TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-106a-3p
miRNA Sequence: CUGCAAUGUAAGCACUUCUUAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51877 ------
NM_000024chr52336 100 193 ----
NM_000038chr53843 339 292 11331 11275 --
NM_000052chrX32986 536 85 ------
NM_000067chr81668 ------
NM_000084chrX66948 5403 2720 2634 1343 147 26843 1575 11088 --
NM_000089chr72758 166 ------
NM_000093chr92694 596 12218 12392 --
NM_000108chr72573 233 ------
NM_000109chrX62641 2492 2368 892 514 281 1402 12010 --
NM_000138chr1532602 2296 1770 ----12306
NM_000161chr142448 53 11996 ----
NM_000163chr51753 ------
NM_000167chrX21812 270 ----11725
NM_000173chr171430 ------
NM_000216chrX73843 3630 3256 3212 3168 1137 29 34038 3561 1150 12777 --
NM_000217chr1243993 3833 2131 151 1835 ----
NM_000232chr453175 2943 2621 701 67 22814 1077 1714 --
NM_000245chr741869 1840 1773 104 21915 1638 ----
NM_000248chr352373 2128 2095 947 215 12603 ----
NM_000259chr1586331 5917 5870 4804 2236 2171 1667 920 25552 1263 15989 14837
NM_000264chr972555 1291 912 402 369 149 132 --13243 12763
NM_000267chr1733268 3121 1188 23256 302 13400 --
NM_000276chrX2195 98 12251 12119 --
NM_000280chr112958 143 1967 ----
NM_000314chr10194 1904 ----
NM_000318chr8----32960 2890 217 12410
NM_000321chr1351715 1707 1547 188 48 ------
NM_000328chrX--140 ----
NM_000329chr14834 822 802 785 ------
NM_000332chr666927 5145 1590 898 645 380 ----15509
NM_000345chr41849 ------
NM_000348chr231433 1084 261 11562 ----
NM_000378chr1141103 1008 365 258 11236 ----
NM_000390chrX83399 2923 2747 2446 2285 2258 1029 299 13293 ----
NM_000415chr121902 31002 677 322 ----
NM_000430chr1773779 3690 3588 2698 1487 1461 180 12599 ----
NM_000447chr11426 ------
NM_000448chr1133053 2899 55 32873 2391 666 22958 2548 --
NM_000452chr1322068 692 ------
NM_000459chr93830 652 321 ----1839
NM_000461chr364465 4078 3772 3406 183 61 ------
NM_000462chr1521333 423 --11168 --
NM_000474chr7152 ------
NM_000484chr213810 798 45 ----1709
NM_000489chrX42655 2319 1343 983 12193 1648 --
NM_000493chr621117 955 ------
NM_000495chrX178 ------
NM_000503chr841528 1358 1352 369 --1654 --
NM_000516chr20165 ------
NM_000551chr351677 1623 319 167 132 ------
NM_000555chrX77160 6912 6598 6425 2633 2515 2314 --152 1144
NM_000590chr5----1124 --
NM_000600chr71370 ------
NM_000609chr1052986 2608 816 249 109 ------
NM_000610chr1163006 2879 2314 2270 438 192 12529 --1105
NM_000618chr1246439 4918 337 165 1693 ----
NM_000618chr1246439 4918 337 165 1693 ----
NM_000627chr21316 2721 128 2786 83 --
NM_000633chr1865213 4861 3912 1848 1721 68 13613 ----
NM_000685chr31886 ------
NM_000685chr31886 ------
NM_000686chrX21187 173 1257 1393 1416
NM_000693chr1521636 617 --11580 --
NM_000719chr12106665 6647 6536 6234 6026 5535 5065 1541 967 742 26729 1631 26506 5355 --
NM_000793chr1445039 4779 1688 396 ----11332
NM_000806chr551865 1823 1735 1358 87 --1660 --
NM_000809chr467931 6045 6032 3529 1697 1514 11760 39116 850 655 18318
NM_000811chr51288 ----1502
NM_000813chr585564 3751 3709 1894 1558 1488 404 332 11396 45441 3646 1386 1283 14773
NM_000814chr152489 130 14094 23496 990 --
NM_000824chr43797 220 43 1128 1105 --
NM_000826chr452249 2038 2009 1946 1924 2862 308 ----
NM_000829chr1132323 923 782 ----1661
NM_000838chr632625 2144 669 --12070 12266
NM_000845chr71370 ------
NM_000859chr541695 1510 249 89 ------
NM_000868chrX31959 582 98 22559 2414 ----
NM_000875chr1546131 5549 5210 761 16944 26566 5660 --
NM_000876chr621297 1274 --21266 1074 --
NM_000891chr1753659 3638 2647 1202 425 12956 ----
NM_000899chr1233267 1466 1266 23166 3037 --13910
NM_000905chr7----1138 --
NM_000912chr842686 2672 724 382 --13521 13296
NM_000918chr171668 ------
NM_000919chr51204 2496 94 ----
NM_000921chr122170 117 ----1207
NM_000935chr311161 ------
NM_000940chr7165 ------
NM_000944chr432036 1935 410 ----1588
NM_000945chr22713 663 --1805 --
NM_000950chrX72922 2776 2409 2363 1155 1065 884 32395 1092 389 ----
NM_000959chr163959 2938 2729 2703 731 463 ------
NM_000961chr2053999 3249 3128 1466 560 --12675 11165
NM_000966chr1211067 ------
NM_000989chr8186 ------
NM_001001323chr1232882 2180 915 1292 --1323
NM_001001389chr1163006 2879 2314 2270 438 192 12529 --1105
NM_001001390chr1163006 2879 2314 2270 438 192 12529 --1105
NM_001001391chr1163006 2879 2314 2270 438 192 12529 --1105
NM_001001392chr1163052 2925 2360 2316 484 238 12575 --1151
NM_001001395chr1252485 1794 587 379 290 1305 ----
NM_001001419chr554817 2056 1134 469 287 24952 811 13223 --
NM_001001420chr554817 2056 1134 469 287 24952 811 13223 --
NM_001001433chr2052577 2290 1108 1075 204 22838 684 ----
NM_001001481chr843267 2558 2497 351 --1593 --
NM_001001484chr10------11589
NM_001001549chr731783 439 425 12802 11886 --
NM_001001550chr731783 439 425 12802 11886 --
NM_001001555chr731783 439 425 12802 11886 --
NM_001001664chr282876 2704 1414 1252 1227 1005 301 135 --13864 --
NM_001001668chr19103874 3814 3385 3060 3047 2809 2791 780 489 280 11232 ----
NM_001001706chr61237 1903 1278 --
NM_001001740chr12228 24 ------
NM_001001740chr12228 24 ------
NM_001001890chr2143507 3489 3195 3018 1515 ----
NM_001001933chr1--1391 ----
NM_001001937chr18145 ------
NM_001001974chr102443 244 --12006 --
NM_001002026chr332445 958 859 ------
NM_001002243chr24732 604 376 28 ------
NM_001002257chr22742 161 --1579 --
NM_001002258chr221871 1835 1315 --11846
NM_001002295chr101322 1296 1279 --
NM_001002843chr152796 469 2980 912 ----
NM_001002860chr1474501 3737 3382 1069 429 353 195 ----14581
NM_001003407chr1064694 3107 1904 1788 1271 1254 ------
NM_001003408chr1064694 3107 1904 1788 1271 1254 ------
NM_001003652chr18118558 8181 7979 6461 5818 5280 3138 1127 805 427 62 17029 26792 1484 --
NM_001003674chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_001003675chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_001003679chr111928 12022 12163 --
NM_001003681chr2252042 1930 1854 69 43 1616 11750 --
NM_001003688chr411226 1231 --1218
NM_001003694chr3----1261 --
NM_001003712chr1223534 359 ------
NM_001003760chr652696 2395 2252 1108 113 1119 ----
NM_001003790chr81299 ------
NM_001003791chr81299 ------
NM_001003792chr3------11007
NM_001003793chr3------11007
NM_001003810chr42267 202 ------
NM_001004308chrX21216 1048 --11476 --
NM_001004317chr654287 3505 3279 3067 936 2770 40 ----
NM_001004346chr41131 ------
NM_001004360chr22458 74 ------
NM_001004419chr12104407 4247 4190 3862 3658 3075 3013 2895 1569 760 ------
NM_001005158chr32481 475 --1371 --
NM_001005159chr32481 475 --1371 --
NM_001005266chr151109 ------
NM_001005267chr151109 ------
NM_001005268chr151109 ------
NM_001005269chr151109 ------
NM_001005335chr191242 ------
NM_001005375chrY11839 ------
NM_001005386chr232225 943 54 ------
NM_001005463chr103895 790 619 1633 ----
NM_001005473chr575996 5904 4730 4556 1489 770 450 --148 --
NM_001005474chr341526 1115 551 258 1358 ----
NM_001005782chr24854 798 728 169 --1268 --
NM_001005849chr172192 156 ----1448
NM_001005861chr31858 ------
NM_001006115chr3156 1360 ----
NM_001006117chrY279 28 ------
NM_001006600chr572236 1933 1777 1743 1531 691 282 ------
NM_001006610chr162308 159 ----1269
NM_001006612chrX3434 155 147 ------
NM_001006613chrX3434 155 147 ------
NM_001006614chrX3434 155 147 ------
NM_001006933chrX143 ----1220
NM_001007023chr1445039 4779 1688 396 ----11332
NM_001007024chr1754338 3046 756 632 579 ------
NM_001007025chr1754338 3046 756 632 579 ------
NM_001007067chr81288 ------
NM_001007068chr81288 ------
NM_001007069chr81288 ------
NM_001007070chr81288 ------
NM_001007097chr974640 1741 1705 1570 1502 1171 316 14796 --13982
NM_001007102chr62545 347 1507 ----
NM_001007156chr1541729 1704 1416 80 11816 11294 --
NM_001007157chr7--183 ----
NM_001007237chr142851 2620 2544 2323 --12538 --
NM_001007246chr2141597 684 314 66 11831 ----
NM_001007257chr151474 1250 1159 1088 47 11530 ----
NM_001007267chr21683 --1285 1149
NM_001007466chr655202 4615 3946 3660 1445 11407 ----
NM_001007565chr31128 ------
NM_001007595chr151287 ------
NM_001007794chr12526 195 1257 ----
NM_001008225chr72651 218 --1772 --
NM_001008239chr1873630 2859 2736 2571 1368 1359 75 1669 13541 --
NM_001008391chr114251 238 195 139 ------
NM_001008408chr776398 6241 2152 1592 1077 407 295 14997 --14689
NM_001008495chr842273 1886 130 92 11685 --1786
NM_001008540chr22102 89 ------
NM_001008541chr1042290 2175 1545 678 ------
NM_001008541chr1042290 2175 1545 678 ------
NM_001008564chr1362224 2215 1972 1502 725 86 11621 22089 1762 --
NM_001008707chr1411887 1239 2544 342 --
NM_001008738chr522123 869 --21792 144 --
NM_001008783chr62684 569 ------
NM_001008895chr13--11415 ----
NM_001008938chr111141 ------
NM_001009554chr473959 3466 1669 924 512 472 361 1829 24085 1892 --
NM_001009554chr473959 3466 1669 924 512 472 361 1829 24085 1892 --
NM_001009571chr761678 1433 1152 391 88 46 ------
NM_001009899chr316556 14010 26406 1062 --
NM_001009909chr1143735 3243 1082 499 13720 12750 --
NM_001009955chr11566 --139 --
NM_001009955chr11566 --139 --
NM_001009993chr234357 3559 1024 24533 4255 ----
NM_001010000chr1853525 3503 3030 2674 1022 ----1141
NM_001010844chr6123 ------
NM_001010853chr662701 2441 2157 912 870 487 ------
NM_001010854chr142520 230 ------
NM_001010861chr122787 2277 185 --1320
NM_001010888chrX84619 4528 4268 3003 1291 1172 970 872 --13635 --
NM_001010895chr91161 ------
NM_001010934chr711173 --1735 --
NM_001010986chrX42199 1902 1818 907 1148 ----
NM_001011515chr4--11026 ----
NM_001011516chr4--11026 ----
NM_001011537chr342096 1906 1488 452 --11472 11718
NM_001011546chr202805 666 ----1734
NM_001011553chr71953 1981 ----
NM_001011658chrX22117 1755 11854 --167
NM_001011663chr103945 813 750 ------
NM_001011666chr766448 4679 4265 1366 1103 764 21013 964 1692 --
NM_001011708chr241812 1806 559 242 22483 815 21926 1008 --
NM_001011713chr1431254 1026 153 1365 11092 --
NM_001012337chr3146 ------
NM_001012393chr1125086 1007 14638 25131 1874 --
NM_001012420chr1551893 770 725 369 242 22957 2498 ----
NM_001012423chr1541893 770 725 242 ------
NM_001012751chr1051487 1321 755 317 178 ------
NM_001012755chrX74944 4792 4770 4332 1643 820 750 13764 34841 4264 123 --
NM_001012761chr53416 200 146 ------
NM_001012968chrX102729 2721 2410 2385 2324 2220 2162 1739 859 194 --1864 12819
NM_001012977chrX1112 --1932 11206
NM_001012979chrX143 ----1220
NM_001012989chrX1575 ------
NM_001013031chr1073416 3387 3277 2473 2155 876 749 --12708 --
NM_001013406chr731453 1116 321 --1435 --
NM_001013415chr421253 568 ------
NM_001013843chr151914 1605 ----
NM_001014434chr11303 ------
NM_001014797chr1087333 6483 6435 6333 1848 933 424 295 1555 17834 --
NM_001014831chr191816 ------
NM_001014832chr191816 ------
NM_001014834chr191816 ------
NM_001014835chr191816 ------
NM_001015045chr421565 155 --11777 --
NM_001015053chr17136 ------
NM_001015508chr81484 ------
NM_001015877chrX53056 2547 2264 2210 981 12962 ----
NM_001017368chr172492 102 --12697 --
NM_001017369chr431038 899 68 ------
NM_001017371chr241351 1217 191 26 1353 ----
NM_001017395chr343413 2927 2674 21 23327 162 ----
NM_001017396chr222170 1454 1779 ----
NM_001017424chr131916 1305 691 11592 11535 --
NM_001017425chr131916 1305 691 11592 11535 --
NM_001017440chr7107833 7507 6679 6178 5721 5492 5256 267 164 29 ------
NM_001017926chr821585 390 ------
NM_001017930chrX51347 1303 1191 944 197 21236 1116 ----
NM_001017969chr94488 458 102 42 ------
NM_001017979chr45774 624 590 144 138 ----1254
NM_001017999chr121856 743 12122 ----
NM_001017999chr121856 743 12122 ----
NM_001018000chr121856 743 12122 ----
NM_001018000chr121856 743 12122 ----
NM_001018001chr121856 743 12122 ----
NM_001018004chr15----2729 700 --
NM_001018005chr151150 ------
NM_001018006chr15----2729 700 --
NM_001018007chr15----2729 700 --
NM_001018009chr32261 62 ------
NM_001018020chr15----2729 700 --
NM_001018037chr941428 949 567 450 11361 ----
NM_001018053chr111965 11876 ----
NM_001018056chr9--1420 ----
NM_001018064chr911566 ------
NM_001018108chr1512257 ------
NM_001018115chr31621 ------
NM_001020658chr11502 31507 1118 1111 ----
NM_001020658chr11502 31507 1118 1111 ----
NM_001023567chr1572476 1914 1596 795 773 369 242 12349 ----
NM_001024071chr14--11018 --1167
NM_001024218chr141691 ------
NM_001024226chr1--1245 ----
NM_001024227chr1--1245 ----
NM_001024228chr1--1245 ----
NM_001024455chrX42642 1041 778 64 --1817 1934
NM_001024463chr1521060 936 ------
NM_001024649chr552496 2161 1972 956 403 1442 11862 --
NM_001024668chr122695 26 1931 ----
NM_001024847chr332449 827 199 --1570 --
NM_001024956chr1195781 5186 4594 4540 4380 4188 932 725 374 11053 13619 25801 2252
NM_001025076chr1055812 5061 3841 256 127 --25036 1313 --
NM_001025077chr1097170 6419 5199 4795 1614 1485 1239 910 100 --26394 2671 --
NM_001025079chr364012 3642 3268 1547 1083 819 ------
NM_001025105chr521161 250 ------
NM_001025201chr21243 ------
NM_001025356chr1242898 2731 1060 117 ------
NM_001025366chr621637 1192 ------
NM_001025366chr621637 1192 ------
NM_001025367chr621637 1192 ------
NM_001025367chr621637 1192 ------
NM_001025368chr621637 1192 ------
NM_001025368chr621637 1192 ------
NM_001025369chr621653 1208 ------
NM_001025369chr621653 1208 ------
NM_001025370chr621637 1192 ------
NM_001025370chr621637 1192 ------
NM_001025579chr1731040 1017 324 ----1459
NM_001025580chrX64272 3753 2887 2865 2807 119 ------
NM_001025595chr4--21531 350 ----
NM_001025780chr91300 1533 ----
NM_001029835chr7--1349 ----
NM_001029858chr663098 2252 693 373 312 69 --12487 --
NM_001029860chr81241 --1146 --
NM_001029863chr642769 2263 274 53 ----11256
NM_001029875chr552938 1976 921 521 246 ------
NM_001029882chr13476 470 439 1232 ----
NM_001029882chr13476 470 439 1232 ----
NM_001030007chr1663868 3372 2604 1193 595 165 ------
NM_001030055chr1464549 4325 4003 3873 1504 1034 21650 263 ----
NM_001030272chr111398 ------
NM_001030273chr111398 ------
NM_001030287chr131116 975 400 1740 ----
NM_001031695chr2265224 5000 4185 3857 3634 1462 161 ----
NM_001031716chr231026 394 60 ------
NM_001031804chr1653792 1441 1341 1093 739 13380 ----
NM_001031812chr592288 1998 1664 1654 1560 1539 880 706 681 ------
NM_001032221chr931431 357 192 ------
NM_001032279chr111378 ------
NM_001032280chr641516 1281 1071 478 --11286 --
NM_001032282chr821195 1146 1850 ----
NM_001032283chr121896 1860 ----
NM_001032284chr121896 1860 ----
NM_001032288chr2021601 1395 1610 ----
NM_001032293chr172502 95 1203 --1566
NM_001032393chrX1747 ------
NM_001032394chr622653 2489 163 --12554
NM_001033057chr321954 1380 21537 575 11515 --
NM_001033112chr51112 3866 605 76 ----
NM_001033557chr2----1948 --
NM_001033561chr171735 1872 --1355
NM_001033566chr171381 ------
NM_001033568chr171381 ------
NM_001033756chr631571 1126 724 ------
NM_001033756chr631571 1126 724 ------
NM_001033925chr1032191 686 604 2792 26 ----
NM_001034841chr16115392 5304 4082 3858 3653 3364 2065 1893 1625 1458 97 --24092 730 --
NM_001034852chr145590 546 392 363 77 1246 ----
NM_001034954chr1053281 3126 3043 844 225 --13200 12896
NM_001034955chr1053281 3126 3043 844 225 --13200 12896
NM_001034956chr1053281 3126 3043 844 225 --13200 12896
NM_001034957chr1053281 3126 3043 844 225 --13200 12896
NM_001037132chr74731 585 475 422 ------
NM_001037133chr74731 585 475 422 ------
NM_001037165chr788803 8008 2840 2493 2352 2011 988 217 --1613 --
NM_001037317chr122787 2277 185 --1320
NM_001037324chr31166 ------
NM_001037331chr181107 ------
NM_001037334chr1841887 647 551 484 12052 11712 --
NM_001037339chr131768 1701 1412 ------
NM_001037340chr131768 1701 1412 ------
NM_001037341chr131768 1701 1412 ------
NM_001037341chr131768 1701 1412 ------
NM_001037553chr2144187 4111 4054 3127 --14412 --
NM_001037954chr1153366 3261 2886 1128 402 13141 ----
NM_001038640chr152840 309 ------
NM_001038702chr532678 1713 1038 1646 ----
NM_001039029chr1241929 1300 1285 54 --1666 --
NM_001039465chr141189 ------
NM_001039538chr233052 444 287 2884 602 11475 1405
NM_001039547chr387073 5698 2636 2565 2271 1885 1458 136 25853 1964 --11531
NM_001039569chr243279 3108 817 435 1359 ----
NM_001039585chr174216 3195 2986 2960 988 720 236 ------
NM_001039590chrX43792 3067 818 594 12781 13155 13554
NM_001039591chrX43792 3067 818 594 12781 13155 13554
NM_001039618chr1135682 5372 4271 ----15469
NM_001039690chr1611856 --12375 --
NM_001039840chrX116030 5889 4860 4792 4609 4002 1860 821 629 565 340 ------
NM_001039937chr1331662 690 99 1452 13972 --
NM_001040020chr721563 151 --11259 1175
NM_001040057chr721247 1149 ------
NM_001040100chr31195 --131 --
NM_001040110chr731717 211 158 ------
NM_001040135chr71126 ----1796
NM_001040142chr231871 868 528 ------
NM_001040143chr231871 868 528 ------
NM_001040144chr1611856 --12375 --
NM_001040146chr1611856 --12375 --
NM_001040152chr785112 5068 5041 4574 4541 4054 3709 749 ------
NM_001040153chr133215 165 129 --2756 396 1653
NM_001040158chr51379 ------
NM_001040159chr451082 970 526 440 139 ------
NM_001040202chr442207 1705 891 58 12038 ----
NM_001040214chr63942 577 336 21796 470 ----
NM_001040260chr431131 1062 474 ------
NM_001040261chr431131 1062 474 ------
NM_001040272chr931821 1815 240 12282 22241 642 --
NM_001040284chr1695887 5809 5603 5427 4627 2170 1960 1266 1021 25216 589 ----
NM_001040402chr472666 2467 2244 711 451 261 174 1334 11064 12604
NM_001040409chr23785 768 327 1347 ----
NM_001040429chr1333394 2900 1034 21142 1119 ----
NM_001040441chr145227 4673 1990 996 --45482 1874 1020 157 --
NM_001040450chr1562865 2593 2251 1852 921 520 ------
NM_001040453chr1562865 2593 2251 1852 921 520 ------
NM_001040624chr842473 2467 236 26 1357 ----
NM_001040625chr842473 2467 236 26 1357 ----
NM_001040626chr842473 2467 236 26 1357 ----
NM_001040627chr842473 2467 236 26 1357 ----
NM_001040628chr842473 2467 236 26 1357 ----
NM_001040629chr842473 2467 236 26 1357 ----
NM_001040630chr842473 2467 236 26 1357 ----
NM_001040665chr744908 4780 1623 546 23210 215 --14616
NM_001040666chr72610 482 ------
NM_001040712chr912631 21026 517 22444 2188 --
NM_001040876chr41162 ------
NM_001042353chr202537 158 ------
NM_001042355chr1674765 4567 3682 3411 3313 1186 89 --152 --
NM_001042357chr1021415 265 ----11352
NM_001042358chr1021415 265 ----11352
NM_001042360chr1021415 265 ----11352
NM_001042361chr1021446 296 ----11383
NM_001042363chr1021415 265 ----11352
NM_001042364chr1021446 296 ----11383
NM_001042365chr1021446 296 ----11383
NM_001042387chr1021446 296 ----11383
NM_001042388chr182619 346 --1127 --
NM_001042389chr1021415 265 ----11352
NM_001042390chr1021415 265 ----11352
NM_001042392chr1021415 265 ----11352
NM_001042393chr1021446 296 ----11383
NM_001042395chr1021415 265 ----11352
NM_001042396chr1021446 296 ----11383
NM_001042397chr1021446 296 ----11383
NM_001042412chr1674765 4567 3682 3411 3313 1186 89 --152 --
NM_001042413chr973987 3863 2876 2827 2502 1173 925 1706 ----
NM_001042425chr641516 1281 1071 478 --11286 --
NM_001042440chr531932 1917 542 11859 ----
NM_001042441chr531932 1917 542 11859 ----
NM_001042442chr531932 1917 542 11859 ----
NM_001042443chr531932 1917 542 11859 ----
NM_001042444chr531932 1917 542 11859 ----
NM_001042445chr531932 1917 542 11859 ----
NM_001042446chr531932 1917 542 11859 ----
NM_001042453chrX31683 1665 1077 11455 11477 --
NM_001042473chr103359 196 105 12181 ----
NM_001042481chr1462498 2223 1885 1773 487 163 1269 ----
NM_001042492chr1733268 3121 1188 23256 302 13400 --
NM_001042494chr1533740 3453 2454 12981 --1688
NM_001042495chr1533740 3453 2454 12981 --1688
NM_001042496chr1533740 3453 2454 12981 --1688
NM_001042497chr1533740 3453 2454 12981 --1688
NM_001042506chrX21364 112 --21215 932 --
NM_001042510chr851969 1605 1365 618 554 2407 252 1571 --
NM_001042511chr851969 1605 1365 618 554 2407 252 1571 --
NM_001042543chr421595 505 11616 1117 --
NM_001042548chr21695 ------
NM_001042555chr12104781 4549 3911 3902 3769 3598 1397 955 804 373 24797 3759 24013 3748 --
NM_001042599chr277733 7245 6761 5076 3136 2270 2106 1719 ----
NM_001042601chr333044 372 124 ------
NM_001042603chr1234852 4603 4324 12107 15233 15243
NM_001042604chr364694 3638 3591 2980 1625 1558 ------
NM_001042635chr14----160 --
NM_001042681chr111632 --2979 483 --
NM_001042682chr111632 --2979 483 --
NM_001042682chr111632 --2979 483 --
NM_001042728chr1211067 ------
NM_001042749chrX31837 1630 804 1535 ----
NM_001042750chrX31837 1630 804 1535 ----
NM_001042751chrX31837 1630 804 1535 ----
NM_001043351chr11505 ----12236
NM_001044722chr592288 1998 1664 1654 1560 1539 880 706 681 ------
NM_001044723chr592288 1998 1664 1654 1560 1539 880 706 681 ------
NM_001045556chr82281 55 ------
NM_001045557chr82281 55 ------
NM_001046chr532990 2339 2150 --12159 --
NM_001048183chr1103754 3701 3133 2476 2460 1522 1388 921 228 104 --23759 536 --
NM_001049chr1442027 1698 980 824 ----12465
NM_001071775chr1351908 1385 454 243 59 --164 --
NM_001083620chr452247 2036 2007 1944 1922 2861 307 ----
NM_001085487chr1176 ------
NM_001106chr337521 6377 211 39520 9071 9017 29549 3543 --
NM_001113490chrX42370 1151 815 722 --12523 --
NM_001121chr1031891 1791 427 --144 --
NM_001122679chr51877 ------
NM_001124chr111526 ------
NM_001128chr1663868 3372 2604 1193 595 165 ------
NM_001148chr441719 816 675 437 1610 ----
NM_001149chr101947 ------
NM_001151chr4165 ------
NM_001152chrX1198 ------
NM_001156chr102646 161 1237 ----
NM_001160chr1222097 113 --1946 --
NM_001167chrX56585 6230 5988 5213 1682 --26730 4261 22161 1837
NM_001172chr14--1135 ----
NM_001173chr1464549 4325 4003 3873 1504 1034 21650 263 ----
NM_001174chrX12060 12109 ----
NM_001178chr111398 ------
NM_001186chr2152856 2583 2564 2385 516 11025 ----
NM_001200chr201411 ------
NM_001201chr473875 3744 3264 3116 1322 518 420 1769 ----
NM_001204chr2137693 7147 6823 6420 6060 5669 5634 5044 2582 2519 2313 713 327 37225 6556 2859 --13006
NM_001206chr942819 2685 1069 160 --1179 --
NM_001219chr711662 ------
NM_001256chr1752922 927 738 694 488 1710 ----
NM_001259chr776250 5896 3921 2030 1996 1148 194 14081 11158 11587
NM_001269chr1--1919 ----
NM_001270chr531133 758 213 11012 ----
NM_001271chr1532869 2600 1075 23103 983 --13235
NM_001284chr51431 ------
NM_001286chr132808 2728 2699 --1728 12873
NM_001290chr41831 3418 248 58 ----
NM_001300chr101300 ------
NM_001304chr1742751 1469 891 863 ------
NM_001310chr1272902 1902 853 369 323 298 230 ------
NM_001326chr11--1348 ----
NM_001351chr311818 ------
NM_001356chrX32415 1579 217 ----12220
NM_001364chr1174687 3537 1865 1841 1580 848 94 --1201 14723
NM_001378chr21412 ------
NM_001386chr821869 1652 --11657 1962
NM_001387chr542736 2587 1973 178 12324 --12993
NM_001390chr1873517 3501 3368 3138 3070 2797 2450 13483 --12501
NM_001396chr21--52566 2534 1002 992 160 1705 12488
NM_001397chr131777 1711 78 12681 ----
NM_001400chr11286 ------
NM_001401chr921232 1010 ----11075
NM_001408chr111611 ------
NM_001412chrX52365 652 388 376 278 ------
NM_001416chr171453 ------
NM_001418chr112753 470 1284 ----
NM_001418chr112753 470 1284 ----
NM_001419chr1954406 4309 1912 1584 505 --34909 915 786 1452
NM_001423chr1221422 520 12023 ----
NM_001427chr71386 --11780 --
NM_001432chr453778 3723 3650 1327 797 12592 ----
NM_001438chr183565 3490 3400 3281 2755 2452 2351 794 12315 1773 --
NM_001451chr1631368 1347 903 ----11080
NM_001453chr631746 1145 683 1500 ----
NM_001463chr2387 80 57 ------
NM_001482chr151646 ------
NM_001494chr10--178 ----
NM_001495chr8--11108 ----
NM_001498chr621151 322 21216 1054 ----
NM_001514chr12443 135 ------
NM_001518chr711116 ------
NM_001530chr141464 --31082 242 237 --
NM_001533chr191242 ------
NM_001542chr142851 2620 2544 2323 --12538 --
NM_001546chr62507 257 --1417 --
NM_001554chr1----1110 --
NM_001584chr111201 11234 --21111 248
NM_001587chrX2195 98 12251 12119 --
NM_001604chr112958 143 1967 ----
NM_001614chr172687 162 ------
NM_001614chr172687 162 ------
NM_001616chr273489 3387 2970 2242 1034 435 172 1468 ----
NM_001621chr742768 2644 2192 1198 31228 1016 970 ----
NM_001621chr742768 2644 2192 1198 31228 1016 970 ----
NM_001642chr111243 --1299 --
NM_001655chr111245 ------
NM_001656chr511584 ------
NM_001658chr1--1245 ----
NM_001663chr1462595 2328 2084 1777 664 499 32440 649 466 ----
NM_001668chr172198 2051 1955 1842 1715 706 282 --22099 436 --
NM_001674chr131116 975 400 1740 ----
NM_001677chr12387 311 ------
NM_001682chr1232596 1894 629 ----137
NM_001689chr221871 1835 1315 --11846
NM_001695chr843843 2774 930 64 ------
NM_001698chr91341 ------
NM_001701chr9------1543
NM_001704chr63521 455 41 ------
NM_001709chr1152756 961 511 299 255 22832 2407 ----
NM_001718chr611229 ------
NM_001726chr11107 ------
NM_001730chr131389 --1161 --
NM_001730chr131389 --1161 --
NM_001742chr721737 1663 ----1139
NM_001746chr552496 2161 1972 956 403 1442 11862 --
NM_001750chr531932 1917 542 11859 ----
NM_001754chr2143507 3489 3195 3018 1515 ----
NM_001755chr163652 403 93 --32199 1595 1540 --
NM_001759chr1253958 1289 945 853 746 31491 1382 439 1730 --
NM_001769chr122322 132 ------
NM_001777chr364012 3642 3268 1547 1083 819 ------
NM_001783chr191316 ------
NM_001788chr71953 1981 ----
NM_001797chr16----1757 --
NM_001802chr165986 876 368 115 36 ------
NM_001822chr21243 ------
NM_001825chr51101 ------
NM_001830chrX53390 1593 1548 1403 830 43980 3722 1606 1057 ----
NM_001839chr12719 112 --1751 --
NM_001845chr1311334 ------
NM_001850chr31143 ------
NM_001855chr92562 345 ------
NM_001859chr983950 3782 3329 2643 1341 845 730 34 13929 23806 754 --
NM_001880chr22277 263 ------
NM_001892chr521161 250 ------
NM_001901chr61150 ------
NM_001904chr31341 1796 ----
NM_001920chr122540 55 ------
NM_001923chr112490 451 ------
NM_001935chr2------1728
NM_001950chr16--1751 ----
NM_001951chr81644 ------
NM_001964chr521169 475 ------
NM_001967chr34615 577 467 67 ------
NM_001969chr1432986 2406 551 1470 33124 2997 715 --
NM_001980chr1222268 756 ------
NM_001991chr1732193 1814 372 ------
NM_001993chr1138 --11018 --
NM_001995chr421392 193 1245 --11346
NM_001999chr511209 ------
NM_002006chr4105754 5715 5404 4427 2298 2132 1459 1369 209 153 ------
NM_002009chr151668 1244 ----
NM_002013chr14--196 ----
NM_002015chr1373252 2624 2529 2365 560 357 293 ----11003
NM_002025chrX128547 8211 7261 7198 7033 6318 5833 5705 2281 1709 979 508 37509 3273 1736 18917 1158
NM_002026chr21214 ----11006
NM_002035chr1863538 3369 3353 2514 1397 559 23982 1537 11384 13479
NM_002039chr41303 145 ----
NM_002040chr2132791 2383 243 12910 ----
NM_002051chr101322 1296 1279 --
NM_002052chr841465 1408 1228 327 ------
NM_002054chr22190 108 ------
NM_002063chrX51121 1098 1057 252 206 --2987 898 --
NM_002069chr721740 1486 --2658 553 --
NM_002072chr93827 779 107 ------
NM_002077chr922087 128 ------
NM_002092chr414008 13152 --1320
NM_002112chr15166 ------
NM_002114chr61422 ------
NM_002126chr1744093 3077 2753 740 ------
NM_002128chr1322466 409 1390 --11700
NM_002130chr511633 31373 1245 659 ----
NM_002136chr122474 189 ------
NM_002137chr722385 1759 1232 --1585
NM_002138chr42267 202 ------
NM_002140chr9----11045 --
NM_002146chr1751234 1192 1157 1022 949 11288 ----
NM_002154chr5----1196 --
NM_002158chr263826 3421 3139 2636 2494 1431 13536 11328 --
NM_002165chr201328 ------
NM_002202chr51415 ----2877 700
NM_002203chr574034 3995 3843 3823 3064 2976 292 14097 ----
NM_002210chr253169 2978 2743 2562 835 12811 13328 --
NM_002211chr102237 84 ------
NM_002214chr753843 1576 845 562 368 1998 11595 --
NM_002222chr3123 1177 ----
NM_002232chr1------1242
NM_002247chr1021900 776 2602 543 --12218
NM_002264chr354182 3572 3300 3103 1211 ------
NM_002267chr1352344 2305 2271 1845 445 ------
NM_002269chr61346 ------
NM_002270chr5115620 4922 4741 4091 3672 3499 1340 1145 989 340 319 13682 22030 1940 --
NM_002271chr132396 159 ----1969
NM_002284chr12----1569 --
NM_002313chr1064694 3107 1904 1788 1271 1254 ------
NM_002317chr51312 ------
NM_002332chr12--1787 ----
NM_002336chr1224844 4368 15057 ----
NM_002342chr12--1600 ----
NM_002351chrX41555 676 396 67 11600 1114 --
NM_002356chr652862 2502 815 747 458 ------
NM_002358chr44465 251 215 208 131 ----
NM_002359chr1744262 4207 1100 184 --1602 --
NM_002374chr233052 444 287 2884 602 11475 1405
NM_002381chr24965 420 146 81 ------
NM_002382chr1421090 870 ------
NM_002387chr532002 1367 180 --1366 --
NM_002398chr241469 1049 959 341 21264 543 11427 11216
NM_002399chr1511296 ------
NM_002402chr711107 ------
NM_002408chr143821 626 280 --1830 --
NM_002428chr1621444 1087 ------
NM_002430chr2242579 2383 527 109 ------
NM_002480chr1271495 1483 1454 1215 1080 226 32 ----11462
NM_002481chr175650 5444 5282 2792 1157 893 784 15187 16027 --
NM_002482chr1--1101 ----
NM_002494chr4143 ------
NM_002499chr1552269 2206 1518 629 75 --2862 580 1949
NM_002501chr1921618 1302 --11669 --
NM_002514chr831221 1154 965 --2412 318 --
NM_002518chr221120 1075 1759 ----
NM_002519chr1111024 1272 1111 --
NM_002524chr111073 11057 ----
NM_002544chr171273 ------
NM_002545chr1125086 1007 14638 25131 1874 --
NM_002546chr81296 ------
NM_002552chr211131 ------
NM_002568chr8------196
NM_002572chr11----199 --
NM_002576chr1121152 26 --1446 --
NM_002577chr342689 1552 1237 330 31379 942 161 ----
NM_002578chrX1428 ------
NM_002581chr944512 3737 1680 233 25233 735 ----
NM_002582chr161932 ------
NM_002588chr51686 ------
NM_002595chr1251610 787 376 317 306 11924 ----
NM_002600chr131768 1701 1412 ------
NM_002607chr731063 215 107 ------
NM_002608chr22158 --11013 --
NM_002613chr1684806 4539 4235 4070 1828 1477 1209 265 25229 3634 14002 --
NM_002641chrX31955 1885 1376 11846 ----
NM_002643chr22161 127 ------
NM_002645chr1143141 840 329 217 ------
NM_002647chr182240 214 ------
NM_002655chr894968 4845 4809 4336 4243 3827 926 891 405 31870 1768 1376 ----
NM_002657chr2043303 1248 646 472 13814 ----
NM_002660chr201428 ------
NM_002670chr3139 --11563 --
NM_002687chr1441145 909 355 102 ------
NM_002706chr2----1231 --
NM_002709chr263170 2594 1441 1271 1121 617 21147 184 --23580 2720
NM_002713chr1----1204 11062
NM_002715chr551169 1099 889 223 27 1975 1206 --
NM_002716chr1141302 935 792 783 --23657 905 --
NM_002718chr312314 22263 605 ----
NM_002719chr1442362 1826 1790 824 --32373 2170 980 --
NM_002721chr91493 ------
NM_002731chr172877 2681 2489 1218 402 197 134 12039 --12938
NM_002734chr1742208 1864 1427 147 1728 ----
NM_002737chr1786665 6595 6379 6187 2003 1730 733 128 ------
NM_002745chr2263962 3610 3491 2875 866 545 13772 ----
NM_002763chr1--1356 --1180
NM_002788chr14123 ------
NM_002806chr14--150 ----
NM_002822chr1251454 1382 576 530 106 ----123
NM_002825chr7159 ------
NM_002828chr181683 ------
NM_002835chr71210 2563 542 ----
NM_002837chr1253925 1672 1158 451 173 --1828 --
NM_002839chr912631 21026 517 22444 2188 --
NM_002841chr31496 ------
NM_002843chr1163384 3150 2787 2392 2241 466 ------
NM_002848chr1221207 450 ------
NM_002851chr74810 762 537 38 1791 1645 --
NM_002852chr32401 394 1540 ----
NM_002857chr132689 2154 220 ------
NM_002858chr11186 --1494 174
NM_002865chr82284 192 ------
NM_002869chr1132079 1588 130 1119 ----
NM_002874chr932444 772 764 --1799 --
NM_002886chr374727 4227 3628 1978 1886 1432 682 21404 621 24458 1764 --
NM_002892chr1441581 1555 137 100 1172 ----
NM_002893chrX1248 --180 --
NM_002902chr152634 542 ------
NM_002906chr1121997 232 11571 ----
NM_002912chr64905 762 653 226 1703 ----
NM_002923chr11530 ------
NM_002940chr41162 ------
NM_002941chr3----1346 21008 587
NM_002942chr331242 299 169 11082 ----
NM_002956chr1221247 70 --1252 --
NM_002958chr31858 ------
NM_002959chr174370 4258 3922 3737 3398 2712 988 ----197
NM_002971chr32463 99 ------
NM_002977chr243426 3415 2187 1058 1328 1565 13453
NM_002994chr441917 1820 1251 340 ------
NM_002998chr8----22232 137 --
NM_003010chr1782286 2209 1914 1870 1763 1674 462 89 ------
NM_003012chr81606 ----1119
NM_003013chr41787 --1734 --
NM_003016chr1751998 1654 1407 550 327 1501 ----
NM_003020chr151398 ------
NM_003022chrX31206 973 48 ------
NM_003031chr162308 159 ----1269
NM_003042chr331992 1599 1460 ------
NM_003054chr10138 ------
NM_003068chr84860 697 377 342 --1305 --
NM_003070chr92609 581 2795 670 ----
NM_003077chr17------1282
NM_003079chr171698 ------
NM_003081chr201118 ------
NM_003094chr14478 379 213 162 ------
NM_003099chr1586546 6421 5866 4651 4110 1890 1797 1052 26260 5977 11592 --
NM_003108chr257082 6923 1515 1280 304 1388 15717 1604
NM_003110chr172944 902 ------
NM_003111chr241351 1217 191 26 1353 ----
NM_003112chr7--23047 2792 --11031
NM_003118chr51261 22028 1606 1319 --
NM_003128chr242835 2759 849 704 1928 ----
NM_003137chr652221 1758 1426 847 396 --1833 --
NM_003144chr651504 1449 739 270 152 ------
NM_003155chr852545 1919 1882 816 137 ----1334
NM_003161chr1742329 871 670 203 21331 1228 1888 --
NM_003174chr101132 ------
NM_003182chr7--1164 1502 --
NM_003182chr7--1164 1502 --
NM_003184chr81438 ------
NM_003185chr2021054 877 ------
NM_003188chr62287 147 --1196 --
NM_003189chr143246 3189 2529 2387 12255 12615 --
NM_003198chr11312 ------
NM_003199chr1845439 4620 1461 23 31290 1020 410 25324 1991 --
NM_003201chr101382 ------
NM_003202chr521826 1637 ------
NM_003203chr241786 1510 996 800 ------
NM_003206chr61450 ------
NM_003211chr1221524 1504 1120 ----
NM_003216chr2223042 398 ------
NM_003220chr641516 1281 1071 478 --11286 --
NM_003221chr663899 3274 3068 2749 1316 533 ------
NM_003242chr332449 827 199 --1570 --
NM_003246chr1561765 1736 752 561 491 50 11377 ----
NM_003247chr651425 414 341 282 68 12022 11603 --
NM_003253chr2111804 ------
NM_003255chr172901 860 12122 12421 1402
NM_003262chr365099 4165 3752 3196 1050 437 ------
NM_003263chr4141 ------
NM_003269chr62978 922 1509 11310 --
NM_003274chr2162471 1099 1033 983 831 495 --12965 12993
NM_003286chr2021066 877 ------
NM_003295chr131154 ------
NM_003298chr376147 6124 4866 4010 3951 2230 1418 1828 ----
NM_003304chr331330 324 59 31613 1443 602 ----
NM_003326chr162745 1853 970 528 515 310 ----182
NM_003337chr541101 201 179 35 --11578 --
NM_003338chr1031526 692 573 1677 196 --
NM_003339chr541378 1231 991 203 21518 1262 --11027
NM_003340chr421009 918 ------
NM_003342chr1783193 2769 2263 1149 1027 704 405 91 33235 1041 251 ----
NM_003348chr1241720 1547 573 429 11511 ----
NM_003349chr2021601 1395 1610 ----
NM_003352chr24854 798 728 169 --1268 --
NM_003360chr4154 ------
NM_003374chr51103 1674 ----
NM_003375chr10164 ------
NM_003376chr621637 1192 ------
NM_003376chr621637 1192 ------
NM_003383chr9--1420 ----
NM_003390chr112848 288 ----1294
NM_003392chr394263 3874 3052 2926 1536 1365 1318 1261 955 33346 780 114 11479 --
NM_003400chr22823 173 ----1564
NM_003403chr143800 617 188 ------
NM_003404chr2021913 771 ----1403
NM_003406chr821715 284 ------
NM_003409chr1821440 1405 --1110 --
NM_003410chrX42895 2721 2360 898 12976 11978 --
NM_003411chrY2698 122 ------
NM_003413chrX41606 1372 647 553 31861 1553 130 ----
NM_003432chr52460 174 1357 ----
NM_003439chr753459 2478 2462 815 791 ----13522
NM_003442chr111202 ------
NM_003452chr91870 ------
NM_003454chr1641428 1393 1045 116 --11081 --
NM_003457chr172502 95 1203 --1566
NM_003463chr663377 2935 2663 2629 2211 1337 1883 ----
NM_003467chr22102 89 ------
NM_003470chr1651173 683 652 519 510 ------
NM_003471chr321739 239 12050 ----
NM_003478chr1172602 2248 2109 1101 798 563 193 ------
NM_003483chr1242843 1073 691 87 ------
NM_003487chr171236 ------
NM_003488chr1731016 971 93 ------
NM_003489chr2133480 2266 1212 12920 --13216
NM_003490chr222740 193 --11076 --
NM_003507chr211969 ------
NM_003558chr93641 611 273 ------
NM_003565chr1241752 1527 1428 616 ------
NM_003566chr1263088 3042 1059 775 530 422 33147 713 104 1841 --
NM_003574chr1875697 5507 4563 4548 2304 1657 237 12150 ----
NM_003583chr1293500 2732 2611 2517 1544 1266 918 756 44 13602 ----
NM_003589chr13--11415 ----
NM_003590chr284046 3071 3045 3034 809 779 734 402 34064 2571 1556 --33460 2664 2529
NM_003591chr102389 38 1364 ----
NM_003597chr222158 1542 ------
NM_003613chr15152 ------
NM_003615chr353885 2869 661 641 83 13431 ----
NM_003617chr131923 1759 1461 14799 11837 --
NM_003618chr241307 461 262 209 21317 520 ----
NM_003620chr17--1168 ----
NM_003626chr1131367 1264 1112 1393 ----
NM_003629chr143397 3002 2721 2320 ----13525
NM_003633chr541959 1725 1708 1659 1121 ----
NM_003663chr32137 21 ----12663
NM_003664chr5--1504 ----
NM_003671chr963605 3387 3021 2843 778 612 2724 91 1333 --
NM_003672chr121576 1471 11715 ----
NM_003690chr21575 ------
NM_003701chr1331045 939 848 ------
NM_003705chr22298 289 ------
NM_003714chr543073 2528 2319 2203 12330 23082 636 --
NM_003716chr3--1842 1899 --
NM_003718chr71207 ------
NM_003722chr342564 1767 620 426 ------
NM_003735chr51686 ------
NM_003736chr51686 ------
NM_003743chr242098 2061 800 736 ----1887
NM_003749chr1321629 218 11635 12390 1870
NM_003759chr463814 3485 2938 1590 988 713 --23716 723 23869 142
NM_003763chr2052577 2290 1108 1075 204 22838 684 ----
NM_003768chr121880 1797 ------
NM_003783chr1142 ------
NM_003787chr1831472 222 133 ------
NM_003794chr31877 ------
NM_003796chr191557 ------
NM_003797chr111148 ------
NM_003798chr9--1154 ----
NM_003800chr622190 626 22426 1941 --21637 846
NM_003822chr142422 2270 2042 860 21951 207 --22036 262
NM_003825chr1551085 988 499 451 312 ------
NM_003850chr132558 159 1106 ----
NM_003862chr51116 ------
NM_003870chr1551661 848 700 545 305 1319 ----
NM_003873chr1032331 1845 776 ------
NM_003887chr252252 2226 2206 571 200 1738 31982 1433 543 --
NM_003895chr2152103 1823 1795 440 189 ----197
NM_003902chr12545 34 --1650 --
NM_003913chr631164 1002 258 24296 1193 --1669
NM_003922chr152342 336 ------
NM_003930chr742528 1664 924 339 22466 597 11927 --
NM_003932chr2231461 1306 1275 11900 11450 --
NM_003939chr1011046 --22663 1089 --
NM_003946chr161551 ------
NM_003966chr597829 7776 7360 6516 5404 5360 651 209 140 --15352 25484 2275
NM_003968chr32489 246 ------
NM_003971chr17--1431 ----
NM_003972chr101853 ------
NM_003983chr1643487 1479 845 579 24376 4179 ----
NM_003994chr1233267 1466 1266 23166 3037 --13910
NM_003998chr42562 473 1605 ----
NM_004006chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004007chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004009chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004010chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004011chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004012chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004013chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004014chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004015chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004016chrX62555 2406 2282 806 428 195 1316 11924 --
NM_004017chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004018chrX62555 2406 2282 806 428 195 1316 11924 --
NM_004019chrX1373 ------
NM_004020chrX62641 2492 2368 892 514 281 1402 12010 --
NM_004021chrX62555 2406 2282 806 428 195 1316 11924 --
NM_004022chrX62555 2406 2282 806 428 195 1316 11924 --
NM_004023chrX62555 2406 2282 806 428 195 1316 11924 --
NM_004034chr102646 161 1237 ----
NM_004046chr18145 ------
NM_004050chr14----1656 --
NM_004061chr51449 ------
NM_004071chr21111 1188 ----
NM_004080chr721100 422 --11415 --
NM_004081chrY11839 ------
NM_004087chr342055 1549 1438 107 11690 ----
NM_004124chr1443530 3298 3289 2823 ------
NM_004126chr71266 ------
NM_004136chr1573302 3214 3152 3041 2541 1272 205 ------
NM_004161chr23601 556 79 31568 547 138 ----
NM_004162chr311165 11096 1910 --
NM_004171chr1199326 8691 7968 7594 7552 6839 6822 6618 6282 18127 16605 --
NM_004187chrX11255 ------
NM_004209chr161933 --11042 --
NM_004215chr81448 ------
NM_004226chr21237 1100 ----
NM_004229chrX21936 1868 ------
NM_004232chr1853863 3705 1300 1038 76 1719 13254 --
NM_004236chr151605 ------
NM_004241chr10--1499 ----
NM_004249chr4--130 ----
NM_004274chr1462848 2314 1106 1053 961 518 13228 11993 --
NM_004291chr51289 ------
NM_004295chr1721234 495 ------
NM_004302chr1222357 2276 12889 ----
NM_004311chr1022375 302 --1307 --
NM_004319chr133161 2165 1169 ----1393
NM_004330chr153887 852 241 ------
NM_004331chr832491 2280 2019 ----186
NM_004337chr832286 639 172 ------
NM_004338chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_004342chr711929 1458 --1779
NM_004349chr8----11163 --
NM_004370chr652018 1992 1945 1495 1467 ----11814
NM_004384chr592288 1998 1664 1654 1560 1539 880 706 681 ------
NM_004389chr2----1870 --
NM_004392chr1342636 2026 1786 277 12234 ----
NM_004397chr1143687 2779 1678 232 --1821 --
NM_004411chr72497 103 ------
NM_004417chr51412 ------
NM_004430chr81375 12620 ----
NM_004432chr941928 449 250 158 1577 1241 --
NM_004434chr1411887 1239 2544 342 --
NM_004438chr253113 2407 2262 1070 142 13276 31325 1292 378 --
NM_004440chr611349 ------
NM_004441chr311221 ------
NM_004447chr12129 ------
NM_004456chr71165 ------
NM_004457chr241602 1535 1216 485 ----11565
NM_004458chrX22591 560 ----1585
NM_004459chr1741956 1819 1370 426 1406 ----
NM_004482chr2--2978 882 ----
NM_004491chr1934303 3842 2901 --11518 --
NM_004496chr1441179 1063 199 184 11271 ----
NM_004499chr51100 1456 ----
NM_004501chr163168 672 450 385 214 178 23757 1514 13103 --
NM_004503chr121548 ------
NM_004504chr273064 2056 1040 441 346 253 131 ------
NM_004505chr1741948 1363 578 166 11536 ----
NM_004520chr5------1546
NM_004521chr101105 ------
NM_004525chr231355 1153 252 ------
NM_004537chr1241378 1131 452 259 ------
NM_004565chr1--1747 ----
NM_004575chr441453 1332 1015 657 ------
NM_004578chr1----1860 --
NM_004580chr1551742 1214 723 167 95 ------
NM_004586chrX85408 5251 5209 4903 4704 2149 1702 1296 --11726 --
NM_004591chr22415 157 ------
NM_004598chr533194 2108 105 42664 2520 2033 42 --23148 2074
NM_004612chr984228 4221 4057 3899 1772 634 569 107 ----11375
NM_004622chr23732 498 331 ------
NM_004634chr3----1261 --
NM_004637chr311183 --11261 --
NM_004654chrY3926 369 355 --11051 --
NM_004655chr1711060 11371 ----
NM_004657chr231302 552 389 1562 11290 --
NM_004663chr1521430 1177 --11144 --
NM_004681chrY1133 ----1728
NM_004685chr1352711 1066 962 178 30 --12945 --
NM_004709chrX31834 1677 1203 21773 1749 ----
NM_004714chr191235 ------
NM_004719chr1232439 989 611 1496 21122 1013 --
NM_004730chr532020 826 641 ----21823 647
NM_004733chr32443 37 1473 1562 --
NM_004736chr142104 1962 1394 818 ----1333
NM_004738chr2052414 2077 1739 808 539 1286 ----
NM_004745chr886940 4781 4673 2671 2385 1326 1130 814 14665 12457 --
NM_004747chr1011306 ------
NM_004748chr1523673 1121 12964 13891 --
NM_004775chr182739 392 11763 12399 12435
NM_004781chr121400 573 ------
NM_004781chr121400 573 ------
NM_004786chr18--2176 32 --1155
NM_004787chr4--1101 ----
NM_004788chr1112283 11885 12512 --
NM_004791chr13----1111 --
NM_004795chr1331661 1334 1298 1387 --11539
NM_004815chr144052 1949 1520 604 13746 11496 13699
NM_004830chr61860 ----1886
NM_004834chr242646 1314 1242 972 12939 ----
NM_004835chr31886 ------
NM_004835chr31886 ------
NM_004841chr12457 300 1781 11092 --
NM_004844chr32261 62 ------
NM_004859chr1772970 2783 2545 2329 1052 846 520 12397 12319 --
NM_004865chr61312 ------
NM_004867chrX3447 191 113 ------
NM_004871chr1754338 3046 756 632 579 ------
NM_004874chr81418 ------
NM_004887chr5----31113 1066 399 --
NM_004893chr51379 ------
NM_004898chr452645 2520 2267 952 274 12770 ----
NM_004904chr766448 4679 4265 1366 1103 764 21013 964 1692 --
NM_004906chr61639 2700 212 ----
NM_004912chr731453 1116 321 --1435 --
NM_004921chr14955 524 212 112 11812 11862 --
NM_004926chr1411189 ------
NM_004932chr511297 11251 ----
NM_004947chr342480 459 411 321 22200 473 ----
NM_004948chr1841412 955 443 52 --1574 --
NM_004949chr1862016 2010 1759 786 572 119 ----12153
NM_004956chr743836 1228 559 143 23791 1745 ----
NM_004960chr16--1125 ----
NM_004985chr1244315 3471 2829 1182 24525 996 23586 1364 --
NM_004992chrX68124 6579 6369 6193 5498 2799 27189 22 18016 --
NM_004992chrX68124 6579 6369 6193 5498 2799 27189 22 18016 --
NM_004993chr1421520 1458 ------
NM_004998chr151262 ------
NM_004999chr654220 4164 4048 3701 975 --14072 --
NM_005010chr74731 585 475 422 ------
NM_005011chr731717 211 158 ------
NM_005023chr531224 1104 314 ----11360
NM_005025chr31200 ------
NM_005028chr1021712 850 ----1867
NM_005030chr161233 ------
NM_005056chr1235096 4847 4568 --15477 15487
NM_005063chr1093846 3710 2966 2466 1296 1100 274 250 230 12688 ----
NM_005065chr1475304 4666 4371 4227 3865 1490 999 1426 ----
NM_005077chr9--1474 ----
NM_005078chr1521327 470 --11851 --
NM_005080chr222624 136 ------
NM_005086chr1221457 174 11631 ----
NM_005095chr132085 1560 826 ------
NM_005102chr21695 ------
NM_005112chr41846 ------
NM_005113chr142348 139 ------
NM_005114chr43471 444 222 1503 ----
NM_005116chr2084199 4156 3332 1826 1741 1113 1092 231 11314 ----
NM_005121chr1773732 3230 3163 3111 735 702 585 23574 452 13200 --
NM_005124chr62907 67 1377 ----
NM_005126chr322105 120 11617 ----
NM_005133chr111378 ------
NM_005134chr182619 346 --1127 --
NM_005135chr1533740 3453 2454 12981 --1688
NM_005140chrX1821 ------
NM_005151chr1841887 647 551 484 12052 11712 --
NM_005153chr165772 657 635 545 309 1626 1575 --
NM_005154chr152419 182 ------
NM_005156chr984921 4668 4437 4273 3880 1575 1332 1313 14210 25372 4264 11186
NM_005159chr1561939 1790 1530 690 255 148 11522 21822 99 1661
NM_005171chr1211268 ----11175
NM_005180chr1061532 1486 1453 1436 1053 280 ----11634
NM_005197chr1466222 6112 5459 4843 4764 300 46203 6143 4438 2101 ----
NM_005222chr72834 671 ------
NM_005230chr122553 90 ------
NM_005231chr1121337 145 1215 ----
NM_005233chr31876 ------
NM_005235chr277733 7245 6761 5076 3136 2270 2106 1719 ----
NM_005238chr1153553 2399 2168 365 145 1646 ----
NM_005239chr212520 139 1528 11866 --
NM_005241chr311047 ------
NM_005243chr221268 ------
NM_005249chr141738 --1197 152
NM_005252chr143779 755 581 ----1561
NM_005254chr1511253 --11386 --
NM_005256chr111751 ------
NM_005257chr18--1964 --1522
NM_005259chr231470 1259 454 ------
NM_005261chr8----1110 --
NM_005277chr421405 284 --2631 447 --
NM_005295chr7--158 ----
NM_005296chrX1151 --1239 --
NM_005302chr71323 ------
NM_005311chr731783 439 425 12802 11886 --
NM_005316chr113855 810 151 1235 11002 --
NM_005328chr81501 ------
NM_005339chr431727 1069 389 11570 ----
NM_005342chrX31789 710 131 --1919 --
NM_005349chr41395 ------
NM_005358chr1361746 1539 1525 705 408 30 1427 1154 --
NM_005359chr1885627 5171 4646 2380 2079 1479 1230 371 26120 538 14511 --
NM_005369chrX1436 ------
NM_005378chr2168 ------
NM_005382chr8----1107 --
NM_005386chr201780 1828 ----
NM_005387chr111547 ------
NM_005388chr9257 33 1417 11201 --
NM_005389chr6--150 ----
NM_005392chr931232 675 313 ------
NM_005398chr102425 66 ------
NM_005400chr222576 137 12022 --13022
NM_005402chr741722 1281 493 61 ------
NM_005412chr121565 ------
NM_005413chr21334 ------
NM_005415chr21620 ------
NM_005433chr1842391 895 755 139 22630 2253 ----
NM_005436chr1063767 3721 1490 997 587 136 1842 11474 13397
NM_005455chr141556 1337 649 228 ------
NM_005456chr11--1186 ----
NM_005461chr2051940 1745 1622 1296 595 11244 11467 --
NM_005465chr131843 311 210 --11848 --
NM_005474chr17136 ------
NM_005487chr2252042 1930 1854 69 43 1616 11750 --
NM_005494chr71111 ------
NM_005497chr17116064 6015 5702 5686 4620 4456 4440 1331 1266 510 220 11503 14464 --
NM_005502chr962964 2939 2743 2663 719 472 23137 350 12094 --
NM_005504chr12136547 6212 5093 4151 2467 2360 2212 2079 1572 1391 935 611 68 26201 174 25797 1651 16235
NM_005509chr551539 1505 694 359 191 ----11654
NM_005513chr311444 ----21474 1338
NM_005517chr11150 ------
NM_005520chr51738 --1712 --
NM_005526chr81274 ------
NM_005542chr711919 ------
NM_005544chr21695 2930 643 1920 1411
NM_005562chr12477 172 31351 1241 1193 ----
NM_005569chr2231535 1393 46 ------
NM_005578chr333921 3391 1168 21725 1037 14549 1831
NM_005593chr121460 ----1181
NM_005596chr995996 5587 5349 5118 5066 4687 4538 1142 250 56284 5264 5172 2215 1734 15772 --
NM_005598chr141662 1274 1264 221 1443 ----
NM_005600chr11228 ------
NM_005602chr311208 ------
NM_005604chr611026 --11828 --
NM_005611chr1621240 1214 11171 ----
NM_005614chr73757 370 227 ------
NM_005625chr81288 ------
NM_005627chr65819 810 746 661 137 ------
NM_005638chrX31546 1243 393 1486 2694 213 --
NM_005639chr121262 11534 ----
NM_005650chr2211188 ------
NM_005651chr41291 ------
NM_005655chr821195 1146 1850 ----
NM_005662chr8--1128 ----
NM_005665chr143934 3872 1728 204 24888 1109 14895 13002
NM_005668chr554462 3767 3556 3540 2857 14621 ----
NM_005678chr152673 86 ------
NM_005688chr34263 227 178 41 --11262 --
NM_005694chr3--1111 ----
NM_005717chr11400 ----1458
NM_005721chr23695 426 343 ------
NM_005722chr232225 943 54 ------
NM_005725chr12794 123 125 ----
NM_005734chr11------1532
NM_005737chr211841 11122 12348 --
NM_005742chr2--1838 ----
NM_005744chr151190 1167 ----
NM_005746chr751040 707 549 489 52 ------
NM_005749chr17--1458 ----
NM_005751chr72181 124 ------
NM_005752chr1641230 1046 1029 970 1105 ----
NM_005756chrX21102 1069 ------
NM_005759chr234760 730 394 ----11765
NM_005766chr131252 ------
NM_005776chr142830 566 ------
NM_005780chr133937 241 168 ------
NM_005786chr1821226 411 --134 --
NM_005795chr242861 2703 661 394 --1329 --
NM_005819chr132909 473 78 --22355 2224 --
NM_005822chr632082 1602 927 12210 ----
NM_005826chr12611 475 ------
NM_005828chr1754861 4626 4117 1940 109 --13486 --
NM_005832chr321160 929 11403 ----
NM_005833chr91173 ------
NM_005839chr1------1160
NM_005840chrX75439 5113 2937 2511 2365 2229 1973 12753 11583 --
NM_005842chr133555 490 235 1519 ----
NM_005843chr231690 1353 591 11391 ----
NM_005845chr1351563 1277 1073 428 345 --2537 72 --
NM_005857chr121498 401 ------
NM_005859chr51423 ------
NM_005860chr193333 280 62 ------
NM_005868chr742472 1732 831 493 --1626 --
NM_005870chr1341180 368 155 81 11095 ----
NM_005877chr2262400 2286 2204 979 832 580 ------
NM_005880chr1611131 --11518 1352
NM_005884chr191816 ------
NM_005885chr51649 --1266 --
NM_005898chr1123073 847 1113 12693 --
NM_005900chr411226 1231 --1218
NM_005901chr18118558 8181 7979 6461 5818 5280 3138 1127 805 427 62 17029 26792 1484 --
NM_005902chr1543137 1243 953 88 14365 14552 --
NM_005903chr554817 2056 1134 469 287 24952 811 13223 --
NM_005906chr62191 31 21486 523 ----
NM_005909chr523080 1538 11438 12658 --
NM_005938chrX11376 ------
NM_005940chr22------1690
NM_005941chr883791 3286 1567 1468 1439 1399 880 848 13884 11359 --
NM_005955chr145466 4087 1640 1332 11224 ----
NM_005962chr1042290 2175 1545 678 ------
NM_005962chr1042290 2175 1545 678 ------
NM_005966chr252196 2019 1677 771 729 41472 503 282 202 ----
NM_005977chr132221 57 ------
NM_005986chr1332495 654 386 ----1680
NM_006007chr973426 1460 1423 1074 1037 715 678 21304 840 23166 1101 --
NM_006037chr283984 3880 3704 3671 1574 1108 901 688 23893 1268 --14335
NM_006047chr2073476 2261 905 524 183 109 40 12204 1510 --
NM_006060chr723700 1649 13645 34278 3024 1755 --
NM_006064chrX195 1410 ----
NM_006070chr31128 ------
NM_006080chr742337 1099 818 325 --22919 364 --
NM_006086chr162279 198 ------
NM_006090chr12526 195 1257 ----
NM_006094chr821921 1613 52340 1955 1766 755 700 ----
NM_006095chr453753 3219 2976 2776 702 1967 13139 --
NM_006106chr115846 652 181 164 81 ----13114
NM_006129chr8------1372
NM_006133chr1122481 2407 ------
NM_006134chr2141367 1328 95 77 21657 1620 1175 --
NM_006135chr121187 522 1972 ----
NM_006136chr721295 1145 1933 --157
NM_006139chr252460 2012 1037 584 379 22786 2077 ----
NM_006141chr1632545 993 557 ------
NM_006147chr14455 375 336 43 ------
NM_006153chr31572 ----1523
NM_006154chr1552898 2708 1958 1815 190 ------
NM_006159chr12--1497 ----
NM_006162chr1821447 501 11108 ----
NM_006166chr1222565 2450 1283 2957 275 --
NM_006180chr911566 ------
NM_006186chr231138 452 369 1828 ----
NM_006194chr1411232 ------
NM_006195chr931281 1043 240 ----11016
NM_006197chr872053 1869 1604 1437 1430 775 252 ------
NM_006202chr19--1262 ----
NM_006203chr565317 4113 1357 852 794 480 15165 1383 --
NM_006206chr432759 2281 392 2646 74 --1352
NM_006211chr82201 118 ------
NM_006237chr1311836 12003 ----
NM_006251chr573224 2946 2520 2481 1078 987 203 12586 ----
NM_006252chr196005 4688 4616 2628 2603 2332 2109 1018 28 35081 1723 729 ----
NM_006254chr31305 ------
NM_006256chr122720 611 --2949 185 --
NM_006265chr821342 1327 1947 11409 11013
NM_006282chr2094645 4385 4279 4172 3564 2908 1566 892 302 ------
NM_006283chr874978 4675 4114 1512 1091 1035 192 --14742 --
NM_006287chr242558 2347 1040 127 22082 491 ----
NM_006298chr612119 ------
NM_006307chrX137 ------
NM_006313chr12--21418 1252 ----
NM_006315chr463917 2949 1343 1167 624 76 --1564 --
NM_006317chr52893 170 --1768 --
NM_006323chr41621 ----1282
NM_006325chr121188 ------
NM_006330chr8--11094 144 --
NM_006345chr411226 21360 1353 ----
NM_006350chr5196 ------
NM_006352chr171906 1656 1416 697 644 424 315 ------
NM_006364chr1431164 316 97 ------
NM_006377chr931258 1181 853 ------
NM_006379chr742163 1533 1502 302 1581 ----
NM_006380chr1764382 4359 4262 3748 2992 354 13771 23932 1683 --
NM_006386chr2242350 2168 1826 736 ----12002
NM_006389chr1121367 1353 ------
NM_006393chr1033613 2867 769 13750 24379 4026 --
NM_006401chr9--1324 ----
NM_006403chr6----11705 --
NM_006410chr111479 ------
NM_006416chr61232 ------
NM_006420chr2042738 2592 2207 195 --1279 --
NM_006434chr1053281 3126 3043 844 225 --13200 12896
NM_006439chr41582 ------
NM_006464chr243482 3252 3203 246 --34137 1246 432 --
NM_006482chr1293500 2732 2611 2517 1544 1266 918 756 44 13602 ----
NM_006483chr191235 ------
NM_006484chr191235 ------
NM_006526chr201122 ----11549
NM_006534chr2072833 2556 2272 1077 992 417 78 12164 12184 13435
NM_006538chr274069 3845 2863 2800 1007 691 544 12792 23354 2990 --
NM_006540chr811284 ------
NM_006544chr1485364 4546 4212 3742 3720 1631 1254 1053 ------
NM_006546chr1796541 6509 6464 6446 4503 4052 2220 531 500 --11301 22380 1566
NM_006561chr1055812 5061 3841 256 127 --25036 1313 --
NM_006565chr1611114 1382 ----
NM_006577chr21899 ------
NM_006582chr1170 ------
NM_006595chr11183 ------
NM_006597chr11127 1194 1172 --
NM_006599chr16108059 7764 7426 6763 6428 5185 3141 400 340 169 ------
NM_006601chr1211052 --1183 --
NM_006603chrX31837 1630 804 1535 ----
NM_006605chr221129 ------
NM_006609chr21328 ------
NM_006614chr363600 2600 2246 1378 1099 781 --1896 --
NM_006624chr1052055 1851 1471 658 247 ----12044
NM_006625chr11738 ------
NM_006625chr11738 ------
NM_006625chr11738 ------
NM_006628chr1554294 4089 4067 3832 376 24268 1047 ----
NM_006629chr1852600 2496 1905 840 465 2747 714 1177 --
NM_006636chr23785 768 327 1347 ----
NM_006646chr132239 123 12517 ----
NM_006654chr12104781 4549 3911 3902 3769 3598 1397 955 804 373 24797 3759 24013 3748 --
NM_006667chrX11008 --11120 --
NM_006699chr11439 --12565 11858
NM_006704chr134403 314 65 52 ------
NM_006713chr53735 111 98 ------
NM_006717chr9113014 2688 2559 2407 2234 2223 2114 1099 1048 912 369 1285 ----
NM_006720chr1064694 3107 1904 1788 1271 1254 ------
NM_006722chr352373 2128 2095 947 215 12603 ----
NM_006726chr411036 ------
NM_006729chrX2915 665 31396 651 161 25122 1462 --
NM_006734chr63508 411 230 ----1594
NM_006735chr72329 285 ------
NM_006738chr1534409 1618 1233 11526 ----
NM_006745chr431038 899 68 ------
NM_006748chr82281 55 ------
NM_006750chr16127260 7090 6555 5954 5560 4975 1717 843 542 355 318 299 17291 38030 5978 5691 11708
NM_006761chr17175 ------
NM_006763chr132078 1766 1736 ------
NM_006766chr832139 1927 103 ------
NM_006775chr662764 2724 2131 885 583 567 ------
NM_006777chrX42218 991 759 632 --12698 --
NM_006785chr183319 278 77 --22104 334 --
NM_006788chr1832120 1305 197 ----12013
NM_006791chr152587 259 ------
NM_006805chr521158 521 ------
NM_006807chr1721342 1019 ------
NM_006826chr231154 1147 1045 ------
NM_006832chr141750 ------
NM_006838chr1241808 1237 734 319 ------
NM_006851chr1222953 2066 ------
NM_006852chr171520 ------
NM_006868chr1863169 2973 2614 2478 409 256 --12211 --
NM_006870chr202805 666 ----1734
NM_006874chr41368 ------
NM_006885chr1684250 4190 3690 3096 2788 869 539 250 11014 13360 --
NM_006888chr1463109 2924 2883 1098 803 634 23487 2942 ----
NM_006902chr153318 2302 702 478 92 11161 ----
NM_006906chr112898 162 ------
NM_006910chr161125 ------
NM_006914chr91304 ------
NM_006918chr1195781 5186 4594 4540 4380 4188 932 725 374 11053 13619 25801 2252
NM_006922chr242009 1948 852 815 1551 --1291
NM_006924chr1774164 4121 2760 891 665 182 121 24269 1055 ----
NM_006925chr141189 ------
NM_006930chr541768 1298 749 444 --11240 --
NM_006936chr2131120 886 40 2513 232 ----
NM_006937chr172192 156 ----1448
NM_006939chr143768 303 204 ------
NM_006940chr1221330 690 --11544 --
NM_006956chr722377 573 --1894 --
NM_006982chr121254 ------
NM_006997chr101148 1458 ----
NM_007005chr931307 1134 1120 --21520 114 --
NM_007007chr1234778 4440 4211 34698 3904 1279 13069 23607 552
NM_007008chr25924 884 839 328 298 1203 2748 96 --
NM_007023chr231063 820 84 1906 ----
NM_007027chr3--1164 ----
NM_007038chr2185630 5611 4636 4617 1303 1266 1164 112 16127 ----
NM_007040chr19--1764 ----
NM_007042chr33539 530 366 22155 1722 12687 --
NM_007054chr593956 3926 3879 1386 1138 721 523 236 190 --13908 --
NM_007061chr221368 ------
NM_007078chr1042744 2499 670 241 --12768 12805
NM_007099chr21149 ------
NM_007111chr133740 688 324 1645 ----
NM_007114chr332561 2088 328 12298 ----
NM_007124chr632003 1913 666 --11628 11876
NM_007125chrY31125 962 560 11387 ----
NM_007146chr1761117 1016 884 668 488 236 1358 32360 2332 703 --
NM_007178chr12----1440 --
NM_007185chr11997 ------
NM_007187chr1311001 --1196 1202
NM_007191chr12--1645 ----
NM_007200chr1534409 1618 1233 11526 ----
NM_007212chr131756 1733 592 ----11397
NM_007214chr611032 11235 ----
NM_007217chr31137 1293 ----
NM_007218chr82654 222 ------
NM_007222chr821585 390 ------
NM_007235chr122114 100 ------
NM_007249chr1379269 7721 2550 2210 1787 819 248 39083 8930 1088 18199 --
NM_007269chr11185 1392 ----
NM_007276chr7--11100 ----
NM_007282chr3------1920
NM_007308chr4------1570
NM_007315chr211391 ------
NM_007345chr1861978 1953 1596 751 196 145 --1316 --
NM_007347chr151196 --22202 1179 --
NM_007353chr71575 32913 2776 2593 --12403
NM_007357chr1----1209 --
NM_007372chr172675 316 --1737 --
NM_007373chr1051731 1477 1130 412 115 1360 11264 --
NM_007375chr132343 2118 1913 176 ----
NM_009585chr31886 ------
NM_009585chr31886 ------
NM_012073chr531220 1051 444 1270 1208 --
NM_012081chr553086 2959 1355 510 261 --12442 1628
NM_012082chr81285 1761 ----
NM_012089chr141512 1503 548 52 1197 ----
NM_012090chr12799 505 ------
NM_012093chr111233 ------
NM_012096chr333295 3267 853 11099 1840 1318
NM_012102chr111632 --2979 483 --
NM_012115chr6135 1422 ----
NM_012120chr632908 2347 2278 1226 ----
NM_012129chr732285 677 501 12064 ----
NM_012141chr1331662 690 99 1452 13972 --
NM_012155chr19161 ------
NM_012161chr421084 1069 1164 ----
NM_012177chr62464 76 1634 ----
NM_012193chr1194928 3727 2107 1938 1525 1052 938 895 273 ------
NM_012199chr164574 4379 3275 1612 1567 1285 11850 ----
NM_012214chr2146201 5644 5248 5085 4654 4127 2234 1898 1627 1616 1099 1003 835 165 11040 15781 --
NM_012215chr1021431 190 --11460 --
NM_012223chr21206 --2446 81 --
NM_012238chr1031641 1289 662 ------
NM_012243chr11893 --2760 173 --
NM_012244chr142675 392 1153 ----
NM_012247chr1031006 162 94 --11016 --
NM_012248chr16140 176 ----
NM_012249chr253366 2463 2313 1395 723 1984 ----
NM_012250chr1111311 ------
NM_012252chr795242 5212 4388 1250 1147 752 638 466 453 14831 ----
NM_012257chr72416 342 --1744 --
NM_012262chr164937 4699 3444 3415 967 169 11384 1934 --
NM_012281chr722349 555 12299 ----
NM_012286chrX2621 248 ------
NM_012287chr353878 3539 3363 1557 751 14517 --24466 3755
NM_012289chr19151 ------
NM_012290chr241568 1542 1478 1437 11506 11528 --
NM_012294chr753630 2663 752 276 71 ----1850
NM_012297chr452517 2155 1884 1020 191 12452 ----
NM_012301chr731563 738 670 ------
NM_012302chr11866 --1377 --
NM_012309chr1134773 3533 3431 13456 ----
NM_012316chr1115153 4830 4017 3980 3432 1951 1739 1631 1535 1020 652 15665 ----
NM_012323chr2231520 1056 434 ------
NM_012326chr21750 ------
NM_012328chr73586 400 339 --21018 430 --
NM_012329chr1721312 1108 --177 --
NM_012330chr1051805 1738 1549 655 423 ------
NM_012341chr10----1418 --
NM_012342chr10--1334 ----
NM_012399chr2221768 1735 ----11612
NM_012412chr71863 --140 --
NM_012416chr931251 1240 1097 ------
NM_012421chr12416 309 ------
NM_012464chr452835 2739 2587 1951 676 11880 ----
NM_012479chr731868 584 287 12407 ----
NM_012486chr11426 ------
NM_013229chr1222097 113 --1946 --
NM_013230chrY31729 557 546 11213 1613 --
NM_013232chr51412 ------
NM_013233chr241467 1244 435 405 ------
NM_013237chr5----166 --
NM_013254chr12--1141 ----
NM_013255chr7128822 8627 8351 7975 7899 3408 3052 2633 2456 2310 998 62 16910 --26593 3462
NM_013261chr433134 2940 1243 21294 79 13717 --
NM_013262chr611273 ------
NM_013269chr12104334 4174 4117 3789 3585 3002 2940 2822 1496 687 ------
NM_013280chr112284 222 ------
NM_013281chr2011403 --11291 --
NM_013305chr181124 ------
NM_013314chr102186 29 ------
NM_013316chr7--1189 ----
NM_013322chr711277 ------
NM_013326chr18151 ------
NM_013341chr241812 1806 559 242 22483 815 21926 1008 --
NM_013351chr171686 ------
NM_013361chr192592 137 ------
NM_013371chr1--1259 1317 --
NM_013374chr373094 3067 2535 2289 492 234 198 ----13122
NM_013377chr121569 --2544 508 --
NM_013386chr121654 724 11676 ----
NM_013390chr92372 149 11508 ----
NM_013437chr831419 1055 26 11171 ----
NM_013438chr941523 725 607 398 1233 ----
NM_013446chr751396 1269 1152 554 297 ------
NM_013449chr1222038 1136 ------
NM_013450chr21784 ------
NM_013943chr173302 3288 2878 821 596 308 91 1653 22359 1212 --
NM_013958chr81135 ------
NM_013959chr81135 ------
NM_013960chr81669 ------
NM_013961chr81135 ------
NM_013962chr81135 ------
NM_013986chr221268 ------
NM_013989chr1445039 4779 1688 396 ----11332
NM_013996chr7--1164 1502 --
NM_013996chr7--1164 1502 --
NM_013997chr7--1164 1502 --
NM_013997chr7--1164 1502 --
NM_013998chr7--1164 1502 --
NM_013998chr7--1164 1502 --
NM_014003chr16--1364 ----
NM_014011chr222103 1044 --12568 --
NM_014016chr331109 313 44 21123 1098 2404 280 --
NM_014021chr122876 1137 1326 --13122
NM_014023chr1032892 2738 349 ----12779
NM_014028chr633144 2775 2309 22294 545 1445 --
NM_014048chr1675257 5067 4938 4654 803 172 89 198 ----
NM_014059chr131248 ------
NM_014071chr201515 ------
NM_014089chr1362224 2215 1972 1502 725 86 11621 22089 1762 --
NM_014106chr1532719 2370 478 32923 2266 243 12450 12640
NM_014110chr1----1204 11062
NM_014112chr874467 4318 3714 2051 1909 1870 1669 ------
NM_014117chr1632403 2257 407 21009 71 12190 --
NM_014155chr11137465 7315 7291 6765 5888 4722 2821 2538 2353 1592 1192 1057 555 17218 16119 11621
NM_014170chr3188 ------
NM_014181chr21817 --11084 --
NM_014211chr531720 429 160 ------
NM_014217chr131916 1305 691 11592 11535 --
NM_014240chr353892 2609 1551 534 276 --24067 3916 --
NM_014241chr101103 ------
NM_014243chr441560 760 584 451 1493 ----
NM_014248chr221141 ------
NM_014250chr2252042 1930 1854 69 43 1616 11750 --
NM_014253chrX31958 1695 67 ------
NM_014263chr1011029 2185 39 21456 58 --
NM_014278chr45455 379 359 347 175 ------
NM_014280chr11898 ------
NM_014283chr111132 ------
NM_014290chr91193 ------
NM_014296chr341514 1049 1004 412 ------
NM_014309chr2265214 4990 4175 3847 3624 1452 151 ----
NM_014319chr1221391 1343 21821 1707 11806 --
NM_014322chr121131 982 ------
NM_014323chr221990 ------
NM_014331chr477447 6452 6041 6000 2667 1579 1563 26749 1134 24752 493 12514
NM_014333chr1122219 283 12377 --11912
NM_014342chr1121223 538 1593 ----
NM_014345chr62746 333 --1805 --
NM_014350chr531216 441 182 ------
NM_014351chr2221073 318 --1236 --
NM_014363chr1331225 958 80 --1111 --
NM_014372chr151948 1545 528 256 238 ------
NM_014379chr82679 135 1286 11051 --
NM_014382chr351590 1556 1474 366 39 ------
NM_014393chr862368 2251 1723 1542 941 448 1820 12350 12321
NM_014397chr9--1305 ----
NM_014415chr311474 ------
NM_014421chr451498 1419 1344 492 28 1601 11454 --
NM_014423chr534897 1843 1592 25292 276 ----
NM_014445chr342420 2337 2041 1814 ----12407
NM_014447chr4--21530 350 ----
NM_014454chr61113 ------
NM_014455chr13444 180 61 ------
NM_014458chr121113 1092 --11186 --
NM_014503chr121434 ------
NM_014504chr721536 41 2448 407 11318 --
NM_014515chr121386 --1394 --
NM_014517chr331409 1348 397 ------
NM_014547chr151311 1152 ----
NM_014547chr151311 1152 ----
NM_014548chr1531307 1103 463 11508 11108 --
NM_014552chr231514 1096 181 11089 ----
NM_014554chr1232056 1562 1438 --11817 --
NM_014563chrX22117 1755 11854 --167
NM_014573chr1711557 ------
NM_014577chr221571 --2690 685 --
NM_014584chr1421464 653 ------
NM_014608chr152434 172 ------
NM_014613chr531232 700 316 --13085 --
NM_014614chr211007 --1977 --
NM_014615chr1663617 3566 2990 1194 1092 490 13572 ----
NM_014616chr343460 3436 3359 2485 1967 11304 --
NM_014618chr9--1317 ----
NM_014620chr12--1746 ----
NM_014646chr1822290 2246 23217 3170 1295 --
NM_014659chr1521060 936 ------
NM_014660chr721089 309 ------
NM_014667chr312042 11908 ----
NM_014671chr72254 196 ------
NM_014676chr11502 31507 1118 1111 ----
NM_014677chr841372 1302 166 158 169 ----
NM_014682chr821677 526 --2256 125 --
NM_014683chr1731559 680 594 ------
NM_014686chr1952504 2291 1895 907 897 ------
NM_014693chr31166 ------
NM_014701chr1533048 811 45 23430 550 ----
NM_014702chr632732 2493 251 22293 266 ----
NM_014707chr731845 1530 603 2781 552 ----
NM_014711chr1652061 1765 768 412 205 ------
NM_014712chr161636 ------
NM_014715chr112849 344 1904 ----
NM_014717chr192866 742 1243 ----
NM_014721chr6137422 7058 5853 5590 5293 5099 4985 4840 2263 2208 1423 722 76 36916 6202 6131 --15161
NM_014726chr17----11315 --
NM_014727chr191222 ------
NM_014729chr821812 203 1475 11876 --
NM_014730chr1245283 1804 1499 618 14111 ----
NM_014730chr1245283 1804 1499 618 14111 ----
NM_014733chr542228 1571 663 434 130 ----
NM_014735chrX3329 193 100 ------
NM_014739chr653389 1608 1381 1111 185 23871 3163 --1271
NM_014742chr2011807 11791 ----
NM_014743chr442768 2559 1261 1195 12397 32539 2251 358 --
NM_014751chr841757 1560 870 722 12000 1420 12160
NM_014755chr253952 2670 680 508 332 41629 1206 372 264 13218 --
NM_014756chr111141 ------
NM_014772chr1842833 2727 2707 444 ------
NM_014779chr3--11103 ----
NM_014781chr83845 485 297 1851 1804 --
NM_014787chr11343 12167 ----
NM_014803chr1042504 1911 688 131 --12511 --
NM_014810chr153242 2977 1281 550 229 ----13429
NM_014813chr12581 118 ----1599
NM_014827chr12489 213 167 ----
NM_014829chr511550 2885 81 ----
NM_014830chr1233895 3806 1157 --13869 --
NM_014832chr1352110 2034 702 635 537 1415 ----
NM_014838chr2242380 1902 1807 405 1416 ----
NM_014839chr132121 2112 1019 ------
NM_014841chr641041 1009 237 210 ------
NM_014847chr11443 ------
NM_014873chr184597 3585 3094 2952 1473 901 531 508 34390 4185 1664 11718 --
NM_014874chr121902 1798 --1330 --
NM_014877chr1727711 2190 25134 363 17081 12660
NM_014883chr421565 155 --11777 --
NM_014888chr721563 151 --11259 1175
NM_014892chr62172 149 ------
NM_014893chrY41745 929 894 544 ------
NM_014897chr1753247 3170 3017 1232 413 ------
NM_014904chr1073996 3017 2968 2925 2877 1467 1328 --13980 --
NM_014905chr21138 --1228 --
NM_014906chr1733123 3090 2674 23771 2575 --13874
NM_014912chr1063161 3057 3024 2528 2493 200 ----13043
NM_014917chr12757 246 ------
NM_014918chr1531629 1579 494 1336 ----
NM_014920chr643257 3140 2313 705 1401 ----
NM_014923chr1332213 2085 69 21735 1544 ----
NM_014926chr3--11101 21122 331 --
NM_014932chr351799 1711 1658 161 40 ------
NM_014937chr10177 ----11357
NM_014946chr243093 2151 944 324 11252 11212 --
NM_014947chr153010 2907 1262 836 757 11129 ----
NM_014951chr1042545 1922 1876 1756 11797 --11788
NM_014952chr1512090 ------
NM_014961chr41379 151 1415 --
NM_014962chr2072843 2683 2470 2332 2083 1087 243 ------
NM_014978chr1021455 533 11699 ----
NM_014982chr1455385 5335 4569 1404 298 ------
NM_014988chr432056 729 616 --12115 --
NM_014990chr14------1538
NM_014991chr433110 2947 2046 1425 23201 871 --
NM_014999chr1241669 1423 1084 50 ------
NM_015000chr1252958 2710 2092 1979 482 11973 1693 --
NM_015001chr11802 ------
NM_015008chr343413 2927 2674 21 23327 162 ----
NM_015009chr32679 243 --1755 --
NM_015015chr1921492 470 11809 ----
NM_015020chr1663885 3798 3789 3198 3113 2705 ------
NM_015024chr821465 590 170 ----
NM_015025chr232174 2068 1685 31831 936 704 --1541
NM_015026chr1253735 2981 1867 1563 821 24416 1924 ----
NM_015039chr113020 24291 1232 23957 606 --
NM_015040chr243312 2878 2425 738 22836 2718 11314 13245
NM_015045chr1011584 ----12076
NM_015046chr92463 200 142 ----
NM_015051chr962704 2468 835 507 288 162 12733 ----
NM_015055chr113845 532 312 --12861 --
NM_015057chr131482 ------
NM_015068chr773964 3920 3893 3426 3393 2906 2561 ------
NM_015071chr565067 4197 3976 1568 1306 433 ----11496
NM_015074chr163500 1939 1313 1290 1046 168 --14084 --
NM_015075chrX42234 1740 761 301 ------
NM_015076chr663955 3353 1530 940 231 145 --24514 1223 11431
NM_015091chr141702 1332 ----
NM_015092chr1654665 4552 4000 3353 1095 13520 11391 --
NM_015093chr61594 ------
NM_015097chr341564 766 427 321 22384 555 ----
NM_015100chr141249 546 453 379 ------
NM_015107chrX3112 53 41 ------
NM_015115chr472666 2467 2244 711 451 261 174 1334 11064 12604
NM_015124chr2242488 2407 2375 23 ------
NM_015130chr421303 1283 ------
NM_015132chr721654 1318 ----11695
NM_015137chr822253 1967 ------
NM_015138chr1512071 22847 1903 ----
NM_015143chr441298 1190 376 198 ------
NM_015144chr16103970 3827 3588 3218 3072 2863 496 297 263 174 13904 ----
NM_015153chr62540 239 ------
NM_015156chr1473896 3550 3258 3189 2715 740 520 ------
NM_015161chr1631353 1284 42 --11376 11445
NM_015170chr811798 ------
NM_015172chr111043 --11519 --
NM_015180chr142583 560 ------
NM_015184chr32209 51 --1646 1630
NM_015187chr42632 283 1659 ----
NM_015192chr2052150 691 645 437 29 --12161 --
NM_015199chr321894 905 2434 326 ----
NM_015200chr431811 1776 981 ------
NM_015208chr1872985 2702 2534 1092 772 470 237 1986 --11076
NM_015209chr121856 743 12122 ----
NM_015213chr111703 ------
NM_015215chr152286 2277 2105 1181 37 --1195 --
NM_015225chr952701 2462 711 688 391 ------
NM_015230chr43499 336 44 --1225 11443
NM_015234chr641399 1124 1075 971 2520 285 11063 11450
NM_015236chr421542 289 ------
NM_015238chr51246 ------
NM_015239chr91442 ------
NM_015245chr61269 ------
NM_015247chr1674765 4567 3682 3411 3313 1186 89 --152 --
NM_015250chr92687 602 ------
NM_015251chr1652339 2315 2267 1538 618 ------
NM_015263chr153912 898 218 ------
NM_015265chr242659 2546 453 175 22583 1906 --11786
NM_015268chr31167 ------
NM_015271chr463607 3550 2884 1714 1088 400 --1797 --
NM_015272chr1632135 2008 1539 ------
NM_015275chr1232072 634 566 ------
NM_015278chr653258 2839 2737 2257 454 13359 13209 23278 734
NM_015285chr1852580 2301 1875 465 343 --11666 --
NM_015291chr163278 2871 2656 2631 1180 1038 --12776 --
NM_015296chr1331253 818 346 ------
NM_015310chr898322 7813 7759 5374 1772 1740 1156 372 134 12904 ----
NM_015313chr1141559 1318 796 306 24301 1426 ----
NM_015317chr221019 688 --12839 --
NM_015323chr641705 1560 652 148 ------
NM_015328chr763088 2864 2799 1975 1146 884 21074 645 11037 --
NM_015335chr1211688 21801 1762 ----
NM_015336chr1272008 1836 943 740 437 416 28 1604 12524 --
NM_015345chr61877 12796 ----
NM_015347chr1252847 2496 1987 338 106 12876 ----
NM_015349chr622972 1944 11970 32390 2136 640 13088
NM_015355chr1751739 1683 729 655 490 ------
NM_015358chr2121081 279 11284 ----
NM_015361chr23832 357 319 --1868 --
NM_015365chrX64272 3753 2887 2865 2807 119 ------
NM_015378chr132193 1928 416 1900 --1807
NM_015379chr71283 ------
NM_015385chr1053281 3126 3043 844 225 --13200 12896
NM_015393chr433824 1331 762 11250 13798 --
NM_015397chr941852 1235 679 253 ------
NM_015416chr122695 26 1931 ----
NM_015423chr1151573 1539 1376 1224 205 ------
NM_015435chr82267 150 ------
NM_015455chr543315 1084 519 457 23676 525 11178 --
NM_015458chr895285 4938 4804 4752 4534 3222 1840 1249 903 --13372 --
NM_015461chr182203 83 --1110 --
NM_015464chr721047 262 ------
NM_015472chr31151 --1512 --
NM_015472chr31151 --1512 --
NM_015475chr221043 939 ------
NM_015477chr15----1957 --
NM_015483chr721164 273 ------
NM_015493chr1941879 1471 370 355 ------
NM_015497chr152950 732 --1799 --
NM_015514chr14----1518 --
NM_015520chr332652 2078 1755 12235 12213 --
NM_015530chr2--1238 ----
NM_015531chr111156 ------
NM_015534chr12922 57 ------
NM_015535chr244039 2951 1372 464 24112 754 21625 1226 --
NM_015542chr10------1775
NM_015550chr72676 658 --13308 1128
NM_015553chr651938 1449 1165 494 309 161 24795 3511 --
NM_015554chr1562539 2469 2066 765 542 162 --22707 2261 11999
NM_015565chr2131972 1697 329 32018 1827 702 ----
NM_015569chr153441 3230 1697 1122 153 --34063 1588 70 --
NM_015570chr721530 307 11704 ----
NM_015571chr632628 999 896 1274 --11974
NM_015575chr253624 3080 1402 564 538 --23512 993 --
NM_015577chr5181 ------
NM_015578chr1932059 628 340 1354 ----
NM_015605chr1021446 296 ----11383
NM_015626chr1721020 321 ------
NM_015630chr21859 ----1874
NM_015635chr962264 2154 1869 578 430 204 ------
NM_015649chr191156 ------
NM_015652chr101616 ------
NM_015676chr141364 ------
NM_015678chr13--21674 1658 21160 142 --
NM_015691chrX42829 2158 617 538 1341 ----
NM_015693chr41242 ------
NM_015718chr6127 ------
NM_015723chr71602 1488 ----
NM_015866chr151474 1250 1159 1088 47 11530 ----
NM_015874chr41395 ------
NM_015878chr861988 1795 1659 747 500 35 32093 1939 543 ----
NM_015879chr18128587 8490 6908 6521 6434 2923 1624 1278 1150 838 588 228 26741 3153 48001 7134 1199 818 --
NM_015885chr111244 ------
NM_015886chr864326 4071 1305 1119 1020 231 --15743 --
NM_015888chr153147 1199 940 901 858 12222 11287 --
NM_015891chr661961 1780 1310 796 731 45 ------
NM_015902chr8121 ------
NM_015904chr2------1601
NM_015906chr174823 4647 4071 3857 3178 2927 755 ------
NM_015914chr16140 184 ----
NM_015957chr111358 ------
NM_015995chr1555102 5096 1998 1072 197 25525 5486 ----
NM_016009chr184358 4156 3590 3147 1047 1034 871 152 ----13889
NM_016018chr821748 660 1411 --1928
NM_016019chr7--2777 426 ----
NM_016021chr642970 1950 1123 307 ------
NM_016023chr82475 453 11617 1215 1418
NM_016025chr162668 293 21538 662 ----
NM_016039chr142148 141 ------
NM_016072chr1222274 421 22408 2339 ----
NM_016075chr1372989 2239 1238 1170 1036 397 344 12307 ----
NM_016078chr1731037 951 219 2874 87 ----
NM_016081chr452245 2141 2033 1978 248 --1404 --
NM_016083chr653687 3497 2654 1392 573 13370 --13724
NM_016090chr113887 161 21 1326 ----
NM_016096chr851969 1605 1365 618 554 2407 252 1571 --
NM_016098chr62362 42 ------
NM_016107chr51312 --1946 --
NM_016120chrX3966 142 123 1759 ----
NM_016121chr111122 31019 939 454 ----
NM_016125chr171563 ------
NM_016131chr241868 1842 1531 333 --12117 --
NM_016132chr1563329 3275 2962 2578 327 81 ----11140
NM_016133chr2----1317 --
NM_016144chr52163 68 1699 ----
NM_016162chr121623 ------
NM_016192chr21187 ------
NM_016195chr10--169 ----
NM_016200chr7------1121
NM_016206chr377912 2889 2725 2626 1889 773 29 23467 472 27672 5509 --
NM_016217chr643703 3557 1454 805 3635 608 563 12261 --
NM_016221chr582364 2064 1492 1483 1461 764 497 126 --1305 --
NM_016227chr111132 ------
NM_016248chr1333667 2560 293 1929 --12554
NM_016255chr632726 857 691 --12401 --
NM_016260chr255649 4922 4705 2908 504 11282 ----
NM_016270chr192389 366 ------
NM_016271chr1882342 2241 1954 1434 820 526 434 351 11590 ----
NM_016275chr352783 2638 2370 1017 774 12754 --149
NM_016277chr641347 190 137 35 ----11442
NM_016281chr1241018 843 345 99 ------
NM_016287chr152030 1524 658 344 121 ------
NM_016290chr5185 ------
NM_016297chr283647 3421 2629 2333 470 292 182 110 --2906 314 --
NM_016300chr31469 --1368 --
NM_016303chrX3434 155 147 ------
NM_016312chr12195 ------
NM_016315chr221856 1629 ------
NM_016322chr973175 2567 2183 2115 1091 430 77 23186 2452 12205 --
NM_016329chr32481 475 --1371 --
NM_016338chr5--11057 ----
NM_016339chr1741798 1762 1360 187 --21818 1418 --
NM_016340chr53309 99 81 1853 ----
NM_016351chr71617 ------
NM_016374chr141578 1255 1229 481 ------
NM_016374chr141578 1255 1229 481 ------
NM_016376chr1743778 3476 1550 815 ------
NM_016395chr1531917 377 169 --11745 11507
NM_016396chr1543015 2805 802 72 --1628 --
NM_016424chr174756 611 528 200 11837 ----
NM_016426chr22--1656 ----
NM_016436chr2052390 2383 2114 2008 1952 --12604 11666
NM_016441chr232119 413 96 ------
NM_016467chr221313 345 11136 ----
NM_016480chr51112 3866 605 76 ----
NM_016485chr621431 183 ------
NM_016488chr1221905 701 21955 667 ----
NM_016505chr12648 603 ------
NM_016507chr1752671 1181 1057 964 306 --12234 --
NM_016513chr643257 3140 2313 705 1401 ----
NM_016531chr423046 1690 ------
NM_016542chrX31683 1665 1077 11455 11477 --
NM_016559chr32499 47 2298 287 ----
NM_016570chr121487 ------
NM_016577chr353916 3763 2851 820 233 --12877 --
NM_016578chr111514 ------
NM_016584chr121256 ------
NM_016587chr7--11100 ----
NM_016603chr522209 254 --12230 --
NM_016607chrX41120 472 342 120 ----139
NM_016626chr1831470 684 526 1506 11475 --
NM_016631chr211700 ----1906
NM_016651chr1411092 ------
NM_016652chr2031654 1146 695 21703 175 ----
NM_016654chr1511253 --11386 --
NM_016656chrX195 1410 ----
NM_016733chr2231535 1393 46 ------
NM_016824chr1031891 1791 427 --144 --
NM_016831chr122003 1833 1794 21778 162 12274
NM_016950chr451082 970 526 440 139 ------
NM_017412chr82914 157 ------
NM_017420chr1453552 3499 3173 3094 187 12725 ----
NM_017423chr422240 2143 21731 820 ----
NM_017426chr42270 258 ------
NM_017440chr122483 55 ------
NM_017447chr2164370 3942 3485 1676 1043 1002 ------
NM_017450chr1711514 ------
NM_017489chr8----1178 --
NM_017491chr41846 ------
NM_017519chr61323 ------
NM_017548chr381994 1554 1343 866 668 357 197 134 --12131 --
NM_017563chr396196 5911 5316 2215 872 518 476 76 25 --15935 --
NM_017578chr3146 ------
NM_017580chr102625 304 1261 21887 1875 --
NM_017582chr12289 133 ------
NM_017593chr41176 ------
NM_017594chr922942 2723 12292 22665 111 --
NM_017610chr153818 709 259 11391 ----
NM_017615chr10169 ------
NM_017628chr423580 691 24406 4086 11171 --
NM_017632chr4198 ------
NM_017634chr821594 238 --1668 --
NM_017635chr112268 128 ------
NM_017637chr9109193 8224 8193 7476 6564 6048 3282 2134 883 566 11387 21808 1138 --
NM_017640chr61612 ------
NM_017643chr1742317 1109 557 275 13044 ----
NM_017650chr785155 5113 5107 4914 2243 1803 1712 405 35618 4976 2043 ----
NM_017651chr651527 1047 1003 262 215 ------
NM_017657chr24732 604 376 28 ------
NM_017658chr1444632 4593 3251 94 13117 ----
NM_017661chr152796 469 2980 912 ----
NM_017664chr132293 266 1956 ----
NM_017669chrX121 ------
NM_017709chr131519 942 675 2789 667 ----
NM_017714chr203699 359 286 1112 ----
NM_017738chr91230 126 --172
NM_017745chrX1541 ------
NM_017747chr5----1132 --
NM_017754chr664213 4029 3257 1408 665 200 25003 4522 ----
NM_017769chr1442938 2515 1051 742 12396 ----
NM_017772chr62351 316 11774 11261 --
NM_017780chr81654 ------
NM_017801chr352257 2213 1930 1630 46 --22539 2291 --
NM_017811chr933152 3016 1923 --12195 --
NM_017813chr865500 2230 1513 1213 756 294 14645 13901 1631
NM_017824chr101198 ------
NM_017831chr18104795 4764 4246 4061 1688 1515 1488 1283 244 39 33309 3229 1094 ----
NM_017847chr122286 632 22259 1878 1187 --
NM_017848chrX64374 4011 3816 1870 769 725 --23737 3083 --
NM_017866chr8------1845
NM_017902chr1055283 4725 1874 1461 93 ------
NM_017905chr13--1541 ----
NM_017919chr995810 5537 4946 4489 4128 3883 3575 1675 912 1513 ----
NM_017925chr941690 1261 323 153 ------
NM_017933chr231259 1109 630 --11030 --
NM_017944chr1182817 2233 2121 1090 914 775 690 312 --22910 1158 --
NM_017954chr761678 1433 1152 391 88 46 ------
NM_017988chr122865 849 ----2649 366
NM_017998chr921332 1061 ------
NM_018011chr133626 423 205 ------
NM_018015chrX1734 ------
NM_018025chr19----180 --
NM_018028chr1911339 ------
NM_018032chr161337 ------
NM_018046chr531460 569 549 11886 1719 --
NM_018047chr52897 847 ------
NM_018048chr1232027 1467 268 21951 1606 ----
NM_018061chr11168 --1499 --
NM_018070chr11566 --139 --
NM_018078chr411012 ------
NM_018092chr1631142 227 134 21509 1292 11423 --
NM_018098chr311195 ------
NM_018105chr811155 ------
NM_018112chr92833 170 ----1310
NM_018120chr821462 56 ----11421
NM_018133chr372104 1987 1906 877 869 295 127 ------
NM_018137chr11527 11392 11423 --
NM_018149chr17--1182 ----
NM_018156chr132193 1928 416 1900 --1807
NM_018157chr1223070 30 ------
NM_018169chr12--1460 1128 --
NM_018176chr441547 1115 615 169 11564 ----
NM_018181chr1841734 1710 1579 1556 2460 110 ----
NM_018195chr1131667 693 420 ------
NM_018200chr1541990 1742 754 572 1901 --1364
NM_018202chr1196 ----151
NM_018206chr16--1494 --1722
NM_018221chr23121 61 44 ------
NM_018225chr975332 5288 5122 4967 4381 3594 1013 15213 ----
NM_018227chr442729 1998 1078 891 12737 ----
NM_018229chr1421071 323 1121 ----
NM_018230chr1123 ------
NM_018237chr10------1229
NM_018243chr463937 3868 2807 2791 1170 764 ------
NM_018247chr663049 2921 2906 2630 2165 693 ------
NM_018263chr222490 2414 ------
NM_018272chr12--125 ----
NM_018286chr173842 792 744 ------
NM_018293chr321186 909 2840 571 ----
NM_018299chr843267 2558 2497 351 --1593 --
NM_018307chr171381 ------
NM_018312chr114651 354 230 187 --21450 157 --
NM_018313chr321689 108 12352 ----
NM_018315chr421253 568 ------
NM_018325chr941636 1575 253 116 --11217 --
NM_018328chr22421 370 ------
NM_018335chr141147 ------
NM_018339chr941722 1480 1263 704 --1687 --
NM_018351chr1253802 3178 2903 1492 80 13861 --24726 350
NM_018361chr842951 562 478 40 13147 ----
NM_018362chr1183724 3492 3032 1552 1518 1426 677 514 21622 90 ----
NM_018364chr153438 3234 2980 1134 455 12507 ----
NM_018365chr15199 ------
NM_018371chr841588 1470 1317 207 --11522 --
NM_018373chr1465803 4853 4574 4264 4021 1502 14722 26226 2565 --
NM_018374chr745125 3266 1633 459 25115 4796 ----
NM_018375chr1441953 1781 1512 218 --1195 --
NM_018383chr231494 670 212 --196 --
NM_018403chr352967 2643 1592 839 252 --23908 3295 --
NM_018416chr1232616 2569 2344 ------
NM_018429chr562240 2108 1093 590 365 337 12608 22463 677 --
NM_018444chr842283 2004 1443 429 12076 ----
NM_018448chr1231192 1114 156 ------
NM_018482chr822420 862 1910 11007 --
NM_018489chr132332 2212 224 --11749 1359
NM_018490chr1141869 1561 1355 672 ----11540
NM_018566chr125071 4127 33323 1245 610 ----
NM_018569chr421472 353 11544 ----
NM_018571chr2--1561 ----
NM_018640chr1252485 1794 587 379 290 1305 ----
NM_018650chr141825 869 676 462 ------
NM_018652chr152840 309 ------
NM_018662chr134396 4245 644 ------
NM_018664chr1180 ------
NM_018667chr1642669 2596 2385 2313 ------
NM_018682chr7----1598 --
NM_018684chrX21249 882 ------
NM_018686chr121240 ------
NM_018695chr572236 1933 1777 1743 1531 691 282 ------
NM_018698chrX61843 1617 515 401 165 73 1291 --11504
NM_018700chr52628 576 11690 11287 --
NM_018703chr161125 ------
NM_018712chr1141407 316 104 47 1969 ----
NM_018717chr432461 2350 473 1655 ----
NM_018718chr752241 1697 1581 818 560 ------
NM_018834chr51104 ------
NM_018840chr20----1462 --
NM_018841chr143905 3231 641 611 --13934 1651
NM_018844chr742083 1957 1696 331 2181 138 ----
NM_018898chr552384 2138 2100 1829 1593 --12147 --
NM_018899chr552384 2138 2100 1829 1593 --12147 --
NM_018900chr552384 2138 2100 1829 1593 --12147 --
NM_018901chr552384 2138 2100 1829 1593 --12147 --
NM_018902chr552384 2138 2100 1829 1593 --12147 --
NM_018903chr552384 2138 2100 1829 1593 --12147 --
NM_018904chr552384 2138 2100 1829 1593 --12147 --
NM_018905chr552384 2138 2100 1829 1593 --12147 --
NM_018906chr552384 2138 2100 1829 1593 --12147 --
NM_018907chr552384 2138 2100 1829 1593 --12147 --
NM_018908chr552384 2138 2100 1829 1593 --12147 --
NM_018909chr552384 2138 2100 1829 1593 --12147 --
NM_018910chr552384 2138 2100 1829 1593 --12147 --
NM_018911chr552384 2138 2100 1829 1593 --12147 --
NM_018912chr51686 ------
NM_018913chr51686 ------
NM_018914chr51686 ------
NM_018915chr51686 ------
NM_018916chr51686 ------
NM_018917chr51686 ------
NM_018918chr51686 ------
NM_018919chr51686 ------
NM_018920chr51686 ------
NM_018921chr51686 ------
NM_018922chr51686 ------
NM_018923chr51686 ------
NM_018924chr51686 ------
NM_018925chr51686 ------
NM_018926chr51686 ------
NM_018927chr51686 ------
NM_018928chr51686 ------
NM_018929chr51686 ------
NM_018945chr623170 612 ------
NM_018970chr722154 616 22196 2162 12299 --
NM_018975chr163794 739 290 ------
NM_018976chr1262598 995 930 735 667 315 ------
NM_018979chr1242584 2540 922 847 --1816 --
NM_018993chr2031324 506 222 ----11478
NM_018999chr1034175 3508 1939 21752 1642 13910 --
NM_019001chr364694 3638 3591 2980 1625 1558 ------
NM_019006chr151624 1564 --1174
NM_019022chr1862931 2482 2227 1220 1096 595 23205 2907 1736 --
NM_019024chr21298 ------
NM_019035chr431275 100 88 11870 ----
NM_019045chrX1201 --1788 --
NM_019050chr411436 ----21776 88
NM_019072chr533061 1187 1021 11385 --13601
NM_019074chr15161 --171 --
NM_019080chr1311543 ----11022
NM_019084chr1022340 2226 12541 ----
NM_019087chr521187 667 11537 ----
NM_019091chr231026 337 35 ------
NM_019095chr20--1221 ----
NM_019106chr2263451 2854 2556 2368 2261 774 ------
NM_019114chr942086 1632 664 431 ------
NM_019116chr1653108 1378 818 475 51 1412 --1432
NM_019555chr321314 581 ------
NM_019556chrX11341 1123 --11485
NM_019590chr10193 21335 420 1550 --
NM_019593chr2052739 1039 781 708 75 13127 ----
NM_019596chr2142873 2227 1845 641 --22122 712 --
NM_019597chrX1747 ------
NM_019610chr121581 207 1777 ----
NM_019852chr141113 ------
NM_019892chr9145 ------
NM_019903chr1031891 1791 427 --144 --
NM_020116chr421518 61 11420 148 --
NM_020119chr764023 1408 1226 877 657 194 22903 1179 ----
NM_020122chr265949 5942 4930 4914 3709 119 22371 90 13736 --
NM_020123chr1021245 475 --11074 --
NM_020130chr8--1952 ----
NM_020132chr2144187 4111 4054 3127 --14412 --
NM_020139chr421481 579 11546 1630 1202
NM_020141chr142396 2297 1749 780 ----1571
NM_020148chr1833034 2909 141 --11161 --
NM_020159chr431185 1071 498 ------
NM_020177chr563284 3136 3014 1260 905 111 ----13372
NM_020179chr111400 ------
NM_020180chr182940 534 ------
NM_020189chr8----1134 --
NM_020194chr2----2559 87 --
NM_020198chr1731140 468 455 ------
NM_020204chr11303 ------
NM_020228chr1112503 ----11617
NM_020235chr3126 ------
NM_020240chr532678 1713 1038 1646 ----
NM_020245chr655108 4521 3852 3566 1351 11313 ----
NM_020297chr1253408 2834 2796 1383 171 11105 --11304
NM_020337chr452109 2076 1218 480 33 12868 32143 443 438 12947
NM_020341chr2021880 1795 --1503 --
NM_020342chr262580 1767 947 651 423 80 1833 12351 --
NM_020346chr1161717 537 492 250 57 50 31301 1214 396 ----
NM_020347chr341711 1556 889 402 ------
NM_020351chr31143 ------
NM_020357chr351189 1160 543 432 283 ------
NM_020379chr1--1615 1680 1710
NM_020382chr1211643 ------
NM_020390chr394776 4698 4635 4394 4325 3780 3274 3147 448 13364 ----
NM_020403chr1361673 1372 1262 714 256 235 ------
NM_020420chrY11839 ------
NM_020432chr752167 1901 1545 398 325 32213 1411 605 ----
NM_020440chr133309 2590 1007 --12390 --
NM_020443chr144466 2197 2191 1489 ------
NM_020445chr71126 ----1796
NM_020449chrX3677 488 143 ------
NM_020455chr622653 2489 163 --12554
NM_020466chr663980 1118 695 517 450 50 34549 3174 1932 ----
NM_020473chrX31955 1885 1376 11846 ----
NM_020532chr25924 884 839 328 298 1203 2748 96 --
NM_020648chr1862804 2499 2018 440 424 194 ------
NM_020651chr221785 1291 1370 --1379
NM_020654chr311148 1426 ----
NM_020659chr191577 ------
NM_020666chr52589 128 ------
NM_020673chr20106743 6298 5459 2139 1544 1481 1049 910 867 268 ------
NM_020699chr155237 4043 3546 3540 513 14010 1506 --
NM_020715chr141635 ------
NM_020717chrX54901 4614 4167 1287 727 14326 11740 --
NM_020718chr16115996 5686 5507 4376 2483 1563 1260 959 602 288 254 24457 166 21994 1860 --
NM_020726chr51206 ------
NM_020727chr2163996 3973 3286 1568 1196 755 22550 2502 ----
NM_020732chr61323 ------
NM_020734chr1263391 3178 2778 2682 2061 389 32766 2739 664 ----
NM_020739chr1523673 1121 12964 13891 --
NM_020742chrX72161 2024 1811 1754 1039 957 737 ------
NM_020747chr52857 22 ------
NM_020748chr171223 ------
NM_020750chr611406 ----11413
NM_020752chr1062906 2595 2391 2250 636 561 ----12652
NM_020755chr62195 39 11467 11639 --
NM_020765chr11103 ------
NM_020766chrX94532 3830 3741 3723 3579 3338 3024 2858 337 24215 601 33937 3511 855 14423
NM_020771chr651388 1133 624 443 288 2551 511 ----
NM_020772chr17138677 8138 7597 6826 6561 5636 3399 2505 1824 1294 1282 869 800 22846 1911 ----
NM_020773chr4--22681 313 ----
NM_020774chr1895978 5201 4858 4173 1827 1352 897 644 294 14292 15706 --
NM_020782chr1274389 4169 3197 1913 734 709 292 --11831 --
NM_020794chr131561 1463 1383 1413 ----
NM_020795chr17--12042 ----
NM_020801chr542628 889 744 346 11703 ----
NM_020804chr612662 ------
NM_020806chr141691 ------
NM_020809chr1152059 2040 1509 587 118 ------
NM_020819chr631204 1168 354 ------
NM_020841chr1223534 359 ------
NM_020854chr181386 ------
NM_020856chr1921260 596 ------
NM_020858chr1542258 2125 1880 1810 1820 1643 --
NM_020859chr443471 1463 775 472 12467 ----
NM_020865chr3155 ------
NM_020868chr22458 74 ------
NM_020871chrX21913 727 --1759 --
NM_020872chr321562 507 ----11279
NM_020899chr1722151 484 ------
NM_020917chr1952801 2523 1109 579 349 1907 ----
NM_020918chr1043429 3258 2887 2291 23636 669 ----
NM_020921chr1422707 641 --12878 --
NM_020924chr91431 ------
NM_020925chr1--11464 --11198
NM_020927chr1632310 1557 813 ------
NM_020935chr244378 3799 2873 1591 31153 1066 888 23994 1615 --
NM_020937chr142123 67 1817 ----
NM_020940chr1092848 2715 2641 2552 2451 775 230 224 113 --12169 --
NM_020948chr152909 2447 2286 1337 1000 --12360 --
NM_020951chr1932115 1800 289 1319 --1349
NM_020960chr964761 3749 3619 1257 797 471 25014 1206 13528 --
NM_020964chr1854742 3202 85 63 31 14516 ----
NM_020977chr441719 816 675 437 1610 ----
NM_020987chr101947 ------
NM_021003chr142639 572 ------
NM_021005chr151310 ------
NM_021007chr231871 868 528 ------
NM_021033chr1373475 3263 1066 897 576 315 287 22764 2147 ----
NM_021038chr363190 2078 737 266 143 86 1549 1934 --
NM_021061chr852854 1349 471 412 240 ------
NM_021072chr562427 919 796 775 585 511 1860 11052 --
NM_021079chr1733323 1186 159 1165 ----
NM_021083chrX23567 2906 --11402 --
NM_021088chr222170 1454 1779 ----
NM_021090chr2264499 4472 3934 3864 3214 151 14639 ----
NM_021116chr798550 7262 6478 6462 5697 5500 3436 2887 137 19043 27420 6486 --
NM_021120chrX1294 22094 1032 13119 12641
NM_021132chr101118 ------
NM_021145chr731147 1109 137 11051 ----
NM_021167chr761082 843 554 325 257 66 22214 2073 ----
NM_021183chrX92273 2135 1942 1830 1734 869 849 770 95 11806 ----
NM_021184chr6--174 ----
NM_021190chr12856 37 ----11079
NM_021191chr1222386 361 1347 2289 179 --
NM_021239chr143900 339 89 ------
NM_021249chr1421462 376 1617 1664 --
NM_021255chr1474070 3492 3175 2617 1651 992 182 --11381 --
NM_021614chr51207 170 ----
NM_021619chr911247 ------
NM_021622chr102443 244 --12006 --
NM_021627chr32890 71 ------
NM_021638chr464713 4106 3624 3452 1911 309 23283 1720 21975 1954 --
NM_021639chr1--1621 ----
NM_021647chr473959 3466 1669 924 512 472 361 1829 24085 1892 --
NM_021722chr71576 ------
NM_021723chr71617 ------
NM_021728chr143924 642 371 ------
NM_021738chr101132 ------
NM_021807chr71485 --1806 --
NM_021809chr2031714 1649 908 ------
NM_021813chr685723 5585 4761 4579 4441 4175 3742 1980 15652 1760 25875 5762
NM_021814chr621684 1578 2370 44 ----
NM_021911chr585564 3751 3709 1894 1558 1488 404 332 11396 45441 3646 1386 1283 14773
NM_021912chr152489 130 14094 23496 990 --
NM_021914chr1442113 863 788 412 ----1833
NM_021935chr31988 1956 ----
NM_021942chr43827 239 67 ----1906
NM_021943chr612159 --1216 --
NM_021946chrX31454 1327 207 ------
NM_021954chr1333254 2258 562 --13376 13678
NM_021959chr61990 ------
NM_021961chr1176941 6204 6162 4925 4523 1501 781 24894 1112 1195 16211
NM_021964chr396512 5277 4674 4618 4231 2309 1291 1163 886 --34863 392 320 26388 5639
NM_021977chr663868 3859 3254 1468 1455 461 ------
NM_021988chr2021601 1395 1610 ----
NM_021998chrX21528 468 ------
NM_022037chr23675 305 165 ------
NM_022048chr1584359 4324 4252 2318 1265 749 279 50 15742 25710 4818 --
NM_022091chr622265 170 ----22337 2220
NM_022114chr144626 4195 4046 558 14357 ----
NM_022130chr541244 1183 1077 566 ----11385
NM_022133chr851769 1219 377 306 192 ----11237
NM_022137chr145590 546 392 363 77 1246 ----
NM_022138chr621520 384 ------
NM_022143chr71973 11558 ----
NM_022170chr721080 458 ------
NM_022173chr23675 305 165 ------
NM_022337chr112591 41 ------
NM_022351chr853731 2862 2619 1422 666 13214 --1239
NM_022361chr64543 201 163 130 ------
NM_022442chr2021601 1395 1610 ----
NM_022457chr12228 24 ------
NM_022459chr1354688 1885 1519 1175 891 24443 2354 26382 1390 --
NM_022461chr34877 520 403 325 1288 ----
NM_022465chr1232589 1934 184 23012 2984 ----
NM_022469chr132524 2364 759 22102 831 11068 --
NM_022474chr14--22824 1946 ----
NM_022475chr42690 221 1518 --1288
NM_022477chr2031747 1533 1381 ----129
NM_022484chr721393 1230 ------
NM_022494chr10154 ------
NM_022550chr52484 142 ------
NM_022648chr244580 1730 1722 154 --24635 1591 --
NM_022716chr143162 2146 546 322 11005 ----
NM_022731chr1----1200 --
NM_022733chr121215 1099 ------
NM_022735chr131843 1753 1242 ------
NM_022739chr171978 ------
NM_022745chr142785 2195 913 314 ------
NM_022753chr142659 2530 381 158 --12084 --
NM_022763chr342615 2499 904 733 13070 23097 687 --
NM_022776chr331404 492 101 11507 21385 76 --
NM_022778chr111480 ------
NM_022780chr22740 637 ------
NM_022782chr12------1364
NM_022783chr81279 ------
NM_022784chr153929 298 36 ------
NM_022787chr152021 1883 896 362 346 --2920 370 --
NM_022824chr531510 767 56 ------
NM_022831chr12715 214 ------
NM_022832chr43924 409 219 12179 ----
NM_022841chr1542718 1986 1926 51 12505 ----
NM_022842chr352331 739 714 300 147 --33057 2926 2180 --
NM_022843chr1321222 393 1126 ----
NM_022845chr163606 357 47 --32153 1549 1494 --
NM_022893chr273080 2966 2760 2032 843 411 288 ------
NM_022898chr1474596 4531 4097 1503 1432 1191 45 ------
NM_022899chr341511 1356 1005 284 180 ----
NM_022900chr731107 426 239 --1229 --
NM_022902chr5168 ----1332
NM_022913chr5--168 ----
NM_022915chr21561 ------
NM_022977chrX22591 560 ----1585
NM_023000chr1441581 1555 137 100 1172 ----
NM_023001chr1441581 1555 137 100 1172 ----
NM_023016chr242328 1893 893 483 22878 596 1437 --
NM_023074chr193935 924 314 1521 ----
NM_023923chr1103754 3701 3133 2476 2460 1522 1388 921 228 104 --23759 536 --
NM_023929chr832217 2069 1722 ------
NM_024007chr542959 2950 2510 23 --12976 12140
NM_024019chr4----1750 --
NM_024054chr7--1263 1332 --
NM_024315chr7--1129 ----
NM_024334chr3----11846 --
NM_024336chr162327 58 ------
NM_024337chr5--1300 ----
NM_024411chr202586 113 ------
NM_024421chr1831204 445 235 --1366 --
NM_024424chr1141103 1008 365 258 11236 ----
NM_024425chr1141103 1008 365 258 11236 ----
NM_024426chr1141103 1008 365 258 11236 ----
NM_024482chr1170 ------
NM_024511chr453010 2620 1066 1021 735 ------
NM_024524chr363166 3112 2684 2659 2341 26 ----13181
NM_024529chr141083 787 355 214 1834 ----
NM_024546chr1331226 840 333 ------
NM_024563chr541734 1590 1366 558 --11453 --
NM_024582chr41219 --1319 2396 59
NM_024583chr22920 745 1962 ----
NM_024586chr11597 ------
NM_024604chr121167 ------
NM_024613chr821843 1165 ------
NM_024615chr51191 ------
NM_024626chr1137 ------
NM_024631chr112582 520 ------
NM_024632chr5--197 ----
NM_024646chr163774 3567 3335 3097 2449 218 ------
NM_024665chr384659 4492 3744 3148 1785 1518 1298 161 --34677 4312 3631 --
NM_024692chr241476 1236 610 290 11291 ----
NM_024713chr1511540 21608 1489 ----
NM_024721chr892690 2630 2366 2081 1814 1683 669 657 301 ------
NM_024751chr41447 ------
NM_024755chr151914 1605 ----
NM_024770chr2106005 4937 4762 4612 2133 1143 878 862 416 404 --15842 25046 4097
NM_024772chr11201 --1425 --
NM_024779chr1221272 182 ------
NM_024811chr11--11306 ----
NM_024817chr1514081 15876 15388 --
NM_024818chr33349 231 23 11227 ----
NM_024824chr1451406 1350 406 130 106 ------
NM_024828chr961510 1419 1413 1250 1159 979 ------
NM_024834chr1041617 360 291 81 21590 52 11330 --
NM_024899chr181453 --156 --
NM_024911chr12253 206 ------
NM_024915chr81254 1658 1636 --
NM_024946chr1661770 1655 1600 592 449 338 1418 ----
NM_024947chr3109597 9517 9470 9123 8973 8353 8039 6895 3843 2850 ----29250 7940
NM_024949chr434797 4600 267 --14305 --
NM_024953chr1242614 2426 2302 179 12111 ----
NM_024969chr22573 79 --1171 --
NM_024979chr1311654 ------
NM_024989chr297535 7065 6936 6648 6435 6396 5842 5371 1631 28021 3140 41921 1449 1377 824 15104
NM_024991chr1053281 3126 3043 844 225 --13200 12896
NM_024993chr21581 ------
NM_025040chr1921723 1605 11865 ----
NM_025054chr873990 3529 3056 2937 1668 1129 461 23784 776 ----
NM_025065chr11880 ------
NM_025079chr11754 --1243 --
NM_025126chr122695 510 ------
NM_025133chr2------135
NM_025134chr1652372 2313 1824 1664 464 164 ----
NM_025146chr352730 2455 1090 526 473 12154 1352 --
NM_025154chr711217 ------
NM_025160chr154256 1662 1398 1246 539 14078 ----
NM_025164chr1142093 2082 1464 487 152 --11351
NM_025181chr21726 ------
NM_025191chr153284 3003 1092 714 544 43532 2904 2837 774 ----
NM_025208chr1142493 1533 691 212 ------
NM_025235chr1031969 1917 444 --12098 --
NM_025237chr1721582 1538 ----1103
NM_030594chr1541057 863 847 120 --31386 1300 1234 --
NM_030621chr1454234 3715 1143 556 194 12635 23824 2902 --
NM_030623chr2--11695 --11735
NM_030625chr1072590 2583 2357 1922 569 484 462 21729 605 --11648
NM_030627chr583868 3821 3668 3457 3013 2955 220 208 11206 --13649
NM_030640chr121664 ------
NM_030647chr746303 6224 1701 834 ------
NM_030648chr465585 4280 3535 1726 1593 1587 35302 3961 3789 --21147 1113
NM_030650chr254242 4226 3788 1356 59 13618 24250 3255 --
NM_030660chr1421520 1458 ------
NM_030664chr10------11589
NM_030665chr1711339 --11417 --
NM_030667chr1221207 450 ------
NM_030668chr1221207 450 ------
NM_030669chr1221207 450 ------
NM_030674chr1234938 976 438 24974 145 11842 --
NM_030751chr102735 358 ------
NM_030751chr102735 358 ------
NM_030755chr1452727 2710 441 318 99 12082 22873 2288 --
NM_030759chr102686 142 1780 ----
NM_030761chr132689 1870 144 ------
NM_030767chr922865 2068 ------
NM_030799chr532114 2004 1846 11751 ----
NM_030806chr178541 8369 7541 6517 3649 179 129 1244 --16055
NM_030808chr173954 931 238 ----1373
NM_030809chr1222482 2059 ------
NM_030816chr153708 3627 1128 691 605 22807 619 ----
NM_030820chr61281 --2835 700 --
NM_030881chr2242350 2168 1826 736 ----12002
NM_030885chr332069 1736 826 ------
NM_030911chr1321539 1421 --147 --
NM_030915chr222241 1596 ------
NM_030918chr145368 5282 4888 3506 15442 ----
NM_030920chr12218 186 ------
NM_030939chr631176 1102 282 1972 ----
NM_030945chr541924 1064 741 95 2934 121 ----
NM_030964chr553430 2585 1471 578 401 13679 ----
NM_030965chr12668 297 1171 ----
NM_030978chr9------1432
NM_031157chr122474 189 ------
NM_031216chr1841604 1373 251 45 ------
NM_031243chr722385 1759 1232 --1585
NM_031262chr9----1988 --
NM_031263chr9----11045 --
NM_031266chr51100 1456 ----
NM_031267chr71207 ------
NM_031268chr1684806 4539 4235 4070 1828 1477 1209 265 25229 3634 14002 --
NM_031296chr421760 126 22689 2454 ----
NM_031369chr42267 202 ------
NM_031370chr42267 202 ------
NM_031371chr141578 1255 1229 481 ------
NM_031371chr141578 1255 1229 481 ------
NM_031372chr41132 1609 ----
NM_031407chrX141 ------
NM_031411chr552384 2138 2100 1829 1593 --12147 --
NM_031412chr1231124 801 488 ------
NM_031418chr1152791 1736 960 723 603 22229 998 2679 222 --
NM_031419chr341526 1115 551 258 1358 ----
NM_031424chr202537 158 ------
NM_031431chr1341578 1454 1358 1196 ------
NM_031435chr1263480 3408 2205 1333 1144 355 ------
NM_031438chr52547 189 --1514 11725
NM_031442chrX62852 2577 2035 940 334 292 --1771 --
NM_031443chr7--1349 ----
NM_031445chr263439 2513 1230 634 487 131 --1623 --
NM_031461chr851917 887 840 544 231 21814 1610 ----
NM_031468chr7107833 7507 6679 6178 5721 5492 5256 267 164 29 ------
NM_031469chr663982 3442 1175 393 359 167 13132 ----
NM_031479chr1221157 1097 ------
NM_031483chr2053424 2951 1263 716 69 12555 --12629
NM_031844chr163168 672 450 385 214 178 23757 1514 13103 --
NM_031845chr233052 444 287 2884 602 11475 1405
NM_031847chr233052 444 287 2884 602 11475 1405
NM_031849chr552384 2138 2100 1829 1593 --12147 --
NM_031850chr31886 ------
NM_031850chr31886 ------
NM_031857chr552384 2138 2100 1829 1593 --12147 --
NM_031860chr552384 2138 2100 1829 1593 --12147 --
NM_031911chr472647 2564 2323 2288 1049 1036 315 12191 ----
NM_031953chr42396 329 ------
NM_031992chr721080 458 ------
NM_032012chr984951 4805 4714 4265 4182 3339 1225 666 1961 14981 --
NM_032013chr2031747 1533 1381 ----129
NM_032041chr842473 2467 236 26 1357 ----
NM_032042chr522814 2684 ----1882
NM_032047chr341834 1626 776 182 ------
NM_032049chr31886 ------
NM_032049chr31886 ------
NM_032050chr221990 ------
NM_032052chr2211375 ------
NM_032088chr51686 ------
NM_032092chr51686 ------
NM_032102chr1163067 2973 2623 979 635 409 2850 210 12258 --
NM_032105chr175783 5577 5415 2925 1290 1026 917 15320 16160 --
NM_032119chr52279 105 ------
NM_032121chrX1358 22113 284 12788 --
NM_032128chr42850 703 ------
NM_032142chr181187 ------
NM_032144chr211445 ----11577
NM_032153chr322423 1967 12452 ----
NM_032154chr103945 813 750 ------
NM_032160chr1833312 1699 1280 ------
NM_032174chr11577 ----1595
NM_032177chr5--175 --150
NM_032199chr1063792 3598 2805 2774 2737 663 12897 1992 13446
NM_032208chr263574 2911 2318 1336 824 361 ----13141
NM_032228chr1112738 ------
NM_032229chr131426 ------
NM_032236chr13975 392 178 ------
NM_032256chr1231059 232 158 ------
NM_032268chr1652911 1297 1256 599 281 ------
NM_032288chr342096 1906 1488 452 --11472 11718
NM_032289chr511866 ------
NM_032291chr13383 246 233 ----11250
NM_032303chr91391 1158 ----
NM_032312chr22255 175 ------
NM_032320chr113804 123 92 1770 ----
NM_032324chr11208 ------
NM_032373chr10165941 5843 5648 5300 4824 4109 1749 1560 917 855 637 598 367 152 129 65 15495 1827 --
NM_032379chr112912 103 ------
NM_032380chr52444 72 ------
NM_032403chr51686 ------
NM_032410chr8--11156 --11204
NM_032420chr51359 ------
NM_032427chr111444 ------
NM_032431chr1121072 1048 ------
NM_032435chr132197 1619 1567 22137 342 ----
NM_032438chr62545 347 1507 ----
NM_032440chr1072874 2578 2188 1839 166 71 57 32706 2045 1031 22435 944 --
NM_032446chr593848 1219 1147 1092 674 511 397 312 216 33711 3327 259 ----
NM_032457chr442388 1262 830 641 22925 312 ----
NM_032458chrX63386 2877 2594 2540 2098 1311 13292 ----
NM_032466chr811656 ------
NM_032468chr811656 ------
NM_032491chr1211022 --1467 1102
NM_032505chr352794 2762 2536 1865 135 ------
NM_032514chr201410 ------
NM_032521chr2032727 2047 325 22833 816 --1122
NM_032523chr21545 ------
NM_032547chr441411 1213 230 207 ------
NM_032564chr111395 --2974 649 --
NM_032594chr141996 ------
NM_032622chr441250 415 402 234 ----1108
NM_032626chr16--162 ----
NM_032682chr343215 2774 2220 596 ------
NM_032711chr1744262 4207 1100 184 --1602 --
NM_032781chr112898 162 ------
NM_032784chr62106 22 ------
NM_032810chr1021114 256 ------
NM_032813chr1321078 202 ------
NM_032828chr1921057 446 34729 4370 3583 --11271
NM_032832chr611741 1147 ----
NM_032842chr731694 1170 200 1165 --1328
NM_032844chr101247 ------
NM_032857chr151164 ------
NM_032859chr1333894 924 22 --2916 28 12810
NM_032860chr6--1181 ----
NM_032869chr841746 1363 1333 409 ------
NM_032873chr1184426 4347 3463 3326 3271 2997 1830 1446 24001 3709 13761 14511
NM_032900chr1033891 2483 1508 13870 11031 --
NM_032905chr1051009 921 837 425 97 ------
NM_032918chr122124 81 ------
NM_032926chrX143 ----1220
NM_032936chr7130 ------
NM_032943chr112912 103 ------
NM_032947chr51101 ------
NM_032968chrX34245 4174 1666 23978 173 ----
NM_032969chrX34245 4174 1666 23978 173 ----
NM_032971chrY1940 ------
NM_032972chrY1940 ------
NM_032973chrY34237 4166 1660 1173 ----
NM_032975chr1873517 3501 3368 3138 3070 2797 2450 13483 --12501
NM_032980chr1873517 3501 3368 3138 3070 2797 2450 13483 --12501
NM_032982chr742588 2095 647 231 --12087 --
NM_032983chr743402 2909 1045 39 --12901 --
NM_032999chr711116 ------
NM_033000chr711116 ------
NM_033001chr711116 ------
NM_033012chr1331045 939 848 ------
NM_033016chr22158 --11013 --
NM_033020chr174823 4647 4071 3857 3178 2927 755 ------
NM_033023chr731039 191 83 ------
NM_033044chr12799 505 ------
NM_033055chr121058 1007 1436 --1408
NM_033056chr102712 514 ------
NM_033121chr1261806 1792 1534 522 367 207 ------
NM_033132chr1341805 1541 559 279 1538 1252 --
NM_033135chr1142493 1533 691 212 ------
NM_033138chr711929 1458 --1779
NM_033139chr711929 1458 --1779
NM_033140chr711929 1458 --1779
NM_033157chr711929 1458 --1779
NM_033181chr653687 3497 2654 1392 573 13370 --13724
NM_033211chr541838 1647 1629 460 ------
NM_033222chr931275 1231 538 --11013 --
NM_033224chr7118077 6193 5293 2975 2954 2516 2322 2078 1744 396 385 16333 35317 3108 1258 27460 2058
NM_033225chr862987 2840 2218 2049 1180 869 --1734 --
NM_033228chr51154 ------
NM_033285chr864407 4396 4151 4041 3114 1798 11078 ----
NM_033290chrX11505 1748 11118 --
NM_033305chr941428 949 567 450 11361 ----
NM_033331chr963605 3387 3021 2843 778 612 2724 91 1333 --
NM_033360chr1244436 3592 2950 1303 24646 1117 23707 1485 --
NM_033380chrX178 ------
NM_033381chrX178 ------
NM_033394chr221480 1073 ------
NM_033401chr161215 ------
NM_033402chr82345 163 268 49 ----
NM_033411chr6------2242 185
NM_033425chr1153366 3261 2886 1128 402 13141 ----
NM_033427chr71591 1263 ----
NM_033430chr474127 3114 2855 996 881 501 258 1577 11677 --
NM_033437chr474127 3114 2855 996 881 501 258 1577 11677 --
NM_033505chr2136583 6550 6450 5790 5231 4410 2575 2139 1500 1393 1142 769 700 26748 1568 ----
NM_033535chr421084 1069 1164 ----
NM_033540chr34892 816 427 98 ------
NM_033631chr153641 1418 1320 1229 823 --12620 12636
NM_033632chr421253 568 ------
NM_033637chr1011046 --22663 1089 --
NM_033656chr2145652 5169 3923 970 25260 1001 13741 1812
NM_052834chr1852580 2301 1875 465 343 --11666 --
NM_052840chr151360 ------
NM_052845chr1242557 1292 1011 830 --22452 257 --
NM_052851chr1342326 2293 2116 277 12395 ----
NM_052854chr112440 420 ------
NM_052855chr171214 1610 ----
NM_052879chr1221601 693 1494 12631 12860
NM_052900chr861530 1219 1121 672 619 502 ------
NM_052905chr221219 310 21412 1208 ----
NM_052907chr1273947 3521 3412 3286 1473 394 296 13179 ----
NM_052918chr1073615 3586 3476 2672 2354 1075 948 --12907 --
NM_052932chr1122492 1844 ------
NM_052937chr831060 839 379 1466 12072 --
NM_052950chr131261 ------
NM_052953chr32197 50 ----187
NM_052958chr81302 ------
NM_053002chr331056 827 760 ------
NM_053016chr975905 5206 1781 1682 1501 1256 768 23210 2921 ----
NM_053023chr1132617 2477 125 ------
NM_053024chr321231 514 11118 --11057
NM_053043chr776398 6241 2152 1592 1077 407 295 14997 --14689
NM_053056chr1153094 2484 2031 1960 1226 --22116 601 --
NM_053064chr141770 --11993 --
NM_053067chr9--1233 ----
NM_057159chr921232 1010 ----11075
NM_057175chr442462 2164 748 79 ------
NM_057178chr172492 102 --12697 --
NM_057749chr821365 937 ------
NM_058237chr141715 ------
NM_079420chr2126 ------
NM_079422chr2126 ------
NM_080422chr181284 ------
NM_080423chr181284 ------
NM_080425chr20165 ------
NM_080426chr20165 ------
NM_080546chr931594 1449 368 ----11789
NM_080599chr10------1775
NM_080605chr11627 1441 ----
NM_080617chr202980 794 ------
NM_080645chr652018 1992 1945 1495 1467 ----11814
NM_080672chr201571 ------
NM_080678chr2----2648 171 --
NM_080743chr641928 620 399 243 ----12042
NM_080759chr1342636 2026 1786 277 12234 ----
NM_080760chr1342636 2026 1786 277 12234 ----
NM_080872chr883805 3799 3106 2724 2641 2571 1258 961 33446 2886 2794 13824 1451
NM_080874chr421881 1406 1391 ----
NM_080927chr342924 2152 515 506 13292 ----
NM_130385chr1163019 2996 2572 2173 1292 1249 1467 ----
NM_130391chr912631 21026 517 22444 2188 --
NM_130392chr912631 21026 517 22444 2188 --
NM_130393chr912631 21026 517 22444 2188 --
NM_130436chr21--52566 2534 1002 992 160 1705 12488
NM_130438chr2112222 33143 3111 737 21282 81 13065
NM_130439chr1042290 2175 1545 678 ------
NM_130439chr1042290 2175 1545 678 ------
NM_130782chr11285 ------
NM_130798chr1551085 988 499 451 312 ------
NM_130811chr201118 ------
NM_130838chr1521333 423 --11168 --
NM_130839chr1521333 423 --11168 --
NM_130847chr1165847 5680 1880 1037 958 879 13736 35953 1414 281 --
NM_130901chr15158 ------
NM_133265chrX42370 1151 815 722 --12523 --
NM_133329chr251784 1773 1615 755 99 ------
NM_133334chr485400 4704 2213 1789 1234 721 474 450 16212 --12245
NM_133369chr511009 ------
NM_133372chr522123 869 --21792 144 --
NM_133433chr51833 1645 ----
NM_133493chr664620 3173 2999 1507 608 125 --14070 23656 3022
NM_133496chr144250 3587 2816 1045 21753 1628 170 --
NM_133503chr122540 55 ------
NM_133504chr122540 55 ------
NM_133505chr122540 55 ------
NM_133506chr122540 55 ------
NM_133507chr122718 233 ------
NM_133631chr3----1346 21008 587
NM_133633chr222856 309 --11192 --
NM_133638chr51973 ------
NM_133646chr285238 4991 4832 4819 4105 4021 4005 1841 25370 893 ----
NM_133647chr1533740 3453 2454 12981 --1688
NM_134265chr1721020 321 ------
NM_134447chr191557 ------
NM_138270chrX42655 2319 1343 983 12193 1648 --
NM_138285chr21541 ------
NM_138286chr1974175 4067 3352 1409 1106 845 132 11652 1379 13687
NM_138290chr72287 118 ------
NM_138333chr942519 2363 1624 974 12406 12423 --
NM_138357chr1031406 1360 181 --166 --
NM_138385chr411417 ------
NM_138423chr1552043 1607 605 183 93 ------
NM_138426chr752394 1849 913 789 478 1869 12416 --
NM_138473chr1274593 3908 3474 1624 1255 987 526 --13386 --
NM_138485chr3188 ------
NM_138554chr952191 1012 795 346 314 12798 ----
NM_138558chr1----1204 11062
NM_138565chr1121337 145 1215 ----
NM_138576chr1474596 4531 4097 1503 1432 1191 45 ------
NM_138609chr51379 ------
NM_138610chr51379 ------
NM_138621chr274069 3845 2863 2800 1007 691 544 12792 23354 2990 --
NM_138638chr1442113 863 788 412 ----1833
NM_138713chr16108059 7764 7426 6763 6428 5185 3141 400 340 169 ------
NM_138714chr16108059 7764 7426 6763 6428 5185 3141 400 340 169 ------
NM_138731chr1452866 2725 1287 1248 702 24282 913 ----
NM_138766chr51204 2496 94 ----
NM_138771chr741488 1327 594 464 ------
NM_138779chr13170 ------
NM_138792chr15138 1112 ----
NM_138821chr51204 2496 94 ----
NM_138822chr51204 2496 94 ----
NM_138927chr213759 306 247 ------
NM_138966chr181420 1598 ----
NM_138980chr42597 184 ------
NM_138982chr42597 184 ------
NM_138994chr161215 ------
NM_139045chr92609 581 2795 670 ----
NM_139048chr3----11179 --
NM_139126chr61680 --1663 --
NM_139131chr111547 ------
NM_139168chr521235 794 11668 --1292
NM_139182chr43499 336 44 --1225 11443
NM_139207chr1242052 1805 1531 230 11501 ----
NM_139215chr171236 ------
NM_139244chr61790 ------
NM_139246chr942041 1759 1607 331 1807 ----
NM_139312chr1011029 2185 39 21456 58 --
NM_139318chr141192 ------
NM_139319chr1231317 1152 62 21614 1495 ----
NM_139321chr2043762 2652 1267 855 24129 4053 13724 --
NM_139323chr2021913 771 ----1403
NM_144567chr122255 497 1226 ----
NM_144571chr496526 4395 2758 2453 2316 1786 769 584 253 16283 25091 1879 12409
NM_144574chr142547 395 ------
NM_144578chr1465121 4423 3988 1284 1135 771 24725 4343 ----
NM_144583chr21605 ------
NM_144588chr1011171 ------
NM_144595chr133215 165 129 --2756 396 1653
NM_144599chr1535461 5020 4161 34880 1464 998 14242 1846
NM_144600chr1621430 36 21523 1366 ----
NM_144629chr2269 52 ----11175
NM_144632chr242216 1682 842 744 11502 ----
NM_144643chr41124 ------
NM_144644chr41183 ------
NM_144657chrX2195 111 1574 ----
NM_144658chrX2304 275 ------
NM_144664chr1142443 2241 872 614 ------
NM_144665chr111239 1207 ----
NM_144726chr51178 ------
NM_144732chr19--1764 ----
NM_144767chr1534409 1618 1233 11526 ----
NM_144778chr1332051 1814 56 --11785 --
NM_144949chr222103 1044 --12568 --
NM_144963chr81170 2319 184 1553 --
NM_144973chr1233588 438 161 ------
NM_144975chr17------11130
NM_144979chr41531 ------
NM_145025chr631132 741 187 ------
NM_145036chr171385 183 ----
NM_145049chr53993 768 393 ------
NM_145055chr1873630 2859 2736 2571 1368 1359 75 1669 13541 --
NM_145112chr1421090 870 ------
NM_145113chr1421362 1142 ------
NM_145115chr711481 11548 --11624
NM_145117chr1113292 13058 --13044
NM_145175chr241379 1312 1258 988 11289 ----
NM_145203chr133310 249 75 ------
NM_145206chr1063339 3260 3254 2040 1195 598 ----1534
NM_145259chr245293 2800 1003 487 --16489 16503
NM_145263chr42238 184 ------
NM_145266chr52142 42 1111 ----
NM_145284chrX41779 950 606 335 11742 ----
NM_145290chr41205 ------
NM_145307chr1053600 1786 1755 750 382 --13342 11237
NM_145313chr1021418 1399 ------
NM_145320chr72676 658 --13308 1128
NM_145321chr72676 658 --13308 1128
NM_145322chr72676 658 --13308 1128
NM_145330chr2163 --1119 --
NM_145331chr62287 147 --1196 --
NM_145686chr242646 1314 1242 972 12939 ----
NM_145687chr242646 1314 1242 972 12939 ----
NM_145690chr821715 284 ------
NM_145698chr103359 196 105 12181 ----
NM_145716chr11566 --139 --
NM_145735chr1342786 2747 2369 739 --22752 136 11049
NM_145739chr21545 ------
NM_145808chr742894 2833 2042 2028 13134 ----
NM_145859chr31137 1293 ----
NM_145860chr31137 1293 ----
NM_145891chr1621382 565 21085 67 ----
NM_145892chr1621382 565 21085 67 ----
NM_145893chr1621504 687 21207 189 176 --
NM_145909chr641033 535 243 182 ----2936 39
NM_145913chr121794 1258 ----
NM_147166chr71218 --2856 660 --
NM_147171chr72181 124 ------
NM_147175chrX32055 1995 1742 ------
NM_147185chr72181 124 ------
NM_147223chr242281 2244 983 919 ------
NM_147233chr242098 2061 800 736 ----1887
NM_148174chr861988 1795 1659 747 500 35 32093 1939 543 ----
NM_148894chr41974 ------
NM_148904chr11597 ------
NM_148905chr11597 ------
NM_148906chr11597 ------
NM_148907chr11597 ------
NM_148908chr11597 ------
NM_148909chr11597 ------
NM_148955chr1586546 6421 5866 4651 4110 1890 1797 1052 26260 5977 11592 --
NM_152132chr14123 ------
NM_152233chr1421462 376 1617 1664 --
NM_152243chr221368 ------
NM_152271chr84756 430 243 234 11082 ----
NM_152277chr521801 1589 22087 1615 1327 --
NM_152280chr143439 842 705 665 ------
NM_152298chr1--1101 ----
NM_152330chr1462498 2223 1885 1773 487 163 1269 ----
NM_152365chr12400 321 ------
NM_152375chr111819 12544 32023 816 695 --
NM_152380chr121268 254 --11332 --
NM_152381chr21231 ----127
NM_152407chr542758 2100 563 81 12074 ----
NM_152409chr542913 2561 2357 1115 --21283 196 --
NM_152415chr81127 ------
NM_152422chr951877 1622 494 412 260 ------
NM_152424chrX53415 1639 1395 940 533 ----12873
NM_152493chr111319 ------
NM_152527chr252309 2174 1921 1715 135 ----134
NM_152556chr72678 385 11606 12260 --
NM_152588chr121220 ------
NM_152594chr1511728 ------
NM_152597chr153632 235 220 ------
NM_152608chr112283 12505 ----
NM_152613chr2241217 931 267 227 ------
NM_152621chr41152 ------
NM_152622chr573415 3164 2734 2559 2425 1218 830 1841 ----
NM_152624chr547421 6006 5689 1365 1366 1884 12689
NM_152629chr973987 3863 2876 2827 2502 1173 925 1706 ----
NM_152636chr1132660 1154 91 --11944 --
NM_152641chr1212351 2737 341 ----
NM_152665chr121113 325 ------
NM_152678chr352243 994 602 572 147 --1321 --
NM_152682chr411695 ------
NM_152688chr61281 ------
NM_152716chr1151664 1357 1123 395 344 11648 ----
NM_152723chr112719 371 31053 440 160 ----
NM_152726chr131454 ------
NM_152731chr661189 914 877 776 381 145 --1398 --
NM_152737chr641742 835 203 35 11603 ----
NM_152739chr71791 2957 213 ----
NM_152744chr721215 856 ------
NM_152745chr72911 323 2864 200 ----
NM_152754chr731388 1365 49 12838 ----
NM_152756chr554357 4145 3770 3480 1011 1668 1256 13967
NM_152772chr121478 ------
NM_152774chr742394 1866 961 144 ----1475
NM_152787chrX103883 3496 3375 3368 3158 2828 1403 1138 459 108 23544 3238 --22982 2902
NM_152789chr721247 1149 ------
NM_152826chr1586546 6421 5866 4651 4110 1890 1797 1052 26260 5977 11592 --
NM_152835chr112765 22912 2741 ----
NM_152836chr851769 1219 377 306 192 ----11237
NM_152837chr851769 1219 377 306 192 ----11237
NM_152838chr2073476 2261 905 524 183 109 40 12204 1510 --
NM_152860chr1231500 485 423 ------
NM_152878chr2231520 1056 434 ------
NM_152896chr92616 549 ------
NM_152902chr141981 1845 1391 1370 1465 ----
NM_152905chr121191 ------
NM_152989chr1221330 690 --11544 --
NM_152991chr111678 ------
NM_152994chr21242 ------
NM_152998chr71165 ------
NM_152999chr744908 4780 1623 546 23210 215 --14616
NM_153015chr82963 933 ----1653
NM_153020chr621694 1357 ------
NM_153035chr143228 2783 1184 1100 --11205 --
NM_153038chr21785 ------
NM_153042chr63688 570 206 ------
NM_153050chr2264499 4472 3934 3864 3214 151 14639 ----
NM_153051chr2264499 4472 3934 3864 3214 151 14639 ----
NM_153181chr181420 1598 ----
NM_153184chr32704 231 1651 11630 --
NM_153188chr5115620 4922 4741 4091 3672 3499 1340 1145 989 340 319 13682 22030 1940 --
NM_153201chr11127 1194 1172 --
NM_153207chr1271206 1083 1063 1047 892 674 82 ----11441
NM_153218chr131323 1172 ----
NM_153223chr521471 136 21598 432 ----
NM_153262chr163093 3035 2073 863 561 230 1363 ----
NM_153273chr3156 1360 ----
NM_153331chr3--1453 ----
NM_153346chrX31804 1412 1295 ------
NM_153367chr1033196 906 185 --23649 594 13291
NM_153371chr1341806 1715 1697 74 ------
NM_153450chr111340 ------
NM_153456chr1376263 6062 2344 2288 1284 605 566 15810 ----
NM_153464chr193758 151 145 1109 ----
NM_153487chr611368 --24277 61 --
NM_153607chr5113170 3144 2999 2673 1281 1194 794 496 406 175 122 22078 893 --159
NM_153616chr1542258 2125 1880 1810 1820 1643 --
NM_153617chr1542258 2125 1880 1810 1820 1643 --
NM_153618chr1542258 2125 1880 1810 1820 1643 --
NM_153619chr1553496 3363 3118 3048 502 12378 153 --
NM_153633chr12--1746 ----
NM_153634chr1221365 185 31113 532 472 ----
NM_153649chr11505 ----12236
NM_153689chr242365 1813 290 98 12261 ----
NM_153693chr121548 ------
NM_153712chr253562 2877 2620 2489 711 12530 ----
NM_153758chr1--1259 1317 --
NM_153810chr10125110 4520 4476 4106 3921 3837 3781 3419 3311 3198 1643 189 ------
NM_153816chr61309 ------
NM_153825chr411602 11551 ----
NM_153828chr25924 884 839 328 298 1203 2748 96 --
NM_170606chr731658 622 320 ------
NM_170607chr1731545 1117 1094 ------
NM_170665chr1281691 1646 1162 1005 790 776 683 324 24209 766 ----
NM_170674chr1511296 ------
NM_170675chr151972 ------
NM_170676chr151972 ------
NM_170677chr1511296 ------
NM_170679chr531073 119 54 --1144 1350
NM_170692chr12457 300 1781 11092 --
NM_170706chr113020 24291 1232 23957 606 --
NM_170710chr443075 2892 2447 110 ----1637
NM_170721chr1751243 1016 421 239 176 ------
NM_170731chr1152756 961 511 299 255 22832 2407 ----
NM_170732chr1152756 961 511 299 255 22832 2407 ----
NM_170733chr1152756 961 511 299 255 22832 2407 ----
NM_170734chr1152756 961 511 299 255 22832 2407 ----
NM_170735chr1152756 961 511 299 255 22832 2407 ----
NM_170775chr51207 170 ----
NM_172037chr8175 --11242 11334
NM_172058chr841528 1358 1352 369 --1654 --
NM_172059chr841528 1358 1352 369 --1654 --
NM_172060chr841528 1358 1352 369 --1654 --
NM_172069chr231773 722 285 22331 1512 ----
NM_172070chr231984 1613 876 ----12237
NM_172071chr177377 6758 5184 2876 1564 1396 351 67433 6563 5421 4830 2784 1154 ----
NM_172127chr451659 1512 1356 719 216 ------
NM_172128chr451615 1468 1312 675 172 ------
NM_172159chr321739 239 12050 ----
NM_172160chr321739 239 12050 ----
NM_172164chr1--1101 ----
NM_172196chr21135 ------
NM_172230chr1121072 1048 ------
NM_172315chr1511296 ------
NM_172316chr1511296 ------
NM_172337chr143924 642 371 ------
NM_172344chr251784 1773 1615 755 99 ------
NM_172387chr1821400 454 11061 ----
NM_172388chr1821447 501 11108 ----
NM_172389chr1821447 501 11108 ----
NM_173060chr531932 1917 542 11859 ----
NM_173061chr531932 1917 542 11859 ----
NM_173063chr531932 1917 542 11859 ----
NM_173074chr22305 271 ------
NM_173078chrX------1438
NM_173082chr61522 ------
NM_173083chr13218 166 37 ------
NM_173084chr351938 1715 809 572 45 12384 ----
NM_173171chr231138 452 369 1828 ----
NM_173172chr221446 31 21136 108 ----
NM_173173chr231138 452 369 1828 ----
NM_173199chr92331 168 --188 --
NM_173214chr16108059 7764 7426 6763 6428 5185 3141 400 340 169 ------
NM_173354chr2131945 1879 367 ------
NM_173355chr22855 376 1161 ----
NM_173359chr32656 527 --11684 --
NM_173463chr432913 1012 736 13585 ----
NM_173468chr465890 5479 5080 4355 1968 170 12006 12263 --
NM_173469chr1561515 1430 1242 1020 597 490 ------
NM_173470chrX32766 2544 2066 ------
NM_173475chr161707 --1564 --
NM_173495chrX62514 2029 1918 425 367 116 ------
NM_173496chr1021947 1063 11096 ----
NM_173505chr183955 62 46 ------
NM_173508chr121084 883 --1365 --
NM_173510chr2231933 310 249 ------
NM_173511chr212654 13582 13048 --
NM_173515chr63860 336 317 ------
NM_173517chr72413 317 ------
NM_173519chr832035 1711 278 ------
NM_173552chr322337 1767 22071 760 21799 670 --
NM_173560chr62407 119 ------
NM_173582chr1194562 4264 4133 2034 1974 1454 1173 480 401 12262 15337 --
NM_173602chr1233184 731 264 ----11020
NM_173609chr151109 ------
NM_173642chr1109142 8485 6964 6926 3442 3200 2306 1822 1774 1336 17821 11105 --
NM_173644chr2031842 1651 652 ------
NM_173645chr22130 83 ------
NM_173654chr32416 187 22292 1957 12346 --
NM_173683chr811302 21690 1252 11662 --
NM_173694chrX42265 1968 1884 973 1214 ----
NM_173794chrX2381 335 ------
NM_173797chr541374 318 231 145 1916 ----
NM_173803chr1631525 1394 241 --11387 --
NM_173808chr164422 3399 474 352 324 210 ------
NM_173812chr12--1481 ----
NM_173822chr231913 82 55 11773 ----
NM_173825chr382776 2629 2480 2068 1950 518 404 363 12205 ----
NM_173829chr5125853 5838 5198 5068 4176 3800 2481 2045 2001 1142 884 367 25110 1355 11608 1312
NM_173830chr65896 586 285 245 131 --1704 --
NM_173848chr82810 143 1216 ----
NM_173851chr831474 1216 222 11177 ----
NM_174858chr111233 ------
NM_174890chr102274 239 ------
NM_174911chr863855 1569 1563 1538 770 378 ------
NM_174916chr1541857 1631 452 159 12356 --11983
NM_175061chr752033 1967 1903 314 299 1378 ----
NM_175634chr8----11163 --
NM_175635chr8----11163 --
NM_175636chr8----11163 --
NM_175736chr1215035 12726 ----
NM_175747chr6--1877 ----
NM_175767chr51665 --1690 --
NM_175839chr20--1262 ----
NM_175840chr20--1262 ----
NM_175841chr20--1262 ----
NM_175842chr20--1262 ----
NM_175854chr1331877 420 58 --1344 12623
NM_175856chr53554 73 50 ------
NM_175861chr1245393 4759 631 550 21941 1335 --13873
NM_175863chr61323 ------
NM_175910chr1922469 2309 ------
NM_176814chr721371 442 ------
NM_176871chr832880 1181 617 ------
NM_177438chr1454234 3715 1143 556 194 12635 23824 2902 --
NM_177452chr1431528 442 89 --1497 --
NM_177524chr711107 ------
NM_177525chr711107 ------
NM_177553chr111751 ------
NM_177947chrX41120 472 342 120 ----139
NM_177948chrX41120 472 342 120 ----139
NM_177952chr142639 572 ------
NM_177968chr242115 1449 406 193 1580 ----
NM_177969chr2----1231 --
NM_177974chr1552043 1607 605 183 93 ------
NM_177990chr2021880 1795 --1503 --
NM_177995chr951877 1622 494 412 260 ------
NM_178006chr1342326 2293 2116 277 12395 ----
NM_178007chr1342326 2293 2116 277 12395 ----
NM_178010chr1221330 690 --11544 --
NM_178011chr1051297 996 826 335 77 1322 ----
NM_178126chr171431 ------
NM_178151chrX77160 6912 6598 6425 2633 2515 2314 --152 1144
NM_178152chrX77160 6912 6598 6425 2633 2515 2314 --152 1144
NM_178153chrX77160 6912 6598 6425 2633 2515 2314 --152 1144
NM_178161chr102289 50 ------
NM_178424chr5----1192 --
NM_178426chr172298 2151 2055 1942 1815 806 382 --22199 536 --
NM_178427chr172198 2051 1955 1842 1715 706 282 --22099 436 --
NM_178450chr5135 ------
NM_178505chr1062617 993 807 634 375 191 23223 697 ----
NM_178566chr931902 1507 294 11551 ----
NM_178568chr1711178 ------
NM_178583chr42762 654 --1196 --
NM_178585chr433110 2947 2046 1425 23201 871 --
NM_178586chr1442362 1826 1790 824 --32373 2170 980 --
NM_178812chr811430 21163 1063 ----
NM_178815chr1012104 ----12442
NM_181054chr14----31228 388 383 --
NM_181077chr1561912 1594 795 773 369 242 ------
NM_181265chr443075 2892 2447 110 ----1637
NM_181291chr14--1689 ----
NM_181302chr142547 395 ------
NM_181308chr142547 395 ------
NM_181332chrX72161 2024 1811 1754 1039 957 737 ------
NM_181353chr201585 ------
NM_181354chr841502 1144 568 59 11597 11260 --
NM_181358chr154152 3552 1624 1518 185 44259 3902 1471 1175 11419 12612
NM_181361chr321160 929 11403 ----
NM_181443chr2072843 2683 2470 2332 2083 1087 243 ------
NM_181481chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_181482chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_181483chr18136676 6553 5893 5680 5526 5285 2589 1343 1332 1132 779 583 161 26973 664 ----
NM_181492chr2211126 ------
NM_181504chr524009 1178 --14180 --
NM_181509chr201410 ------
NM_181523chr524009 1178 --14180 --
NM_181524chr524009 1178 --14180 --
NM_181659chr2072833 2556 2272 1077 992 417 78 12164 12184 13435
NM_181659chr2072833 2556 2272 1077 992 417 78 12164 12184 13435
NM_181689chr201780 1828 ----
NM_181702chr8----1110 --
NM_181705chr564033 2059 1789 1654 1044 524 13668 24057 2083 15796
NM_181712chr121746 318 --11630 11881
NM_181723chr851866 1477 789 783 453 22292 924 11835 --
NM_181741chr211131 ------
NM_181742chr211131 ------
NM_181780chr32437 56 ------
NM_181787chr841571 1325 1276 106 23741 271 23389 3158 --
NM_181825chr221284 ------
NM_181836chr542664 2187 43 29 ------
NM_181838chr541378 1231 991 203 21518 1262 --11027
NM_181861chr1222097 113 --1946 --
NM_181868chr1222097 113 --1946 --
NM_181869chr1222182 198 --11031 --
NM_181886chr421009 918 ------
NM_181887chr421009 918 ------
NM_181888chr421009 918 ------
NM_181889chr421009 918 ------
NM_181890chr421009 918 ------
NM_181891chr421009 918 ------
NM_181892chr421056 965 ------
NM_181893chr421009 918 ------
NM_181897chr312314 22263 605 ----
NM_182485chr473128 2844 2718 2666 1448 1437 1326 23438 805 23014 673 13082
NM_182492chr22--1299 ----
NM_182493chr1674383 3812 3518 1614 1350 887 440 24120 1096 ----
NM_182503chr653681 1270 1131 618 486 23552 185 25416 1565 --
NM_182515chr19126233 6143 4779 4763 2228 1679 1180 1028 1012 633 552 61 15406 34888 4787 4242 --
NM_182551chr22742 161 --1579 --
NM_182569chr171188 ------
NM_182641chr1741956 1819 1370 426 1406 ----
NM_182643chr821921 1613 52340 1955 1766 755 700 ----
NM_182644chr3193 --1318 1107
NM_182646chr473128 2844 2718 2666 1448 1437 1326 23438 805 23014 673 13082
NM_182659chrY1185 ------
NM_182691chr761407 1183 1145 1096 576 255 ------
NM_182692chr761407 1183 1145 1096 576 255 ------
NM_182700chr721478 96 --1255 11870
NM_182710chr111394 1314 ----
NM_182728chr142675 392 1153 ----
NM_182765chr1052329 2016 2010 680 360 ----1471
NM_182767chr1232002 1734 202 ------
NM_182811chr201428 ------
NM_182830chr14--12008 --11495
NM_182898chr766448 4679 4265 1366 1103 764 21013 964 1692 --
NM_182899chr766448 4679 4265 1366 1103 764 21013 964 1692 --
NM_182910chr142583 560 ------
NM_182913chr142583 560 ------
NM_182914chr142583 560 ------
NM_182931chr7----1598 --
NM_182943chr311161 ------
NM_182948chr172877 2681 2489 1218 402 197 134 12039 --12938
NM_182964chr1113292 13058 --13044
NM_182972chr161762 1011 539 421 151 58 1921 --1390
NM_183004chr1432986 2406 551 1470 33124 2997 715 --
NM_183043chr132221 57 ------
NM_183044chr132221 57 ------
NM_183227chr641347 190 137 35 ----11442
NM_183234chr1551742 1214 723 167 95 ------
NM_183235chr1551742 1214 723 167 95 ------
NM_183236chr1551742 1214 723 167 95 ------
NM_183244chr201571 ------
NM_183246chr201571 ------
NM_183381chr3------1920
NM_183383chr3------1920
NM_183384chr3------1920
NM_183393chr3--1842 1899 --
NM_183394chr3--1842 1899 --
NM_183419chr82267 150 ------
NM_194247chr243962 3903 489 327 ------
NM_194271chr122695 510 ------
NM_194283chr521421 110 ------
NM_194285chr1153436 2924 2529 2504 1038 12417 ----
NM_194286chr1255698 5643 5636 4323 3843 15113 --14726
NM_194298chr1021457 527 ----1272
NM_194314chr175340 5148 5094 3961 3543 2198 1031 23751 432 ----
NM_194317chr252738 2204 2098 1714 136 --1171 --
NM_194356chr1242391 1482 879 118 ------
NM_194434chr1875697 5507 4563 4548 2304 1657 237 12150 ----
NM_194454chr731453 1116 321 --1435 --
NM_194455chr731453 1116 321 --1435 --
NM_194456chr731453 1116 321 --1435 --
NM_197941chr542943 2573 2259 759 ----13010
NM_197977chr91870 ------
NM_198087chr1641428 1393 1045 116 --11081 --
NM_198088chr1641428 1393 1045 116 --11081 --
NM_198120chr81448 ------
NM_198123chr861530 1219 1121 672 619 502 ------
NM_198124chr861530 1219 1121 672 619 502 ------
NM_198128chr1882342 2241 1954 1434 820 526 434 351 11590 ----
NM_198150chr541399 992 338 322 1609 ----
NM_198158chr352373 2128 2095 947 215 12603 ----
NM_198159chr352373 2128 2095 947 215 12603 ----
NM_198177chr352373 2128 2095 947 215 12603 ----
NM_198178chr352373 2128 2095 947 215 12603 ----
NM_198181chr15--12843 ----
NM_198182chr231514 1096 181 11089 ----
NM_198195chr32489 246 ------
NM_198204chr1731545 1117 1094 ------
NM_198205chr1731545 1117 1094 ------
NM_198240chr1221247 70 --1252 --
NM_198268chr154152 3552 1624 1518 185 44259 3902 1471 1175 11419 12612
NM_198269chr154152 3552 1624 1518 185 44259 3902 1471 1175 11419 12612
NM_198270chrX33442 1270 757 ------
NM_198273chr533087 2982 848 1418 12458 --
NM_198279chrX3872 794 381 ------
NM_198329chr33349 231 23 11227 ----
NM_198336chr711831 ------
NM_198391chr2011403 --11291 --
NM_198400chr1552898 2708 1958 1815 190 ------
NM_198404chr131698 ------
NM_198465chrX12979 12076 11988 --
NM_198503chr111781 --11587 --
NM_198521chr121105 ------
NM_198549chr163271 2662 2541 1203 985 524 1564 13295 --
NM_198581chr297492 5969 5010 2656 1553 1107 793 742 607 37506 6251 251 ----
NM_198595chr464713 4106 3624 3452 1911 309 23283 1720 21975 1954 --
NM_198793chr364008 3638 3264 1543 1079 815 ------
NM_198844chr173975 676 327 --2993 732 --
NM_198859chr351875 1288 990 923 522 1781 --24823 414
NM_198896chr1132079 1588 130 1119 ----
NM_198900chr1215035 12726 ----
NM_198935chr203766 623 227 ------
NM_198956chr721478 96 --1255 11870
NM_198965chr123157 130 34 ------
NM_198966chr123157 130 34 ------
NM_198991chr18------1550
NM_199000chr712230 ------
NM_199003chr821439 1021 ------
NM_199053chr43849 261 89 ----1928
NM_199072chr722096 639 1126 --177
NM_199129chr201426 ------
NM_199144chr2021601 1395 1610 ----
NM_199160chr921396 1368 12002 ----
NM_199168chr1041448 1398 282 204 ------
NM_199188chr1221601 693 1494 12631 12860
NM_199189chr51104 ------
NM_199190chr1221601 693 1494 12631 12860
NM_199203chr2021601 1395 1610 ----
NM_199321chr173975 676 327 --2993 732 --
NM_199324chr453425 1202 1036 701 192 --1441 --
NM_199436chr243093 2151 944 324 11252 11212 --
NM_199437chr1112503 ----11617
NM_199438chr1112503 ----11617
NM_199439chr1112503 ----11617
NM_199454chr144626 4195 4046 558 14357 ----
NM_199483chr20----1290 --
NM_201413chr213810 798 45 ----1709
NM_201414chr213810 798 45 ----1709
NM_201436chr71863 --140 --
NM_201516chr71919 --196 --
NM_201517chr71863 --140 --
NM_201591chr421405 284 --2631 447 --
NM_201592chr421405 284 --2631 447 --
NM_201632chr521826 1637 ------
NM_201634chr521925 1736 ------
NM_201999chr41368 ------
NM_203283chr41395 ------
NM_203284chr41395 ------
NM_203303chrX157 ------
NM_203327chr2084199 4156 3332 1826 1741 1113 1092 231 11314 ----
NM_203350chr141451 1232 544 123 ------
NM_203365chr22513 38 ------
NM_203372chr241602 1535 1216 485 ----11565
NM_203390chr831741 669 431 1618 ----
NM_203391chrX21812 270 ----11725
NM_203394chr1242582 2548 2285 1741 ------
NM_203406chr532271 1827 497 2975 611 ----
NM_203434chr961221 1014 994 968 275 266 1156 ----
NM_203437chr24732 604 376 28 ------
NM_203446chr2152913 2633 2605 999 205 ----1907
NM_203454chr1--1889 ----
NM_203458chr183242 2838 2473 2458 2337 1414 905 118 12714 ----
NM_203459chr142533 2079 2064 1703 ------
NM_203463chr274325 4092 4039 3890 3510 3390 717 167 ----
NM_203487chr1361673 1372 1262 714 256 235 ------
NM_203499chr172675 316 --1737 --
NM_203500chr19151 ------
NM_203504chr452517 2155 1884 1020 191 12452 ----
NM_203505chr452517 2155 1884 1020 191 12452 ----
NM_205768chr171906 1656 1416 697 644 424 315 --1842 --
NM_205836chr51149 ------
NM_205848chr122742 2204 1918 ----
NM_205860chr142422 2270 2042 860 21951 207 --22036 262
NM_206594chr183565 3490 3400 3281 2755 2452 2351 794 12315 1773 --
NM_206595chr183565 3490 3400 3281 2755 2452 2351 794 12315 1773 --
NM_206839chr152587 259 ------
NM_206853chr613799 31190 740 515 1269 --
NM_206854chr675060 3680 3497 710 458 408 127 22001 1776 31530 395 370 1813
NM_206855chr6106025 4645 4462 4216 4094 1675 1423 1373 1092 154 --32495 1360 1335 11778
NM_206860chr101148 1458 ----
NM_206861chr101148 1458 ----
NM_206862chr101148 1458 ----
NM_206866chr2152856 2583 2564 2385 516 11025 ----
NM_206876chr263170 2594 1441 1271 1121 617 21147 184 --23580 2720
NM_206907chr573224 2946 2520 2481 1078 987 203 12586 ----
NM_206909chr898322 7813 7759 5374 1772 1740 1156 372 134 12904 ----
NM_206927chr112912 103 ------
NM_206928chr112912 103 ------
NM_206929chr112912 103 ------
NM_206930chr112912 103 ------
NM_206933chr132545 2260 99 ------
NM_206943chr21316 2721 128 2786 83 --
NM_207043chr131851 1482 460 --11938 1884
NM_207044chr131851 1482 460 --11938 1884
NM_207047chr131851 1482 460 --11938 1884
NM_207121chr202537 158 ------
NM_207123chr41303 145 ----
NM_207171chr141249 546 453 379 ------
NM_207189chr11107 ------
NM_207292chr363190 2078 737 266 143 86 1549 1934 --
NM_207293chr363190 2078 737 266 143 86 1549 1934 --
NM_207294chr363190 2078 737 266 143 86 1549 1934 --
NM_207295chr363190 2078 737 266 143 86 1549 1934 --
NM_207296chr363190 2078 737 266 143 86 1549 1934 --
NM_207297chr363215 2103 762 291 168 111 1574 1959 --
NM_207303chr1041666 1641 1301 376 13598 --23126 440
NM_207325chr1911911 ------
NM_207334chr11231 ----11023
NM_207361chr1395976 5506 5322 4209 4202 1357 927 410 398 ------
NM_207366chr762273 1703 1583 893 369 116 --22288 393 --
NM_207422chrX1248 ------
NM_207481chr221353 367 --1937 --
NM_207517chr1551901 1891 794 635 409 11272 ----
NM_207520chr25924 884 839 328 298 1203 2748 96 --
NM_207521chr25924 884 839 328 298 1203 2748 96 --
NM_207647chr932079 2053 571 ----12596
NM_207660chr1451406 1350 406 130 106 ------
NM_207661chr1451406 1350 406 130 106 ------
NM_207662chr1451406 1350 406 130 106 ------
NM_212471chr1742208 1864 1427 147 1728 ----
NM_212472chr1742208 1864 1427 147 1728 ----
NM_212474chr21214 ----11006
NM_212475chr21214 ----11006
NM_212476chr21214 ----11006
NM_212478chr21214 ----11006
NM_212482chr21214 ----11006
NM_212539chr31305 ------
NM_213589chr295045 5023 4711 3891 1942 1799 1636 1093 568 25512 4806 ----
NM_213594chr1211022 --1467 1102
NM_213648chr521826 1637 ------
NM_213651chr121654 724 11676 ----
NM_213662chr1742469 2202 918 902 --1544 --