1742 1579 1387 --11593 1498
NM_001025370chr641895 1726 1563 1371 --11577 1482
NM_001025370chr641895 1726 1563 1371 --11577 1482
NM_001025389chr1161599 1140 1059 266 183 22 11407 ----
NM_001025390chr1161599 1140 1059 266 183 22 11407 ----
NM_001025580chrX84170 3891 3021 2840 2608 1181 1055 1003 23585 2939 2527 183 --
NM_001025616chr41296 ------
NM_001025780chr911086 ------
NM_001029858chr683339 2265 2256 1144 1132 799 573 86 ------
NM_001029863chr683260 3187 2476 2026 1985 594 519 189 --12676 --
NM_001029989chr15183 ----1279
NM_001030007chr1693682 3234 3173 2964 2619 1127 735 663 436 11104 ----
NM_001030055chr1484184 4011 3551 3018 2874 1589 1345 477 24507 405 14594 --
NM_001031623chr641696 1279 353 161 ----1110
NM_001031679chr1233317 2523 168 ------
NM_001031695chr2284629 3823 3624 1559 1039 284 234 184 --14647 --
NM_001031700chr472349 2136 1965 556 307 212 44 11603 ----
NM_001031732chr483413 3161 2969 1156 1062 998 881 50 11318 ----
NM_001031740chr1----1251 --
NM_001031804chr1654374 3999 3857 3099 2878 ----14183
NM_001031812chr592247 2097 1947 1922 1824 1731 1604 1543 748 --12124 11896
NM_001032283chr124883 762 126 63 --1316 --
NM_001032284chr124883 762 126 63 --1316 --
NM_001032296chr1382870 2790 2611 2219 866 713 682 325 --1629 --
NM_001032363chr141982 1854 371 174 12201 --1146
NM_001032363chr141982 1854 371 174 12201 --1146
NM_001032380chr1071956 1578 1355 622 612 368 145 11848 --11549
NM_001032394chr652609 2282 1725 1113 254 12205 ----
NM_001032395chr642476 2149 980 121 12072 ----
NM_001032999chr2065341 4126 3507 1535 975 887 1717 --14318
NM_001033045chr234260 3816 3668 --24254 677 --
NM_001033047chr462657 2086 1857 1618 677 131 ------
NM_001033057chr351407 1386 490 239 209 11970 --1143
NM_001033059chr652042 1558 1432 629 600 11649 ----
NM_001033081chr121870 1747 ------
NM_001033082chr121870 1747 ------
NM_001033087chr2083275 3189 3021 2439 2320 1310 855 147 1975 ----
NM_001033557chr21335 ------
NM_001033566chr174968 384 141 119 ------
NM_001033568chr174968 384 141 119 ------
NM_001033578chr892216 2207 2067 912 493 462 171 141 65 ------
NM_001033602chr1352699 1965 992 618 492 --12523 --
NM_001033756chr641829 1660 1497 1305 --11511 1416
NM_001033756chr641829 1660 1497 1305 --11511 1416
NM_001033925chr1031458 692 345 31675 860 465 --11536
NM_001034841chr1695509 4194 3881 3787 3491 1946 1389 568 486 13617 ----
NM_001034954chr1063243 2830 2341 2169 828 228 --12367 --
NM_001034955chr1063243 2830 2341 2169 828 228 --12367 --
NM_001034956chr1063243 2830 2341 2169 828 228 --12367 --
NM_001034957chr1063243 2830 2341 2169 828 228 --12367 --
NM_001035003chr441433 574 410 354 ------
NM_001035004chr441433 574 410 354 ------
NM_001035260chr1051623 1571 1144 602 234 --1412 --
NM_001037164chr751949 1659 626 506 233 ----11639
NM_001037165chr7128741 8475 8442 8092 7789 7153 6812 6530 6519 5847 3397 647 27416 156 18938 11609
NM_001037172chr341199 959 921 903 ----11392
NM_001037174chr231712 1647 443 21483 146 ----
NM_001037317chr162790 2660 1790 967 764 702 --2980 356 --
NM_001037334chr1881895 1846 1726 914 889 379 115 47 12097 1538 --
NM_001037872chr2----161 --
NM_001038640chr155960 761 286 226 196 1170 ----
NM_001038707chr111967 ------
NM_001038707chr111967 ------
NM_001039029chr1212023 ------
NM_001039091chrX61337 1184 1027 946 429 206 ------
NM_001039199chr2064980 3914 3340 1864 1698 226 14281 --13880
NM_001039348chr23834 159 29 ------
NM_001039349chr23834 159 29 ------
NM_001039457chr1----1279 --
NM_001039468chr111268 ------
NM_001039469chr111308 ------
NM_001039538chr293610 3155 2519 2277 1247 806 533 290 193 --13668 1611
NM_001039547chr3198033 7913 6919 6670 6483 4937 2941 2786 2551 2478 1590 1567 1461 1268 1252 1236 963 957 405 75180 5028 4926 2956 2120 1478 432 16404 --
NM_001039569chr252753 2537 1053 937 275 ----2906 346
NM_001039577chr174494 4236 1732 1723 1547 1523 511 11485 13647 --
NM_001039580chr484677 4198 3857 3799 3589 1132 167 24 24649 939 23140 490 --
NM_001039585chr173975 3809 1682 1554 1160 582 175 1865 ----
NM_001039590chrX73816 3795 3434 3365 3078 1301 542 22652 1265 1971 --
NM_001039591chrX73816 3795 3434 3365 3078 1301 542 22652 1265 1971 --
NM_001039618chr11124964 4791 4530 4436 3669 2219 1565 1507 1325 899 468 30 22255 1879 21126 724 --
NM_001039693chr2104114 3423 3309 3276 3262 2784 2675 2637 1312 756 12620 --13289
NM_001039709chr2065341 4126 3507 1535 975 887 1717 --14318
NM_001039840chrX94416 3718 2405 1785 1402 1263 1226 998 943 35228 1103 906 12198 --
NM_001039937chr1383986 3975 3286 2995 1552 1471 1332 469 23387 110 --14057
NM_001040001chr652020 1973 1935 1786 28 21527 672 11984 --
NM_001040092chr83356 103 65 ------
NM_001040101chr451535 1338 435 330 190 ------
NM_001040142chr232227 1798 672 ------
NM_001040143chr232227 1798 672 ------
NM_001040152chr755102 4636 3869 3653 3547 23437 319 44206 3368 3148 1367 --
NM_001040153chr135953 912 866 384 178 ------
NM_001040157chr452006 857 294 279 123 ------
NM_001040159chr461485 1222 1181 1112 443 180 1130 ----
NM_001040167chr72985 791 ------
NM_001040214chr632386 2343 70 11666 12325 --
NM_001040260chr42906 342 --21079 478 --
NM_001040261chr42906 342 --21079 478 --
NM_001040284chr16125890 5864 5583 5532 4757 4600 4511 3994 3742 1977 534 125 45728 4299 4278 237 15558 --
NM_001040402chr481233 1219 1156 538 411 393 353 206 22674 588 23238 3094 --
NM_001040429chr13112783 2207 1421 1128 1090 905 774 643 538 352 30 ------
NM_001040440chr51192 --1515 --
NM_001040441chr134895 4887 1157 21520 594 ----
NM_001040446chr522370 496 12378 22404 448 --
NM_001040633chr71122 ------
NM_001040653chr362529 2517 2511 2359 2086 827 22334 2027 21649 873 --
NM_001040665chr764604 3617 3250 3103 1626 743 23203 624 ----
NM_001040709chr121993 1954 22556 1967 --1940
NM_001040712chr963590 3167 3102 2551 1402 1071 1704 --12193
NM_001040876chr431687 572 46 1452 --11408
NM_001042355chr16105194 4846 4173 3958 3380 1902 692 612 190 176 34811 4350 4042 ----
NM_001042361chr1051502 466 369 309 197 21412 1351 --1526
NM_001042364chr1051502 466 369 309 197 21412 1351 --1526
NM_001042365chr1051502 466 369 309 197 21412 1351 --1526
NM_001042387chr1051502 466 369 309 197 21412 1351 --1526
NM_001042393chr1051502 466 369 309 197 21412 1351 --1526
NM_001042396chr1051502 466 369 309 197 21412 1351 --1526
NM_001042397chr1051502 466 369 309 197 21412 1351 --1526
NM_001042404chr161983 1888 1770 1409 1219 437 11717 1725 --
NM_001042406chr641148 947 456 307 ------
NM_001042412chr16105194 4846 4173 3958 3380 1902 692 612 190 176 34811 4350 4042 ----
NM_001042413chr963290 3250 3244 1438 648 621 13257 ----
NM_001042453chrX51480 1186 649 603 159 21645 582 ----
NM_001042459chr31257 ------
NM_001042481chr1462517 2451 2062 824 743 129 1694 12389 --
NM_001042537chrX32315 2251 1636 ----32420 2198 535
NM_001042543chr431397 1367 148 ------
NM_001042555chr1284819 4059 4040 3677 1807 1047 1002 971 2745 669 1820 --
NM_001042599chr2147663 7299 7214 7011 6785 6213 5931 5913 5438 4884 2789 2174 1105 685 17641 17249 --
NM_001042601chr362854 1171 1115 1038 547 351 1537 --1488
NM_001042603chr1265362 5133 4535 4005 3625 1289 ------
NM_001042604chr3114746 4621 4448 3650 3531 3361 3274 1427 861 579 382 11940 ----
NM_001042646chr331770 1363 699 11762 ----
NM_001042669chr41296 ------
NM_001042749chrX52050 1857 776 595 433 --1328 --
NM_001042750chrX52050 1857 776 595 433 --1328 --
NM_001042751chrX52050 1857 776 595 433 --1328 --
NM_001043318chr14103776 3736 3636 3030 2780 1640 1579 1552 881 802 --1674 --
NM_001044385chr233594 280 65 --291 39 --
NM_001044722chr592247 2097 1947 1922 1824 1731 1604 1543 748 --12124 11896
NM_001044723chr592247 2097 1947 1922 1824 1731 1604 1543 748 --12124 11896
NM_001046chr562793 2776 2022 1841 941 818 ----12682
NM_001079874chr172117 1900 1651 1599 665 647 104 2472 402 ----
NM_001083620chr482154 1884 1854 1711 1673 1625 792 567 1831 ----
NM_001099678chr386104 5054 4458 4342 2583 1627 1194 227 15200 --16284
NM_001101662chr1139 ------
NM_001106chr3119567 8895 8838 8664 7835 7758 7344 6829 2389 2242 1692 11299 ----
NM_001113490chrX52715 2679 1076 963 878 --1705 --
NM_001115chr8134 ------
NM_001116chr1653022 2888 2829 875 56 22023 327 22081 62 12916
NM_001117chr1862284 2161 2145 464 423 107 --12195 --
NM_001123chr101305 ------
NM_001128chr1693682 3234 3173 2964 2619 1127 735 663 436 11104 ----
NM_001130chr191121 ------
NM_001146chr852368 1987 1878 1518 886 32341 1764 170 ----
NM_001148chr461992 1977 1597 1535 305 135 11398 11434 --
NM_001151chr41187 ------
NM_001152chrX1201 ------
NM_001160chr12102765 2678 2663 2652 2253 2035 744 520 357 340 ------
NM_001167chrX86637 6539 5777 1452 1262 1130 910 584 --22683 102 --
NM_001173chr1484184 4011 3551 3018 2874 1589 1345 477 24507 405 14594 --
NM_001174chrX32194 2028 1883 --11988 --
NM_001177chr1282277 1726 1686 901 469 254 158 133 1961 12103 --
NM_001186chr2133202 2347 769 ----11111
NM_001198chr652164 456 284 274 261 21951 636 ----
NM_001200chr2061160 940 434 359 310 243 ------
NM_001201chr473556 3335 2692 1287 669 403 102 12980 1184 --
NM_001204chr2106813 5019 4776 2292 2165 2141 1850 1819 822 239 46449 5940 5501 2238 12298 16194
NM_001241chr261853 1626 935 491 338 219 21791 1570 ----
NM_001241chr261853 1626 935 491 338 219 21791 1570 ----
NM_001256chr1742961 2705 950 393 12655 --12142
NM_001257chr161393 --11484 --
NM_001259chr7106193 5903 5651 4776 4574 4496 4354 4016 612 210 1293 1544 --
NM_001271chr1553285 3154 2453 2190 1102 ------
NM_001278chr1071160 900 769 752 424 286 242 ------
NM_001286chr132811 1773 515 22843 1018 12597 --
NM_001289chrX41496 172 138 32 21586 1215 --1550
NM_001304chr1783556 2757 2637 2335 1303 348 313 266 11133 1572 1995
NM_001310chr1272742 2516 2332 2208 2052 799 301 42978 2797 2183 2090 ----
NM_001315chr632225 1660 1585 1587 11756 --
NM_001351chr351730 480 429 408 276 21312 638 ----
NM_001356chrX51746 1709 642 294 268 ----12291
NM_001357chr14269 225 109 87 ------
NM_001364chr1194691 4610 2922 2887 1180 1021 1009 97 39 ------
NM_001390chr1853324 3110 3044 1120 406 13431 ----
NM_001400chr141304 1093 988 309 --11030 --
NM_001401chr9----2651 142 --
NM_001412chrX73537 3453 3389 2453 2332 551 331 ----13479
NM_001418chr111478 ----162
NM_001418chr111478 ----162
NM_001419chr19124742 3383 1638 1608 1474 1334 1177 918 886 851 429 335 1907 ----
NM_001423chr1211628 ------
NM_001427chr742083 1980 429 393 ------
NM_001430chr232002 1845 85 --1669 11809
NM_001432chr4113622 3530 2662 2463 1315 1240 1135 1077 738 168 115 23748 540 ----
NM_001438chr153552 3539 3284 3202 3183 1825 1861 --
NM_001451chr1661377 1326 1285 1182 1047 446 11261 11205 11219
NM_001490chr943337 1491 950 462 11090 ----
NM_001493chrX1753 ------
NM_001497chr992760 2706 2675 2418 2275 1960 907 865 726 ------
NM_001527chr6164776 4741 4717 3830 3072 1725 1541 1463 1356 1293 1144 782 490 467 226 116 24561 3728 11573 --
NM_001530chr141226 ------
NM_001542chr162839 2623 2388 2363 2186 197 1485 ----
NM_001546chr6------1899
NM_001550chr73639 429 60 --1214 --
NM_001554chr11152 ------
NM_001560chrX92136 2093 1859 1743 1043 866 378 362 62 ------
NM_001587chrX4570 262 139 56 --1563 --
NM_001604chr112993 260 1740 2681 274 --
NM_001608chr22960 773 --1627 --
NM_001609chr1094396 4360 3471 1293 1090 704 612 562 232 13834 13734 --
NM_001616chr2123428 3360 3310 3177 2973 2741 2572 2392 2245 1042 893 759 32708 1196 926 1440 --
NM_001634chr652042 1558 1432 629 600 11649 ----
NM_001650chr1864150 4061 3836 3519 1095 608 21130 386 ----
NM_001656chr562033 1811 625 503 451 257 11541 ----
NM_001663chr1442610 2219 2087 518 32401 2359 249 ----
NM_001664chr31140 --1688 --
NM_001682chr1272893 2880 2872 2360 1914 1086 549 --11886 --
NM_001684chr174038 3991 3842 3023 2953 1594 1579 ------
NM_001690chr382456 2401 2339 1774 946 792 464 135 ------
NM_001695chr8143988 3509 3393 3188 1571 1239 902 892 854 834 739 650 388 315 1747 ----
NM_001706chr3----1688 --
NM_001709chr1162759 1074 665 578 195 52 ------
NM_001717chr153956 433 91 --11186 1116
NM_001722chr81250 ------
NM_001726chr11110 ------
NM_001729chr43361 131 119 158 ----
NM_001742chr761829 1628 1563 730 106 65 --2585 417 --
NM_001746chr582915 2686 2633 1865 927 745 601 499 12946 12929 --
NM_001754chr2153929 3796 3510 3460 3388 --2533 527 --
NM_001755chr1641543 1454 549 232 11657 11645 --
NM_001759chr1285319 4463 1526 1514 1330 882 856 527 21568 203 1191 --
NM_001762chr72695 172 ------
NM_001777chr374066 3768 3277 3271 3058 2777 1539 21426 1413 13524 --
NM_001795chr1611576 ------
NM_001806chr1932682 2098 428 ----11006
NM_001830chrX63933 3872 3184 2600 481 187 --23044 813 11223
NM_001839chr15754 726 714 304 26 --2654 538 --
NM_001842chr91517 ----1570
NM_001844chr121393 ------
NM_001845chr1331294 1261 1069 ------
NM_001852chr11553 ------
NM_001858chr694947 3888 3393 3290 1750 1674 1091 809 181 23284 147 ----
NM_001859chr943184 2947 2579 1528 ----13875
NM_001894chr22148 ------
NM_001918chr199196 8447 6759 5867 3663 2937 2685 971 139 38960 3489 2271 ----
NM_001924chr12429 354 1408 ----
NM_001939chrX41359 763 684 123 13607 22812 1031 13292
NM_001942chr1812034 ------
NM_001944chr1832299 2101 752 12066 1741 --
NM_001946chr121768 11057 1450 11075
NM_001949chr663041 2864 2373 2256 1266 411 --12444 --
NM_001955chr621047 1032 ------
NM_001957chr482172 2125 1444 744 698 608 504 492 2538 481 11732 --
NM_001967chr33486 470 453 191 --1445
NM_001968chr44841 713 349 99 ------
NM_001969chr1472783 2692 999 935 829 756 256 22796 1564 ----
NM_001980chr1242133 2053 1965 1547 12044 ----
NM_001987chr1273008 2960 2885 1529 1440 1368 945 --13881 --
NM_001992chr582260 1642 1535 898 678 518 323 158 ------
NM_001993chr141087 804 736 94 1932 ----
NM_001999chr541382 980 355 219 ----161
NM_002006chr475718 4328 3884 2252 1609 1473 609 13983 21812 264 --
NM_002009chr1562589 2407 2285 841 487 154 ------
NM_002015chr1353140 2240 1119 1079 699 --2876 361 --
NM_002024chrX72147 1727 1388 584 510 475 363 ----11566
NM_002025chrX129134 9110 7952 7188 6329 5762 5610 3336 3150 2960 982 235 22636 750 --1226
NM_002035chr1854005 3528 3510 2592 533 1218 12961 --
NM_002040chr2173176 3103 2620 2493 2321 720 561 ------
NM_002048chr971336 1322 1264 1239 1168 1092 413 ------
NM_002052chr811497 ------
NM_002063chrX21193 918 --11281 --
NM_002069chr771600 1536 665 540 414 292 28 ------
NM_002072chr92265 71 ------
NM_002077chr921374 106 --11435 --
NM_002082chr51211 --1220 --
NM_002090chr44635 591 191 171 ------
NM_002092chr4134389 4323 4020 3919 3288 1716 1631 1539 1374 958 885 50 44 34692 4509 2018 13268 21865 535
NM_002094chr161351 ------
NM_002126chr1744115 2983 1489 1461 12564 --1844
NM_002128chr1342528 2390 194 44 ------
NM_002149chr24791 759 630 555 --1721 --
NM_002158chr283355 3248 3188 1520 1274 880 716 419 11233 ----
NM_002182chr332743 1053 857 22759 1751 12646 --
NM_002190chr64954 445 406 272 1412 ----
NM_002194chr21126 ------
NM_002199chr4164 ------
NM_002203chr563463 3002 2815 1448 390 126 14007 ----
NM_002210chr293331 3256 2438 2287 1233 871 350 220 148 22390 2271 ----
NM_002214chr785676 5597 5190 4658 2239 2095 1335 1014 35406 4742 3679 15360 --
NM_002222chr391302 524 390 339 317 310 209 110 26 --11309 --
NM_002223chr1273968 3916 2600 2530 1210 975 939 32567 2514 928 ----
NM_002234chr122717 496 --1265 189
NM_002242chr23704 648 489 11463 --21903 608
NM_002247chr1041770 1536 849 124 21607 477 --1552
NM_002267chr1332226 1511 796 1733 ----
NM_002270chr5105646 5639 4875 4512 3869 2283 1678 1585 1483 1018 ------
NM_002285chr294043 3381 3248 1396 1123 1058 873 579 94 13235 1922 --
NM_002293chr162792 2766 2741 2543 2402 1043 11072 12274 --
NM_002296chr171745 1589 666 561 441 235 51 ----11419
NM_002298chr1331502 230 159 ----1445
NM_002336chr12114932 4910 4768 4427 3947 3941 3824 3626 3245 1724 155 1470 ----
NM_002342chr121591 ------
NM_002351chrX21418 100 ----1654
NM_002359chr1754257 4202 3504 803 699 1848 ----
NM_002374chr293610 3155 2519 2277 1247 806 533 290 193 --13668 1611
NM_002387chr574169 3712 2005 1837 1671 466 343 35099 4854 3935 24937 936 --
NM_002395chr651413 1386 1341 1184 487 11208 ----
NM_002408chr142283 44 ----1602
NM_002431chr141127 ------
NM_002449chr541158 436 410 402 --11280 --
NM_002469chr123390 381 365 ------
NM_002478chr111514 ------
NM_002481chr167975 7828 7650 6354 1814 1459 16487 142 --
NM_002482chr1153 ----1569
NM_002492chr32323 71 ------
NM_002499chr1552042 1834 387 370 300 2724 475 12034 --
NM_002507chr1711735 ------
NM_002508chr121797 34 2775 686 2707 639 --
NM_002514chr831136 880 117 ------
NM_002520chr51309 ------
NM_002525chr1139 ------
NM_002527chr121256 ------
NM_002537chr151421 ------
NM_002544chr171309 ------
NM_002545chr1185039 4755 4679 4547 4075 716 352 144 --11590 --
NM_002547chrX84292 4201 3526 3103 2739 1441 1388 727 13003 ----
NM_002569chr15167 ------
NM_002577chr3104027 3453 3223 2660 1605 1292 1089 463 346 291 21477 1317 1690 --
NM_002581chr965118 4280 3817 3807 834 278 ------
NM_002592chr201218 ------
NM_002594chr2052265 1939 1580 961 347 ------
NM_002595chr1271831 1532 1397 756 437 168 104 11914 ----
NM_002608chr2211620 --149 --
NM_002610chr232247 400 147 22259 117 22227 961 --
NM_002613chr1665094 5071 4875 3847 3378 134 15157 23918 1348 --
NM_002623chr204796 293 199 26 ------
NM_002628chr341197 882 364 143 --21066 479 --
NM_002641chrX51958 1593 1399 336 34 11701 ----
NM_002643chr21185 ------
NM_002645chr1142477 1954 155 109 ------
NM_002655chr8154972 4848 4508 3779 3397 3366 3355 2045 1834 1033 682 645 587 205 178 --15062 --
NM_002667chr631004 529 423 ------
NM_002709chr242669 2301 1053 764 23456 91 --12576
NM_002714chr611083 ------
NM_002718chr351838 991 781 73 36 12378 ----
NM_002731chr172418 1955 1221 1121 1058 862 791 32761 2439 367 ----
NM_002734chr1771961 1948 1480 1461 744 416 390 --1874 --
NM_002737chr1796633 6553 6120 5429 5390 5061 4353 1906 1360 ----26370 1559
NM_002740chr352468 2382 1798 1759 95 ------
NM_002745chr2274272 3733 3227 3109 843 475 129 13844 43742 3335 1625 1252 --
NM_002752chr52551 381 ------
NM_002763chr11479 ------
NM_002764chrX2904 873 ----166
NM_002765chrX61337 1184 1027 946 429 206 ------
NM_002767chr171463 ------
NM_002788chr14126 ------
NM_002792chr201120 ------
NM_002806chr144325 300 253 239 ------
NM_002814chrX2737 725 --2590 70 --
NM_002822chr1221832 407 1549 21694 1311 --
NM_002823chr21271 ------
NM_002827chr2041663 1464 684 446 ------
NM_002828chr183931 687 285 ------
NM_002833chr1521618 1537 --1404 --
NM_002837chr12114568 4494 4345 4118 2854 1259 1209 1161 875 213 186 24430 1616 ----
NM_002838chr151178 1167 1008 881 119 ------
NM_002839chr963590 3167 3102 2551 1402 1071 1704 --12193
NM_002843chr1142954 2596 1018 719 2666 512 1929 --
NM_002851chr72253 230 ------
NM_002865chr81206 193 --1213
NM_002868chr1242464 906 770 551 1572 12397 --
NM_002869chr1172153 2100 2027 1576 1481 812 721 ----12084
NM_002873chr52473 132 ------
NM_002886chr3124661 3987 3954 3865 3848 3656 1726 1586 1423 1291 821 754 11968 13509 --
NM_002890chr55980 847 836 676 202 ------
NM_002892chr1441330 1131 255 219 ----1411
NM_002901chr114795 400 376 154 1700 ----
NM_002906chr1162205 2135 1806 1636 885 655 1649 12303 --
NM_002940chr431687 572 46 1452 --11408
NM_002941chr331057 619 323 21363 1103 11093 --
NM_002956chr1251267 873 475 452 358 21170 242 1385 --
NM_002959chr154432 4423 3790 1474 1365 21535 1257 ----
NM_002968chr161245 ------
NM_002971chr331080 782 41 ------
NM_002977chr272398 2349 2256 1053 841 397 49 1868 1417 --
NM_002990chr16------22285 1774
NM_002994chr461773 1654 1335 748 241 117 ------
NM_002995chr11122 --1710 --
NM_002996chr1611984 ------
NM_002998chr862185 875 764 332 158 140 --1802 --
NM_003030chr352015 1814 1538 518 460 21846 1387 ----
NM_003034chr1256893 2617 1788 831 37 --15373 --
NM_003042chr332186 1823 451 11541 11969 --
NM_003043chr384209 4120 3960 3798 1606 312 280 89 23880 1627 --24127 992
NM_003045chr1374740 4399 4150 3056 1903 1481 1014 14530 ----
NM_003046chr875395 5139 4569 3416 2037 1601 1346 12103 11612 --
NM_003051chr151666 1445 1255 752 109 21756 1690 ----
NM_003072chr191367 ------
NM_003107chr652497 2187 1740 646 180 11721 --12204
NM_003108chr287300 7131 6782 5135 4842 4604 1214 973 15479 16610 --
NM_003112chr783056 2816 2744 878 868 655 463 212 12675 12226 --
NM_003128chr25905 802 545 261 142 2889 711 12216 12236
NM_003133chr131027 928 399 3916 675 250 ----
NM_003144chr682157 2122 2012 1923 1414 712 552 467 ------
NM_003156chr1111212 ------
NM_003161chr1743564 2533 2206 1423 33583 1238 694 23302 929 --
NM_003184chr831009 930 450 ----1148
NM_003185chr2051169 863 338 331 35 ------
NM_003193chr11139 ------
NM_003199chr1895704 5501 5087 4423 4010 1883 1490 1205 697 11531 45420 1684 1031 328 14887
NM_003211chr1231133 464 98 21735 1550 --1211
NM_003213chr121190 ------
NM_003221chr6103759 3421 3104 2765 1614 1549 1479 1325 869 226 ------
NM_003253chr2151735 1665 1365 706 498 ------
NM_003257chr1531285 1187 1113 --1124 2920 336
NM_003262chr3114819 4581 4126 4116 3974 3299 1898 1814 1589 1575 919 21488 217 2665 87 23218 124
NM_003298chr396173 6047 5571 4869 1344 952 643 254 76 ------
NM_003304chr351373 1213 1138 510 449 1552 ----
NM_003320chr1154428 4359 3377 2841 1660 ----1674
NM_003330chr1271796 1757 1507 1447 1373 1183 220 --1732 --
NM_003338chr1081933 1923 1805 1600 1583 725 423 194 2742 112 ----
NM_003339chr561350 1237 1174 1087 994 531 179 ----
NM_003341chr34509 267 105 30 --1668 --
NM_003342chr1723196 209 23013 2612 11271 --
NM_003348chr1231613 1180 70 11557 21327 1199 --
NM_003360chr41191 ------
NM_003369chr1162818 2794 2144 1120 942 284 22557 2230 1381 --
NM_003372chrX2945 215 ------
NM_003375chr102144 135 ------
NM_003376chr641895 1726 1563 1371 --11577 1482
NM_003376chr641895 1726 1563 1371 --11577 1482
NM_003380chr101239 ------
NM_003387chr292682 2674 2574 2558 2494 2017 1893 692 329 ------
NM_003392chr3114231 3920 3830 3381 3257 2897 2641 1368 642 547 186 22940 994 ----
NM_003403chr141527 ------
NM_003404chr2031892 1422 470 --1168 1478
NM_003406chr871864 1459 1305 780 656 604 55 1124 ----
NM_003407chr193685 570 537 ------
NM_003410chrX72657 2137 1080 1011 785 711 22 23050 547 ----
NM_003411chrY31695 1331 470 21369 500 11530 --
NM_003412chr352808 2347 2321 1194 775 23093 2140 13114 12608
NM_003413chrX71868 1698 1564 632 516 481 216 ----1209
NM_003427chr61716 ------
NM_003463chr673241 2864 1275 1081 487 241 188 --33297 2121 168 --
NM_003468chr294237 4012 1056 773 284 257 210 144 51 24261 1712 11753 --
NM_003471chr362271 1903 1842 1821 1448 609 1953 2642 312 --
NM_003472chr681500 1388 1304 585 402 248 183 82 ------
NM_003474chr1052279 2200 1631 299 246 ------
NM_003477chr112226 89 1314 --1138
NM_003478chr1172923 2912 2112 994 986 536 90 ------
NM_003489chr2142569 1334 718 332 --13014 --
NM_003506chr83454 369 304 1404 11190 1426
NM_003565chr1211522 ------
NM_003566chr1283406 3265 2771 1386 1310 980 299 85 --11019 --
NM_003567chr1------1301
NM_003574chr18125579 5083 4746 4037 3545 2261 2247 1478 1423 793 727 572 14097 ----
NM_003576chr1382870 2790 2611 2219 866 713 682 325 --1629 --
NM_003583chr1292853 2682 2452 1379 837 312 250 113 92 --33538 3185 3129 --
NM_003590chr283975 3836 3500 3079 3057 1231 716 253 ------
NM_003603chr462151 1681 1575 1390 678 438 1302 ----
NM_003607chr1103822 3619 3356 3261 3156 3057 2952 1408 956 701 24039 855 13086 --
NM_003610chr201332 ------
NM_003613chr151722 --1636 --
NM_003615chr352878 1088 527 481 166 13580 12937 --
NM_003617chr1214878 4869 4733 4632 4588 4515 4376 3828 3815 3377 3184 3056 1749 1541 1526 1475 1265 1081 761 748 61 ------
NM_003618chr22464 240 ------
NM_003622chr1282612 2417 2143 1824 1653 972 278 265 ----11973
NM_003624chr19----11444 --
NM_003626chr1151395 1183 1029 548 386 ----153
NM_003633chr521666 594 --12191 1354
NM_003645chr15----1216 --
NM_003648chr212506 ------
NM_003663chr343031 812 614 82 13121 12782 --
NM_003672chr161901 1595 1298 449 282 258 11635 --11383
NM_003677chr125796 606 406 293 22 ----11535
NM_003679chr142453 798 664 177 184 ----
NM_003690chr21205 ----1482
NM_003692chr91130 ------
NM_003714chr562592 2523 2481 2344 2337 2222 22403 992 ----
NM_003722chr341858 1779 981 916 ----1846
NM_003741chr31384 ------
NM_003750chr103924 758 243 1400 1676 --
NM_003759chr4104283 4209 3590 3291 2733 1686 1283 959 188 172 ------
NM_003760chr1146 ------
NM_003762chr141397 947 444 284 ------
NM_003763chr2062983 2806 2469 2039 1148 722 ----12511
NM_003764chr61719 ------
NM_003774chr1273216 2992 2906 2287 768 447 83 --23350 576 --
NM_003787chr1821602 471 ------
NM_003799chr1874122 1010 561 431 390 253 152 175 24507 3015 --
NM_003800chr672358 2018 1668 1490 656 647 385 1118 ----
NM_003821chr81151 ------
NM_003822chr143175 3012 2878 2404 --1199 --
NM_003829chr951204 1166 255 230 203 ------
NM_003870chr1562127 1592 1490 1395 603 169 ------
NM_003873chr1072463 2055 1886 1870 1558 1030 442 1225 ----
NM_003884chr341818 1704 1303 170 1741 ----
NM_003885chr1762553 2207 2091 1918 943 41 22447 562 ----
NM_003887chr262043 1936 1706 1657 700 209 12321 ----
NM_003895chr2141526 391 211 72 1132 11768 --
NM_003902chr11223 --2257 25 --
NM_003909chr862739 2450 2309 1091 684 98 12970 ----
NM_003913chr684305 4080 3770 3761 3734 1014 994 944 34289 3066 126 11295 --
NM_003916chrX2413 35 11369 --1347
NM_003919chr73227 191 172 ------
NM_003921chr131493 716 83 31167 302 94 1347 --
NM_003932chr223534 457 165 31867 1547 417 --11764
NM_003934chr971102 1058 507 427 341 79 58 21268 1131 ----
NM_003941chr732347 914 857 --1646 --
NM_003948chr432166 307 129 ------
NM_003951chrX2397 75 ------
NM_003953chr142865 500 420 365 ------
NM_003958chr663939 3067 2674 2613 1208 503 1275 --2759 24
NM_003966chr577727 5809 4764 2403 1369 1282 116 47190 4896 4836 2357 1869 --
NM_003983chr1654315 4287 3203 1659 582 ----1356
NM_003994chr1273880 3733 3496 3473 3012 1580 333 ------
NM_004004chr1341331 1297 453 91 1130 1324 --
NM_004006chrX42597 2375 2129 358 22345 632 ----
NM_004007chrX42597 2375 2129 358 22345 632 ----
NM_004009chrX42597 2375 2129 358 22345 632 ----
NM_004010chrX42597 2375 2129 358 22345 632 ----
NM_004011chrX42597 2375 2129 358 22345 632 ----
NM_004012chrX42597 2375 2129 358 22345 632 ----
NM_004013chrX42597 2375 2129 358 22345 632 ----
NM_004014chrX42597 2375 2129 358 22345 632 ----
NM_004015chrX42597 2375 2129 358 22345 632 ----
NM_004016chrX42511 2289 2043 272 22259 546 ----
NM_004017chrX42597 2375 2129 358 22345 632 ----
NM_004018chrX42511 2289 2043 272 22259 546 ----
NM_004020chrX42597 2375 2129 358 22345 632 ----
NM_004021chrX42511 2289 2043 272 22259 546 ----
NM_004022chrX42511 2289 2043 272 22259 546 ----
NM_004023chrX42511 2289 2043 272 22259 546 ----
NM_004028chr1864150 4061 3836 3519 1095 608 21130 386 ----
NM_004047chr1----1279 --
NM_004065chrX------198
NM_004081chrY81752 1322 694 578 527 469 378 77 11338 ----
NM_004085chrX1192 ------
NM_004086chr143721 669 626 ------
NM_004093chr1353040 2949 2112 1169 412 ------
NM_004094chr1462963 1116 805 460 208 125 21013 677 12996 --
NM_004100chr661854 1643 912 871 822 118 --1675 --
NM_004105chr23834 159 29 ------
NM_004113chr382012 1914 1897 1884 1700 1400 462 456 ------
NM_004114chrX41224 807 300 217 --1941 --
NM_004124chr14103292 3150 3050 2982 1389 1208 855 430 136 28 13241 ----
NM_004136chr1532168 964 510 22873 2687 12831 --
NM_004156chr85581 555 241 172 65 ------
NM_004162chr331185 481 71 ------
NM_004171chr11127856 7093 6940 6707 3740 2822 2115 1472 1100 1078 875 739 47196 2993 1538 235 --17912
NM_004172chr532035 1368 1303 21312 1248 ----
NM_004186chr31131 ------
NM_004209chr1611140 ------
NM_004229chrX72226 1871 1834 1774 1718 432 245 ----12084
NM_004232chr1883753 3635 2847 2743 2484 2410 1419 861 ------
NM_004235chr95844 802 636 574 50 ------
NM_004239chr14----1104 --
NM_004241chr102712 284 ------
NM_004272chr521259 697 ----11842
NM_004274chr1452235 2197 755 615 114 1508 12656 --
NM_004277chr641223 446 363 243 11445 ----
NM_004279chr762298 1975 754 259 85 37 21822 855 ----
NM_004291chr51292 ------
NM_004293chr983801 3727 2972 2477 2373 1487 771 592 1322 ----
NM_004295chr171498 ------
NM_004331chr81175 21822 69 --11708
NM_004338chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_004346chr43493 72 61 --11422 --
NM_004365chr51139 ------
NM_004370chr652196 2098 1704 598 222 ------
NM_004384chr592247 2097 1947 1922 1824 1731 1604 1543 748 --12124 11896
NM_004397chr1193963 3890 2865 2828 1486 732 448 390 36 --13194 --
NM_004398chr112459 407 ------
NM_004420chr1142283 1698 1546 209 --22427 1669 --
NM_004426chr1231974 1645 321 ----1615
NM_004430chr862697 2654 2601 2084 1839 891 ------
NM_004432chr972368 2300 2097 2069 1647 517 476 12306 --1168
NM_004438chr263195 2998 2885 1150 381 361 1199 1313 13310
NM_004440chr641963 1700 426 337 21830 1295 ----
NM_004442chr11604 ------
NM_004449chr2131201 1083 441 1565 21397 1133 --
NM_004457chr241608 1228 421 397 ----21130 533
NM_004458chrX72564 2290 2109 1876 1624 1040 984 1724 1875 --
NM_004459chr1751896 1322 779 438 392 1755 ----
NM_004463chrX1517 ------
NM_004464chr484279 2808 1495 1278 542 306 274 131 13778 ----
NM_004491chr1924094 3911 1224 34288 2929 58 --
NM_004500chr1452004 1402 1320 701 495 ------
NM_004501chr1114119 3011 2996 2871 2801 1619 1037 735 725 679 241 23535 3184 ----
NM_004503chr125739 639 580 551 80 --1625 --
NM_004504chr252995 1097 914 813 313 12037 1329 --
NM_004505chr171169 21255 590 21475 1422 --
NM_004516chr1941175 1074 367 250 ------
NM_004520chr52753 218 2282 78 --1580
NM_004521chr101350 ------
NM_004523chr1041267 566 519 494 ------
NM_004535chr2061533 1395 1161 1132 474 101 11272 11593 --
NM_004575chr431189 527 491 --21143 220 --
NM_004580chr1551478 1425 1292 1167 306 ----11736
NM_004583chr171731 --1674 --
NM_004586chrX85040 4785 3989 2102 1516 1199 700 22 ----11344
NM_004593chr32716 234 --1173 --
NM_004600chr121156 619 11566 --1509
NM_004612chr994636 4013 3920 1729 1235 1002 930 801 572 11825 24232 4061 --
NM_004627chr215694 683 667 658 534 ------
NM_004651chrX1334 ------
NM_004655chr17------1272
NM_004666chr631437 1390 28 21348 202 1511 --
NM_004687chr1761877 1768 1544 1524 1496 590 1446 ----
NM_004690chr65728 660 601 313 193 ------
NM_004712chr171494 ------
NM_004719chr1262134 2083 1947 1138 514 374 12152 11904 --
NM_004725chr1061415 1199 1152 1103 1006 389 --1220 --
NM_004726chrX115638 5583 4063 3881 3723 3535 2002 1684 1486 1347 915 15508 13990 --
NM_004730chr561983 1753 1691 716 445 303 --31418 729 673 --
NM_004733chr32602 196 1164 ----
NM_004734chr1322988 2908 ------
NM_004736chr132244 1502 232 --1605 --
NM_004738chr201729 ------
NM_004744chr473945 2987 2748 1527 1490 1312 1000 13536 1783 --
NM_004745chr8127064 6659 6115 5576 5335 2298 2071 1963 1853 1093 856 817 16757 25442 2056 --
NM_004748chr15104015 3949 3922 3460 2742 1396 1124 963 318 23 11652 ----
NM_004760chr742095 1896 1852 298 12374 11956 --
NM_004768chr12906 347 1969 177 --
NM_004772chr521569 1476 --11590 --
NM_004775chr1882280 2077 2003 1992 1709 1698 891 448 ------
NM_004779chr551285 1220 1115 843 522 1282 ----
NM_004788chr1162747 2680 1869 1682 1007 462 22487 2451 ----
NM_004789chr92290 71 ------
NM_004808chr10103334 1269 584 443 414 388 286 211 156 40 ------
NM_004821chr51681 ------
NM_004824chr621357 900 ------
NM_004842chr621773 1225 ----1366
NM_004849chr641603 1149 355 328 21567 1211 ----
NM_004857chr14124101 4094 3242 3121 1828 1653 1431 630 539 299 69 61 14360 --13681
NM_004860chr172572 551 ------
NM_004866chr5134852 3861 3801 3465 3324 3277 3054 1609 1152 1057 994 508 322 23974 1601 ----
NM_004871chr1734376 3210 2748 14053 24342 4154 12946
NM_004873chr1483062 2740 2617 1988 1261 580 251 109 12898 ----
NM_004890chr171225 ------
NM_004891chr21221 ------
NM_004896chr1051538 1486 1059 517 149 --1327 --
NM_004897chr102601 111 1618 1881 --
NM_004904chr7106413 6341 5634 4828 4706 4211 4171 2281 1906 70 24100 1831 36559 6323 6305 --
NM_004912chr731734 1139 665 --11120 --
NM_004921chr172491 2378 2368 2285 2248 2233 65 22144 263 ----
NM_004954chr111268 ------
NM_004956chr7114029 3952 3721 1753 1194 1045 549 437 425 99 27 1182 21518 563 --
NM_004964chr1191 ------
NM_004966chr101691 ------
NM_004985chr1294367 4265 4198 3772 3662 3248 2868 1674 952 23479 1771 179 --
NM_004992chrX67115 5147 2933 2213 1534 978 16813 16197 --
NM_004992chrX67115 5147 2933 2213 1534 978 16813 16197 --
NM_004998chr151265 ------
NM_004999chr651631 1330 1196 1130 1017 ----1605
NM_005045chr75945 395 355 343 186 ------
NM_005056chr1265606 5377 4779 4249 3869 1533 ------
NM_005063chr1063554 3513 3225 2611 1127 1021 23145 513 --13176
NM_005065chr1495037 3911 3904 3729 3588 3358 1325 941 569 --1913 168
NM_005066chr14761 575 129 75 1835 ----
NM_005078chr1521561 526 --1541 --
NM_005079chr883238 2986 2802 2745 2525 1157 677 466 1402 11254 --
NM_005086chr122177 156 11195 --11120
NM_005093chr2065341 4126 3507 1535 975 887 1717 --14318
NM_005099chr151316 1090 945 315 304 ------
NM_005105chr12549 262 144 --1127
NM_005116chr2054574 4523 4504 3339 771 24260 415 34402 2934 1029 --
NM_005121chr1783641 3421 2666 2329 1137 983 803 97 12459 1277 --
NM_005126chr332259 2174 474 32269 2196 425 ----
NM_005130chr42220 143 ------
NM_005151chr1881895 1846 1726 914 889 379 115 47 12097 1538 --
NM_005154chr15----1588 --
NM_005156chr9145319 5144 5010 4866 4726 4719 4366 3781 1881 1135 1033 793 658 363 24109 3273 11484 --
NM_005160chr2276433 5649 5576 5471 5145 4344 171 36358 6251 2153 35352 1393 1262 --
NM_005163chr144929 903 656 71 ----1100
NM_005164chr1262583 2394 2320 2159 1767 1699 12596 2545 367 --
NM_005168chr271736 1680 1621 1265 1171 465 326 ----1125
NM_005180chr1051675 1382 1268 1132 1056 ------
NM_005181chr82685 250 1212 --1644
NM_005188chr11108113 7418 7224 6297 6067 3023 2629 2085 1028 310 37695 6113 1182 --1216
NM_005197chr1496085 5917 5354 5348 5315 4469 1353 1071 39 11006 ----
NM_005227chr11505 ------
NM_005233chr342063 1948 424 204 ------
NM_005235chr2147663 7299 7214 7011 6785 6213 5931 5913 5438 4884 2789 2174 1105 685 17641 17249 --
NM_005238chr1173556 3302 2727 1347 948 671 598 ------
NM_005239chr2142054 1778 804 507 ----1556
NM_005242chr521304 1280 1999 21446 1267 --
NM_005243chr221134 ------
NM_005256chr112792 265 ------
NM_005257chr1841426 890 443 328 21412 1325 1995 --
NM_005259chr231421 948 173 ------
NM_005277chr451899 1821 1714 1433 660 130 ----
NM_005284chr61430 ------
NM_005296chrX3327 309 121 --1886 1270
NM_005311chr782816 2311 2146 2070 2049 1786 928 458 12294 22041 660 --
NM_005316chr112859 722 ----1967
NM_005324chr1741975 676 513 24 11542 21335 102 --
NM_005329chr1652363 2230 1984 1503 858 12113 11851 --
NM_005339chr463647 3573 3499 2849 2653 1187 22731 1512 14219 1506
NM_005342chrX41805 336 324 305 173 22799 923 --
NM_005347chr921411 656 --21524 448 --
NM_005358chr1371722 1584 732 556 343 224 175 1381 2709 412 --
NM_005359chr1896342 4794 4359 2548 2447 1847 855 777 704 ----14522
NM_005375chr66846 764 380 326 301 145 21105 820 --1986
NM_005378chr2----1772 --
NM_005388chr961502 1480 1330 1313 397 378 ------
NM_005393chrX1244 ------
NM_005399chr154165 1372 986 944 52 11189 13573 1155
NM_005406chr1821631 995 ------
NM_005412chr121568 ------
NM_005433chr1852446 1007 851 465 206 ------
NM_005436chr1083532 3198 1589 1148 880 278 103 88 2949 812 1272 --
NM_005442chr33264 231 194 ------
NM_005455chr171763 1676 1544 1234 337 282 258 ------
NM_005474chr1711568 ------
NM_005475chr12----13205 --
NM_005494chr74610 431 151 123 151 ----
NM_005496chr35988 865 719 140 58 ------
NM_005497chr17115766 4867 3729 2406 2279 1960 1411 1405 1198 234 86 --24671 351 --
NM_005502chr962787 2696 2097 1051 1017 904 11233 ----
NM_005503chr151237 ------
NM_005504chr12146581 6550 6519 5955 5045 4893 2640 2457 2269 2152 1775 1654 1054 600 14041 --173
NM_005506chr442397 2151 927 241 12315 ----
NM_005509chr541861 1822 1508 1363 1630 --1452
NM_005513chr371487 1385 1304 517 423 238 75 ------
NM_005519chr101181 ------
NM_005520chr51280 ------
NM_005526chr81277 ------
NM_005578chr3115092 4996 4358 4124 3947 3939 3563 3555 1858 1489 750 14457 24553 344 --
NM_005593chr121159 ------
NM_005596chr9126080 6044 5440 4402 4319 4288 2392 2379 1812 1759 1576 437 ------
NM_005610chr11588 --1772 --
NM_005611chr1631340 1325 428 ------
NM_005618chr62568 473 1595 ----
NM_005623chr171154 ------
NM_005638chrX51592 1555 1246 1194 475 11447 ----
NM_005639chr1221673 333 2734 544 2317 27 --
NM_005647chrX43429 3313 2154 1000 --12726 --
NM_005648chr8142 ------
NM_005665chr154314 1854 1200 669 406 23757 451 ----
NM_005668chr584610 4490 3904 3732 2968 1543 1325 831 11276 --13911
NM_005669chr592255 2134 1744 1649 1612 1471 877 345 232 12140 1435 --
NM_005694chr3197 ------
NM_005715chr652476 2347 1833 328 168 ----11056
NM_005717chr121178 899 ------
NM_005721chr231080 1013 1000 2988 214 --1431
NM_005722chr262105 1965 1957 772 453 264 12293 ----
NM_005738chr751949 1659 626 506 233 ----11639
NM_005746chr792643 2600 2474 2428 2356 886 367 178 101 1400 12247 11916
NM_005748chr1262634 1266 1196 1159 751 271 21367 386 1797 --
NM_005749chr174679 565 232 155 ------
NM_005751chr71471 ------
NM_005756chrX21498 457 ------
NM_005759chr264019 3992 3227 1813 1694 198 1698 14764 --
NM_005779chr553615 3511 3237 2631 720 169 23338 1452 --
NM_005795chr272698 2610 2523 2226 1214 1086 624 ------
NM_005797chr1131341 380 52 --11203 --
NM_005802chr95808 780 641 167 92 ------
NM_005808chr363216 3149 2884 2748 851 216 23471 2354 12947 13083
NM_005813chr232457 452 254 12350 22585 2199 11819
NM_005819chr153449 3324 833 483 299 13261 22613 1305 --
NM_005822chr652353 2254 833 492 235 21866 507 --11939
NM_005828chr1765056 4559 1888 486 284 42 --23634 1862 --
NM_005840chrX107690 6961 5829 5809 5310 5145 3068 2116 654 631 27517 644 15390 --
NM_005841chr411075 ------
NM_005843chr271980 1907 1767 1482 1248 750 552 ----11669
NM_005845chr1351627 1545 1329 1079 37 21142 127 11311 --
NM_005850chr12185 159 ------
NM_005868chr752072 1628 921 734 107 --1849 --
NM_005871chr102853 83 --1945 1159
NM_005885chr531205 1156 1069 ----1116
NM_005898chr1152904 2727 1955 469 86 1315 ----
NM_005899chr174634 475 326 154 --11299 --
NM_005901chr18138600 8037 7536 7188 6666 6339 5382 2774 2727 2253 1688 1649 1060 28716 167 16256 --
NM_005903chr5105065 4915 4839 4164 4081 3516 2004 982 165 141 44615 3364 521 316 15071 --
NM_005906chr671458 1333 1246 530 353 244 176 1478 11638 1264
NM_005908chr43510 489 46 ----1127
NM_005909chr584238 3774 3495 2617 1284 520 259 197 34273 3704 3096 2822 310 --
NM_005924chr731134 779 125 --1425 --
NM_005930chr143731 322 132 ------
NM_005935chr475045 3994 3794 3289 495 133 76 15118 13591 --
NM_005941chr863277 1561 1513 1251 810 759 21527 1286 ----
NM_005955chr1165404 5272 5117 4646 4604 4500 4071 3781 2015 1582 1240 927 899 554 452 134 15011 ----
NM_005962chr1032135 889 157 --12207 --
NM_005962chr1032135 889 157 --12207 --
NM_005966chr212250 22190 572 1315 --
NM_005985chr201736 ------
NM_005994chr17189 ------
NM_005999chr141226 1198 1154 74 ------
NM_006007chr954478 3820 3429 785 387 13588 33170 1644 536 --
NM_006011chr1564198 4148 3987 3237 3217 180 11564 ----
NM_006022chr1311056 ------
NM_006036chr252453 1952 1827 1640 402 1569 --12447
NM_006047chr2062579 1094 660 598 254 76 --12632 --
NM_006055chr273178 2744 2412 2249 2241 1096 584 ----13200
NM_006064chrX1105 ------
NM_006079chr61793 ------
NM_006080chr762922 2214 2110 1037 633 316 21948 1163 ----
NM_006089chrX31661 233 69 ----1603
NM_006094chr892440 2406 2316 1967 1709 1540 952 640 359 ------
NM_006095chr494261 4003 3573 1459 1300 973 938 823 748 11407 41666 679 500 217 --
NM_006106chr1162908 2820 1040 701 549 388 ------
NM_006113chr172117 1900 1651 1599 665 647 104 2472 402 ----
NM_006139chr232841 2771 1165 21145 812 --12465
NM_006141chr1642529 2515 2287 568 11966 ----
NM_006154chr15102722 2412 2264 1800 995 852 715 430 395 193 12835 1648 1140
NM_006158chr831446 1263 438 ----11357
NM_006166chr1252568 1992 1880 794 508 --1500 --
NM_006167chr851997 809 644 550 279 ------
NM_006203chr5105224 3539 2104 1918 1534 965 893 352 222 113 ----23732 3508
NM_006206chr462650 2524 2272 2190 1155 542 --12384 --
NM_006209chr83356 103 65 ------
NM_006212chr1104989 4956 4705 4099 3822 3800 3731 1752 1602 1323 --14906 15383
NM_006221chr191118 ------
NM_006226chr21146 ------
NM_006237chr1332265 1534 51 --1116 11864
NM_006241chr352292 2267 921 527 460 ----11557
NM_006243chr131086 1064 959 ------
NM_006246chr1431339 995 411 1864 11177 --
NM_006251chr583295 2287 2192 1276 667 378 112 72 22550 1089 ----
NM_006252chr1167477 7256 7107 6417 6360 6042 4748 4717 2558 2161 1921 1801 1380 1371 1334 825 37616 5778 3021 1544 15464
NM_006256chr141991 1073 717 68 12594 11089 --
NM_006257chr10----1978 --
NM_006264chr43393 172 26 ------
NM_006267chr261906 1740 1470 423 341 207 1372 ----
NM_006275chr205968 706 550 356 318 ------
NM_006283chr8124916 4634 4497 3884 3790 3756 3667 1921 1677 1199 905 720 31788 1765 1377 2748 36 --
NM_006290chr631634 1576 1538 ----11869
NM_006298chr64628 540 522 479 ------
NM_006300chr19102335 2310 2301 2106 1735 1690 1500 964 369 213 1834 ----
NM_006306chrX75340 4135 3979 1983 1776 588 535 2887 68 ----
NM_006313chr1251578 1476 1211 510 219 21694 1197 11085 11501
NM_006315chr4104053 3696 3425 2869 2835 2799 1132 1055 836 567 --24329 4279 --
NM_006335chr131034 941 826 --1214 --
NM_006343chr21372 1394 186 1421
NM_006345chr411050 ----1890
NM_006359chrX32315 2251 1636 ----32420 2198 535
NM_006375chrX41382 1332 1248 325 --1281 --
NM_006379chr752156 1948 669 488 157 ------
NM_006380chr1784317 3943 3631 3139 3019 1686 1656 1343 11166 1694 --
NM_006391chr111229 ------
NM_006393chr1074302 3616 3020 758 612 289 182 --13095 --
NM_006403chr661717 1404 1369 477 370 309 ------
NM_006420chr20103311 3206 2999 2976 2815 2549 2168 2118 589 180 --1776 12201
NM_006434chr1063243 2830 2341 2169 828 228 --12367 --
NM_006449chr242093 1963 1542 133 1498 187 --
NM_006457chr4133933 3825 3394 3300 3021 2989 2700 2579 1642 424 216 194 162 12607 13836 12562
NM_006464chr234609 1716 1061 13642 --11102
NM_006467chr572315 2268 2226 1708 1599 70 50 --12159 --
NM_006482chr1292853 2682 2452 1379 837 312 250 113 92 --33538 3185 3129 --
NM_006486chr221170 --1111 --
NM_006504chr1062627 1016 1008 775 753 439 11923 12683 --
NM_006526chr2062074 1808 1686 816 672 349 21836 1527 ----
NM_006529chr431388 1358 139 ------
NM_006534chr2093088 2924 2491 1263 1246 667 580 546 133 1150 ----
NM_006538chr283898 3310 3039 2647 1171 1154 792 657 --34063 3580 885 --
NM_006540chr85994 547 337 323 82 ------
NM_006544chr14125701 4760 4692 4430 3748 1618 1530 1313 1070 763 703 424 24705 4446 ----
NM_006547chr731913 1407 551 11880 11997 11860
NM_006548chr331383 1159 1144 ------
NM_006549chr1262897 2858 558 261 133 65 ----22229 426
NM_006561chr10106165 5064 4928 4596 4478 1384 1161 666 160 74 ------
NM_006565chr1611162 ----1795
NM_006571chr81320 ------
NM_006572chr1783509 3217 3195 2347 1136 1049 1027 1006 43384 3314 2360 1083 12175 22532 878
NM_006575chr1461319 1209 1090 937 916 309 ------
NM_006577chr261313 1044 819 378 364 39 1125 ----
NM_006587chr431429 1260 638 1598 ----
NM_006595chr1131823 1413 1283 21678 695 --11315
NM_006599chr16168241 8168 8016 7588 7060 6847 6840 6578 6520 5743 5377 3247 2556 2179 2001 1973 27472 242 ----
NM_006601chr121929 1957 2714 111 --
NM_006603chrX52050 1857 776 595 433 --1328 --
NM_006609chr26878 612 448 430 310 127 12101 11160 --
NM_006614chr373297 3090 2268 1251 583 304 253 --21080 568 --
NM_006625chr131014 459 171 ----1867
NM_006625chr131014 459 171 ----1867
NM_006625chr131014 459 171 ----1867
NM_006626chr922078 1881 42259 2060 1841 1731 2300 75 --
NM_006628chr1564667 4070 1273 938 565 394 22829 98 ----
NM_006646chr1332317 282 161 --1658 --
NM_006654chr1284819 4059 4040 3677 1807 1047 1002 971 2745 669 1820 --
NM_006667chrX51123 770 313 48 34 1802 ----
NM_006695chr171334 ------
NM_006699chr142568 2529 2184 1665 --21946 391 --
NM_006706chr51531 --2333 128 1838
NM_006710chr23384 217 75 1865 1922 --
NM_006717chr993311 2754 2732 2415 1323 888 716 177 51 ----12859
NM_006721chr101305 ------
NM_006727chr53530 471 87 172 ----
NM_006729chrX105542 4617 4119 2229 1829 738 635 248 105 54 --1147 --
NM_006732chr1912070 ------
NM_006738chr1584590 4498 4437 3657 1604 657 626 372 11569 33479 3217 1622 --
NM_006745chr42941 916 --11086 --
NM_006749chr811105 ------
NM_006750chr1697839 6690 5095 2851 2572 2427 2120 1642 565 25582 897 27935 6947 --
NM_006751chr271070 900 831 276 156 143 35 1165 ----
NM_006764chr32472 48 --190 --
NM_006775chr673015 2784 2753 2665 991 861 797 ----12314
NM_006777chrX62739 2685 2346 2221 2109 1049 11022 ----
NM_006785chr183833 465 337 --11391 11899
NM_006805chr561436 1375 1216 589 432 166 11676 ----
NM_006827chr1442657 663 625 422 --23135 296 --
NM_006857chr25352 243 216 72 65 ------
NM_006873chr293204 1288 1139 1009 969 859 770 585 169 ------
NM_006874chr441265 479 394 58 11045 1863 --
NM_006884chr352015 1814 1538 518 460 21846 1387 ----
NM_006888chr1431209 1101 274 23389 2227 12458 13096
NM_006912chr13962 634 145 ----11658
NM_006915chrX22274 1883 32123 909 664 --1582
NM_006918chr11125891 5841 5793 5745 5591 4810 4778 3836 2010 1422 119 54 24967 3571 35827 1958 340 --
NM_006920chr251620 725 377 362 62 ------
NM_006922chr262587 2109 2013 1719 607 384 ------
NM_006924chr1774290 4105 3390 3010 2780 1676 185 --12892 --
NM_006947chr431442 1175 234 ------
NM_006948chr2142439 1992 460 25 12251 1880 1777
NM_006965chr1821097 1025 --11229 1484
NM_006981chr921199 380 11924 12412 1976
NM_006990chr11179 ------
NM_006996chr151385 1189 558 535 104 ------
NM_007006chr1673501 3362 3269 3078 2570 2251 702 13572 12660 --
NM_007007chr12144814 4742 4268 4228 4073 3434 3397 3220 3081 3072 2960 1715 560 276 3840 461 212 11109 --
NM_007010chr1721433 1219 1109 --11192
NM_007013chr8135 --1757 1953
NM_007034chr131025 411 206 ------
NM_007035chr124683 329 135 123 2749 713 ----
NM_007038chr21136050 5994 5640 5233 4948 4216 4067 2012 1769 1093 1051 869 733 1279 25525 1037 15616
NM_007042chr342690 2443 1777 438 ----1322
NM_007043chr1232050 168 78 ----1287
NM_007078chr1032415 2255 444 --21222 171 --
NM_007106chr1332670 2644 207 ----2996 848
NM_007107chr321911 912 21887 938 21878 146 --
NM_007114chr353014 2281 1139 980 42 33032 389 188 --12213
NM_007118chr51240 ------
NM_007124chr662006 1535 1288 757 732 277 1660 31817 549 259 --
NM_007125chrY51411 1128 899 501 321 11450 ----
NM_007146chr1752065 652 521 505 135 --12764 --
NM_007159chr351729 700 584 548 332 11439 ----
NM_007166chr1151471 1396 1194 382 317 --2541 339 --
NM_007172chr2232458 2327 619 43147 1231 1028 223 32907 856 501 --
NM_007173chr1162414 2195 938 899 852 364 2281 177 31778 550 517 --
NM_007174chr1242144 1951 1806 479 --11912 --
NM_007175chr843523 3391 3294 2546 32624 499 350 ----
NM_007187chr1331031 1009 690 ----1124
NM_007192chr146942 344 325 138 112 78 198 1978 --
NM_007195chr1853361 3070 2867 1338 827 12330 ----
NM_007197chr123984 787 660 ----1333
NM_007200chr1584590 4498 4437 3657 1604 657 626 372 11569 33479 3217 1622 --
NM_007203chr94903 525 512 75 --21499 1469 --
NM_007204chr12559 99 ----1527
NM_007212chr152289 1941 1795 536 202 1764 --11922
NM_007220chrX103384 3158 1928 1594 1401 771 646 590 116 24 ----194
NM_007231chrX51791 884 379 286 71 22011 439 1574 --
NM_007236chr1542074 1647 547 34 ------
NM_007246chr41812 --158 --
NM_007249chr13119387 9061 8990 8903 6931 3413 2817 2384 1225 1105 646 38541 6790 3158 19344 27020 865
NM_007287chr363138 3091 2112 1175 712 454 --12794 --
NM_007288chr363138 3091 2112 1175 712 454 --12794 --
NM_007289chr363138 3091 2112 1175 712 454 --12794 --
NM_007327chr91235 ------
NM_007345chr1832322 916 503 11629 ----
NM_007347chr1553160 2961 1080 626 425 13195 13041 --
NM_007358chr162041 1987 1857 1259 723 709 11458 21564 376 --
NM_007361chr143556 514 189 ------
NM_007372chr171740 ------
NM_007375chr172768 2739 2691 2452 2219 1799 141 --11726 --
NM_012064chr1221096 890 ------
NM_012081chr553558 2963 1078 937 167 ------
NM_012089chr141506 1492 1232 244 1105 ----
NM_012093chr131236 880 816 --1192 --
NM_012095chr1033527 733 613 --2818 107 --
NM_012096chr3103508 3270 3091 997 843 681 419 268 120 112 12509 --12801
NM_012097chr231712 1647 443 21483 146 ----
NM_012120chr672963 2861 2557 2350 1985 776 756 1383 12956 --
NM_012124chr113298 288 114 ------
NM_012129chr752537 2467 2130 585 363 --21683 1669 --
NM_012137chr132787 978 297 ------
NM_012141chr1383986 3975 3286 2995 1552 1471 1332 469 23387 110 --14057
NM_012158chr133448 357 62 --11737 --
NM_012164chr9137445 7204 6813 6736 6381 5989 5351 2878 2622 1700 897 268 231 35780 5108 1448 ----
NM_012177chr62566 472 ------
NM_012193chr1174463 4257 4098 1812 1324 760 53 24356 619 --13828
NM_012199chr174283 4035 4004 3351 3234 1129 998 --14514 1923
NM_012207chr106817 786 295 178 130 82 ------
NM_012214chr2105380 5296 5254 4828 4640 4480 3885 1809 1142 692 15855 24676 169 16394
NM_012215chr1051705 1605 1318 1205 335 --1622 --
NM_012233chr22949 814 ------
NM_012238chr1081544 1505 1368 1301 665 518 420 281 11779 ----
NM_012250chr113969 905 563 ------
NM_012255chr203402 114 55 ------
NM_012259chr611366 1128 --11087
NM_012262chr1145190 5088 4203 3551 2033 1800 1071 937 787 649 511 380 345 193 --43438 3199 983 768 --
NM_012266chr921161 1123 ------
NM_012281chr762001 1821 966 648 450 176 ------
NM_012286chrX1624 --1399 1535
NM_012287chr374120 3726 3351 3180 3127 2899 558 1899 ----
NM_012290chr261494 1363 579 346 303 167 --1467 171
NM_012297chr462647 2397 2105 1788 862 586 ------
NM_012307chr183852 755 253 ------
NM_012309chr1144328 3095 1872 1508 --24364 536 --
NM_012316chr165610 5435 3530 1164 938 884 ------
NM_012323chr2211582 ------
NM_012325chr2051669 1417 1266 612 410 --11360 1470
NM_012326chr2------1336
NM_012329chr17----11488 --
NM_012330chr1061601 1148 632 484 412 115 ------
NM_012334chr573579 3279 3248 1649 1209 889 787 24271 2989 14480 --
NM_012338chr741208 1199 1189 300 11171 ----
NM_012343chr53703 420 250 21016 801 ----
NM_012345chr1361950 1652 1583 1565 1476 254 --1229 --
NM_012347chr6102984 2928 2829 2659 2550 2314 2288 669 551 424 ------
NM_012382chr574102 3935 1673 1603 756 503 418 2901 24 1651 13078
NM_012388chr1583011 2889 2640 2516 2217 1943 1931 41 ------
NM_012395chr753347 2340 843 659 387 --1206 --
NM_012397chr18101712 1675 1624 1310 1161 700 600 554 364 108 ----1629
NM_012419chr62637 443 --1259 --
NM_012428chr151881 ------
NM_012431chr773302 3253 1241 1202 1085 884 42 1161 ----
NM_012443chr103860 810 258 178 ----
NM_012449chr7----170 --
NM_012464chr462939 2874 2792 2677 2416 408 1194 ----
NM_012465chr1083363 3218 3006 2822 1292 1228 717 105 1151 1909 --
NM_012474chr11102 ------
NM_012479chr752251 1966 983 899 597 --21982 1048 --
NM_012484chr53736 97 82 171 --1726
NM_013229chr12102765 2678 2663 2652 2253 2035 744 520 357 340 ------
NM_013230chrY31747 1382 380 --11271 1618
NM_013231chr1484049 3617 2833 2780 2757 1420 1214 929 190 24117 113 1122
NM_013235chr5127 ------
NM_013249chr113339 202 147 ------
NM_013255chr7208866 8402 8354 6497 6312 5831 5814 5563 5528 3198 2580 2445 2396 2213 2015 1264 1081 936 417 391 1944 12731 13418
NM_013257chr892216 2207 2067 912 493 462 171 141 65 ------
NM_013261chr432563 1103 1081 11288 ----
NM_013262chr631394 1135 968 --11305 --
NM_013269chr1234371 3203 1665 23367 2746 ----
NM_013278chr16172 ------
NM_013281chr2041516 258 236 128 ------
NM_013283chr53808 643 607 1269 ----
NM_013302chr1684486 4171 1300 858 839 462 215 101 11520 ----
NM_013320chr12----1144 --
NM_013341chr232529 2491 136 3958 411 319 ----
NM_013365chr221825 ------
NM_013374chr342809 1104 1036 842 32634 289 169 ----
NM_013386chr191821 1510 1467 1342 1311 1200 1151 630 105 21353 699 ----
NM_013390chr931805 269 67 --1211 1140
NM_013423chrX41156 990 845 312 --1950 --
NM_013427chrX41156 990 845 312 --1950 --
NM_013437chr871041 1033 936 488 477 470 241 1307 11341 --
NM_013438chr9121394 1271 597 509 498 472 422 370 301 226 172 131 ------
NM_013441chr11429 --1561 --
NM_013444chrX51025 898 435 357 142 ------
NM_013446chr741411 1044 974 300 --11082 --
NM_013450chr271089 1056 1028 980 790 417 71 ------
NM_013943chr1143252 3197 3040 2963 2892 1323 1181 873 809 777 724 633 439 94 ------
NM_013986chr221134 ------
NM_013989chr14125133 3820 3690 3454 3445 1850 1691 938 877 777 588 410 11433 ----
NM_013995chrX82590 2430 2347 1882 909 752 604 276 1511 12500 --
NM_014011chr232615 2333 352 --2715 295 1272
NM_014021chr193201 2990 2621 2528 2386 2318 1007 564 197 23509 2766 ----
NM_014023chr1052706 2655 596 315 182 ------
NM_014026chr11194 ------
NM_014028chr642705 829 773 647 --22104 237 1291
NM_014034chr631489 1013 215 --21295 588 1148
NM_014035chr571429 1220 1147 1030 577 560 337 ------
NM_014043chr321127 89 ------
NM_014048chr16115298 5203 4566 4138 4011 3609 1942 1516 909 901 783 11834 25113 4664 --
NM_014065chr32151 30 ------
NM_014106chr1572442 2188 2072 1104 742 232 73 32301 2101 422 1118 --
NM_014109chr821018 132 ------
NM_014112chr885447 3947 2204 1627 998 973 808 408 15166 12008 --
NM_014117chr1662419 2193 390 336 299 158 --32685 2172 1808 --
NM_014141chr764920 4773 4266 976 547 378 11201 ----
NM_014155chr11147110 6789 6699 6537 6332 6279 6084 6017 4763 4756 2918 2259 1896 742 --15936 --
NM_014157chr1653894 3757 2541 852 246 --1760 --
NM_014160chr331413 444 431 ------
NM_014178chr144404 374 171 106 ------
NM_014181chr272797 2727 2607 1975 1890 415 363 ------
NM_014184chr12159 141 ------
NM_014210chr17164 ----1235
NM_014213chr2----2192 176 --
NM_014240chr353435 2820 1505 1361 189 ------
NM_014243chr431783 1503 1333 ------
NM_014253chrX72427 2369 2199 2025 1613 669 154 22330 391 12390 --
NM_014264chr43501 444 409 ------
NM_014267chr112792 579 ----1354
NM_014268chr1841252 424 389 377 11394 ----
NM_014283chr1--1424 --21105 70
NM_014294chr851169 1122 1077 907 136 ----21110 153
NM_014305chr132657 629 ------
NM_014309chr2284619 3813 3614 1549 1029 274 224 174 --14637 --
NM_014315chr141178 ------
NM_014319chr1261737 1648 1361 486 292 271 ----11921
NM_014325chr123733 453 107 --21896 472 --
NM_014326chr15----11229 --
NM_014333chr1152745 2468 1973 1782 210 11859 ----
NM_014342chr113976 948 267 --11442 --
NM_014350chr531056 958 367 3167 150 40 11123 --
NM_014372chr12241 197 --2419 302 --
NM_014382chr361762 1711 1240 483 436 23 ------
NM_014390chr71494 ------
NM_014392chr451535 1338 435 330 190 ------
NM_014393chr84355 343 274 247 1529 1579 --
NM_014399chr73774 277 75 3907 825 191 ----
NM_014415chr361453 478 435 367 332 61 1247 11459 --
NM_014421chr442075 2027 242 48 11989 ----
NM_014423chr5145530 5499 5488 5442 5358 5286 5085 5063 3954 3586 2265 1710 793 747 35048 880 539 --13749
NM_014454chr621076 231 ------
NM_014455chr12447 376 ------
NM_014458chr151432 1330 1251 1028 104 ------
NM_014481chrX----2331 306 --
NM_014497chr2160 ------
NM_014504chr752095 555 489 111 23 2192 29 ----
NM_014521chr281822 1418 1191 717 455 429 409 224 ------
NM_014552chr241531 1472 961 171 ------
NM_014554chr1242343 1977 1851 832 11461 ----
NM_014574chr1451347 1191 1174 1079 190 --1223 --
NM_014577chr224920 634 611 588 ------
NM_014584chr1461674 595 560 532 365 313 11429 ----
NM_014586chr21114670 4541 4474 4446 4334 4030 3997 3379 3268 3084 1645 --14739 13884
NM_014606chr431363 1230 24 ------
NM_014607chr241968 1642 405 282 ------
NM_014612chr911003 1407 1380 1239
NM_014616chr351359 956 903 356 283 12135 ----
NM_014629chr831363 1148 409 --1121 --
NM_014630chr1573618 3520 3125 3008 2973 2670 791 22840 812 ----
NM_014636chr964299 4265 3750 2972 1587 539 ------
NM_014647chr1621567 535 1221 2791 238 --
NM_014663chr11396 ------
NM_014666chr51166 --1970 --
NM_014667chr341846 739 591 123 ----1977
NM_014669chr161124 ------
NM_014670chr22586 265 --11008 --
NM_014671chr791569 1528 1478 1366 1354 1199 1107 557 488 ------
NM_014674chr3103913 3747 3054 2879 1572 981 843 836 737 576 ------
NM_014675chr11452 ------
NM_014676chr151445 1438 1216 527 408 ------
NM_014677chr8--11283 --11267
NM_014682chr882329 2232 2106 2059 563 370 353 107 21720 765 ----
NM_014701chr1583132 2838 2099 1266 719 644 107 94 --23365 2857 --
NM_014702chr6103427 3368 2989 2816 2520 2455 1174 739 347 168 32534 2317 771 23079 495 --
NM_014705chr772055 1977 1712 1585 1449 674 228 ------
NM_014710chrX4706 203 193 153 2955 310 --1234
NM_014711chr1662064 1435 645 295 174 119 ------
NM_014719chr71780 --11112 --
NM_014721chr6207366 7172 6275 6180 5735 5311 5252 4763 2647 2497 2266 2253 2149 1629 1587 1417 1233 1191 1064 466 --26966 5055 17404
NM_014729chr832035 898 808 2595 130 ----
NM_014730chr1264188 3510 3278 1786 295 76 31796 1701 801 ----
NM_014730chr1264188 3510 3278 1786 295 76 31796 1701 801 ----
NM_014733chr561968 1813 828 506 437 268 ------
NM_014735chrX11623 --42009 793 743 252 --
NM_014736chr151108 ----1304
NM_014740chr17164 ------
NM_014743chr462675 2507 2254 2201 2095 407 2889 219 ----
NM_014746chr2104091 3562 3285 3103 2843 1459 712 568 495 469 ----24150 1517
NM_014747chr152154 1105 1083 1054 219 --25801 784 --
NM_014750chr142144 87 ------
NM_014752chr1141938 1426 585 334 --21542 1461 --
NM_014755chr241043 511 438 344 23267 250 12595 --
NM_014765chr182230 898 856 727 621 607 189 152 ------
NM_014776chr1282814 2771 2520 2446 2314 1933 412 204 ------
NM_014787chr162274 2255 2224 1880 1811 480 ----12686
NM_014795chr251253 1124 1094 399 267 ------
NM_014802chr1211133 --1896 --
NM_014803chr1062717 1796 1024 953 446 134 2997 170 11086 --
NM_014806chr91463 ------
NM_014812chr161983 1888 1770 1409 1219 437 11717 1725 --
NM_014819chr542347 2198 872 822 12115 12368 --
NM_014820chr371870 1857 1765 1567 381 128 106 ------
NM_014824chr1132006 1817 806 21800 1591 1799 --
NM_014826chr1103822 3619 3356 3261 3156 3057 2952 1408 956 701 24039 855 13086 --
NM_014829chr562368 2218 2086 1561 651 609 1297 ----
NM_014832chr1372013 1767 1421 1390 1369 1310 441 ------
NM_014835chr2042047 1939 622 553 ------
NM_014836chr1071956 1578 1355 622 612 368 145 11848 --11549
NM_014838chr2242490 2332 1129 391 --21811 577 --
NM_014840chr1233376 3221 325 23308 3185 2712 230 --
NM_014841chr641343 334 228 22 --1219 --
NM_014847chr11201 ------
NM_014848chr1582624 2247 2159 1008 764 720 476 305 ----2560 341
NM_014860chr252477 1749 983 800 163 --1809 --
NM_014864chr154230 990 704 305 144 --12804 --
NM_014868chr121176 ----196
NM_014872chr951940 755 529 347 166 --1153 --
NM_014873chr184845 4600 4493 3860 1374 838 483 260 13841 24781 952 --
NM_014877chr17157785 7761 7226 6076 5529 5459 5328 5294 4970 4801 2995 1728 372 342 187 1984 15710 --
NM_014890chr31257 ------
NM_014892chr61657 ----1460
NM_014897chr1762635 2203 2193 627 238 77 ------
NM_014899chr593152 3107 2540 2313 2241 2064 485 411 389 22105 1256 ----
NM_014901chr542134 1714 803 119 --1178 12041
NM_014903chr1262373 2220 1554 770 210 64 --11832 --
NM_014904chr1093709 3638 3588 3540 3079 2530 1624 1566 1470 2855 839 11600 13865
NM_014905chr261943 817 338 290 105 74 --11738 --
NM_014906chr1793740 3239 3126 2663 2549 904 749 693 435 11216 ----
NM_014909chr142213 207 --1250 --
NM_014910chr191285 ------
NM_014912chr1073323 3233 3116 2941 2682 2564 2323 ------
NM_014918chr1531638 1543 1253 --21521 1054 --
NM_014920chr663237 2396 1252 1132 286 258 11085 12935 --
NM_014923chr1382234 1771 1485 1437 783 492 479 92 11945 ----
NM_014924chr1452829 2035 786 564 162 ------
NM_014936chr6112851 2779 2764 2366 2260 2214 2122 1085 909 394 312 2622 599 22416 169 --
NM_014939chr182248 193 --1513 170
NM_014947chr173055 2862 2402 1086 803 687 266 --12743 --
NM_014952chr1511995 ------
NM_014953chr1363999 3944 3690 527 349 135 13882 11638 --
NM_014962chr2072851 2650 2382 2335 1855 910 529 1356 1633 --
NM_014982chr1484613 3396 3328 1954 1757 1422 1349 749 --23642 1984 --
NM_014988chr452752 2282 571 470 100 12267 1208 --
NM_014990chr1451324 1135 888 859 841 1290 ----
NM_014991chr493207 3040 2916 2662 2371 1217 938 757 347 ------
NM_014999chr1251552 1415 407 196 121 --11141 --
NM_015000chr1242666 2276 2105 895 ------
NM_015002chr1212222 1571 32071 402 358 --
NM_015008chr373171 2919 2843 2588 2392 662 170 12770 13194 --
NM_015015chr1912026 ------
NM_015020chr1653824 3647 2996 2452 1187 23033 3025 ----
NM_015025chr262735 2194 2091 1712 360 268 11071 ----
NM_015026chr12194722 3929 3848 3781 3478 3316 3285 2989 2942 1876 1759 1711 1688 1335 1304 1162 1142 968 539 14027 ----
NM_015032chr1362124 2029 1069 743 492 155 --1418 --
NM_015042chr1534348 4340 1238 11088 --14177
NM_015045chr1062162 2018 1815 1786 474 252 11840 31986 1588 168 --
NM_015051chr973150 838 693 600 532 395 94 12196 12619 --
NM_015053chr1----12251 --
NM_015055chr1132792 2598 1121 --11806 --
NM_015068chr753954 3488 2721 2505 1088 --23058 219 --
NM_015071chr566555 6155 4255 2097 936 650 11734 --1233
NM_015074chr154604 4322 3711 3023 596 --14880 14363
NM_015076chr684517 4264 3147 2909 1550 1321 555 288 --11088 --
NM_015092chr1684643 4555 4127 3886 1847 1394 1224 964 21171 927 ----
NM_015093chr651624 1433 1251 450 381 11690 ----
NM_015097chr361876 1849 1570 821 525 145 ------
NM_015100chr142068 1548 333 296 --197 --
NM_015101chr142881 2496 2314 499 42549 2535 2111 697 1599 1717
NM_015110chr942294 1778 822 595 1887 ----
NM_015115chr481233 1219 1156 538 411 393 353 206 22674 588 23238 3094 --
NM_015132chr751976 1746 1482 1224 461 ------
NM_015137chr851895 1721 1691 914 784 11021 ----
NM_015138chr1562659 2235 2224 1778 556 151 ------
NM_015141chr372735 2163 1928 752 596 570 543 ----1362
NM_015143chr431417 243 50 11338 --1136
NM_015155chr1052825 2080 560 295 275 ------
NM_015158chr95808 759 663 606 535 --1726 --
NM_015170chr831814 841 821 2413 311 1146 1344
NM_015192chr2042761 2064 757 697 2905 623 32480 2280 568 12880
NM_015199chr341864 1195 1112 655 12344 --12632
NM_015200chr431674 989 818 12353 22400 852 --
NM_015206chr1573524 3321 3155 2893 2816 216 118 12917 --1773
NM_015208chr1893580 3395 3385 2598 2551 1247 1162 828 269 13198 ----
NM_015215chr142710 2228 1124 926 11055 1199 --
NM_015216chr5171 ----1979
NM_015230chr461704 1458 1343 1259 148 137 1758 ----
NM_015233chr1352699 1965 992 618 492 --12523 --
NM_015238chr51272 ------
NM_015247chr16105194 4846 4173 3958 3380 1902 692 612 190 176 34811 4350 4042 ----
NM_015251chr1652225 1613 1476 276 231 11849 ----
NM_015262chr101143 ------
NM_015263chr1551188 980 937 821 246 1273 ----
NM_015265chr262448 2365 2286 884 705 211 11816 12247 --
NM_015269chr11213 ----1615
NM_015271chr4104223 4120 3665 3416 3049 2918 2624 2615 1484 179 ------
NM_015272chr1661318 697 678 566 286 168 ------
NM_015275chr1231925 1437 1429 21832 251 22007 335 11538
NM_015278chr652239 2161 2109 592 476 12658 32741 2590 1213 --
NM_015282chr262959 2947 1914 375 350 130 ------
NM_015285chr1871924 1892 1733 1669 1019 365 29 --12353 --
NM_015286chr1542346 2157 675 628 ------
NM_015288chr5103635 3511 3196 2897 2876 2464 1427 924 432 357 --12977 --
NM_015291chr183419 3032 2779 2417 2198 1160 1041 64 ------
NM_015308chr112842 739 ------
NM_015310chr8138326 7365 6867 5883 5750 3259 3068 2218 2175 2016 1797 1678 1551 36048 5991 5924 28013 5238 --
NM_015313chr1194585 4510 4469 3976 3751 3235 1501 388 342 23010 348 24853 4502 1365
NM_015317chr2102491 2254 1815 1798 1136 963 829 537 171 141 ------
NM_015328chr772163 1947 1241 1016 699 436 271 21228 788 22248 688 --
NM_015336chr1282011 1978 1682 1082 961 850 380 287 22494 1715 ----
NM_015342chr52125 117 ------
NM_015347chr1232345 1013 252 1268 32096 777 598 22720 2679
NM_015349chr692879 2861 2600 2456 2240 1925 926 294 284 31231 1049 379 --12680
NM_015355chr1791968 1591 1247 700 537 501 333 253 142 11992 --11923
NM_015358chr2151250 1223 367 249 29 ------
NM_015361chr23742 367 173 --170 1786
NM_015365chrX84170 3891 3021 2840 2608 1181 1055 1003 23585 2939 2527 183 --
NM_015378chr132215 728 287 ----12375
NM_015385chr1063243 2830 2341 2169 828 228 --12367 --
NM_015387chr231844 1296 801 ------
NM_015393chr473808 3084 2424 1088 961 765 366 13788 ----
NM_015409chr1222048 1833 --12711 1812
NM_015429chr351112 881 271 257 165 ------
NM_015435chr851418 1285 1248 554 544 11392 11410 --
NM_015439chr6----1474 --
NM_015443chr1721364 144 --1619 169
NM_015446chr151364 1176 473 272 33 ------
NM_015455chr5104040 3954 3849 3728 3370 2693 1341 1033 507 239 1132 ----
NM_015458chr8115250 4838 4680 4620 4318 3868 3580 3551 1219 381 280 14882 34858 3510 3281 --
NM_015469chr96724 565 522 492 263 203 195 ----
NM_015488chr221739 1659 ------
NM_015496chr81268 ------
NM_015509chr1211042 ----11589
NM_015520chr342105 2084 937 907 12668 --1841
NM_015530chr21215 ------
NM_015532chr1572566 2235 2189 2131 2106 908 346 1190 22354 1918 --
NM_015534chr141085 925 356 240 --1816 --
NM_015535chr284049 3828 3664 2889 2694 2680 245 229 1473 --1499
NM_015548chr64988 813 131 37 --1139 --
NM_015550chr793499 3286 3054 2946 2342 1000 538 160 34 22419 851 --1631
NM_015554chr1572875 2355 2264 1785 803 200 181 --32182 546 537 --
NM_015555chr641696 1279 353 161 ----1110
NM_015560chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_015564chr583381 2715 2635 2338 2251 775 468 148 1745 ----
NM_015567chr1371054 970 930 852 821 194 33 31087 1046 75 11137 --
NM_015568chr2064051 3766 3751 2917 1638 839 ------
NM_015569chr194843 4202 3833 3505 3158 1809 1128 851 271 54872 3854 3171 292 59 ----
NM_015571chr671921 821 686 577 423 248 204 22484 1913 ----
NM_015576chr342529 1087 655 316 42731 2583 2500 352 ----
NM_015577chr521793 1379 ------
NM_015605chr1051502 466 369 309 197 21412 1351 --1526
NM_015609chr152981 2967 2290 994 836 1453 ----
NM_015635chr941676 1365 271 123 1534 ----
NM_015640chr1145314 4843 4657 4473 3470 3408 1203 1082 951 657 528 360 301 207 13368 ----
NM_015641chr751193 992 805 301 53 ----1199
NM_015646chr1221132 902 --1874 --
NM_015670chr171146 ------
NM_015691chrX52921 523 397 89 28 21963 285 ----
NM_015702chr25330 117 105 45 32 ------
NM_015850chr822191 2168 --22236 1758 --
NM_015866chr141517 999 523 498 --11099 --
NM_015878chr852034 698 448 244 137 --1512 11993
NM_015879chr18138533 8012 8004 7815 7300 6944 6604 5963 2040 1510 1259 1179 267 13089 38220 592 232 11522
NM_015886chr884826 4813 3704 2197 1730 1710 1579 876 75435 4094 3797 2297 621 326 182 ----
NM_015888chr1103320 3071 2410 2115 2089 880 730 565 256 124 53301 2647 2397 1345 212 12638 --
NM_015891chr642079 734 369 161 1225 ----
NM_015895chr61160 ------
NM_015906chr1124493 4120 4014 3831 3441 1815 1600 1424 1254 1017 976 960 ------
NM_015912chr841984 1848 453 411 12317 11825 1896
NM_015913chr11731 ------
NM_015915chr14----1250 --
NM_015933chr3150 ------
NM_015956chr191223 ------
NM_015975chrX41173 296 120 27 --31834 742 509 --
NM_015990chr41791 ------
NM_016002chr11748 3222 65 58 1568 --
NM_016009chr164744 3915 1095 658 504 43 --11263 --
NM_016018chr8112599 2544 2253 2217 2005 1817 626 502 348 186 51 ------
NM_016021chr642892 2806 518 100 32817 2427 226 ----
NM_016028chr11135 ------
NM_016037chr11956 ------
NM_016045chr2051449 1237 1132 237 65 11564 ----
NM_016061chr241456 1092 596 176 11313 21660 1269 11517
NM_016072chr1262307 2286 1871 931 758 271 157 1375 11588
NM_016076chr172900 2301 2062 2043 1102 825 145 --42687 2082 2054 1035 --
NM_016078chr1751121 1061 1029 900 341 --1886 --
NM_016081chr432144 1789 1418 12230 ----
NM_016083chr663271 2922 2827 2688 748 478 --22416 1380 --
NM_016087chr751751 1493 1382 1133 469 11390 ----
NM_016090chr1131030 391 307 --11068 --
NM_016094chr33617 562 555 129 ----
NM_016107chr551152 895 371 335 46 1169 ----
NM_016121chr131152 1038 929 ------
NM_016128chr31343 ------
NM_016131chr262231 1692 1510 787 258 139 --11966 --
NM_016132chr1552421 1198 1124 1055 1030 12124 ----
NM_016162chr122329 290 --1887 --
NM_016169chr1042996 2877 2025 530 ------
NM_016201chr371997 1805 1657 1643 1637 1533 1462 --11468 --
NM_016203chr71122 ------
NM_016205chr43965 926 318 11421 ----
NM_016206chr3178689 8494 7560 7144 6909 6720 6703 6433 6403 6002 3399 3368 2138 942 457 200 193 48185 8166 2681 2191 37877 6417 3586 11057
NM_016217chr663617 3104 2669 1442 1385 823 12941 1223 13160
NM_016226chr121401 ------
NM_016227chr1--1424 --21105 70
NM_016231chr1741574 1475 1392 1380 21741 413 ----
NM_016248chr13103946 3778 3474 3440 3354 2989 2466 975 648 589 12885 21381 33 1257
NM_016252chr22696 66 1722 --1736
NM_016255chr653352 2945 2123 645 308 12839 12174 --
NM_016260chr2206982 6871 6847 6728 6687 6178 6140 6011 5781 2871 2280 1888 1708 1266 1252 1045 958 772 722 159 --46880 5091 2527 917 12840
NM_016262chr6----1564 --
NM_016271chr1842068 1686 767 529 12332 --1677
NM_016277chr641498 1172 582 485 ------
NM_016279chr52529 508 ------
NM_016281chr1241175 1046 846 794 --1925 --
NM_016287chr161724 1591 1459 1295 637 360 --31730 157 68 --
NM_016289chr242283 2260 1720 740 1637 2680 41 12120
NM_016303chrX4399 298 158 60 ------
NM_016308chr141941 1295 528 500 ----11798
NM_016315chr281859 1830 1621 1551 1411 1162 606 597 --11714 --
NM_016316chr2----161 --
NM_016322chr963069 2971 2337 2072 1194 518 22041 29 ----
NM_016351chr71559 ------
NM_016357chr1241168 1087 914 482 ------
NM_016374chr161394 1335 1161 1135 429 362 1383 ----
NM_016374chr161394 1335 1161 1135 429 362 1383 ----
NM_016376chr1784072 3904 3877 3827 3809 3689 2783 541 ------
NM_016377chr621773 1225 ----1366
NM_016395chr1511946 ------
NM_016396chr1582796 2589 1928 1870 993 692 634 96 22424 591 ----
NM_016404chr11141 ------
NM_016410chr92541 239 ------
NM_016418chr2223001 1510 --1307 --
NM_016436chr2062684 2104 1085 1064 958 752 11788 12715 --
NM_016467chr221391 107 ------
NM_016472chr1441496 1256 1248 1069 11049 ----
NM_016475chr1431280 1185 513 ------
NM_016485chr671919 1570 1554 856 738 318 28 --32081 912 687 --
NM_016488chr1241817 1675 1615 1392 11740 ----
NM_016505chr11662 ------
NM_016507chr1742237 1250 1114 82 22611 2098 32537 873 109 12852
NM_016513chr663237 2396 1252 1132 286 258 11085 12935 --
NM_016519chr41499 ------
NM_016530chr1593725 3141 1379 1291 1114 809 487 407 344 1786 3734 693 445 --
NM_016531chr464124 2844 2567 1233 1155 963 --14078 --
NM_016542chrX51480 1186 649 603 159 21645 582 ----
NM_016544chr263949 3936 3570 2787 493 126 --1186 --
NM_016545chr11876 ------
NM_016584chr121259 ------
NM_016613chr492723 2589 2349 2136 1965 556 307 212 44 12706 ----
NM_016617chr1351800 1685 785 82 51 --11634 11538
NM_016620chr131395 1235 414 ------
NM_016626chr1831723 1463 1456 --11579 --
NM_016631chr212236 26 1997 --1772
NM_016656chrX1105 ------
NM_016950chr461485 1222 1181 1112 443 180 1130 ----
NM_016953chr285708 5455 4796 4778 4747 3854 1232 488 13741 15687 --
NM_017409chr12----1567 --
NM_017410chr12195 ------
NM_017412chr84921 528 265 251 ----11132
NM_017415chr563810 3728 3716 1755 1460 1346 --34149 4018 3930 11436
NM_017420chr1443802 2952 541 509 --13009 --
NM_017423chr462243 2078 1664 1467 861 668 ------
NM_017426chr44563 542 501 224 --1458 --
NM_017447chr21134436 4364 4321 3692 3488 3244 3129 1460 1396 1052 540 200 131 13521 --1471
NM_017449chr11604 ------
NM_017455chr151881 ------
NM_017489chr84536 115 55 41 ------
NM_017490chr111268 ------
NM_017520chr132446 212 ------
NM_017548chr372138 1909 1898 1850 1768 1617 780 21732 1500 ----
NM_017551chr1021798 180 --12698 --
NM_017563chr376280 5727 5588 5487 3966 2260 115 25347 5038 14264 --
NM_017582chr131818 1806 577 --168 --
NM_017594chr983256 2966 2917 2053 1102 645 151 114 --23195 2608 --
NM_017599chr124589 438 277 238 21956 1843 11850 --
NM_017607chr192508 29 ------
NM_017610chr1561620 1359 712 263 238 184 --12146 --
NM_017628chr464952 3645 3391 3216 965 464 14171 ----
NM_017632chr4------2403 40
NM_017633chr673926 3565 2772 1563 1349 983 796 23526 2635 ----
NM_017634chr831878 1428 304 ----1356
NM_017637chr9189330 8153 7624 7546 3432 3393 3363 3196 3111 2308 2191 2147 1940 1927 1444 1210 157 120 28958 5775 28456 2339 --
NM_017640chr62901 220 ----1250
NM_017641chr1241143 822 454 402 21103 297 ----
NM_017643chr1752669 2497 1242 612 551 ----22886 222
NM_017644chr3135072 5020 4768 4557 4346 3952 3837 3645 3496 3233 3159 2003 1277 14271 22055 258 --
NM_017650chr7195833 5301 5081 5054 4982 4766 4518 4313 3929 3762 2371 2270 2247 1605 1463 1033 825 648 152 34384 3718 2171 14301 --
NM_017658chr14134619 4504 4436 3648 1846 1691 1666 1508 1483 1040 1020 634 475 44062 1527 1429 819 ----
NM_017669chrX124 ------
NM_017680chr951010 732 387 302 55 ------
NM_017693chr1341485 541 479 374 11066 --11254
NM_017704chr113349 312 284 11017 --1167
NM_017709chr164158 3763 3731 3144 2758 1282 --188 --
NM_017736chr1683129 3071 2771 2371 1932 1149 509 99 12902 22777 1166 --
NM_017737chr152055 1434 673 537 159 11575 21353 594 --
NM_017742chr1861873 1696 1535 1445 1282 79 21901 1685 --1337
NM_017744chr131725 301 122 --1445 --
NM_017754chr674634 4093 3611 3580 3061 1060 345 34935 4189 1484 ----
NM_017762chr1552333 1829 1778 935 434 1735 1623 180
NM_017769chr1422039 1153 32054 977 942 12736 --
NM_017779chr162533 1675 1042 791 605 104 1437 ----
NM_017786chr8----1441 1118
NM_017787chr1062855 2800 1824 1127 808 146 ------
NM_017789chr23855 830 680 1849 1303 --
NM_017813chr8105519 5267 4057 3795 2115 974 708 510 262 123 14711 ----
NM_017831chr1884656 4636 4584 4282 2928 1834 1477 148 24311 3071 --11288
NM_017848chrX74445 3051 1802 1653 1617 1391 372 33334 1590 1443 ----
NM_017849chr252931 2634 2450 2264 862 13111 ----
NM_017867chr4131 ------
NM_017919chr935794 4344 4038 15566 --25477 2185
NM_017922chr141599 --1272 197
NM_017925chr91723 2333 182 21368 274 --
NM_017938chrX72037 2013 1990 1963 1846 778 46 11730 ----
NM_017945chr331352 1081 1069 ------
NM_017952chr273918 3097 2909 1439 1106 586 223 --12799 13121
NM_017953chr11153 ------
NM_017954chr741292 1229 321 119 ------
NM_017958chr283030 2845 2740 2578 2429 406 287 70 1263 ----
NM_017987chr1052242 2063 628 472 192 --1109 1335
NM_018004chr35417 345 303 294 126 ----1148
NM_018009chr121110 ------
NM_018010chr341471 1287 306 103 1528 ----
NM_018011chr131229 ------
NM_018018chr1241820 1525 378 267 21593 66 ----
NM_018025chr19192 ------
NM_018030chr184986 881 220 133 1700 ----
NM_018046chr571914 1822 1715 1619 650 623 616 ------
NM_018056chr11124 ------
NM_018060chr11365 ------
NM_018061chr141469 1193 228 119 21404 1089 ----
NM_018070chr11239 ------
NM_018078chr43273 178 105 ------
NM_018084chr2102945 2869 2798 1071 1044 936 855 537 474 369 --11054 --
NM_018085chr197716 7168 6455 5361 5175 2634 1280 875 23 --15383 --
NM_018086chr231871 1797 1606 --11548 --
NM_018092chr1621344 572 11169 1514 --
NM_018112chr92854 822 2377 242 1174 --
NM_018121chr1062658 2203 2073 749 561 342 --53053 2770 2598 2131 2125 --
NM_018126chr451474 1462 1087 619 469 ------
NM_018131chr105828 758 164 67 46 1746 ----
NM_018155chr3143421 3410 3381 3182 3086 2851 2312 2267 2153 1245 1162 995 762 498 12661 12595 --
NM_018156chr132215 728 287 ----12375
NM_018157chr1293269 3227 3174 3161 2235 2061 2050 2028 881 ----12829
NM_018181chr1841478 1279 1265 254 2550 271 --21780 182
NM_018182chr1721816 1413 --1901 1632
NM_018184chr362123 2025 1977 1858 1411 457 ------
NM_018191chr1332126 1871 216 12001 --11921
NM_018200chr1562614 2471 2088 1967 1778 831 ------
NM_018202chr1199 ------
NM_018216chr1190 ------
NM_018221chr21477 ------
NM_018238chr731102 951 111 --1925 --
NM_018243chr463912 3583 3315 1448 576 410 --11122 --
NM_018247chr6133144 2979 2683 2648 2450 2403 2395 2168 1958 1006 680 558 375 ------
NM_018254chr151870 1618 947 490 312 11649 ----
NM_018257chr2072544 2202 2182 1937 1930 1830 830 --11848 --
NM_018270chr202723 641 --1338 --
NM_018287chr1081296 932 462 421 326 242 174 73 ------
NM_018293chr382889 2796 2748 2035 1866 1150 1136 412 12158 ----
NM_018299chr8103115 2776 2643 2624 2483 1393 1212 849 513 136 ------
NM_018307chr174968 384 141 119 ------
NM_018312chr1171366 1347 1335 834 755 646 545 ----1359
NM_018313chr352113 1752 1657 618 112 ------
NM_018314chr111656 ------
NM_018315chr4----11226 --
NM_018323chr481789 1709 1619 1290 1273 235 216 129 ------
NM_018348chr1631207 1173 112 11027 31220 1077 55 --
NM_018351chr12134745 4641 3496 3108 3066 3058 2950 2906 1307 876 697 581 501 34259 3731 1808 14304 --
NM_018360chrX1116 ------
NM_018361chr8104033 3130 1169 985 598 481 412 346 321 299 13603 11177 --
NM_018362chr11123727 3591 3343 3089 2864 1394 1296 1180 904 857 521 34 23010 702 ----
NM_018364chr184117 3912 3896 3528 3386 2532 1099 364 --13368 --
NM_018367chr1152360 2233 1780 909 200 31668 858 382 ----
NM_018374chr7125039 4385 4374 4228 4221 3415 1790 1702 525 474 187 71 44957 4429 3308 1818 ----
NM_018394chr321122 234 --1142 --
NM_018403chr374078 3474 2810 2735 1260 599 564 1659 13134 13727
NM_018409chr482767 2552 2473 2408 1034 568 115 57 23150 385 11242 13139
NM_018425chr1042494 2270 898 762 12509 12646 --
NM_018426chr61129 ------
NM_018427chr1641149 1058 251 33 --1510 --
NM_018429chr592550 2192 1945 1878 988 449 301 204 76 22792 2247 ----
NM_018440chr8178548 8011 7856 7553 7496 7235 6758 5796 5317 3107 3087 2688 2561 2121 960 908 806 23274 1389 18520 --
NM_018444chr862200 2138 1752 1644 729 108 21810 564 11697 --
NM_018448chr1251057 945 887 191 172 1247 ----
NM_018452chr6_random33401 1367 980 11123 23519 843 --
NM_018462chr33846 819 221 ----1267
NM_018471chr2----1401 --
NM_018482chr862287 2091 919 804 600 519 ------
NM_018553chr1711237 ------
NM_018557chr261653 1289 1212 1060 192 182 ------
NM_018566chr194994 4985 4709 4412 4073 3987 3488 1310 936 11648 ----
NM_018571chr2167 ------
NM_018638chr1284959 4865 4616 4546 4538 4258 1239 611 ----15008
NM_018640chr1292816 2491 1933 1843 564 430 382 361 350 1312 --11079
NM_018641chr71168 ------
NM_018652chr155960 761 286 226 196 1170 ----
NM_018682chr74715 545 477 134 1584 ----
NM_018685chr731118 142 85 ------
NM_018695chr562292 1912 1523 819 743 694 ------
NM_018698chrX41946 1580 570 25 --1646 --
NM_018712chr1161453 1437 1425 1160 333 319 ------
NM_018719chr71915 ------
NM_018837chr202751 250 --1844 --
NM_018841chr143815 3427 2758 85 ----13722
NM_018844chr751740 821 794 703 488 1159 ----
NM_018847chr921854 178 31766 1756 462 1534 --
NM_018945chr663549 2668 1441 1388 416 184 --2912 372 1365
NM_018970chr783186 3056 2665 2557 2391 1243 1132 467 --12501 --
NM_018976chr1222480 556 1368 22602 2402 11022
NM_018979chr1262246 2239 2116 1047 808 104 ------
NM_018981chr24964 893 854 276 ------
NM_018992chr1631698 1637 639 ------
NM_018999chr10114753 4457 4189 3913 3872 3699 3184 1705 1532 1080 199 24492 914 23367 1465 --
NM_019001chr3114746 4621 4448 3650 3531 3361 3274 1427 861 579 382 11940 ----
NM_019004chr762300 2163 911 872 765 643 ------
NM_019015chr71101 ------
NM_019022chr1862101 793 722 262 112 24 ------
NM_019027chr452151 2128 1649 552 275 12545 ----
NM_019030chr5189 --1207 --
NM_019035chr451371 204 190 147 103 11790 11561 --
NM_019036chr641148 947 456 307 ------
NM_019041chr622629 2034 --12115 --
NM_019042chr771101 1072 819 379 167 121 65 --11002 1346
NM_019050chr481924 1903 1846 1739 843 568 351 197 11878 1650 --
NM_019053chr104993 408 324 158 1295 ----
NM_019072chr541665 931 346 293 23328 988 159 --
NM_019074chr151942 ------
NM_019080chr1361526 1359 974 291 238 200 ------
NM_019091chr23992 195 163 ------
NM_019094chr1253186 2868 2540 1407 1044 22831 307 23850 3811 --
NM_019095chr201199 ------
NM_019114chr962336 1890 1617 1601 610 490 1351 12093 12520
NM_019117chrX42788 1357 1118 660 ------
NM_019555chr331826 1520 218 --154 --
NM_019593chr2072621 2497 1098 890 854 495 127 1350 23062 442 --
NM_019600chr152804 25 ------
NM_020066chr14951 920 771 401 ------
NM_020122chr254239 1912 1824 1737 320 --45422 5347 945 42 --
NM_020123chr1011405 --2979 335 --
NM_020135chr62416 286 ------
NM_020150chr1052252 2045 1926 1703 500 ------
NM_020159chr441749 1618 617 317 41130 505 436 400 ----
NM_020177chr573290 2962 2291 2162 1232 1107 501 ------
NM_020193chr1131229 388 68 ------
NM_020205chr193446 3047 2848 2729 2287 978 803 603 474 --1755 --
NM_020239chr111967 ------
NM_020243chr221619 --1912 --
NM_020245chr6114946 4927 4906 4686 4239 3920 1640 1603 1597 793 173 14301 44618 4351 540 235 24568 485
NM_020297chr1283649 2330 2288 2197 1050 861 483 29 13077 13564 --
NM_020336chr2063805 3673 3602 1486 879 815 1155 12952 --
NM_020337chr463023 2820 2368 2079 380 306 ------
NM_020338chr1033730 3661 3307 13679 13172 --
NM_020341chr2041962 1431 672 429 --12046 --
NM_020346chr1151500 1307 1262 1061 380 11520 1220 --
NM_020347chr392260 1511 1419 915 892 650 327 80 68 1496 ----
NM_020348chr1042755 2055 1917 1908 --11005 --
NM_020357chr341412 1298 1179 200 1614 1510 --
NM_020390chr3104893 4328 4005 3706 3289 1525 1505 1415 1260 1094 13986 ----
NM_020403chr131260 --2528 306 --
NM_020420chrY81752 1322 694 578 527 469 378 77 11338 ----
NM_020429chr733012 2882 1254 ----11965
NM_020432chr731599 1588 661 21424 667 --12306
NM_020440chr153353 3275 2938 2846 2440 22852 561 1658 --
NM_020443chr177007 5907 5426 5355 2746 2649 862 36722 5471 1524 1205 --
NM_020453chr462054 1535 297 271 167 109 1315 ----
NM_020455chr652609 2282 1725 1113 254 12205 ----
NM_020456chr1372274 2059 1803 745 609 317 27 1387 1202 --
NM_020466chr6114058 3959 3850 3728 3454 3327 3208 3108 811 178 53 --21958 110 --
NM_020473chrX51958 1593 1399 336 34 11701 ----
NM_020548chr2----1215 --
NM_020640chr321774 164 ------
NM_020648chr1882874 2840 2807 2502 2175 1929 1097 785 1480 ----
NM_020654chr341377 1151 1124 472 --165 --
NM_020673chr20117309 6726 6139 5725 5515 5209 2556 2386 1547 840 326 26750 962 27145 1704 --
NM_020680chr11153 ------
NM_020711chr252443 1840 1002 376 215 52296 2230 360 347 87 ----
NM_020718chr16146468 6081 5041 4874 4797 4524 4464 4175 4162 2586 1780 1489 1263 962 46530 5237 5140 2161 11432 --
NM_020734chr1273322 3245 2781 2197 2064 1062 963 --1743 --
NM_020739chr15104015 3949 3922 3460 2742 1396 1124 963 318 23 11652 ----
NM_020742chrX52770 2745 2319 1073 889 22375 1786 12309 --
NM_020747chr5----1338 --
NM_020748chr1752077 1352 1344 639 301 ------
NM_020749chr852089 1595 1519 1400 37 ------
NM_020750chr611401 ------
NM_020752chr1082880 2772 2493 2169 1986 1858 1036 1019 --12700 --
NM_020760chr251391 1253 1233 261 152 --1379 --
NM_020766chrX44604 1630 1511 809 14194 --1593
NM_020768chr533197 2524 231 --1532 --
NM_020772chr17147940 7752 7120 7066 6413 6068 5639 3242 3227 2840 2745 1952 1482 569 37479 2410 1631 28475 1537 --
NM_020774chr18156193 5945 5754 5580 5332 4363 4352 4310 4012 2474 1267 1081 905 612 297 16125 12156 --
NM_020782chr1284178 3560 3302 1585 1080 1024 1015 364 14778 --1896
NM_020783chr1842051 1506 913 471 1549 11784 --
NM_020786chr1651544 1496 1430 1362 454 1279 ----
NM_020792chr362254 2178 1779 1706 1127 756 12163 ----
NM_020794chr141564 1523 1055 625 ------
NM_020796chr562871 2756 2748 2445 2123 2014 ------
NM_020801chr592555 2338 2074 1939 1647 921 905 877 805 --12090 --
NM_020803chr451982 967 923 587 315 1882 1719 --
NM_020805chr1851848 1817 1784 1515 545 ------
NM_020809chr1132205 1512 1446 --1663 --
NM_020813chr191203 ------
NM_020819chr621162 258 ------
NM_020825chr1642842 2373 1047 331 --23074 2341 12555
NM_020841chr1283651 3167 2645 2501 1396 967 654 512 33720 3366 187 --1864
NM_020843chr15----1267 125
NM_020844chr8157473 7364 7124 6709 6238 6185 5089 4923 2178 1706 1333 1181 374 137 93 26272 2685 27227 205 17599
NM_020850chr1643319 3108 488 335 --11277 --
NM_020854chr1861326 1300 557 421 169 140 ------
NM_020856chr1941134 1026 363 312 11085 ----
NM_020858chr1542235 2164 517 98 ------
NM_020859chr463920 3888 3647 2556 2536 579 43930 1268 568 532 ----
NM_020868chr221498 507 21982 728 12003 21637 152
NM_020870chr451925 786 468 317 80 ------
NM_020871chrX62534 2416 2150 879 735 622 41626 870 407 43 --1213
NM_020873chr3191 ------
NM_020899chr17----12515 12261
NM_020909chr2104058 3763 3661 2869 1619 896 791 319 154 94 ------
NM_020917chr1973628 3537 3241 2832 2804 2776 562 12841 12674 --
NM_020918chr1073506 3403 3087 3050 2723 2374 1107 13265 --13434
NM_020920chr14142 ------
NM_020921chr1473696 3149 2966 2526 989 711 27 1358 12344 --
NM_020932chrX----3490 103 96 --
NM_020935chr264480 3419 3058 2830 1111 40 1739 --14098
NM_020940chr1082963 2335 2061 1970 1795 778 365 274 ------
NM_020948chr1113073 2963 2770 2647 2559 2540 2528 2308 2289 655 203 2335 257 11016 12625
NM_020960chr984936 4902 4210 3564 3534 1983 939 764 14825 24857 4765 --
NM_020962chr1572426 2388 2379 2233 1809 580 502 ------
NM_020975chr1051466 1439 1426 743 632 ------
NM_020977chr461992 1977 1597 1535 305 135 11398 11434 --
NM_021007chr232227 1798 672 ------
NM_021032chr382012 1914 1897 1884 1700 1400 462 456 ------
NM_021033chr13113038 2995 2529 2298 1318 1310 1074 952 915 199 170 1269 23510 1046 --
NM_021069chr462151 1681 1575 1390 678 438 1302 ----
NM_021083chrX73492 3419 2829 2472 2465 1388 1147 ------
NM_021090chr2244475 4002 1762 1291 ----14466
NM_021101chr351004 843 637 400 227 --11678 --
NM_021111chr951203 970 914 392 133 11150 1411 --
NM_021115chr221157 ------
NM_021116chr748281 5724 5519 3414 17402 27605 5794 --
NM_021132chr1031230 506 466 ------
NM_021148chr761836 1823 1590 275 197 119 ------
NM_021151chr72324 259 ------
NM_021167chr772341 2292 2277 2263 2032 1085 490 ------
NM_021174chr81271 ------
NM_021180chr14794 774 730 641 ------
NM_021183chrX51022 990 698 476 347 1679 --11739
NM_021190chr151117 951 843 530 339 158 ----
NM_021191chr1262145 2012 2002 1789 694 364 1217 ----
NM_021202chr2011144 --12075 12208
NM_021215chr2062170 1893 705 586 367 216 --1875 --
NM_021222chr161449 1083 1033 903 424 252 ------
NM_021228chr19152 ------
NM_021237chr31355 ------
NM_021238chr1251921 1614 1566 628 455 11841 ----
NM_021252chr1082051 1578 1315 696 609 557 375 132 132 11787 --
NM_021255chr1483835 3750 3323 2857 2779 1475 1346 857 11525 ----
NM_021569chr91235 ------
NM_021622chr1062272 2264 1519 789 721 661 11831 12024 --
NM_021629chr3175063 4784 4662 4498 4066 3937 3908 2043 1113 987 946 812 574 444 329 273 89 ------
NM_021638chr454856 4716 3774 1231 747 ------
NM_021643chr251932 1436 1309 1171 381 11359 11882 --
NM_021644chr106817 786 295 178 130 82 ------
NM_021647chr4114740 4556 4548 4277 4088 3903 3685 3061 2929 1481 609 --13360 --
NM_021722chr71518 ------
NM_021723chr71559 ------
NM_021813chr685106 4813 4705 4650 4097 1971 717 107 1752 25198 4558 --
NM_021815chr252588 2424 617 525 301 21981 1225 ----
NM_021818chr1451188 1028 571 367 135 21360 1285 ----
NM_021911chr5145222 4959 4617 4006 3900 3602 3543 1976 1530 1286 1121 639 342 154 15088 ----
NM_021914chr14195 22247 953 --12265
NM_021923chr411296 ------
NM_021946chrX2456 441 ------
NM_021949chrX62390 2331 1045 1038 1017 985 1691 1447 --
NM_021950chr1152229 2003 1379 804 308 1824 11387 --
NM_021954chr1383694 3614 3202 2893 1403 758 496 487 23574 547 --12707
NM_021961chr11107059 6911 6363 6260 5623 4973 4588 1919 1443 399 1950 37118 5953 363 27083 6353
NM_021963chrX4632 555 314 79 ------
NM_021964chr3176547 5925 5911 5826 4969 4629 4178 2243 2102 2076 1294 1155 944 938 889 162 156 35199 4428 1890 ----
NM_021977chr691531 1471 1431 1342 1241 867 738 150 88 --12492 --
NM_021978chr11----1507 --
NM_021998chrX41523 1012 982 301 1146 ----
NM_022037chr21116 ------
NM_022045chr81188 ------
NM_022048chr1576258 5979 5920 5415 4956 4089 1492 24151 1752 24910 1397 15953
NM_022058chr291852 1842 1656 1598 581 573 557 412 332 21809 648 1718 --
NM_022080chr2072630 2561 2083 799 685 375 234 --1282 --
NM_022114chr173558 1685 1673 1473 672 579 503 ------
NM_022118chr134522 187 165 80 ------
NM_022129chr10145 1570 --1527
NM_022133chr851868 1772 1251 697 195 1531 ----
NM_022138chr621215 265 --195 1257
NM_022143chr741584 1576 989 588 ------
NM_022160chr93560 503 356 1554 --1516
NM_022166chr1646196 6015 2448 1132 --25777 5765 --
NM_022169chr11----11503 --
NM_022173chr21116 ------
NM_022346chr4147 ----1348
NM_022459chr13136385 6128 5796 5476 4886 4786 4691 2135 1874 1810 1788 1017 96 15542 ----
NM_022484chr73972 87 80 1466 ----
NM_022491chr1282965 2933 2752 1019 780 730 473 407 --12858 --
NM_022566chr151612 ------
NM_022572chr221739 1659 ------
NM_022650chr55980 847 836 676 202 ------
NM_022652chr121768 11057 1450 11075
NM_022658chr1261274 1064 999 384 191 92 --11041 --
NM_022739chr173981 852 819 ------
NM_022753chr182579 2504 1961 1871 1113 985 514 60 1489 ----
NM_022763chr372873 2512 2247 2207 2059 968 608 12413 ----
NM_022776chr321242 1168 ------
NM_022777chr7------11400
NM_022780chr251476 588 500 493 53 ------
NM_022810chrX2397 75 ------
NM_022824chr551641 1455 1189 172 62 11554 1128 --
NM_022828chr531722 238 166 21518 1338 ----
NM_022838chrX1208 ------
NM_022841chr1532728 821 660 --3764 117 55 --
NM_022843chr1351455 1408 1122 226 185 11417 ----
NM_022845chr1641497 1408 503 186 11611 11599 --
NM_022893chr292429 2307 2289 2236 2018 1106 846 709 292 1257 13084 12252
NM_022894chr261440 1257 1246 1135 538 447 --1261 --
NM_022898chr1474789 3708 3537 3038 1401 1031 232 21625 1362 24606 4483 --
NM_022901chr921683 1488 ----1332
NM_022902chr51342 --159 --
NM_022965chr411168 --11321 --
NM_022977chrX72564 2290 2109 1876 1624 1040 984 1724 1875 --
NM_023000chr1441330 1131 255 219 ----1411
NM_023001chr1441330 1131 255 219 ----1411
NM_023016chr272511 2141 2011 901 582 440 36 --1487 --
NM_023076chr16102965 2896 2845 2178 2153 1914 1853 775 636 228 12864 ----
NM_023105chr822191 2168 --22236 1758 --
NM_023106chr822191 2168 --22236 1758 --
NM_023110chr822191 2168 --22236 1758 --
NM_023111chr822191 2168 --22236 1758 --
NM_023929chr872835 2790 1877 1830 527 285 172 1921 2840 35 --
NM_023943chr32219 33 ------
NM_024007chr561981 1085 1034 953 578 312 --1226 --
NM_024045chr101143 ------
NM_024050chr191156 ------
NM_024052chr1753153 3103 2123 1998 734 12985 11046 --
NM_024068chr12193 ------
NM_024090chr431521 759 351 ------
NM_024092chr1111271 ------
NM_024094chr84916 191 136 115 ------
NM_024122chrX172 ------
NM_024312chr1271625 1523 1426 1289 1085 47 36 ------
NM_024320chr173889 760 153 ------
NM_024334chr311849 --11465 --
NM_024345chr9146147 5422 4935 4724 4521 4473 4103 2230 1962 1859 1444 896 385 73 35888 1972 915 15349 --
NM_024408chr1103265 3218 2987 2731 2570 1246 1066 466 333 276 13746 ----
NM_024429chr71122 ------
NM_024490chr154583 539 94 66 ------
NM_024491chr3154 --1100 --
NM_024519chr161276 ------
NM_024524chr312956 52275 2157 1144 492 130 12098 --
NM_024556chr111477 ------
NM_024561chr1351160 1087 345 100 73 ------
NM_024569chr142942 577 497 442 ------
NM_024573chr62604 384 ----1670
NM_024607chr853972 1489 661 584 118 11302 13512 13600
NM_024613chr831646 1345 660 ----11183
NM_024617chr91241 ------
NM_024641chr672730 2648 1043 686 484 383 238 12754 --11932
NM_024665chr364579 3506 3047 2873 1448 250 --34252 1853 1333 --
NM_024670chr103598 134 74 ----1470
NM_024674chr162745 2257 885 740 699 613 13131 ----
NM_024676chr131301 1280 878 --1134 11323
NM_024680chr113554 431 196 ------
NM_024692chr261840 1503 1466 518 293 39 ------
NM_024700chr131176 960 796 1164 21044 229 11149
NM_024713chr1531356 1060 283 --2264 27 --
NM_024721chr841916 841 514 444 --1985 12642
NM_024744chr272524 1904 1004 990 589 242 144 11893 ----
NM_024770chr2105894 4913 4823 4527 4480 1898 1597 354 148 110 14132 ----
NM_024817chr1585627 5469 5213 5189 4396 3921 1769 1646 12060 14092 13725
NM_024834chr102623 566 ----1254
NM_024874chr111395 ------
NM_024930chr561841 635 479 356 112 80 1145 ----
NM_024944chr2121003 400 ------
NM_024945chr92975 814 ----11119
NM_024947chr3179393 9358 9293 9285 8820 8224 7473 7155 6981 6303 3791 2827 2333 1961 1592 1310 177 49646 9262 6816 1507 ----
NM_024949chr475018 3725 3420 3206 1313 938 461 24231 1988 ----
NM_024953chr1242476 2073 2046 786 12729 --12277
NM_024960chr201127 ------
NM_024969chr22133 52 ------
NM_024979chr1321464 1082 11668 --1533
NM_024989chr2188120 7979 7770 7371 6923 6911 6759 6460 6220 5923 5550 5362 3106 2350 2163 2148 764 342 35803 5435 968 16499 15178
NM_024991chr1063243 2830 2341 2169 828 228 --12367 --
NM_024997chr1651343 884 839 73 42 --11012 --
NM_025054chr884080 1594 1565 1354 961 904 879 53 24094 334 11024 --
NM_025069chr81147 ------
NM_025073chr164465 3641 1629 1515 404 316 34476 4371 435 ----
NM_025074chr4113051 3004 2591 2448 2237 2175 2163 1104 508 67 22 1986 12959 --
NM_025107chr662264 2136 1725 336 235 220 ------
NM_025133chr2181 ----1878
NM_025134chr16102518 2442 2381 2056 1903 1678 1633 969 307 119 ------
NM_025146chr332528 2458 1063 ----21040 639
NM_025147chr241131 888 406 63 1450 197 --
NM_025151chr872170 2014 1810 1672 1610 1475 324 ------
NM_025152chr1451388 1231 644 544 242 1139 ----
NM_025160chr1114304 3670 3191 3068 3046 2967 1731 727 717 693 51 1607 ----
NM_025179chr154837 4551 4526 4292 1216 21070 328 --13858
NM_025181chr22710 640 1296 --1571
NM_025184chrX3835 607 600 1893 ----
NM_025191chr163105 2795 2699 2686 517 29 ----13513
NM_025195chr831433 387 45 ------
NM_025208chr1142443 706 590 215 32239 1726 982 ----
NM_025221chr441433 574 410 354 ------
NM_025235chr1062032 1617 1413 433 393 371 1556 ----
NM_030579chr1653707 3526 3519 3357 1215 13010 23438 2911 11168
NM_030621chr14103914 3827 3570 3247 3075 2849 2790 1645 1389 1198 34084 3636 1664 11313 --
NM_030625chr1031825 695 45 ----12379
NM_030627chr584134 4049 3936 3924 3604 3271 882 333 ------
NM_030647chr7196262 6200 6175 6080 6040 6016 5781 5534 5177 4692 2168 1515 1412 1220 998 875 396 301 147 24588 828 ----
NM_030648chr465550 5295 3814 3649 3415 1198 ----1234
NM_030650chr2103483 3427 3416 3335 3278 3029 2629 1164 1088 816 3748 140 117 11690 12586
NM_030674chr1295910 5594 5425 4955 1907 1044 882 756 732 1574 ----
NM_030755chr14112937 2243 1226 1040 951 750 661 513 459 333 260 1370 23077 2686 --
NM_030762chr1231716 771 568 --11368 --
NM_030780chr861690 1604 1547 1419 1371 306 ------
NM_030791chr1471861 1814 1246 1141 686 605 148 11524 11381 21800 419
NM_030806chr1149408 8966 8841 8420 8198 7309 6507 6427 6078 5796 2445 2345 2199 1327 27205 2057 28439 1148 --
NM_030809chr1282497 2413 1677 1634 1589 915 566 155 1586 ----
NM_030816chr153116 2288 1043 702 608 ------
NM_030817chr1293654 3573 3442 3290 2666 2530 2355 1494 1438 23397 3036 1431 --
NM_030885chr352280 1852 829 666 85 1330 ----
NM_030912chr101898 ------
NM_030915chr262343 2262 2228 2082 1577 396 ------
NM_030948chr6172 ------
NM_030965chr12712 562 ----1689
NM_030978chr91137 ------
NM_031216chr1861992 1615 1528 754 747 368 2207 98 1646 --
NM_031244chr631210 1094 71 ------
NM_031268chr1665094 5071 4875 3847 3378 134 15157 23918 1348 --
NM_031271chr851633 1526 1490 1344 446 31467 1364 326 ----
NM_031296chr462338 2327 1964 1771 956 141 1763 1405 --
NM_031305chr41296 ------
NM_031309chr8----1934 --
NM_031314chr1452004 1402 1320 701 495 ------
NM_031362chr252838 2292 1773 278 256 12616 1878 --
NM_031365chr262974 2428 1909 414 392 142 12752 11014 --
NM_031366chr262974 2428 1909 414 392 142 12752 11014 --
NM_031371chr161394 1335 1161 1135 429 362 1383 ----
NM_031371chr161394 1335 1161 1135 429 362 1383 ----
NM_031418chr1152129 2079 1964 1888 1117 12838 ----
NM_031427chr1475176 5076 4840 2143 952 879 594 31721 823 384 ----
NM_031435chr1253095 2995 2434 2265 805 32906 600 175 --12751
NM_031442chrX92885 2404 2395 2306 2069 1193 873 759 458 ------
NM_031469chr663429 2644 1029 814 220 33 33850 3811 679 ----
NM_031483chr2053551 2561 641 172 41 22246 1120 1419 --
NM_031844chr1114119 3011 2996 2871 2801 1619 1037 735 725 679 241 23535 3184 ----
NM_031845chr293610 3155 2519 2277 1247 806 533 290 193 --13668 1611
NM_031847chr293610 3155 2519 2277 1247 806 533 290 193 --13668 1611
NM_031858chr174634 475 326 154 --11299 --
NM_031862chr174634 475 326 154 --11299 --
NM_031890chr2243021 2128 777 94 --1863 --
NM_031892chrX----1629 --
NM_031904chr1122099 1806 ------
NM_031935chr12970 159 ----1391
NM_032012chr9115048 4492 3635 3378 2057 1772 1269 896 885 843 185 1576 ----
NM_032018chr15878 829 563 538 310 ------
NM_032102chr1142960 2495 1200 1087 1259 ----
NM_032121chrX32758 2748 1860 --12558 1197
NM_032128chr42857 706 ------
NM_032138chr13148 ------
NM_032141chr173715 656 107 ------
NM_032144chr251433 1338 1140 664 573 ------
NM_032145chr661878 1320 1184 769 333 262 --11248 --
NM_032151chr54782 532 480 263 ------
NM_032165chr121226 ------
NM_032186chr131395 1235 414 ------
NM_032189chr1394761 4430 4183 1902 1863 1853 1762 1452 1229 44360 1513 1478 1252 ----
NM_032199chr10113652 3345 3225 3082 2626 2391 1414 1102 540 364 94 --12407 13495
NM_032221chr2021530 1414 --11961 --
NM_032228chr1193408 3068 2884 2741 2732 2345 2205 507 401 42426 2321 1316 435 33429 2389 982 --
NM_032233chr141290 ----1762
NM_032246chr1551351 1241 1100 1083 1022 ------
NM_032291chr13386 290 186 --1237 --
NM_032303chr951396 1385 1165 290 113 --1669 --
NM_032320chr112519 193 --1219 --
NM_032325chr1131975 1921 1433 1693 11726 11762
NM_032352chr1451446 1428 1219 964 944 --1122 11394
NM_032373chr1095799 5681 5322 4748 2280 1993 1210 1118 44 11415 1221 --
NM_032379chr113869 697 614 2901 228 ----
NM_032435chr162430 2203 1549 706 323 30 31799 850 758 ----
NM_032438chr641564 1285 612 335 --11508 --
NM_032446chr552925 2530 2434 1131 370 23002 1023 13677 --
NM_032457chr493627 3072 2968 2918 2762 1265 1135 573 461 11013 ----
NM_032458chrX62872 2634 1246 1055 879 663 12689 ----
NM_032482chr194859 751 739 206 --12669 --
NM_032505chr3102777 2480 2343 2228 1973 1835 956 322 216 82 ----12449
NM_032507chr6----1256 --
NM_032521chr2073135 2772 2315 1165 659 375 54 ------
NM_032547chr461185 1081 570 514 467 414 ------
NM_032558chr931310 1257 1163 --1992 --
NM_032564chr111168 ------
NM_032569chr1651924 1607 1419 1286 811 ------
NM_032575chr1611905 ------
NM_032582chr1741284 1167 597 65 --21498 1445 --
NM_032594chr141938 --11063 --
NM_032595chr1711323 ------
NM_032607chr1911077 ------
NM_032632chr1452025 1991 1463 381 270 1595 ----
NM_032635chr19----172 --
NM_032682chr393379 3236 2347 757 660 442 183 174 93 13516 ----
NM_032711chr1754257 4202 3504 803 699 1848 ----
NM_032801chr1162416 1794 1626 920 772 567 --12536 --
NM_032804chr1021779 866 --11638 --
NM_032813chr134922 434 317 205 1958 ----
NM_032825chr192751 400 ------
NM_032826chr774193 3978 3736 3514 3493 3403 543 45444 4679 4171 3705 ----
NM_032828chr1974171 3155 1627 1368 1198 1064 26 1643 23447 3317 11136
NM_032859chr13113927 3833 3524 3369 3303 2775 1595 789 458 420 31 33848 2762 774 ----
NM_032869chr832077 2009 420 ----11272
NM_032873chr11134393 4377 4350 4269 3695 3106 2795 1786 1751 1237 938 853 835 24383 3622 13298 11522
NM_032875chr172797 36 --1583 --
NM_032884chr11343 ------
NM_032900chr1083480 3424 2435 2372 1147 942 701 107 13850 1447 1658
NM_032918chr1221193 332 --11259 1230
NM_032943chr113869 697 614 2901 228 ----
NM_032961chr4----11003 --
NM_032968chrX54060 3430 749 285 198 ------
NM_032969chrX54060 3430 749 285 198 ------
NM_032973chrY44052 749 285 198 ------
NM_032975chr1853324 3110 3044 1120 406 13431 ----
NM_032980chr1853324 3110 3044 1120 406 13431 ----
NM_032991chr43493 72 61 --11422 --
NM_033016chr2211620 --149 --
NM_033020chr1124493 4120 4014 3831 3441 1815 1600 1424 1254 1017 976 960 ------
NM_033083chr353400 3385 3172 1130 704 13036 12688 --
NM_033132chr1372214 2205 1571 624 598 442 187 11998 ----
NM_033135chr1142443 706 590 215 32239 1726 982 ----
NM_033143chr4104610 3139 2829 1826 1609 873 637 605 462 21 14109 ----
NM_033150chr121393 ------
NM_033181chr663271 2922 2827 2688 748 478 --22416 1380 --
NM_033211chr531987 707 405 ------
NM_033222chr931278 1138 1108 2945 57 ----
NM_033224chr7147947 7171 6767 6482 5747 2981 2178 2134 2095 1802 1692 1390 478 388 37044 5071 1723 11844 --
NM_033254chr3187 ------
NM_033276chr123351 259 249 ------
NM_033281chr51151 ------
NM_033285chr894448 4228 4009 2899 783 742 596 300 131 --23915 1752 --
NM_033305chr911369 --1304 --
NM_033360chr12104488 4386 4319 3893 3783 3369 2989 2842 1795 1073 13600 1200 --
NM_033389chr1754058 3642 3596 3239 1179 11056 --24720 4344
NM_033402chr82381 153 ----1440
NM_033430chr453975 3868 1181 194 121 23896 1434 2505 95 --
NM_033437chr453975 3868 1181 194 121 23896 1434 2505 95 --
NM_033480chr6102984 2928 2829 2659 2550 2314 2288 669 551 424 ------
NM_033481chr6102984 2928 2829 2659 2550 2314 2288 669 551 424 ------
NM_033505chr286544 5566 4368 2345 2288 1415 715 387 22659 2058 11585 --
NM_033540chr341037 895 853 167 --1803 --
NM_033624chr1212222 1571 32071 402 358 --
NM_033632chr4----11226 --
NM_033642chrX41224 807 300 217 --1941 --
NM_033656chr21135623 5143 5121 4821 4249 2191 2099 1975 1722 929 739 161 46 11625 13872 1246
NM_052832chr872965 2798 2558 2535 1997 381 66 12623 ----
NM_052834chr1871924 1892 1733 1669 1019 365 29 --12353 --
NM_052851chr1352330 2283 2119 2015 1533 ------
NM_052879chr1293378 3253 2876 2644 2517 2510 1090 873 408 --24071 4065 --
NM_052880chr2221394 468 ----11464
NM_052885chr1284743 4704 4660 4570 4168 1562 941 718 --11600 --
NM_052898chr831657 1454 551 1138 --11303
NM_052900chr841290 313 280 237 --11239 --
NM_052905chr251227 752 709 656 437 ------
NM_052907chr1273584 2772 1533 951 917 838 487 14083 22939 1224 13291
NM_052910chr1341674 795 752 683 ----11658
NM_052918chr1093707 3534 3428 3331 2539 2449 964 520 143 ------
NM_052927chr552134 2042 1876 693 681 ------
NM_052932chr1172486 2425 2281 2044 1927 1650 816 ------
NM_052937chr842585 1018 737 392 11998 2812 61 --
NM_052948chr19180 ------
NM_053001chr81392 ------
NM_053002chr331069 352 344 --21005 978 --
NM_053016chr997806 6932 6070 6052 5251 2650 2604 1784 1484 26457 5485 12877 16489
NM_053023chr1152459 2306 2253 83 45 ------
NM_053043chr7116357 6173 5011 4789 4674 4477 4392 4381 1850 1835 1170 21230 396 11548 --
NM_053064chr1472892 2257 2169 1974 986 882 747 22744 2665 12353 194
NM_054016chr151929 1897 1706 1432 340 11698 1269 --
NM_054016chr151929 1897 1706 1432 340 11698 1269 --
NM_054016chr151929 1897 1706 1432 340 11698 1269 --
NM_057159chr9----2651 142 --
NM_057168chr751751 1493 1382 1133 469 11390 ----
NM_057169chr1282814 2771 2520 2446 2314 1933 412 204 ------
NM_057170chr1282814 2771 2520 2446 2314 1933 412 204 ------
NM_057180chr121401 ------
NM_058170chr131364 575 117 11057 ----
NM_058191chr212153 48 1319 --1135
NM_058237chr144962 798 367 319 ------
NM_058240chr1431246 1071 218 ------
NM_058241chr261753 1526 835 391 238 119 21691 1470 ----
NM_058241chr261753 1526 835 391 238 119 21691 1470 ----
NM_080422chr181304 ------
NM_080423chr181304 ------
NM_080546chr982276 2240 2206 1702 1597 1536 775 600 11881 2640 67 --
NM_080597chr184986 881 220 133 1700 ----
NM_080617chr203320 196 172 ----1943
NM_080645chr652196 2098 1704 598 222 ------
NM_080664chr1461621 794 716 631 470 103 ------
NM_080666chr144563 477 463 340 ------
NM_080676chr2083275 3189 3021 2439 2320 1310 855 147 1975 ----
NM_080678chr22640 550 ------
NM_080683chr43393 172 26 ------
NM_080684chr43393 172 26 ------
NM_080685chr43393 172 26 ------
NM_080743chr642174 2122 2072 1730 2793 760 ----
NM_080764chr2252955 2216 714 610 32 22237 160 ----
NM_080867chr1484136 3734 1668 1586 1548 721 597 359 2346 317 ----
NM_080872chr894062 3359 2990 2681 990 523 492 233 48 ----13962
NM_080921chr151178 1167 1008 881 119 ------
NM_080927chr373355 3320 1150 1069 859 718 305 --13265 --
NM_130391chr963590 3167 3102 2551 1402 1071 1704 --12193
NM_130392chr963590 3167 3102 2551 1402 1071 1704 --12193
NM_130393chr963590 3167 3102 2551 1402 1071 1704 --12193
NM_130395chr62416 286 ------
NM_130435chr1062627 1016 1008 775 753 439 11923 12683 --
NM_130439chr1032135 889 157 --12207 --
NM_130439chr1032135 889 157 --12207 --
NM_130831chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130832chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130833chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130834chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130835chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130836chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130837chr372893 2623 2579 2136 1979 1108 310 42770 707 670 501 ----
NM_130838chr1551867 1360 503 432 378 ------
NM_130839chr1551867 1360 503 432 378 ------
NM_133265chrX52715 2679 1076 963 878 --1705 --
NM_133326chr11293 ------
NM_133329chr221836 695 2746 294 --1549
NM_133334chr4105741 5681 5403 5279 5150 4598 4502 4348 4047 769 32087 2026 1460 ----
NM_133338chr52473 132 ------
NM_133339chr52473 132 ------
NM_133340chr52473 132 ------
NM_133341chr52473 132 ------
NM_133342chr52473 132 ------
NM_133343chr52473 132 ------
NM_133344chr52473 132 ------
NM_133367chr653060 3021 2462 2112 462 22615 918 ----
NM_133370chr483413 3161 2969 1156 1062 998 881 50 11318 ----
NM_133372chr572945 1069 975 783 495 440 71 ----1249
NM_133468chr74972 630 465 336 --21726 82 1802
NM_133473chr1961803 1604 1438 1207 652 74 ------
NM_133477chr4103093 2908 2702 2412 1114 706 521 364 283 264 --12716 13244
NM_133486chrX1350 ------
NM_133496chr164206 4122 3803 3693 1498 848 --1624 23469 1613
NM_133631chr331057 619 323 21363 1103 11093 --
NM_134421chr24791 759 630 555 --1721 --
NM_138270chrX63256 2658 2296 2168 904 181 ------
NM_138288chr1462190 2138 1573 1534 258 239 --1856 --
NM_138333chr912540 2446 103 1747 11774
NM_138409chr641338 1101 238 213 ----11395
NM_138423chr1532264 1440 582 ------
NM_138426chr752486 2246 632 241 221 22043 255 --12431
NM_138459chr642958 2832 2255 198 31322 992 746 --13656
NM_138468chr2104672 4541 4369 4263 1332 1312 965 834 594 55 32248 1113 160 --16242
NM_138473chr1234280 3389 301 24267 1889 31566 1136 247 --
NM_138494chr772378 2236 2082 672 506 304 284 --12810 12184
NM_138576chr1474789 3708 3537 3038 1401 1031 232 21625 1362 24606 4483 --
NM_138621chr283898 3310 3039 2647 1171 1154 792 657 --34063 3580 885 --
NM_138633chr621773 1225 ----1366
NM_138638chr14195 22247 953 --12265
NM_138713chr16168241 8168 8016 7588 7060 6847 6840 6578 6520 5743 5377 3247 2556 2179 2001 1973 27472 242 ----
NM_138714chr16168241 8168 8016 7588 7060 6847 6840 6578 6520 5743 5377 3247 2556 2179 2001 1973 27472 242 ----
NM_138727chr131725 301 122 --1445 --
NM_138728chr131725 301 122 --1445 --
NM_138731chr1494215 4166 4057 3788 3496 3121 956 710 438 21612 861 --14038
NM_138736chr1614209 --11080 --
NM_138766chr5186 ------
NM_138782chr531557 892 878 21774 116 ----
NM_138799chr21425 ----1558
NM_138821chr5186 ------
NM_138822chr5186 ------
NM_138927chr214820 309 230 206 --1361 --
NM_138931chr3----1688 --
NM_138959chr196569 5469 2541 2433 2093 1605 1490 1431 158 46283 6268 5604 4639 25589 437 --
NM_139012chr632225 1660 1585 1587 11756 --
NM_139014chr632305 1740 1665 1667 11836 --
NM_139068chr52682 512 ------
NM_139069chr52682 512 ------
NM_139070chr52551 381 ------
NM_139076chr461034 965 599 156 102 34 11447 ----
NM_139160chr11132 ------
NM_139168chr552010 1635 1432 746 233 ------
NM_139182chr461704 1458 1343 1259 148 137 1758 ----
NM_139207chr125779 666 358 167 89 1756 ----
NM_139242chr1541035 541 259 37 ------
NM_139245chr341802 1422 1191 704 --11549 --
NM_139266chr22203 81 ------
NM_139279chr253034 2890 1290 1271 107 --23482 3453 13282
NM_139283chr1261961 1945 1926 1690 1660 764 21568 224 ----
NM_139319chr1261581 1543 1269 1198 709 633 11386 ----
NM_139321chr2064182 4117 3974 3328 2691 1696 2961 692 13477 --
NM_139323chr2031892 1422 470 --1168 1478
NM_144498chr2042047 1939 622 553 ------
NM_144563chr21308 ------
NM_144563chr21308 ------
NM_144568chr142617 568 ------
NM_144571chr4126788 5599 5118 5052 4912 2781 2523 1657 1531 486 405 169 16228 1314 --
NM_144578chr1495288 4907 4844 4663 4128 3561 2014 375 229 --24771 1200 --
NM_144583chr22273 145 ------
NM_144588chr1011158 ------
NM_144595chr135953 912 866 384 178 ------
NM_144599chr1565244 5195 5160 4462 4308 1250 --11016 11615
NM_144632chr242291 1525 784 23 1809 ----
NM_144642chr381329 1267 1015 952 543 479 364 293 21417 564 ----
NM_144645chr41234 ------
NM_144664chr1172385 2173 1927 1845 581 154 22 1217 ----
NM_144721chr462707 1992 830 440 417 347 12788 1189 --
NM_144767chr1584590 4498 4437 3657 1604 657 626 372 11569 33479 3217 1622 --
NM_144778chr1352777 2395 2182 1865 1101 --11789 --
NM_144949chr232615 2333 352 --2715 295 1272
NM_144963chr872587 2240 2180 2020 1775 240 216 ------
NM_144973chr1294959 4624 4290 4094 1615 766 630 201 118 3783 559 171 21355 1039 --
NM_144979chr45612 604 568 117 100 ------
NM_145005chr931021 194 179 1958 1663 1125
NM_145010chr1062240 429 215 148 127 36 ------
NM_145011chr1052153 2044 1526 553 167 ------
NM_145037chr321392 1017 11118 --1282
NM_145049chr51936 ----11015
NM_145055chr18103865 3725 3355 3334 3068 2698 1001 716 490 359 12654 2994 111 --
NM_145115chr752351 2283 830 796 681 22360 912 ----
NM_145203chr134944 680 656 253 --150 --
NM_145206chr1043120 2719 1214 546 ----13159
NM_145243chr11181 ------
NM_145245chr1911265 ------
NM_145251chr1451235 1222 1106 326 38 ------
NM_145259chr2187039 6945 6821 6492 6178 5505 5467 5144 5073 4959 2532 2145 2117 1725 1495 941 827 119 12449 15090 --
NM_145263chr462382 2102 1690 1554 853 247 --1166 --
NM_145291chr44414 388 362 354 ------
NM_145307chr1074333 3168 3086 2879 2849 1318 941 23705 3276 23849 1773 --
NM_145313chr1011471 ----11614
NM_145320chr793499 3286 3054 2946 2342 1000 538 160 34 22419 851 --1631
NM_145321chr793499 3286 3054 2946 2342 1000 538 160 34 22419 851 --1631
NM_145322chr793499 3286 3054 2946 2342 1000 538 160 34 22419 851 --1631
NM_145330chr21147 ------
NM_145690chr871864 1459 1305 780 656 604 55 1124 ----
NM_145693chr252491 1829 1039 819 142 --42508 2282 596 224 12498
NM_145716chr11239 ------
NM_145728chr1542346 2157 675 628 ------
NM_145735chr1342442 2187 2096 1728 12714 32857 2253 875 --
NM_145753chr34617 585 428 150 11697 ----
NM_145799chrX93090 2755 2146 2118 2008 1014 982 822 650 --22152 407 --
NM_145805chr151612 ------
NM_145858chr211110 1158 --2437 49
NM_145891chr1651477 1113 1071 368 180 ------
NM_145892chr1651477 1113 1071 368 180 ------
NM_145893chr1651599 1235 1193 490 302 ------
NM_146387chr191223 ------
NM_146388chr1911298 ------
NM_147150chr94903 525 512 75 --21499 1469 --
NM_147164chr91517 ----1570
NM_147166chr73859 826 76 --1607 --
NM_147171chr71471 ------
NM_147175chrX42031 1873 1713 1551 --11669 --
NM_147181chr441433 574 410 354 ------
NM_147182chr441433 574 410 354 ------
NM_147183chr441433 574 410 354 ------
NM_147185chr71471 ------
NM_147188chr1541096 584 154 79 1524 ----
NM_148174chr852034 698 448 244 137 --1512 11993
NM_148894chr41385 ------
NM_148957chr1362685 2124 1912 1881 871 820 22236 500 --1139
NM_152132chr14126 ------
NM_152221chr22148 ------
NM_152261chr1241955 1921 1808 881 --12417 --
NM_152263chr185925 5300 4758 4695 1368 756 147 86 1740 26047 211 --
NM_152265chr171527 1233 565 401 279 170 147 21460 160 11339 --
NM_152275chr242278 2142 89 67 1941 22353 367 --
NM_152277chr521829 787 ----1513
NM_152280chr143026 2539 961 399 --1709 --
NM_152282chr341199 959 921 903 ----11392
NM_152291chr421035 897 1889 ----
NM_152298chr1153 ----1569
NM_152300chr1721433 1219 1109 --11192
NM_152330chr1462517 2451 2062 824 743 129 1694 12389 --
NM_152332chr14132585 2393 2382 1997 1871 885 816 736 727 519 471 392 330 12019 1979 --
NM_152388chr233594 280 65 --291 39 --
NM_152400chr462020 832 657 478 467 31 1687 11321 --
NM_152407chr563134 793 594 446 398 359 ----1201
NM_152409chr583272 2882 2321 1245 662 510 495 390 12397 1200 --
NM_152414chr841642 1208 1019 621 ------
NM_152415chr84380 341 201 87 ------
NM_152417chr841330 855 231 100 ------
NM_152420chr91714 ------
NM_152422chr941880 1741 1701 475 21886 241 --1151
NM_152423chrX51491 1309 1193 1032 26 21094 122 ----
NM_152447chr141232 ------
NM_152493chr111638 ------
NM_152522chr21999 ------
NM_152529chr234260 3816 3668 --24254 677 --
NM_152549chr51192 --1515 --
NM_152556chr762544 2441 2151 2074 691 238 1598 ----
NM_152589chr121224 ------
NM_152594chr1572234 2049 1815 1694 301 243 152 21912 1535 1216 --
NM_152608chr182591 2552 2286 2176 1596 1016 214 26 ------
NM_152622chr553432 2831 1257 494 158 13024 23472 2563 1793
NM_152624chr5117033 6867 6397 5943 4679 4624 2457 1110 1039 483 250 15217 12801 --
NM_152629chr963290 3250 3244 1438 648 621 13257 ----
NM_152638chr1241190 480 263 234 1250 1332 --
NM_152641chr1231021 983 623 22229 975 11063 12444
NM_152653chr31632 ------
NM_152666chr16862 764 618 573 249 35 --1197 --
NM_152678chr362714 2413 2164 2081 1664 231 --21976 1886 12068
NM_152680chr462342 2010 1949 1783 754 539 11839 1630 --
NM_152695chrX72229 2033 1522 793 662 521 175 32102 2046 923 ----
NM_152699chr353760 2855 2429 2406 922 --13635 --
NM_152716chr1141321 587 490 273 ------
NM_152744chr73870 523 250 ----12580
NM_152756chr5104174 4089 3722 3660 3426 1578 1368 1140 788 49 11270 11204 --
NM_152758chr843036 2613 2562 2494 1435 1718 --
NM_152774chr782312 2082 1997 1049 598 590 518 328 21024 307 190 --
NM_152787chrX73894 3600 3245 2806 913 757 503 --23534 535 --
NM_152793chr734524 1976 79 --11049 --
NM_152829chr751193 992 805 301 53 ----1199
NM_152835chr182358 2340 2289 2221 1966 817 448 312 1493 ----
NM_152836chr851868 1772 1251 697 195 1531 ----
NM_152837chr851868 1772 1251 697 195 1531 ----
NM_152838chr2062579 1094 660 598 254 76 --12632 --
NM_152857chr6----1999 --
NM_152858chr6----1999 --
NM_152866chr1152229 2003 1379 804 308 1824 11387 --
NM_152878chr2211582 ------
NM_152879chr212506 ------
NM_152889chr31700 ------
NM_152902chr162009 1627 1541 1438 532 55 21287 1258 11973 --
NM_152903chr1332626 1985 233 32553 2420 239 1997 11892
NM_152999chr764604 3617 3250 3103 1626 743 23203 624 ----
NM_153013chr542510 2159 2114 1829 42408 2309 618 398 ----
NM_153040chr15----1141 --
NM_153042chr651446 1326 1248 561 209 11684 ----
NM_153050chr2244475 4002 1762 1291 ----14466
NM_153051chr2244475 4002 1762 1291 ----14466
NM_153183chrX21261 248 1944 11021 --
NM_153184chr351881 1354 799 667 435 ----1624
NM_153186chr95808 759 663 606 535 --1726 --
NM_153188chr5105646 5639 4875 4512 3869 2283 1678 1585 1483 1018 ------
NM_153207chr12153668 3294 3281 3177 3107 2995 2914 1633 895 853 613 590 544 429 134 1791 ----
NM_153226chr104484 325 107 89 ------
NM_153235chr65710 596 514 377 167 21928 1829 ----
NM_153261chr162409 321 ------
NM_153262chr1113187 3165 2964 2630 2575 2558 2471 2210 1048 960 667 --23214 1241 12028
NM_153341chr1197 ------
NM_153365chr432441 2089 585 --22238 2055 --
NM_153367chr1073183 3167 2835 2773 2567 2512 1053 23391 2688 ----
NM_153377chr122329 281 ------
NM_153426chr41213 ------
NM_153427chr41213 ------
NM_153453chr6----1698 --
NM_153456chr1385989 4130 4090 3844 2213 1394 763 742 21057 527 12008 --
NM_153498chr101541 ------
NM_153499chr1262995 2956 656 359 231 163 ----22327 524
NM_153500chr1262995 2956 656 359 231 163 ----22327 524
NM_153605chr331255 619 555 ------
NM_153607chr5103033 2867 2696 2676 2481 1949 610 367 179 39 ------
NM_153616chr1542235 2164 517 98 ------
NM_153617chr1542235 2164 517 98 ------
NM_153618chr1542235 2164 517 98 ------
NM_153619chr1553473 3402 2684 2527 1336 ------
NM_153640chr201127 ------
NM_153645chr2232458 2327 619 43147 1231 1028 223 32907 856 501 --
NM_153682chr21136 ------
NM_153686chr43563 87 65 ------
NM_153688chr1621775 1678 ------
NM_153689chr252244 1935 1851 556 162 ------
NM_153693chr125739 639 580 551 80 --1625 --
NM_153702chr4----1292 --
NM_153810chr1084734 4694 3634 1326 821 461 390 376 21076 1063 ----
NM_153825chr461745 1707 1583 1528 1456 228 130 ----
NM_170606chr731632 1473 661 --11750 --
NM_170665chr1264476 3894 3787 1605 1331 758 11181 ----
NM_170707chr12656 139 ------
NM_170708chr12656 139 ------
NM_170709chr892216 2207 2067 912 493 462 171 141 65 ------
NM_170710chr493194 3095 2994 2912 2489 2204 1987 848 227 32549 2423 400 ----
NM_170731chr1162759 1074 665 578 195 52 ------
NM_170732chr1162759 1074 665 578 195 52 ------
NM_170733chr1162759 1074 665 578 195 52 ------
NM_170734chr1162759 1074 665 578 195 52 ------
NM_170735chr1162759 1074 665 578 195 52 ------
NM_170750chrX3883 871 60 --2736 216 --
NM_170751chr621357 900 ------
NM_170752chr621357 900 ------
NM_171998chrX32540 2157 101 1942 --1352
NM_172020chr711385 ------
NM_172037chr821271 433 ------
NM_172069chr262337 2166 2083 1558 392 372 1147 1741 --
NM_172071chr1207481 7259 6741 6519 6028 5945 5920 5614 5030 4643 2891 2757 2750 1930 1348 1316 746 578 382 189 37055 7003 975 ----
NM_172103chr661854 1643 912 871 822 118 --1675 --
NM_172105chr661854 1643 912 871 822 118 --1675 --
NM_172159chr362271 1903 1842 1821 1448 609 1953 2642 312 --
NM_172160chr362271 1903 1842 1821 1448 609 1953 2642 312 --
NM_172164chr1153 ----1569
NM_172178chr1241384 501 398 44 152 11203 --
NM_172193chr1441252 1209 931 187 1300 ----
NM_172216chr1262897 2858 558 261 133 65 ----22229 426
NM_172226chr1262995 2956 656 359 231 163 ----22327 524
NM_172240chr1241334 269 122 22 ------
NM_172242chr103867 817 265 185 ----
NM_172250chr4149 ------
NM_172344chr221836 695 2746 294 --1549
NM_172373chr1331311 275 217 ------
NM_173054chr75945 395 355 343 186 ------
NM_173074chr21329 ------
NM_173083chr131313 815 132 11176 11003 --
NM_173172chr251463 1063 526 231 167 ------
NM_173198chr921199 380 11924 12412 1976
NM_173200chr921199 380 11924 12412 1976
NM_173214chr16168241 8168 8016 7588 7060 6847 6840 6578 6520 5743 5377 3247 2556 2179 2001 1973 27472 242 ----
NM_173355chr25737 315 262 85 77 1868 ----
NM_173359chr331856 1775 489 --11886 --
NM_173468chr496103 5728 5470 5381 5307 5099 2167 1154 901 15544 --11973
NM_173470chrX52181 710 536 206 93 --1960 --
NM_173473chr1052595 2452 848 199 121 12256 --12650
NM_173491chr511206 --21299 191 11160
NM_173495chrX62534 2517 1826 1615 1000 706 ------
NM_173511chr283877 3741 3567 3095 2489 2432 1573 735 13402 ----
NM_173519chr841745 1299 389 240 --1569 --
NM_173552chr372379 2044 1828 984 543 384 353 11973 ----
NM_173562chr642698 1312 1058 716 22784 1172 12519 12233
NM_173564chr72804 653 ------
NM_173567chr11202 ------
NM_173582chr11115960 5824 4498 4208 4017 2328 1992 1969 751 626 537 22453 987 16270 1518
NM_173591chr125901 825 746 250 111 1764 ----
NM_173602chr1262666 758 392 295 267 201 13711 13469 11360
NM_173642chr1118504 8405 7204 7106 7037 5700 1778 559 129 91 23 --38530 7194 6200 --
NM_173644chr2061804 1773 605 555 88 22 --11879 --
NM_173654chr362339 2094 1787 892 864 618 32392 2236 2196 ----
NM_173665chr53180 150 74 --1279 --
NM_173694chrX52161 976 663 445 201 1962 --11625
NM_173698chrX41778 1757 1420 369 11847 ----
NM_173797chr541243 1114 1029 196 ------
NM_173798chrX1459 ------
NM_173808chr164215 3589 3533 2969 1132 440 23312 1701 --23722 3024
NM_173822chr232041 641 141 --11371 --
NM_173827chr482836 2382 2308 2293 1153 972 847 57 1461 13153 --
NM_173829chr5116211 5746 5071 5049 4705 4226 4179 2194 1661 1191 233 --2264 132 --
NM_173830chr62765 137 ------
NM_173849chr141223 ------
NM_174858chr131236 880 816 --1192 --
NM_174900chr441171 220 195 179 21264 1246 ----
NM_174902chr1131884 1452 1235 2516 483 1411 11268
NM_174907chr3129 ------
NM_174909chr52863 695 ------
NM_174916chr1532238 2214 229 --2654 356 11601
NM_174921chr45738 472 425 412 356 1208 ----
NM_175056chr352061 384 360 205 105 ------
NM_175061chr731626 687 183 11475 1483 --
NM_175075chr83709 552 123 2202 117 ----
NM_175610chr1531285 1187 1113 --1124 2920 336
NM_175624chr12107813 6561 6334 6305 6239 6032 4928 4766 1353 413 26865 588 14837 --
NM_175625chr12107813 6561 6334 6305 6239 6032 4928 4766 1353 413 26865 588 14837 --
NM_175630chr23797 173 127 1755 1704 --
NM_175852chr153057 2634 345 197 174 --1427 --
NM_175854chr1372789 2649 2611 1744 746 402 94 ----11830
NM_175876chr152662 937 712 488 282 ------
NM_175884chr751471 1133 1016 998 970 ------
NM_176812chr20----1263 --
NM_176824chr41377 2397 124 --11273
NM_177438chr14103914 3827 3570 3247 3075 2849 2790 1645 1389 1198 34084 3636 1664 11313 --
NM_177452chr1482353 1560 684 358 281 262 120 62 12025 ----
NM_177538chr2107468 6453 6270 5962 5694 2638 2381 2248 1670 116 38139 997 180 ----
NM_177553chr112792 265 ------
NM_177966chr341630 1272 763 499 1687 --21847 1182
NM_177968chr271735 867 501 209 161 151 140 21408 477 1611 --
NM_177972chr1154428 4359 3377 2841 1660 ----1674
NM_177974chr1532264 1440 582 ------
NM_177985chr231712 1647 443 21483 146 ----
NM_177990chr2041962 1431 672 429 --12046 --
NM_177995chr941880 1741 1701 475 21886 241 --1151
NM_178006chr1352330 2283 2119 2015 1533 ------
NM_178007chr1352330 2283 2119 2015 1533 ------
NM_178011chr1062723 2272 2188 1116 310 211 13184 --12748
NM_178043chr4176 ------
NM_178150chr101265 ------
NM_178151chrX147860 7530 7110 6665 6318 6300 6115 5645 5444 2983 2518 2303 974 310 47360 7222 4891 1379 27213 2678 --
NM_178152chrX147860 7530 7110 6665 6318 6300 6115 5645 5444 2983 2518 2303 974 310 47360 7222 4891 1379 27213 2678 --
NM_178153chrX147860 7530 7110 6665 6318 6300 6115 5645 5444 2983 2518 2303 974 310 47360 7222 4891 1379 27213 2678 --
NM_178313chr231881 134 125 12122 11789 --
NM_178422chr11944 ------
NM_178498chr1163962 3877 3710 2902 1602 1417 --13605 --
NM_178500chr171285 --1139 --
NM_178507chr111758 ------
NM_178585chr493207 3040 2916 2662 2371 1217 938 757 347 ------
NM_178815chr1092791 2483 2317 2189 2107 1002 680 612 451 21059 714 11968 --
NM_178868chr3194 ------
NM_180989chr1382293 2281 2203 1830 876 557 469 140 1478 ----
NM_181077chr1562193 1580 1462 218 150 120 194 1894 --
NM_181265chr493194 3095 2994 2912 2489 2204 1987 848 227 32549 2423 400 ----
NM_181332chrX52770 2745 2319 1073 889 22375 1786 12309 --
NM_181349chr733012 2882 1254 ----11965
NM_181358chr184224 4215 3877 3333 3122 1422 1324 716 --12595 13932
NM_181443chr2072851 2650 2382 2335 1855 910 529 1356 1633 --
NM_181481chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_181482chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_181483chr18106731 6157 5951 4981 4591 940 868 721 323 223 15414 --26787 316
NM_181504chr543956 3912 2550 1485 --22708 2559 --
NM_181521chr16127209 6165 6008 5689 4657 4619 4576 2827 2547 2539 2299 829 37150 6772 4449 56159 2738 2694 305 201 12593
NM_181523chr543956 3912 2550 1485 --22708 2559 --
NM_181524chr543956 3912 2550 1485 --22708 2559 --
NM_181598chr14----1250 --
NM_181645chr113461 157 21 ------
NM_181656chr172941 228 ----1209
NM_181659chr2093088 2924 2491 1263 1246 667 580 546 133 1150 ----
NM_181659chr2093088 2924 2491 1263 1246 667 580 546 133 1150 ----
NM_181670chr1241161 565 317 279 11125 11191 --
NM_181701chr962343 2193 2008 709 277 208 12390 21818 394 --
NM_181705chr565218 5143 5122 4211 717 189 35481 994 320 --1301
NM_181706chr1191581 1569 1466 796 555 231 178 107 91 ------
NM_181711chr12126 ------
NM_181714chr661977 1619 1409 605 330 59 --11296 --
NM_181726chr41158 ------
NM_181782chr641790 507 401 359 ------
NM_181783chr1251518 1440 695 583 386 ------
NM_181787chr8113647 3593 3558 3080 2515 1316 1279 1084 656 504 434 198 ----
NM_181828chr2223001 1510 --1307 --
NM_181829chr2223001 1510 --1307 --
NM_181830chr2223001 1510 --1307 --
NM_181832chr2223016 1525 --1322 --
NM_181836chr542518 1076 294 175 12246 1618 --
NM_181838chr561350 1237 1174 1087 994 531 179 ----
NM_181861chr12102765 2678 2663 2652 2253 2035 744 520 357 340 ------
NM_181868chr12102765 2678 2663 2652 2253 2035 744 520 357 340 ------
NM_181869chr12112850 2763 2748 2737 2338 2120 829 605 442 425 59 ------
NM_181897chr351838 991 781 73 36 12378 ----
NM_182314chrX41382 1332 1248 325 --1281 --
NM_182485chr493730 3277 2808 2799 2677 2669 2385 1019 244 ------
NM_182503chr6125596 5207 3951 1696 1602 1568 1261 1134 846 555 408 136 43676 3383 1193 649 11176 23610 1380
NM_182515chr1996092 5595 5202 4891 4435 4340 2650 2042 1495 36403 6382 40 1648 26135 5931
NM_182551chr273549 3062 3009 1177 545 120 77 ------
NM_182641chr1751896 1322 779 438 392 1755 ----
NM_182643chr892440 2406 2316 1967 1709 1540 952 640 359 ------
NM_182645chr6----1698 --
NM_182646chr493730 3277 2808 2799 2677 2669 2385 1019 244 ------
NM_182649chr201218 ------
NM_182666chr34509 267 105 30 --1668 --
NM_182687chr16------1223
NM_182689chr11321 ------
NM_182690chr11383 ------
NM_182703chr1541390 522 396 47 1435 11112 --
NM_182729chr1271796 1757 1507 1447 1373 1183 220 --1732 --
NM_182734chr2043008 2311 1004 944 21152 870 32727 2527 815 13127
NM_182742chr1271796 1757 1507 1447 1373 1183 220 --1732 --
NM_182743chr1271796 1757 1507 1447 1373 1183 220 --1732 --
NM_182758chr1573535 3310 3283 3189 2726 428 62 11508 23141 2593 --
NM_182765chr1082222 2212 2029 1807 1584 1561 788 691 ------
NM_182796chr53808 643 607 1269 ----
NM_182830chr1422290 462 12194 11684 --
NM_182848chr1331626 1441 269 --11566 1119
NM_182896chr341768 1726 1566 189 --171 11377
NM_182898chr7106413 6341 5634 4828 4706 4211 4171 2281 1906 70 24100 1831 36559 6323 6305 --
NM_182899chr7106413 6341 5634 4828 4706 4211 4171 2281 1906 70 24100 1831 36559 6323 6305 --
NM_182907chr652164 456 284 274 261 21951 636 ----
NM_182918chr2131201 1083 441 1565 21397 1133 --
NM_182931chr74715 545 477 134 1584 ----
NM_182936chr1431246 1071 218 ------
NM_182948chr172418 1955 1221 1121 1058 862 791 32761 2439 367 ----
NM_182977chr53703 420 250 21016 801 ----
NM_183002chr1431246 1071 218 ------
NM_183004chr1472783 2692 999 935 829 756 256 22796 1564 ----
NM_183078chr663845 2973 2580 2519 1114 409 1181 --1665
NM_183227chr641498 1172 582 485 ------
NM_183234chr1551478 1425 1292 1167 306 ----11736
NM_183235chr1551478 1425 1292 1167 306 ----11736
NM_183236chr1551478 1425 1292 1167 306 ----11736
NM_183380chr64988 813 131 37 --1139 --
NM_183416chr151716 1666 1450 740 622 1762 ----
NM_183419chr851418 1285 1248 554 544 11392 11410 --
NM_183422chr1311056 ------
NM_194071chr7125459 5335 4654 4174 3805 3436 3399 1721 1671 1467 1200 736 14494 22117 423 --
NM_194247chr2114405 4158 3458 3305 2783 1765 1669 759 745 673 392 --1686 --
NM_194250chr2----1348 --
NM_194278chr14103776 3736 3636 3030 2780 1640 1579 1552 881 802 --1674 --
NM_194282chr462399 2221 1944 1116 469 92 --12160 1729
NM_194285chr1143070 2582 2080 135 22361 150 11293 --
NM_194286chr1275852 5543 5439 4785 4239 1579 558 22111 605 ----
NM_194291chr892828 2497 2182 1920 1214 966 561 352 319 ------
NM_194294chr8----1689 --
NM_194301chr1431152 963 716 1118 1427 --
NM_194314chr1135324 5160 4508 4103 3538 2136 2098 2071 1704 1362 631 297 171 1197 14446 --
NM_194317chr282498 2110 1902 642 540 433 274 245 ------
NM_194318chr1342464 1004 404 147 21678 993 ----
NM_194356chr1252256 2176 2088 1670 68 12167 ----
NM_194434chr18125579 5083 4746 4037 3545 2261 2247 1478 1423 793 727 572 14097 ----
NM_194439chr421316 151 21245 303 11400 --
NM_194442chr171745 1589 666 561 441 235 51 ----11419
NM_194454chr731734 1139 665 --11120 --
NM_194455chr731734 1139 665 --11120 --
NM_194456chr731734 1139 665 --11120 --
NM_197964chr7166 ------
NM_198123chr841290 313 280 237 --11239 --
NM_198124chr841290 313 280 237 --11239 --
NM_198128chr1842068 1686 767 529 12332 --1677
NM_198173chr14794 774 730 641 ------
NM_198174chr14794 774 730 641 ------
NM_198181chr15111974 1833 1011 902 704 309 249 219 189 161 131 21149 79 22577 2102 --
NM_198182chr241531 1472 961 171 ------
NM_198189chr23384 217 75 1865 1922 --
NM_198215chr1041243 1118 993 269 21344 466 ----
NM_198225chr1071956 1578 1355 622 612 368 145 11848 --11549
NM_198240chr1251267 873 475 452 358 21170 242 1385 --
NM_198268chr184224 4215 3877 3333 3122 1422 1324 716 --12595 13932
NM_198269chr184224 4215 3877 3333 3122 1422 1324 716 --12595 13932
NM_198270chrX53410 3289 3277 2391 396 --13133 1901
NM_198273chr593060 2959 2892 2234 2224 2106 2031 1083 738 22121 752 22462 2013 --
NM_198336chr731536 1183 704 ------
NM_198353chr42138 25 ------
NM_198391chr2041516 258 236 128 ------
NM_198399chr331803 1787 246 11145 11579 --
NM_198400chr15102722 2412 2264 1800 995 852 715 430 395 193 12835 1648 1140
NM_198401chr891770 1680 1625 1365 1337 625 539 523 122 1164 ----
NM_198427chr11443 ------
NM_198441chr132872 865 ------
NM_198468chr6114597 4426 4358 3915 3801 3595 3122 2886 1167 978 852 23878 1120 34533 3699 491 --
NM_198485chr392389 2057 1908 1819 1800 567 493 414 135 ------
NM_198503chr162044 1923 1702 1635 789 344 32181 1822 194 ----
NM_198507chr52438 103 ------
NM_198549chr162512 2085 1275 470 283 154 32670 2641 2563 1535 1548
NM_198569chr642476 2149 980 121 12072 ----
NM_198570chr71280 ------
NM_198581chr2226912 6797 6582 6111 6025 5819 5309 5013 2211 1692 1621 1604 1305 1145 1110 1061 928 600 558 417 395 166 --1980 1576
NM_198584chr842670 2103 1753 507 ------
NM_198595chr454856 4716 3774 1231 747 ------
NM_198715chr1136045 5828 5654 5426 5295 5171 4718 4357 4320 4023 1240 630 498 25444 4033 11075 --
NM_198793chr374062 3764 3273 3267 3054 2773 1535 21422 1409 13520 --
NM_198794chr1461319 1209 1090 937 916 309 ------
NM_198844chr175927 348 174 160 125 ------
NM_198859chr3135153 5031 4360 4016 3656 1996 1868 1754 1724 1409 681 456 196 11165 34667 4179 1078 --
NM_198896chr1172153 2100 2027 1576 1481 812 721 ----12084
NM_198965chr121427 ------
NM_198966chr121427 ------
NM_198969chr191121 ------
NM_198970chr191121 ------
NM_199039chr41791 ------
NM_199040chr1253186 2868 2540 1407 1044 22831 307 23850 3811 --
NM_199072chr762521 2461 2205 1295 454 359 12370 12578 11094
NM_199131chr1043586 2960 2241 294 13003 13075 --
NM_199168chr1061426 1263 1204 297 182 169 11300 11184 --
NM_199185chr51309 ------
NM_199188chr1293378 3253 2876 2644 2517 2510 1090 873 408 --24071 4065 --
NM_199190chr1293378 3253 2876 2644 2517 2510 1090 873 408 --24071 4065 --
NM_199205chr81271 ------
NM_199262chr1721560 107 ------
NM_199320chr492889 2861 2834 2681 2592 2463 2110 471 185 --12469 --
NM_199320chr492889 2861 2834 2681 2592 2463 2110 471 185 --12469 --
NM_199321chr175927 348 174 160 125 ------
NM_199324chr493525 3161 3134 2513 1298 1217 1110 810 273 1411 1690 --
NM_199327chr411075 ------
NM_199328chr2141195 1105 944 832 ----2878 815
NM_199421chr1484136 3734 1668 1586 1548 721 597 359 2346 317 ----
NM_199454chr173558 1685 1673 1473 672 579 503 ------
NM_199461chr1063142 2929 871 815 708 205 ------
NM_199482chr231844 1296 801 ------
NM_201269chr131395 1235 414 ------
NM_201434chr171731 --1674 --
NM_201441chr121190 ------
NM_201443chr121190 ------
NM_201521chr61388 ------
NM_201522chr61388 ------
NM_201523chr61388 ------
NM_201570chr10----11315 --
NM_201571chr10----11315 --
NM_201572chr10----11315 --
NM_201590chr10----11315 --
NM_201591chr451899 1821 1714 1433 660 130 ----
NM_201592chr451899 1821 1714 1433 660 130 ----
NM_201593chr10----11315 --
NM_201596chr10----11315 --
NM_201597chr10----11315 --
NM_201999chr441265 479 394 58 11045 1863 --
NM_203282chr1941708 1458 457 291 ------
NM_203327chr2054574 4523 4504 3339 771 24260 415 34402 2934 1029 --
NM_203349chr1582175 1840 1801 1643 678 635 522 434 ----12037
NM_203350chr171658 1571 1439 1129 232 177 153 ------
NM_203354chr143731 322 132 ------
NM_203355chr143731 322 132 ------
NM_203356chr143731 322 132 ------
NM_203372chr241608 1228 421 397 ----21130 533
NM_203390chr841788 1366 424 62 --2646 320 --
NM_203394chr1252501 1895 854 360 179 ------
NM_203403chr931056 795 44 ------
NM_203406chr542527 1935 535 81 --12854 --
NM_203446chr2152336 2053 1201 1021 882 2942 65 12578 --
NM_203447chr93639 242 82 2961 351 ----
NM_203453chr971725 1587 1427 697 615 473 101 ------
NM_203458chr153229 2658 1119 1033 829 12551 21110 881 --
NM_203459chr182432 2322 1850 1599 606 449 355 159 22626 2362 1582 --
NM_203463chr284407 3729 3396 3065 952 128 55 40 --53304 728 272 236 230 --
NM_203487chr131260 --2528 306 --
NM_203499chr171740 ------
NM_203504chr462647 2397 2105 1788 862 586 ------
NM_203505chr462647 2397 2105 1788 862 586 ------
NM_205834chr19130 ------
NM_205836chr51614 ------
NM_205852chr1232171 841 243 ------
NM_205860chr143175 3012 2878 2404 --1199 --
NM_206594chr153552 3539 3284 3202 3183 1825 1861 --
NM_206595chr153552 3539 3284 3202 3183 1825 1861 --
NM_206853chr663998 3966 3730 3290 3279 1479 21306 662 13803 --
NM_206854chr675259 5227 4991 4551 4540 3527 475 11923 25064 3684 --
NM_206855chr6126224 6192 5956 5516 5505 4492 4225 4019 3910 1440 539 445 2330 247 26029 4649 --
NM_206866chr2133202 2347 769 ----11111
NM_206876chr242669 2301 1053 764 23456 91 --12576
NM_206907chr583295 2287 2192 1276 667 378 112 72 22550 1089 ----
NM_206909chr8138326 7365 6867 5883 5750 3259 3068 2218 2175 2016 1797 1678 1551 36048 5991 5924 28013 5238 --
NM_206927chr113869 697 614 2901 228 ----
NM_206928chr113869 697 614 2901 228 ----
NM_206929chr113869 697 614 2901 228 ----
NM_206930chr113869 697 614 2901 228 ----
NM_207012chr1033527 733 613 --2818 107 --
NM_207015chr342182 1763 579 138 12190 11749 --
NM_207171chr142068 1548 333 296 --197 --
NM_207189chr11110 ------
NM_207303chr1063672 3333 2878 970 887 516 12703 ----
NM_207304chr1352664 2282 2069 1752 988 --11676 --
NM_207352chr452716 2126 850 375 178 --12364 --
NM_207406chr4106456 5787 5643 5458 5121 4743 4504 1823 1701 1311 56249 5694 5045 2006 640 14916 --
NM_207481chr261488 1369 1229 1107 571 531 11041 ----
NM_207517chr1571935 1883 1855 1723 1485 490 90 --1437 --
NM_207647chr932416 2189 277 42552 2290 2155 1582 1158 --
NM_212460chr751949 1659 626 506 233 ----11639
NM_212471chr1771961 1948 1480 1461 744 416 390 --1874 --
NM_212472chr1771961 1948 1480 1461 744 416 390 --1874 --
NM_212554chr10--1462 11331 1315
NM_212558chr9124123 4082 3716 3567 3374 3344 2950 1509 1444 1337 1022 1014 21265 798 1485 --
NM_213589chr274511 3934 3452 2068 1081 383 282 ------
NM_213651chr191821 1510 1467 1342 1311 1200 1151 630 105 21353 699 ----