TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-106b-3p
miRNA Sequence: CCGCACUGUGGGUACUUGCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511055 ------
NM_000038chr521298 610 ------
NM_000074chrX1352 ------
NM_000084chrX86723 5743 4899 4656 2381 2298 1835 116 --25814 1124 --
NM_000092chr243146 3092 1557 911 --13756 --
NM_000108chr741594 1532 1335 200 ------
NM_000109chrX1413 ------
NM_000110chr11908 1311 ----
NM_000115chr1311059 ------
NM_000125chr624069 3699 --13879 --
NM_000161chr1431323 440 416 11646 ----
NM_000176chr533554 2429 317 ------
NM_000177chr93239 201 36 ------
NM_000183chr21160 ------
NM_000192chr1231443 1151 369 11466 ----
NM_000202chrX73445 3259 2565 1327 1271 556 383 ------
NM_000210chr272274 2223 1875 1787 1641 1605 60 12104 ----
NM_000216chrX43848 1141 1087 130 ------
NM_000217chr1253738 2042 1654 722 462 ------
NM_000218chr1111080 ----1938
NM_000227chr181408 ------
NM_000242chr1012596 ------
NM_000245chr731809 1442 566 ------
NM_000248chr322495 227 1726 ----
NM_000253chr4--11127 ----
NM_000259chr1586267 5880 5617 4432 3953 2016 983 935 --34732 4712 2010 --
NM_000264chr942796 1352 995 263 13217 ----
NM_000266chrX1344 ------
NM_000280chr111635 ------
NM_000284chrX4642 168 124 48 ------
NM_000289chr122247 77 ------
NM_000304chr171445 ------
NM_000315chr11142 ------
NM_000321chr1311641 ------
NM_000325chr41188 ------
NM_000328chrX--1142 ----
NM_000332chr6127209 6916 6441 6358 5183 4904 2383 1491 874 747 493 279 --12813 11069
NM_000333chr31243 ------
NM_000334chr1721670 1513 ------
NM_000340chr311020 ------
NM_000346chr1711476 --2561 348 --
NM_000362chr2233623 2953 93 12251 ----
NM_000368chr944382 3478 1486 21 --1237 --
NM_000376chr1253052 1068 801 492 22 12825 ----
NM_000386chr171155 ------
NM_000396chr1155 ------
NM_000430chr1753051 2750 849 454 315 --13279 --
NM_000447chr1177 ------
NM_000461chr364452 4004 3991 3245 1050 1018 --23239 2852 --
NM_000462chr15------1550
NM_000480chr1131198 1174 285 ------
NM_000484chr211277 ------
NM_000496chr22--186 ----
NM_000555chrX27480 2046 ------
NM_000601chr71178 ------
NM_000609chr1052945 2274 1080 207 56 ----1575
NM_000611chr1196686 6232 4836 4682 4522 2078 1489 1384 794 --16058 16320
NM_000615chr1132754 723 555 12709 ----
NM_000618chr121462 16313 12655 --
NM_000618chr121462 16313 12655 --
NM_000627chr22613 261 ------
NM_000639chr13737 590 289 ------
NM_000663chr1643018 2739 2034 625 ------
NM_000679chr5--1317 ----
NM_000684chr101948 ------
NM_000697chr17--1282 ----
NM_000719chr1256410 1834 1170 545 151 11734 24507 4081 --
NM_000721chr141694 1026 875 365 --2999 74 --
NM_000794chr51166 ------
NM_000800chr51311 ------
NM_000806chr511667 ------
NM_000813chr535608 4169 1992 ------
NM_000814chr1534010 3821 219 --2751 636 13743
NM_000816chr51578 ------
NM_000817chr21265 ------
NM_000826chr432236 1852 106 ----1154
NM_000827chr53366 356 69 --11633 --
NM_000828chrX2494 169 11496 ----
NM_000836chr191963 ------
NM_000840chr71185 ------
NM_000842chr111147 ------
NM_000844chr31130 ----1935
NM_000855chr111265 ------
NM_000868chrX1728 12072 ----
NM_000875chr1576142 6083 4525 1794 1685 1619 1384 ------
NM_000876chr61507 --11017 --
NM_000883chr7146 ------
NM_000883chr7146 ------
NM_000891chr1793468 2562 2291 1310 1029 1006 894 462 429 ------
NM_000899chr1221217 519 ------
NM_000933chr2041226 1178 591 373 ------
NM_000944chr422049 659 ------
NM_000958chr521243 982 ------
NM_000963chr142441 1566 809 463 1745 ----
NM_000965chr31855 ------
NM_000983chr11557 1315 188 --
NM_001001132chr211507 ------
NM_001001323chr1222641 573 ------
NM_001001342chr1011249 ------
NM_001001394chr21645 1600 ----
NM_001001395chr123840 613 396 11031 ----
NM_001001396chr124258 3863 1748 24224 401 --
NM_001001419chr554678 1444 1106 762 628 ------
NM_001001420chr554678 1444 1106 762 628 ------
NM_001001433chr2023007 817 1600 21247 846 --
NM_001001436chr161217 ------
NM_001001481chr823485 1157 ------
NM_001001484chr10----11675 --
NM_001001521chr21111 ------
NM_001001549chr772878 2659 1994 1774 764 746 130 ------
NM_001001550chr772878 2659 1994 1774 764 746 130 ------
NM_001001555chr772878 2659 1994 1774 764 746 130 ------
NM_001001664chr263781 3391 3171 1527 1440 1371 --11481 --
NM_001001787chr12468 422 ------
NM_001001995chrX41793 1635 1618 1255 ------
NM_001002233chr822179 1990 ------
NM_001002243chr21762 --1924 --
NM_001002257chr263199 3142 2672 2620 2175 753 ------
NM_001002294chr11146 ------
NM_001002295chr1031004 386 251 ------
NM_001002843chr15254 25 ------
NM_001002877chr22------1207
NM_001002878chr22------1207
NM_001002879chr22------1207
NM_001002909chr171107 ------
NM_001002919chr22202 190 ------
NM_001003406chr2273295 3076 2911 2433 1298 897 194 ------
NM_001003674chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_001003675chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_001003698chr651693 1615 220 166 75 ------
NM_001003699chr651693 1615 220 166 75 ------
NM_001003712chr1273879 3546 3158 3017 2696 764 59 --1925 --
NM_001003792chr31940 ------
NM_001003793chr31940 ------
NM_001003800chr973409 2962 2719 1055 977 806 76 --13718 --
NM_001004065chr923600 241 --11167 --
NM_001004304chr1263216 2828 2569 1165 526 303 ------
NM_001004360chr231249 667 271 ------
NM_001004419chr1241516 909 894 570 ------
NM_001005353chr121068 51 --1263 --
NM_001005353chr121068 51 --1263 --
NM_001005366chr121356 1782 ----
NM_001005375chrY11605 ------
NM_001005463chr1012035 1746 ----
NM_001005476chr21123 ------
NM_001005609chrX33507 1351 127 12433 --13753
NM_001005781chr21535 ------
NM_001005782chr22984 139 ------
NM_001005861chr32872 349 ------
NM_001006600chr51895 ------
NM_001006610chr162342 30 ------
NM_001006617chr911089 ------
NM_001006619chr911089 ------
NM_001006620chr911089 ------
NM_001006621chr911089 ------
NM_001006624chr132009 1950 424 --11439 --
NM_001006636chr2163 ------
NM_001007097chr935042 4335 336 34750 3787 482 ----
NM_001007098chr11885 ------
NM_001007156chr1531945 1771 130 1704 ----
NM_001007237chr121797 562 --11973 --
NM_001007246chr2111304 ----11239
NM_001007466chr664921 4224 4010 2039 1538 1149 23459 3231 ----
NM_001007546chr211269 ------
NM_001007559chr1811563 ------
NM_001008220chr553836 2939 2838 2524 283 --22961 1429 --
NM_001008239chr1812596 13596 ----
NM_001008401chr192341 331 ------
NM_001008407chr721194 424 --11313 11373
NM_001008408chr786170 5978 4283 3995 3982 2119 2044 421 25384 2206 15898 --
NM_001008539chr875296 4228 4217 1607 1390 340 240 14758 ----
NM_001008540chr21476 ------
NM_001008541chr1032224 1647 23 12037 ----
NM_001008541chr1032224 1647 23 12037 ----
NM_001008738chr542469 1944 350 322 11863 ----
NM_001008925chr413519 ------
NM_001009881chr11487 ------
NM_001009882chr11487 ------
NM_001009993chr2104367 3699 3496 3348 2859 1610 1383 1374 1282 734 12932 ----
NM_001010000chr1822909 2567 ------
NM_001010853chr632558 812 503 ------
NM_001010867chr1116473 6392 6298 6220 6156 5671 5554 4945 2557 1895 1280 1826 ----
NM_001010891chr545454 5344 4643 63 16815 ----
NM_001010898chr1103733 3221 2964 2770 2413 2377 2271 1210 1198 872 --11135 --
NM_001010908chr101685 1711 ----
NM_001010924chr10----1918 --
NM_001010932chr71178 ------
NM_001010986chrX2927 754 --12024 --
NM_001010989chr161505 --1114 --
NM_001010990chr161505 --1114 --
NM_001011553chr72622 61 ------
NM_001011657chrX31071 409 109 ------
NM_001011663chr102723 404 ------
NM_001011666chr734499 2109 1236 11390 ----
NM_001011713chr1431272 576 123 ------
NM_001012393chr1135186 2059 413 ------
NM_001012398chr161121 ------
NM_001012426chr642230 2185 1150 769 ----1148
NM_001012427chr642230 2185 1150 769 ----1148
NM_001012456chr7--151 ----
NM_001012751chr1041833 1450 1352 336 ------
NM_001012755chrX34360 3479 1051 ------
NM_001012761chr532679 2107 678 --22686 2603 --
NM_001012989chrX122 ------
NM_001013415chr421013 332 ------
NM_001013438chr32206 45 ------
NM_001013439chr3152 ------
NM_001013699chr121446 ------
NM_001014283chr1311654 ------
NM_001014286chr131325 ------
NM_001014336chr12169 ------
NM_001014809chr42167 69 ------
NM_001014812chr15----1107 --
NM_001015877chrX32501 2300 624 ------
NM_001015880chr1031673 1600 1513 ------
NM_001015881chrX11012 ------
NM_001015887chr321213 137 ------
NM_001017368chr1732682 754 25 ------
NM_001017371chr2----11377 --
NM_001017395chr353489 2521 1171 952 806 ------
NM_001017405chr41889 ------
NM_001017424chr11476 --1612 --
NM_001017425chr11476 --1612 --
NM_001017440chr757262 6471 2885 1581 213 16895 12698 --
NM_001017535chr1253052 1068 801 492 22 12825 ----
NM_001017923chr141132 ------
NM_001017928chr31277 ------
NM_001017963chr143723 680 614 ------
NM_001017977chr1184 ------
NM_001018005chr151172 ------
NM_001018008chr151629 ------
NM_001018054chr11921 ------
NM_001018065chr995428 4918 4430 2284 1681 1295 1252 852 561 --1186 --
NM_001018066chr995428 4918 4430 2284 1681 1295 1252 852 561 --1186 --
NM_001018067chr124867 1943 --21825 332 --
NM_001018068chr124867 1943 --21825 332 --
NM_001018069chr124867 1943 --21825 332 --
NM_001018074chr533554 2429 317 ------
NM_001018075chr533554 2429 317 ------
NM_001018076chr533554 2429 317 ------
NM_001018077chr533554 2429 317 ------
NM_001018089chr1543436 2726 740 48 11473 ----
NM_001018090chr15177 ------
NM_001018091chr151187 ------
NM_001018102chr15177 ------
NM_001018159chr16126 ------
NM_001018160chr16126 ------
NM_001020658chr111064 11400 ----
NM_001020658chr111064 11400 ----
NM_001023587chr331112 771 68 ------
NM_001024071chr141345 1668 ----
NM_001024094chr533554 2429 317 ------
NM_001024455chrX21911 613 12269 ----
NM_001024649chr552768 2526 2500 939 670 --12320 --
NM_001024660chr3------143
NM_001024937chr17--1675 ----
NM_001024948chr153308 3086 2859 2611 1057 11107 --12251
NM_001025068chr331721 1193 70 --11605 --
NM_001025069chr331721 1193 70 --11605 --
NM_001025076chr1056150 1808 1358 1086 540 --22284 1125 15605
NM_001025077chr1057508 2716 2444 1898 478 --12483 16963
NM_001025079chr343707 2720 933 647 ------
NM_001025108chr263850 3775 3095 1644 799 371 ------
NM_001025109chr1131 ------
NM_001025205chr3185 1413 ----
NM_001025366chr621809 448 ------
NM_001025366chr621809 448 ------
NM_001025367chr621809 448 ------
NM_001025367chr621809 448 ------
NM_001025368chr621809 448 ------
NM_001025368chr621809 448 ------
NM_001025369chr621825 464 ------
NM_001025369chr621825 464 ------
NM_001025370chr621809 448 ------
NM_001025370chr621809 448 ------
NM_001025389chr1131198 1174 285 ------
NM_001025390chr1131198 1174 285 ------
NM_001025580chrX33318 869 421 ------
NM_001025595chr4--11656 11183 --
NM_001029860chr8133 ------
NM_001029863chr622606 640 ------
NM_001029875chr522490 2391 ----12202
NM_001030006chr1752427 2088 2021 446 42 --21050 715 --
NM_001030007chr1633246 2956 2843 ------
NM_001030272chr111198 ------
NM_001030273chr111198 ------
NM_001031740chr121232 1070 --144 --
NM_001031804chr1611128 --24309 3495 --
NM_001031812chr542004 1446 884 654 --12114 --
NM_001031849chr31503 ------
NM_001032221chr951752 1609 714 618 511 ------
NM_001032280chr61673 ------
NM_001032283chr121829 ------
NM_001032284chr121829 ------
NM_001032380chr1021249 812 11266 ----
NM_001032999chr2054927 4313 4017 3651 296 --1192 --
NM_001033057chr321375 431 --11862 --
NM_001033059chr62326 86 ----11699
NM_001033112chr5------1839
NM_001033117chr354423 4095 3991 3559 3097 --13855 14616
NM_001033507chr121579 412 ----1499
NM_001033578chr8197 ------
NM_001033756chr621743 382 ------
NM_001033756chr621743 382 ------
NM_001033925chr101812 1487 11353 --
NM_001034025chr121809 1273 ----
NM_001034850chr511495 ------
NM_001034915chr821092 373 ------
NM_001034954chr103818 620 196 ------
NM_001034955chr103818 620 196 ------
NM_001034956chr103818 620 196 ------
NM_001034957chr103818 620 196 ------
NM_001035chr12977 465 ------
NM_001035003chr421350 337 ------
NM_001035004chr421350 337 ------
NM_001035511chr121568 383 ------
NM_001035512chr121675 490 ------
NM_001035513chr121675 490 ------
NM_001037132chr742093 836 736 672 12173 ----
NM_001037133chr742093 836 736 672 12173 ----
NM_001037164chr721934 179 ------
NM_001037165chr788519 8501 7799 3506 2138 1374 948 920 16484 21682 1354 --
NM_001037172chr311383 ------
NM_001037332chr52501 372 --1241 --
NM_001037333chr52501 372 --1241 --
NM_001037533chr12635 314 ------
NM_001037954chr1132667 2180 244 ------
NM_001038640chr151752 ------
NM_001039199chr2034976 4945 4368 ----1435
NM_001039350chr731292 1212 432 --1473 --
NM_001039569chr243050 3030 2860 463 ------
NM_001039570chr2273782 3519 3478 3433 1616 547 509 14570 ----
NM_001039571chr2273782 3519 3478 3433 1616 547 509 14570 ----
NM_001039574chr11258 ------
NM_001039590chrX23084 367 13742 ----
NM_001039591chrX23084 367 13742 ----
NM_001039615chr81158 12091 --1487
NM_001039618chr1144328 1807 1661 1266 14089 1552 --
NM_001039709chr2054927 4313 4017 3651 296 --1192 --
NM_001039762chr1032174 914 612 ------
NM_001039840chrX54676 4169 1415 278 52 ------
NM_001040101chr451516 1460 1136 464 111 11255 ----
NM_001040142chr242126 1714 357 136 ------
NM_001040143chr242126 1714 357 136 ------
NM_001040157chr422166 964 --22227 305 --
NM_001040159chr42948 324 ------
NM_001040181chr32761 459 ------
NM_001040182chr32761 459 ------
NM_001040183chr32761 459 ------
NM_001040199chr32761 459 ------
NM_001040200chr32761 459 ------
NM_001040214chr621492 597 12174 1713 --
NM_001040272chr911713 ------
NM_001040284chr1675913 5612 5457 4486 4406 885 344 25479 2198 ----
NM_001040429chr1341230 1219 1069 1045 ----1338
NM_001040450chr1532392 2149 868 ------
NM_001040453chr1532392 2149 868 ------
NM_001040665chr744024 3810 1601 1393 ------
NM_001040709chr142567 336 237 223 --1532 --
NM_001040712chr953622 2816 2398 1293 1239 --1944 --
NM_001040876chr42396 331 11462 ----
NM_001042357chr101184 ------
NM_001042358chr101184 ------
NM_001042360chr101184 ------
NM_001042363chr101184 ------
NM_001042371chr163795 776 701 ------
NM_001042389chr101184 ------
NM_001042390chr101184 ------
NM_001042392chr101184 ------
NM_001042395chr101184 ------
NM_001042403chr122765 98 ------
NM_001042404chr12742 231 ------
NM_001042406chr61408 ------
NM_001042413chr942788 1038 561 489 ------
NM_001042425chr61673 ------
NM_001042430chr142163 154 ------
NM_001042453chrX11745 ------
NM_001042481chr1452058 1668 766 648 292 ------
NM_001042494chr1531083 700 636 ------
NM_001042495chr1531083 700 636 ------
NM_001042496chr1531083 700 636 ------
NM_001042497chr1531083 700 636 ------
NM_001042506chrX1102 ------
NM_001042533chr333004 1333 1182 --1250 --
NM_001042537chrX21769 82 1569 ----
NM_001042539chr161928 ------
NM_001042550chr91352 ------
NM_001042555chr1294238 4177 3250 1803 1766 596 565 420 235 14380 13668 --
NM_001042604chr343693 1906 1441 909 11735 ----
NM_001042646chr351961 1405 345 161 83 ------
NM_001042681chr122576 928 ------
NM_001042682chr122576 928 ------
NM_001042682chr122576 928 ------
NM_001042749chrX166 ------
NM_001042750chrX166 ------
NM_001042751chrX166 ------
NM_001043318chr1433326 1432 44 --2443 323 13059
NM_001043351chr122081 920 --12284 --
NM_001044305chr631503 1403 655 ------
NM_001044385chr211598 ----13379
NM_001044722chr542004 1446 884 654 --12114 --
NM_001044723chr542004 1446 884 654 --12114 --
NM_001071775chr1321912 103 1630 ----
NM_001083620chr432234 1850 106 ----1154
NM_001095chr1241889 1394 766 449 ------
NM_001100108chr1108273 8172 5418 3177 2063 1813 1770 870 623 109 ------
NM_001106chr3139379 8189 7754 7382 3552 3393 2923 2531 2172 2159 2067 1899 1757 --28054 5976 12123
NM_001113490chrX32810 420 375 ------
NM_001117chr1822500 2063 ------
NM_001119chr411503 --1167 --
NM_001121chr1011588 --11490 --
NM_001122679chr511055 ------
NM_001123chr101218 ------
NM_001126chr11183 ------
NM_001128chr1633246 2956 2843 ------
NM_001144chr161388 ----1407
NM_001149chr1041242 1039 260 99 ------
NM_001174chrX31780 714 139 ------
NM_001178chr111198 ------
NM_001186chr2122513 1992 ------
NM_001197chr221130 ------
NM_001204chr257769 7154 5893 2918 1958 ----17551
NM_001206chr91512 ------
NM_001219chr71707 11970 ----
NM_001254chr17170 ------
NM_001256chr1782928 2849 2836 1859 612 172 127 43 11076 ----
NM_001259chr7106324 5972 5866 5735 4427 2482 1669 1536 1436 402 --1322 --
NM_001270chr51718 ------
NM_001271chr1592885 2433 2385 2360 2320 1046 873 380 363 --1435 --
NM_001274chr11140 ------
NM_001280chr191481 ------
NM_001282chr1752427 2088 2021 446 42 --21050 715 --
NM_001290chr431074 940 363 ------
NM_001304chr1723057 2344 ----12768
NM_001313chr42167 69 ------
NM_001329chr1031429 1155 135 11102 ----
NM_001331chr1122224 2137 1492 ----
NM_001346chr342465 2432 2143 214 ------
NM_001349chr22576 111 --130 --
NM_001351chr311425 ------
NM_001356chrX12014 11949 ----
NM_001364chr111534 --14669 --
NM_001386chr842322 2231 2186 971 ------
NM_001390chr1843081 1106 245 214 ------
NM_001391chr181122 ------
NM_001399chrX33507 1351 127 12433 --13753
NM_001400chr131259 411 60 ------
NM_001406chr1721490 228 ------
NM_001412chrX33321 3099 2312 1825 ----
NM_001417chr122289 254 1385 --1282
NM_001419chr1934166 2966 424 24558 1654 ----
NM_001427chr731513 1429 74 ------
NM_001429chr221260 ------
NM_001431chr61847 ------
NM_001438chr122406 695 12490 ----
NM_001440chr852591 2338 2224 1946 1054 1454 11822 --
NM_001444chr81155 ------
NM_001449chrX21297 882 ------
NM_001453chr621149 300 ------
NM_001482chr15198 ------
NM_001493chrX----1668 --
NM_001497chr922287 250 --11809 --
NM_001542chr121797 562 --11973 --
NM_001546chr6--2564 307 ----
NM_001584chr111357 ------
NM_001604chr111635 ------
NM_001610chr112794 287 ------
NM_001616chr252694 2415 749 718 503 --11061 --
NM_001634chr62326 86 ----11699
NM_001650chr1832583 1626 827 ----13764
NM_001655chr1122165 170 ------
NM_001668chr11536 ------
NM_001677chr131106 1060 291 ------
NM_001679chr32210 163 ----1684
NM_001681chr121545 ------
NM_001682chr1222355 287 ------
NM_001684chr123975 3580 1465 23941 118 --
NM_001690chr332465 1677 119 12249 ----
NM_001694chr162136 128 ------
NM_001704chr6------191
NM_001706chr35833 728 683 115 96 ------
NM_001730chr1341119 1086 342 299 ------
NM_001730chr1341119 1086 342 299 ------
NM_001742chr711578 ------
NM_001746chr552768 2526 2500 939 670 --12320 --
NM_001755chr1631804 1680 725 ------
NM_001759chr1255228 5126 5055 4219 1765 15020 --12114
NM_001760chr61368 --1158 --
NM_001777chr343707 2720 933 647 ------
NM_001788chr72622 61 ------
NM_001796chr16--1208 ----
NM_001826chr11395 ------
NM_001830chrX53752 3458 3374 2701 1416 1656 ----
NM_001839chr11188 --1532 --
NM_001854chr1----2939 364 --
NM_001859chr943975 3146 940 891 ------
NM_001894chr22124 ------
NM_001895chr2011224 ------
NM_001901chr61855 11028 ----
NM_001902chr1--1393 ----
NM_001903chr52722 629 ------
NM_001914chr181324 ------
NM_001918chr1128942 8858 8262 7788 7190 7005 6666 6649 6404 6028 3252 1933 26957 226 13181 --
NM_001936chr731292 1212 432 --1473 --
NM_001938chr11287 ------
NM_001949chr642618 2608 2538 74 --12907 --
NM_001950chr161765 ------
NM_001964chr51408 ------
NM_001967chr32495 30 1504 ----
NM_001968chr41926 ------
NM_001977chr42704 671 ------
NM_002015chr1313165 --13087 --
NM_002024chrX21996 1741 ------
NM_002025chrX119245 8623 7278 7217 6696 6477 3048 2599 1312 730 185 --18252 --
NM_002030chr19171 ------
NM_002035chr1843816 2811 687 125 22736 1062 --13400
NM_002037chr63313 298 280 ------
NM_002039chr41639 ------
NM_002040chr212874 604 ----1228
NM_002048chr931164 1131 290 ------
NM_002051chr1031004 386 251 ------
NM_002063chrX41306 945 826 39 ------
NM_002069chr71220 ----1204
NM_002072chr91261 ------
NM_002081chr231730 1528 1373 --1225 --
NM_002084chr52734 310 ------
NM_002086chr1732195 548 297 11623 ----
NM_002092chr424986 347 --14951 --
NM_002094chr162387 379 ------
NM_002106chr4159 ------
NM_002126chr1733916 3511 700 ------
NM_002128chr1352508 2260 1711 560 130 ------
NM_002130chr5----1474 --
NM_002137chr731677 634 457 ------
NM_002139chrX1634 ------
NM_002140chr9--131 1435 --
NM_002156chr22339 59 ------
NM_002157chr21132 ------
NM_002158chr243415 1161 1146 828 ------
NM_002166chr22676 632 ------
NM_002198chr54683 278 246 180 2750 109 ----
NM_002211chr1021130 1015 ------
NM_002214chr774601 4119 1851 1831 1587 856 575 14367 ----
NM_002221chr152936 2818 2371 1106 385 ------
NM_002232chr1----11354 --
NM_002247chr101142 --11530 --
NM_002253chr42481 212 11255 ----
NM_002264chr354764 3340 1962 1445 917 11828 ----
NM_002267chr1332332 2208 361 ----1426
NM_002270chr555048 4886 4508 2235 1776 ----11218
NM_002271chr1321553 389 22018 411 11738 --
NM_002285chr263850 3775 3095 1644 799 371 ------
NM_002310chr544507 4501 4445 1993 24583 656 14106 --
NM_002317chr52316 36 ------
NM_002336chr1264030 3857 3791 3449 3436 563 ------
NM_002356chr632406 1865 470 --12074 --
NM_002359chr1763731 3567 2880 2629 1151 379 --22687 657 --
NM_002383chr161751 ------
NM_002397chr5----143 --
NM_002398chr21967 ------
NM_002401chr1762494 2478 1924 1646 936 228 --1269 --
NM_002408chr142679 557 ------
NM_002412chr10199 ------
NM_002430chr2252005 817 689 578 249 ------
NM_002487chr153649 130 92 ------
NM_002499chr1521932 1679 --1516 --
NM_002501chr1924012 3445 ------
NM_002504chr91147 11026 ----
NM_002515chr14--11573 ----
NM_002519chr1121372 1019 ------
NM_002522chr1742812 2482 1310 994 --13527 --
NM_002545chr1135186 2059 413 ------
NM_002556chr1121373 514 ------
NM_002581chr972048 1646 1467 1141 1113 498 321 --1244 --
NM_002586chr61200 11528 ----
NM_002590chr13173 ------
NM_002594chr2012247 ------
NM_002595chr122464 294 ----1182
NM_002607chr741130 1018 179 99 --1114 --
NM_002612chr72181 51 1319 ----
NM_002628chr32847 342 ------
NM_002633chr12448 139 ------
NM_002635chr123463 86 45 ------
NM_002645chr1132989 2640 2178 ------
NM_002655chr855265 4294 3803 2085 73 --13841 --
NM_002657chr2043520 2526 560 125 ------
NM_002709chr232822 2370 65 ------
NM_002710chr121790 ------
NM_002713chr111226 ------
NM_002715chr511072 ------
NM_002717chr81109 --1120 --
NM_002718chr31111 ------
NM_002719chr1432332 369 228 --11978 --
NM_002731chr152745 2154 347 310 37 1715 ----
NM_002734chr173798 343 250 ------
NM_002737chr1786682 4821 4729 4098 2410 983 860 222 --1779 --
NM_002738chr161130 ------
NM_002740chr342717 2364 1089 1033 ------
NM_002742chr141604 ------
NM_002745chr2274156 4095 2915 1683 870 712 254 --22923 1302 --
NM_002752chr51409 ------
NM_002755chr151820 ------
NM_002764chrX3981 851 103 ------
NM_002811chr16----161 --
NM_002814chrX150 ------
NM_002815chr17133 ------
NM_002821chr61114 --1267 --
NM_002822chr122520 429 11182 ----
NM_002829chr91896 ------
NM_002834chr1263536 3286 1346 1135 793 552 --12961 --
NM_002835chr71105 ------
NM_002837chr1224375 669 1847 ----
NM_002839chr953622 2816 2398 1293 1239 --1944 --
NM_002841chr31239 ------
NM_002843chr1122608 1096 ------
NM_002844chr621357 463 11210 ----
NM_002855chr1183444 3217 3010 1349 965 618 563 538 12821 ----
NM_002869chr1142183 1518 631 185 ----176
NM_002874chr92169 37 --1212 --
NM_002886chr343983 3857 1075 663 --1725 --
NM_002892chr14----1521 --
NM_002897chr22533 521 1574 --1501
NM_002940chr42396 331 11462 ----
NM_002942chr331261 1117 79 ------
NM_002955chr651693 1615 220 166 75 ------
NM_002958chr32872 349 ------
NM_002959chr133404 3344 406 ----1924
NM_002971chr33292 267 30 ------
NM_002994chr411427 2294 168 ----
NM_002998chr821908 199 ------
NM_003001chr121675 490 ------
NM_003010chr173203 197 80 ------
NM_003016chr1731658 1284 574 ------
NM_003017chr621342 315 ------
NM_003026chr911144 --11166 --
NM_003031chr162342 30 ------
NM_003042chr331819 1616 730 2309 55 ----
NM_003045chr1354408 4223 1310 519 86 --1477 --
NM_003046chr875296 4228 4217 1607 1390 340 240 14758 ----
NM_003051chr11634 ------
NM_003054chr10149 ------
NM_003069chrX1226 ------
NM_003070chr91138 ------
NM_003072chr192416 328 ------
NM_003074chr311837 --22205 222 1814
NM_003081chr20----1933 --
NM_003092chr202140 46 ------
NM_003100chr51289 ------
NM_003107chr621925 1736 ----1731
NM_003108chr267228 7060 6777 6003 4537 2197 --26963 2311 --
NM_003110chr171894 ------
NM_003111chr2----11377 --
NM_003112chr782959 2837 2802 2664 2309 1082 614 30 ------
NM_003113chr22601 266 ------
NM_003128chr24900 511 338 314 ------
NM_003131chr622182 2162 --1901 --
NM_003139chr114910 824 338 100 ------
NM_003144chr621897 73 ------
NM_003145chr11430 ------
NM_003152chr1731247 463 228 ------
NM_003161chr1712277 ------
NM_003170chr172597 177 ------
NM_003178chr32737 146 11641 21889 460 1285
NM_003185chr20------1145
NM_003199chr18115246 4910 3931 3895 3745 1667 1651 1483 1192 861 835 11299 ----
NM_003201chr101412 ------
NM_003204chr171145 ------
NM_003211chr12--1146 --11690
NM_003216chr2273279 3117 2536 2138 1184 623 540 ------
NM_003217chr1241796 1492 1458 1264 ----11387
NM_003220chr61673 ------
NM_003221chr644181 3179 565 207 ------
NM_003222chr2031147 476 416 --21159 857 --
NM_003234chr331794 952 626 ------
NM_003239chr141203 ------
NM_003246chr1542031 1621 739 729 --1132 --
NM_003253chr2121749 750 ------
NM_003257chr151471 ------
NM_003269chr62842 347 ------
NM_003274chr2132590 1821 1127 --1917 --
NM_003298chr396152 5740 5157 4093 4083 1884 1860 1019 667 25407 1033 ----
NM_003304chr32270 162 ------
NM_003339chr52222 142 1594 ----
NM_003341chr31505 ------
NM_003342chr1742667 2574 2494 2461 ----12680
NM_003347chr2222258 51 131 2677 509 --
NM_003348chr12122 ------
NM_003352chr22984 139 ------
NM_003373chr1031820 1379 1207 ------
NM_003376chr621809 448 ------
NM_003376chr621809 448 ------
NM_003387chr222549 807 ------
NM_003388chr722043 113 1213 ----
NM_003390chr111708 ------
NM_003392chr354289 3371 3334 3116 1350 ------
NM_003400chr21840 ------
NM_003403chr144744 311 249 235 153 ----
NM_003404chr2031520 586 31 ------
NM_003405chr222235 88 ------
NM_003406chr831575 1275 304 ------
NM_003409chr1821046 132 ------
NM_003410chrX1172 ------
NM_003412chr353104 2945 2032 698 239 12757 ----
NM_003418chr31573 ------
NM_003453chr131117 ------
NM_003459chr21185 --1258 --
NM_003463chr652641 2615 2201 1212 937 21239 968 ----
NM_003467chr21476 ------
NM_003468chr253943 1633 1601 1375 685 ------
NM_003469chr2----171 --
NM_003470chr1621149 247 11764 21640 1598 --
NM_003472chr631172 1083 310 --1461 1443
NM_003474chr103749 225 146 --1231 --
NM_003478chr111832 ------
NM_003482chr12--12543 ----
NM_003483chr1212079 ------
NM_003489chr211456 ----13402
NM_003496chr7------1852
NM_003502chr161104 ------
NM_003574chr1855232 4705 2046 1290 462 --13832 --
NM_003583chr1232656 551 256 23387 3167 ----
NM_003590chr233281 2482 356 ------
NM_003592chr71403 ------
NM_003597chr21451 ------
NM_003603chr421353 211 21663 618 1462 --
NM_003615chr353325 2790 2522 442 409 ------
NM_003628chr21123 ------
NM_003629chr132753 2540 985 ------
NM_003633chr511946 ------
NM_003637chr121583 989 ------
NM_003645chr15----1197 --
NM_003663chr31222 12403 ----
NM_003670chr311372 ------
NM_003671chr953038 2959 2669 2205 1444 --12858 --
NM_003672chr11320 ------
NM_003678chr22------1207
NM_003688chrX--1117 ----
NM_003692chr91755 1899 ----
NM_003705chr21570 --1743 --
NM_003718chr71493 ------
NM_003722chr321744 665 ------
NM_003737chr11142 ------
NM_003749chr1372384 2212 1892 1753 1713 598 322 --1638 --
NM_003750chr10--1639 ----
NM_003759chr421609 310 ------
NM_003763chr2023007 817 1600 21247 846 --
NM_003768chr11342 --11839 --
NM_003787chr1821164 238 ------
NM_003797chr11131 ------
NM_003800chr621540 187 --22418 702 --
NM_003818chr202948 289 ------
NM_003819chr11214 ------
NM_003829chr92875 833 ------
NM_003831chr1821813 24 ------
NM_003872chr242248 1926 1133 816 ------
NM_003873chr1052197 653 555 415 99 ------
NM_003884chr311577 --143 --
NM_003885chr1772580 2491 2072 1790 1640 900 798 ----11999
NM_003887chr221667 505 ------
NM_003896chr22767 187 --1954 --
NM_003905chr16126 ------
NM_003908chr2041410 1042 538 497 --1378 --
NM_003913chr694314 2954 2635 1591 1503 1327 753 445 241 --14261 --
NM_003916chrX21267 406 ------
NM_003930chr741723 1017 846 631 1685 1608 --
NM_003932chr2221478 83 1397 11821 --
NM_003934chr911022 ------
NM_003939chr10104129 4088 3947 3775 3474 3389 1026 474 467 218 ------
NM_003947chr311183 ------
NM_003958chr643592 2747 957 398 144 ----
NM_003966chr587676 6065 6032 5677 3004 2945 1378 1220 ----12521
NM_003968chr31585 ------
NM_003971chr172424 198 ------
NM_003975chr11131 ------
NM_003994chr1221217 519 ------
NM_004006chrX1413 ------
NM_004007chrX1413 ------
NM_004009chrX1413 ------
NM_004010chrX1413 ------
NM_004011chrX1413 ------
NM_004012chrX1413 ------
NM_004013chrX1413 ------
NM_004014chrX1413 ------
NM_004015chrX1413 ------
NM_004016chrX1327 ------
NM_004017chrX1413 ------
NM_004018chrX1327 ------
NM_004020chrX1413 ------
NM_004021chrX1327 ------
NM_004022chrX1327 ------
NM_004023chrX1327 ------
NM_004028chr1832583 1626 827 ----13764
NM_004037chr13873 847 295 --1762 --
NM_004068chr3185 1413 ----
NM_004080chr71455 ----1370
NM_004081chrY11605 ------
NM_004086chr142562 184 --149 --
NM_004087chr341845 1821 1709 441 ------
NM_004089chrX11012 ------
NM_004090chr1733439 396 129 ------
NM_004093chr1352975 2238 2214 894 424 ------
NM_004096chr1031448 712 480 ------
NM_004097chr21352 ------
NM_004098chr1011095 ------
NM_004099chr942059 2053 1918 1780 ------
NM_004116chr21172 --1103 --
NM_004117chr631972 556 81 ------
NM_004124chr1453257 2656 2629 2422 2332 ------
NM_004130chr32430 199 --1640 --
NM_004136chr1543180 3016 2455 227 ------
NM_004162chr311301 ------
NM_004163chr181159 ------
NM_004170chr91643 ------
NM_004171chr1168053 7034 5856 3450 1369 174 --28255 354 --
NM_004172chr51603 --12004 --
NM_004229chrX2238 200 --11967 --
NM_004232chr1843553 3186 1088 436 --13898 --
NM_004236chr153590 513 41 ------
NM_004238chr2121 ------
NM_004255chr15--153 ----
NM_004272chr521985 502 ------
NM_004274chr1432318 2138 742 13180 ----
NM_004302chr1292706 2242 1133 642 622 570 366 294 248 ------
NM_004308chr1131868 1650 333 ------
NM_004319chr143139 2978 988 224 ------
NM_004337chr842197 1664 177 68 ------
NM_004338chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_004354chr42753 189 ------
NM_004365chr51300 ------
NM_004370chr631919 1434 23 ------
NM_004380chr1612204 ------
NM_004384chr542004 1446 884 654 --12114 --
NM_004386chr1962244 2192 2002 913 879 247 --1571 --
NM_004389chr21127 ------
NM_004392chr1311059 ------
NM_004393chr332405 1891 343 ------
NM_004396chr172216 113 ------
NM_004397chr1131566 1448 1424 ------
NM_004411chr72808 502 ------
NM_004414chr2121170 430 ------
NM_004417chr51521 --1262 --
NM_004420chr1152137 2027 943 757 530 --2683 172 --
NM_004426chr1232000 742 475 11461 ----
NM_004432chr922262 99 ------
NM_004436chr11615 --1456 --
NM_004437chr11934 --22813 2223 --
NM_004440chr631823 1707 623 ------
NM_004441chr31374 --1990 --
NM_004447chr1211098 ------
NM_004449chr211255 ------
NM_004454chr352198 2183 1567 684 219 11584 ----
NM_004457chr241573 1523 1319 601 ------
NM_004458chrX2606 193 ------
NM_004491chr1984207 3878 3633 3386 973 611 354 256 11073 13625 --
NM_004499chr52555 344 ------
NM_004500chr1421365 456 ------
NM_004501chr154040 3945 3814 1140 872 ------
NM_004503chr121665 ------
NM_004529chr9----11047 --
NM_004537chr1221480 1140 ------
NM_004569chr142481 125 ------
NM_004571chr2152460 1281 470 164 144 12879 22611 437 --
NM_004575chr431310 315 278 ------
NM_004588chr1133816 1357 353 ------
NM_004593chr33665 581 92 ------
NM_004598chr52408 319 ------
NM_004602chr2021204 509 ------
NM_004612chr9114474 4322 4089 3399 3149 3118 1685 1410 1350 1301 125 ------
NM_004615chrX2663 386 1857 ----
NM_004630chr11----21202 1004 --
NM_004631chr11921 ------
NM_004642chr121508 ------
NM_004643chr141623 ------
NM_004645chr171713 ------
NM_004654chrY2540 166 ------
NM_004660chrY1249 11878 ----
NM_004664chr121288 --1248 --
NM_004667chr151269 ------
NM_004668chr72751 302 ------
NM_004670chr1031673 1600 1513 ------
NM_004673chr121098 1074 ------
NM_004717chr711405 ------
NM_004719chr1242883 2306 2004 274 --12742 --
NM_004726chrX55796 4038 1829 1153 573 ------
NM_004734chr1352846 2700 2357 989 933 12232 ----
NM_004736chr122067 1387 ------
NM_004742chr32587 57 ------
NM_004745chr865919 5587 4983 4740 2147 1251 16415 14555 --
NM_004748chr1544159 4001 3578 2993 ------
NM_004759chr141522 500 275 35 ------
NM_004768chr12902 43 ------
NM_004772chr5------11530
NM_004774chr172630 382 ------
NM_004776chr2012553 12849 ----
NM_004781chr131669 1586 205 ------
NM_004781chr131669 1586 205 ------
NM_004788chr1122728 2001 --1831 --
NM_004796chr1422256 1809 11514 1567 --
NM_004801chr22995 235 ------
NM_004805chr2--1251 ----
NM_004824chr6----11318 --
NM_004834chr253361 3087 2090 1310 482 ------
NM_004839chr151612 ------
NM_004840chrX52469 2277 838 360 28 ------
NM_004850chr211361 ------
NM_004859chr1731966 524 477 ------
NM_004863chr1485283 5044 4547 4276 3794 3610 1521 1493 --1889 --
NM_004865chr61130 --1279 --
NM_004866chr564884 4727 4408 3338 1804 194 --11790 --
NM_004869chr1821303 528 ------
NM_004887chr52962 403 ------
NM_004898chr432833 231 164 12096 ----
NM_004902chr20----2774 164 --
NM_004904chr734499 2109 1236 11390 ----
NM_004906chr62520 29 ------
NM_004922chr101403 ------
NM_004926chr141372 ------
NM_004938chr91268 ------
NM_004947chr32901 565 12296 21710 1596 --
NM_004949chr1842005 658 505 213 11871 ----
NM_004960chr162279 51 ------
NM_004961chrX2406 271 ------
NM_004965chr211228 ------
NM_004966chr101147 1699 ----
NM_004974chr1----190 --
NM_004978chr11575 ------
NM_004985chr1244136 3198 1728 1074 ----14345
NM_004992chrX116724 6509 5995 5288 2854 2196 1722 1324 1085 412 403 ------
NM_004992chrX116724 6509 5995 5288 2854 2196 1722 1324 1085 412 403 ------
NM_004993chr1431341 533 261 ------
NM_005006chr22365 55 ------
NM_005010chr742093 836 736 672 12173 ----
NM_005028chr1042309 2171 1826 251 ------
NM_005066chr12256 171 ------
NM_005067chr32136 41 --1303 --
NM_005068chr62990 282 ------
NM_005076chr164118 3981 3477 2716 925 133 ------
NM_005077chr9--1327 ----
NM_005078chr153664 521 430 ------
NM_005087chr3152 ------
NM_005088chrX1712 ------
NM_005093chr2054927 4313 4017 3651 296 --1192 --
NM_005095chr1----1149 --
NM_005109chr312103 ------
NM_005112chr43873 673 659 ------
NM_005119chr11824 ------
NM_005135chr1531083 700 636 ------
NM_005141chr4--1118 ----
NM_005155chr62614 546 ------
NM_005156chr975257 4760 3609 3585 3534 1288 672 11920 11866 14829
NM_005159chr1522271 867 ------
NM_005168chr211386 1217 ----
NM_005188chr1188224 8020 7729 6236 3050 1912 524 250 --27349 1631 --
NM_005197chr1465333 4896 4552 4045 1797 1728 --16018 --
NM_005202chr14836 594 523 219 11454 ----
NM_005215chr18199 ------
NM_005225chr202935 436 --1336 --
NM_005245chr43530 162 81 1506 ----
NM_005252chr141226 ------
NM_005254chr1521245 1101 ------
NM_005261chr82780 350 ------
NM_005276chr1241729 1302 539 290 ------
NM_005276chr1241729 1302 539 290 ------
NM_005277chr421423 1366 ------
NM_005295chr71301 ------
NM_005311chr772878 2659 1994 1774 764 746 130 ------
NM_005318chr22----1791 --
NM_005324chr1731327 826 446 --11342 --
NM_005338chr793393 3045 2763 1119 766 593 244 126 29 ------
NM_005339chr453545 1102 593 360 296 13531 ----
NM_005347chr931593 1243 664 ------
NM_005348chr143723 680 614 ------
NM_005359chr1845122 4343 3997 282 16251 ----
NM_005378chr21847 --1151 --
NM_005384chr91259 ------
NM_005400chr2----11013 --
NM_005402chr711233 ------
NM_005410chr51256 ------
NM_005415chr2180 --1689 --
NM_005417chr2031872 1694 749 --11444 --
NM_005430chr121937 --1677 --
NM_005433chr1812514 --1249 --
NM_005436chr1051089 521 494 212 169 --1291 1836
NM_005465chr111927 ------
NM_005475chr1221151 635 22076 58 12542 --
NM_005477chr151322 ------
NM_005477chr151322 ------
NM_005497chr1766047 5430 5043 1561 428 184 ------
NM_005499chr191220 ------
NM_005502chr941188 502 486 188 ------
NM_005504chr1234297 834 282 ------
NM_005523chr721184 589 ------
NM_005544chr21674 ------
NM_005547chr11290 ------
NM_005563chr1167 --1601 --
NM_005570chr1811047 ------
NM_005578chr323711 337 ------
NM_005587chr151150 ------
NM_005596chr995683 5400 5303 4648 4453 2115 2099 1876 1382 --1684 11997
NM_005604chr62941 282 ------
NM_005613chr142046 1850 342 90 ------
NM_005614chr731002 358 276 ------
NM_005627chr61405 ------
NM_005629chrX2280 260 1851 ----
NM_005637chr1811563 ------
NM_005639chr12139 ------
NM_005644chr12387 129 ------
NM_005647chrX33463 2240 704 ------
NM_005662chr81267 1101 ----
NM_005665chr144378 4273 4077 1336 ------
NM_005667chr21104 ------
NM_005668chr542900 2797 1450 275 ------
NM_005686chr111493 ------
NM_005707chr152517 21 1405 ----
NM_005711chr51992 1237 ----
NM_005717chr141328 1099 1014 938 ------
NM_005721chr231037 363 357 --1315 --
NM_005724chr151270 1658 ----
NM_005734chr113802 552 291 ------
NM_005736chr1041602 1105 119 101 --11515 --
NM_005738chr721934 179 ------
NM_005746chr71148 ------
NM_005748chr1242279 727 360 254 --12569 --
NM_005749chr171690 ------
NM_005752chr1611003 ------
NM_005756chrX11312 ----142
NM_005765chrX172 ------
NM_005776chr141856 ------
NM_005780chr131730 ------
NM_005801chr171235 ------
NM_005819chr142387 2286 555 406 ------
NM_005828chr1744166 1020 590 188 --1458 --
NM_005836chr8------1104
NM_005839chr11176 ------
NM_005840chrX115265 5137 2876 2506 1956 1532 1442 1424 941 811 131 --26181 2693 --
NM_005843chr211266 ------
NM_005848chr15148 ------
NM_005857chr11468 ------
NM_005859chr511154 ------
NM_005870chr1311088 1272 ----
NM_005871chr101771 ------
NM_005882chr41889 ------
NM_005885chr521040 367 ------
NM_005888chr123463 86 45 ------
NM_005895chr1264143 4004 3599 3360 3249 2696 12664 ----
NM_005898chr1132155 447 49 ------
NM_005903chr554678 1444 1106 762 628 ------
NM_005904chr1831197 339 299 1350 ----
NM_005906chr631262 1181 200 ------
NM_005909chr534224 3413 1139 ------
NM_005910chr1743239 3128 1084 53 1505 1728 --
NM_005917chr21180 ------
NM_005920chr163248 2893 2817 2631 1020 861 13738 1915 --
NM_005923chr61493 ------
NM_005924chr71997 ------
NM_005933chr1121124 22 ------
NM_005937chr1763777 2961 1602 761 656 138 --1753 --
NM_005938chrX51406 1296 1115 923 873 ------
NM_005941chr873831 3467 2778 2689 1500 1456 747 1515 ----
NM_005955chr144946 1547 1082 865 15294 1402 --
NM_005962chr1032224 1647 23 12037 ----
NM_005962chr1032224 1647 23 12037 ----
NM_005964chr1721274 1064 ------
NM_005966chr2186 ------
NM_005969chr1111189 ------
NM_006007chr9--13129 12909 --
NM_006010chr31214 ------
NM_006011chr1511548 11079 ----
NM_006016chr62654 590 ------
NM_006029chr143485 263 25 ------
NM_006035chr143454 81 56 ------
NM_006037chr234002 1061 803 ------
NM_006042chr171462 ------
NM_006047chr2053070 2963 2414 2340 1326 ------
NM_006054chr11191 1442 ----
NM_006076chr742756 626 389 227 --12905 --
NM_006088chr9------138
NM_006094chr841553 1472 514 334 1460 1366 --
NM_006095chr454435 3451 2891 2798 1062 ------
NM_006099chr11712 ------
NM_006100chr32548 33 ------
NM_006106chr1183137 3095 2935 2576 2545 1154 964 566 ------
NM_006141chr1621102 515 21126 161 ----
NM_006147chr12364 107 ------
NM_006158chr811624 ------
NM_006166chr1232390 768 643 1590 11913 --
NM_006178chr1731166 356 143 ------
NM_006190chr22392 376 --1267 --
NM_006195chr911070 ------
NM_006197chr821545 471 ------
NM_006203chr534966 937 526 1296 ----
NM_006216chr2----1626 --
NM_006224chr1752434 2289 2218 2112 1744 --1791 --
NM_006226chr23246 190 152 ------
NM_006239chr4----1145 --
NM_006242chr20------1505
NM_006244chr111546 ------
NM_006246chr1411055 ------
NM_006251chr543151 2574 1117 518 ------
NM_006252chr157340 5903 2411 1563 1202 ----15914
NM_006256chr122007 694 ------
NM_006258chr1051001 566 533 177 93 ------
NM_006265chr831233 976 41 ------
NM_006275chr2022416 1706 ------
NM_006282chr2034243 4099 798 --1412 --
NM_006283chr864783 4689 4082 1591 1195 223 21083 212 ----
NM_006288chr1141162 967 143 45 ------
NM_006298chr642863 535 166 74 ------
NM_006300chr1952379 1945 1593 701 562 --1890 --
NM_006315chr473960 3735 3514 3329 3213 1589 768 --13598 --
NM_006324chr16180 ------
NM_006325chr123609 590 68 1878 ----
NM_006330chr82441 101 ------
NM_006333chr2--1518 ----
NM_006350chr51367 ------
NM_006352chr121487 658 ------
NM_006357chr2------125
NM_006359chrX21769 82 1569 ----
NM_006364chr141216 ------
NM_006371chr375226 5063 4674 3683 3211 2067 472 ------
NM_006372chr61354 ------
NM_006375chrX2503 296 ------
NM_006380chr1784304 4197 3732 3157 2781 2659 927 603 ------
NM_006386chr2232305 973 908 ------
NM_006390chr1231787 1184 358 161 ----
NM_006393chr1034277 2996 335 11100 ----
NM_006416chr62759 609 --1120 --
NM_006420chr2043173 2114 462 22 12897 ----
NM_006421chr841268 231 171 104 ------
NM_006434chr103818 620 196 ------
NM_006460chr1731358 629 614 ----1397
NM_006463chr2147 ------
NM_006464chr224617 1057 1830 ----
NM_006465chr151309 ------
NM_006469chr111043 ------
NM_006472chr131267 498 103 ------
NM_006474chr132009 1950 424 --11439 --
NM_006482chr1232656 551 256 23387 3167 ----
NM_006489chr14--11573 ----
NM_006496chr131837 1682 1563 1219 135 --
NM_006520chrX3682 88 50 ------
NM_006534chr2032905 1157 946 ------
NM_006540chr831192 422 252 --21119 565 --
NM_006544chr1464051 1736 1480 883 331 27 ------
NM_006546chr1754262 1939 1493 1015 58 ------
NM_006548chr321723 1464 ------
NM_006559chr11239 ------
NM_006561chr1056150 1808 1358 1086 540 --22284 1125 15605
NM_006565chr161249 ------
NM_006570chr91107 ------
NM_006572chr1733458 1385 331 ------
NM_006577chr211054 ------
NM_006599chr1686740 6694 6516 2649 2566 1466 1194 1054 ------
NM_006603chrX166 ------
NM_006609chr222424 2264 ------
NM_006621chr131761 1467 401 ----11650
NM_006628chr1551362 1354 598 182 129 13494 13335 --
NM_006644chr131603 ------
NM_006650chr553836 2939 2838 2524 283 --22961 1429 --
NM_006654chr1294238 4177 3250 1803 1766 596 565 420 235 14380 13668 --
NM_006667chrX2467 214 ------
NM_006690chr2032316 1743 84 ------
NM_006699chr122406 2052 ------
NM_006706chr51305 ------
NM_006717chr943166 3018 2814 873 ------
NM_006721chr101218 ------
NM_006722chr322495 227 1726 ----
NM_006738chr1543769 3308 1113 515 --14551 --
NM_006743chrX2800 387 ------
NM_006750chr1667213 6469 5884 5740 2667 104 --23006 1653 --
NM_006751chr22975 22 ------
NM_006759chr21111 ------
NM_006763chr12757 252 ------
NM_006772chr611735 ------
NM_006775chr64900 616 546 105 ------
NM_006791chr151212 ------
NM_006809chr202736 180 ------
NM_006813chr61302 1750 ----
NM_006814chr2032352 1062 324 --1218 --
NM_006815chr121928 ------
NM_006818chr11312 ------
NM_006823chr8--11207 ----
NM_006838chr1211908 ------
NM_006852chr1742266 1937 400 350 ------
NM_006854chr761938 1669 1509 1479 1387 768 --1262 --
NM_006874chr411005 ------
NM_006875chrX1868 ------
NM_006885chr1643720 3451 2963 2801 ------
NM_006888chr1443286 2536 1291 961 ------
NM_006894chr11146 ------
NM_006895chr232221 2071 1829 ------
NM_006897chr121186 ------
NM_006908chr711341 ------
NM_006912chr131733 477 38 ------
NM_006920chr221762 135 ------
NM_006922chr242150 1007 380 129 ------
NM_006924chr1734097 4075 756 ------
NM_006931chr1242007 1447 1314 393 ------
NM_006939chr1431089 320 225 ------
NM_006948chr2132244 2011 339 ------
NM_006965chr181828 ------
NM_006981chr912943 11170 --12817
NM_006996chr121355 1342 ------
NM_007006chr1622329 64 12672 ----
NM_007010chr1721482 768 1475 ----
NM_007011chr1552421 2397 1897 1390 504 --14931 1887
NM_007017chr5--1604 ----
NM_007024chr3121 ------
NM_007036chr51810 ------
NM_007039chr1411732 ------
NM_007042chr32544 193 ------
NM_007064chr3------143
NM_007067chr1741450 1068 477 362 ------
NM_007068chr22132 ------
NM_007078chr1042884 2358 2345 1002 ------
NM_007106chr1331005 905 747 1589 1411 --
NM_007107chr352024 1975 1901 900 616 ------
NM_007114chr322861 2025 ------
NM_007124chr6141 ------
NM_007129chr131760 ------
NM_007137chrX54430 3501 866 477 407 --11712 14523
NM_007144chr1711135 ------
NM_007146chr172797 126 ------
NM_007167chr12902 868 1659 ----
NM_007182chr34671 487 96 49 165 ----
NM_007187chr132224 210 ------
NM_007200chr1543769 3308 1113 515 --14551 --
NM_007203chr923600 241 --11167 --
NM_007207chr13848 739 696 ------
NM_007214chr651331 1126 278 160 26 ------
NM_007219chr201782 ------
NM_007249chr1376535 3548 2932 2257 1994 823 84 ------
NM_007274chr12215 54 ------
NM_007276chr71729 177 ----
NM_007285chr161105 ------
NM_007325chrX2494 169 11496 ----
NM_007347chr154497 334 273 118 12681 ----
NM_007353chr762981 1121 825 543 510 485 ------
NM_007358chr12794 455 ------
NM_007361chr143572 510 140 ------
NM_007365chr12233 171 --21888 565 11999
NM_007375chr141713 935 589 455 --1121 --
NM_012081chr553291 2526 748 668 343 ------
NM_012082chr8135 ------
NM_012086chr22126 52 ------
NM_012089chr131115 132 48 11420 ----
NM_012095chr1033519 3443 2871 ------
NM_012096chr323772 3569 ------
NM_012102chr122576 928 ------
NM_012120chr612356 ----11012
NM_012129chr712503 --1358 --
NM_012156chr2043382 2773 1135 983 ------
NM_012157chr31346 ------
NM_012164chr984778 4717 4683 714 530 480 254 121 --15453 --
NM_012193chr1164069 3819 1253 1128 595 531 14202 11311 --
NM_012197chr911297 --11550 1249
NM_012199chr133667 776 319 --21860 1572 --
NM_012214chr255986 5867 5262 3878 2013 1812 14726 --
NM_012219chr352643 2488 2259 2060 575 ------
NM_012223chr22220 48 ------
NM_012234chr322869 1260 ------
NM_012238chr1011733 ----1570
NM_012242chr101702 1669 1217 --
NM_012249chr233093 2801 897 ------
NM_012250chr1111335 ------
NM_012255chr201299 ------
NM_012259chr631156 462 295 ------
NM_012262chr174567 4560 4239 4168 3747 1539 175 --1453 --
NM_012281chr731790 1563 947 ------
NM_012286chrX1199 ------
NM_012290chr21444 ------
NM_012297chr41383 11642 ----
NM_012300chr532497 940 850 --11743 --
NM_012302chr121230 815 ------
NM_012309chr1174850 4729 3767 1777 655 544 362 ------
NM_012316chr145552 2059 1734 83 23966 870 13912 14877
NM_012325chr2031441 1168 1134 ------
NM_012333chr1----11645 --
NM_012347chr611962 1472 ----
NM_012420chr1021538 910 ------
NM_012421chr11299 ------
NM_012433chr2196 ------
NM_012446chr5184 ------
NM_012448chr1742034 1548 836 801 1174 ----
NM_012455chr231592 1260 375 --21561 1520 --
NM_012465chr1021068 96 ------
NM_012471chrX31615 1457 481 ------
NM_012476chr2------1191
NM_012479chr742551 2495 1959 473 --11071 --
NM_012486chr1177 ------
NM_013231chr1434282 4182 3730 ------
NM_013243chr1521192 1021 ------
NM_013257chr8197 ------
NM_013261chr423247 292 --11312 --
NM_013269chr1241443 836 821 497 ------
NM_013293chr7--1571 ----
NM_013302chr1663730 3536 1549 1093 815 110 ------
NM_013338chr13140 ------
NM_013361chr193634 186 74 ----131
NM_013381chr122403 108 ------
NM_013390chr931626 1344 450 ------
NM_013410chr121068 51 --1263 --
NM_013437chr81904 11164 ----
NM_013438chr9----11752 --
NM_013444chrX31112 949 879 ------
NM_013449chr1242891 2841 479 142 ------
NM_013450chr22880 277 ------
NM_013995chrX2796 282 --1943 --
NM_014000chr1031820 1379 1207 ------
NM_014011chr231006 523 85 ----1363
NM_014016chr321216 632 --11636 --
NM_014021chr133457 3335 435 ------
NM_014023chr1032431 1138 140 ------
NM_014080chr155559 423 400 286 208 ------
NM_014106chr1552294 2158 1926 1824 947 ------
NM_014110chr111226 ------
NM_014112chr845408 4433 2083 1558 ------
NM_014117chr162942 661 --1499 --
NM_014153chr161259 ------
NM_014155chr1136613 5478 208 ------
NM_014181chr222546 1010 12168 ----
NM_014189chr411503 --1167 --
NM_014190chr411855 --1519 --
NM_014217chr11476 --1612 --
NM_014223chr12307 244 ------
NM_014232chr1711615 --11096 --
NM_014232chr1711615 --11096 --
NM_014251chr72376 23 ------
NM_014252chr13------185
NM_014253chrX----11685 --
NM_014264chr41473 ------
NM_014268chr181402 ------
NM_014278chr41191 ------
NM_014279chr91756 --1121 --
NM_014280chr13884 373 286 ------
NM_014283chr121524 508 ------
NM_014294chr821214 458 ------
NM_014299chr1942113 2026 1919 1677 --1481 --
NM_014302chr7--151 ----
NM_014325chr1231688 1584 1509 ------
NM_014333chr1132709 2487 2285 ------
NM_014342chr11----183 --
NM_014344chr111862 ------
NM_014350chr51964 ------
NM_014352chr11--1996 ----
NM_014361chr112433 335 ------
NM_014368chr92482 69 ------
NM_014376chr52501 372 --1241 --
NM_014379chr81182 ------
NM_014390chr7----2458 124 --
NM_014392chr451516 1460 1136 464 111 11255 ----
NM_014409chr11163 ------
NM_014421chr42200 191 ------
NM_014423chr533597 1999 1780 ----11256
NM_014437chr11386 ------
NM_014447chr4--11655 11182 --
NM_014452chr61163 ----1374
NM_014454chr61710 ------
NM_014456chr101336 ------
NM_014472chr103684 590 478 ------
NM_014494chr1632116 1981 451 --12199 --
NM_014591chr102251 23 --11007 --
NM_014600chr241643 1436 351 31 ------
NM_014614chr211453 ------
NM_014630chr1523589 147 1104 --198
NM_014634chr2273464 3352 2774 2398 753 520 113 ------
NM_014646chr1833246 2344 1090 --1987 --
NM_014660chr71400 162 ----
NM_014662chr221417 ------
NM_014665chr863333 3241 2722 2387 386 168 --23479 2501 --
NM_014674chr393498 3382 3134 2582 1374 1113 1022 724 169 --12700 --
NM_014676chr111064 11400 ----
NM_014679chr1131328 562 382 ------
NM_014683chr1711471 --1368 --
NM_014685chr161505 --1114 --
NM_014689chr21193 ------
NM_014700chr1641512 1299 602 105 --11548 --
NM_014701chr152478 351 13463 ----
NM_014705chr741971 1948 462 398 ------
NM_014707chr721916 79 ------
NM_014711chr1611394 ------
NM_014720chr101624 ------
NM_014730chr1284666 4624 4503 3638 3525 1910 1839 735 ------
NM_014730chr1284666 4624 4503 3638 3525 1910 1839 735 ------
NM_014731chr204628 491 321 60 ------
NM_014732chr1665805 5643 2055 910 720 606 --24045 1710 --
NM_014735chrX31858 596 589 --11793 --
NM_014743chr422157 362 --12786 --
NM_014746chr23692 125 44 ------
NM_014751chr832009 1707 726 ------
NM_014755chr243896 2869 2849 818 ------
NM_014757chr531922 1535 385 ------
NM_014759chr81178 ------
NM_014766chr763790 3035 519 512 352 205 --13273 --
NM_014781chr821046 57 1958 ----
NM_014782chrX1126 --152 --
NM_014787chr13943 933 50 ------
NM_014795chr21213 ------
NM_014797chr653160 3011 2939 2361 877 ------
NM_014810chr143561 3078 936 235 ------
NM_014812chr12742 231 ------
NM_014819chr53698 206 28 11648 ----
NM_014824chr1121934 625 ------
NM_014832chr1311346 --21610 1581 --
NM_014836chr1021249 812 11266 ----
NM_014841chr631362 1153 278 1447 1501 --
NM_014850chr354423 4095 3991 3559 3097 --13855 14616
NM_014868chr121172 ------
NM_014872chr952126 1918 1817 1572 700 ------
NM_014873chr174015 3952 1912 1251 849 579 59 --1797 --
NM_014876chr223420 175 133 ------
NM_014877chr1756976 5472 3017 1719 751 --17703 --
NM_014900chr21413 ------
NM_014905chr21117 1406 ----
NM_014906chr1743334 564 358 162 ------
NM_014912chr1041328 1164 179 82 13491 ----
NM_014917chr12359 115 --1384 1638
NM_014920chr653315 2909 2877 1324 486 --1450 --
NM_014923chr1331966 457 140 ------
NM_014926chr3125 ------
NM_014935chr183654 2666 890 883 695 659 548 192 ----12680
NM_014937chr1021300 838 ------
NM_014942chr632585 2373 2161 ------
NM_014947chr143069 2982 1930 781 ------
NM_014952chr1512001 --11272 --
NM_014953chr13114254 4203 3779 3503 2772 1628 1346 772 670 442 81 1644 ----
NM_014962chr2042866 2159 435 93 --22762 2131 --
NM_014978chr1011626 ------
NM_014982chr1455293 3707 1184 722 436 ------
NM_014988chr432715 2637 158 12599 ----
NM_014989chr61387 ------
NM_014991chr463172 2982 2697 2114 895 792 --1715 --
NM_014992chr141275 ------
NM_014997chr72559 69 ------
NM_015000chr1222807 177 11941 ----
NM_015008chr353489 2521 1171 952 806 ------
NM_015017chr131050 522 224 ------
NM_015020chr1633061 1465 510 1462 122 --
NM_015023chr121157 523 --11750 --
NM_015024chr821456 423 1396 1993 --
NM_015025chr21113 ------
NM_015026chr1284356 4150 4017 3497 3422 1051 535 201 ------
NM_015032chr1352662 2453 988 760 409 --11028 --
NM_015039chr141352 1321 536 134 14056 11001 --
NM_015040chr253123 3078 2436 1076 343 ------
NM_015042chr1553748 3372 1573 1553 495 ------
NM_015044chr1623197 2549 12641 2247 87 --
NM_015045chr1051981 1860 1560 1388 348 ------
NM_015051chr942777 2289 1087 1067 ------
NM_015074chr135009 3196 976 --24240 3683 --
NM_015076chr621072 933 ------
NM_015090chr1135702 5106 4816 4591 4244 3837 3784 2412 2155 2032 1961 1290 693 --25424 212 --
NM_015092chr1643757 1040 959 143 ------
NM_015093chr63464 263 254 ------
NM_015094chr2264652 4604 3345 3327 1287 927 13720 ----
NM_015110chr92900 749 ------
NM_015113chr1741752 974 218 96 ------
NM_015132chr7--1548 ----
NM_015137chr81825 ------
NM_015138chr1562694 2622 2482 1828 614 592 --22612 222 --
NM_015144chr1643268 2574 568 267 ------
NM_015150chr35976 786 316 219 173 ------
NM_015155chr1053323 3065 507 484 103 --12359 172
NM_015156chr1443282 3181 2973 991 ------
NM_015170chr8------159
NM_015172chr131310 1224 661 ----1384
NM_015185chrX42837 2679 2183 1083 12813 ----
NM_015191chr1111036 --22680 1785 --
NM_015192chr2032346 1841 307 --1737 --
NM_015200chr412448 --11948 --
NM_015206chr1533644 3273 1120 ------
NM_015215chr122644 2080 --1946 --
NM_015250chr921711 1264 --12020 --
NM_015265chr242474 946 922 398 ------
NM_015267chr12--12000 ----
NM_015268chr32111 39 ------
NM_015269chr11487 ------
NM_015270chr1242205 1856 888 831 ------
NM_015272chr1611830 ------
NM_015288chr563902 3735 2648 787 757 666 --12967 --
NM_015299chr1442866 2746 1398 464 ------
NM_015310chr855627 5601 3116 507 112 ------
NM_015313chr1124421 4124 198 2176 80 --
NM_015326chr112212 --12250 --
NM_015328chr742140 455 263 186 ------
NM_015335chr1241693 1665 324 164 --1241 --
NM_015338chr2021319 38 ----1610
NM_015339chr201862 ----160
NM_015343chr171274 ------
NM_015344chr832076 1951 534 ------
NM_015345chr632756 2314 621 ------
NM_015347chr1212265 --21105 85 --
NM_015349chr61824 --12845 --
NM_015355chr1721416 724 ------
NM_015359chr841026 414 322 207 ------
NM_015361chr2--1599 ----
NM_015365chrX33318 869 421 ------
NM_015375chr144784 4756 1599 583 --1590 --
NM_015378chr122705 2038 --22940 317 --
NM_015382chr142621 301 ------
NM_015385chr103818 620 196 ------
NM_015387chr221732 1478 --1189 --
NM_015393chr433674 3519 1439 --1658 --
NM_015423chr1131564 1488 549 11423 ----
NM_015443chr1711506 ------
NM_015446chr121076 54 --11164 21257 1246
NM_015447chr91122 ------
NM_015455chr521453 1236 --11183 --
NM_015460chr331745 125 55 ------
NM_015483chr71426 1337 ----
NM_015508chr3----1224 --
NM_015520chr322073 1129 --12560 --
NM_015532chr15177 ------
NM_015542chr101412 ------
NM_015550chr723327 2611 --1157 --
NM_015553chr645178 4839 1968 1615 1829 ----
NM_015564chr533460 2832 1225 ------
NM_015565chr21174 ------
NM_015569chr11988 13225 ----
NM_015576chr362737 2704 2615 998 930 546 --1108 --
NM_015578chr1921562 1493 ------
NM_015589chr14158 ------
NM_015601chr102822 30 ------
NM_015607chr11152 ------
NM_015638chr20----138 --
NM_015640chr124867 1943 --21825 332 --
NM_015713chr812436 1183 1291 --
NM_015716chr17--1675 ----
NM_015850chr842098 1636 585 447 ------
NM_015852chr723161 2270 43580 563 479 59 12342 --
NM_015878chr81694 --167 1421
NM_015879chr1856297 3193 1121 1044 772 28569 1131 ----
NM_015891chr622031 1613 ------
NM_015906chr134280 3169 506 ------
NM_015960chr10--1329 ----
NM_015984chr13186 117 100 ------
NM_016006chr31171 ------
NM_016018chr822429 1930 ------
NM_016021chr611043 ----12224
NM_016025chr1621950 164 ------
NM_016026chr1431389 1196 154 --1926 --
NM_016037chr1----1271 --
NM_016041chr17184 ------
NM_016045chr2031704 1301 515 11310 ----
NM_016061chr22480 327 --1195 --
NM_016066chr1132 ------
NM_016083chr642445 2430 1336 458 11077 ----
NM_016089chr391857 1659 841 757 505 421 337 169 85 --1589 --
NM_016090chr112726 684 ------
NM_016107chr53307 155 24 ------
NM_016120chrX2930 852 ------
NM_016131chr211771 ------
NM_016132chr15--12990 ----
NM_016152chr31855 ------
NM_016169chr1042954 2822 125 62 1108 12694 --
NM_016178chr11106 ------
NM_016179chr13150 ------
NM_016200chr72320 86 1225 ----
NM_016217chr633580 2298 455 11000 ----
NM_016224chr651906 1842 734 597 389 ------
NM_016226chr121307 ------
NM_016227chr121524 508 ------
NM_016231chr171246 --11196 --
NM_016248chr1343700 3140 325 231 ------
NM_016250chr142580 535 --1655 --
NM_016255chr652249 931 922 912 805 ----1116
NM_016257chr132526 2492 1375 ----12715
NM_016258chr11514 ------
NM_016260chr257424 6755 2448 967 153 --11799 --
NM_016272chr2222088 179 --1976 --
NM_016287chr1----162 --
NM_016297chr233292 2840 987 1167 ----
NM_016322chr922321 869 12861 --11243
NM_016374chr111410 ------
NM_016374chr111410 ------
NM_016376chr1744183 1537 642 475 --33735 2991 183 --
NM_016396chr1522151 228 ------
NM_016422chr111950 --1583 --
NM_016424chr1741827 245 170 88 ------
NM_016453chr3----141 --
NM_016480chr5------1839
NM_016507chr1711040 --11975 --
NM_016513chr653315 2909 2877 1324 486 --1450 --
NM_016519chr4162 ------
NM_016522chr1111490 --1315 --
NM_016526chr1121817 1658 ----12427
NM_016529chr132220 57 ------
NM_016530chr1553138 1439 1153 870 303 --12617 --
NM_016542chrX11745 ------
NM_016544chr263758 3708 3693 1500 1299 1140 --13380 --
NM_016577chr31833 --44255 3491 953 936 --
NM_016587chr71729 177 ----
NM_016591chr5----152 --
NM_016603chr511754 ------
NM_016604chr521171 968 --1112 --
NM_016605chr522471 417 1252 ----
NM_016620chr11335 ------
NM_016631chr211298 ------
NM_016651chr143890 401 169 1448 ----
NM_016654chr1521245 1101 ------
NM_016824chr1011588 --11490 --
NM_016831chr122284 750 ------
NM_016834chr1743239 3128 1084 53 1505 1728 --
NM_016835chr1743239 3128 1084 53 1505 1728 --
NM_016836chr22533 521 1574 --1501
NM_016839chr22533 521 1574 --1501
NM_016841chr1743239 3128 1084 53 1505 1728 --
NM_016930chr43213 109 75 ------
NM_016936chr163749 443 300 ------
NM_016950chr42948 324 ------
NM_017409chr121252 ------
NM_017410chr1211136 ------
NM_017415chr524171 299 --1163 --
NM_017420chr1443278 3107 2453 597 --1583 --
NM_017447chr2164021 3476 1772 1027 906 272 ------
NM_017452chr2021204 509 ------
NM_017453chr2021204 509 ------
NM_017454chr2021204 509 ------
NM_017489chr811166 ------
NM_017491chr43873 673 659 ------
NM_017519chr61261 ------
NM_017522chr11921 ------
NM_017540chr552496 2263 2158 2075 787 --12297 --
NM_017548chr332168 788 229 ------
NM_017569chr131362 ------
NM_017590chr2222127 1830 12321 1863 --
NM_017629chr121515 443 ------
NM_017633chr653881 3572 3472 2998 716 ------
NM_017634chr81696 ------
NM_017635chr1111485 --1651 --
NM_017637chr968519 8012 6081 3297 1561 737 13756 59170 7316 2714 329 72 --
NM_017643chr1712605 ------
NM_017644chr334500 4380 3805 14284 ----
NM_017650chr745853 5528 2031 1185 1321 1383 11619
NM_017651chr631170 488 283 ----11335
NM_017657chr21762 --1924 --
NM_017658chr143845 826 803 ------
NM_017660chr1923246 2925 12313 --11318
NM_017661chr15254 25 ------
NM_017672chr1531025 458 448 ------
NM_017686chr12911 801 --1900 --
NM_017693chr13--11239 ----
NM_017697chr81373 ------
NM_017709chr144185 1369 208 170 ------
NM_017714chr201205 ------
NM_017719chr321984 1857 ------
NM_017734chr12585 117 ------
NM_017736chr1652620 2089 661 536 280 ------
NM_017737chr152017 1795 1568 543 412 ------
NM_017738chr92272 243 ------
NM_017742chr185633 588 492 262 38 ------
NM_017745chrX1498 --128 --
NM_017748chr172811 114 1175 ----
NM_017758chr173592 394 379 ------
NM_017763chr172221 32 1898 ----
NM_017769chr1452788 2315 2255 2007 829 ------
NM_017778chr81403 ------
NM_017791chr141399 --11520 --
NM_017798chr20----181 1848
NM_017813chr835018 1336 684 --25081 4209 --
NM_017831chr1844355 4106 1544 144 ------
NM_017845chr4----1709 --
NM_017848chrX64326 3850 1211 1012 798 720 11577 14420 --
NM_017849chr243141 3059 1210 420 13033 11288 --
NM_017851chr152826 810 --1996 --
NM_017873chr94687 417 379 297 --11072 --
NM_017880chr23455 360 136 ------
NM_017902chr1075741 3922 3865 2210 1743 1693 430 14577 31803 1526 262 11039
NM_017915chr122811 117 ------
NM_017919chr925459 3586 1136 12232 --
NM_017933chr21225 ------
NM_017938chrX3303 164 65 189 ----
NM_017944chr1162914 2206 890 670 153 72 --12664 --
NM_017969chr2190 ------
NM_018011chr131478 ------
NM_018014chr221085 384 ------
NM_018027chr1023295 1212 --12679 --
NM_018036chr1463799 3665 2733 1597 958 831 --22871 464 122
NM_018047chr51839 ------
NM_018061chr141588 1558 1277 1139 ------
NM_018084chr233065 2080 1280 ------
NM_018086chr231388 1351 277 ------
NM_018092chr1621229 526 ------
NM_018094chrX2363 356 ------
NM_018098chr31769 1967 ----
NM_018105chr81999 --1334 --
NM_018110chr1621000 63 ------
NM_018116chr1165 --1561 --
NM_018133chr331774 695 422 ------
NM_018137chr1--11108 ----
NM_018144chr101252 ------
NM_018156chr122705 2038 --22940 317 --
NM_018159chrX11592 11371 ----
NM_018171chr12----1937 --
NM_018178chr111532 --1285 --
NM_018182chr17------1102
NM_018184chr31443 ----11708
NM_018189chr34379 330 162 70 11136 ----
NM_018202chr13925 876 691 ------
NM_018211chr12832 344 --1227 --
NM_018225chr955109 4866 4563 3459 1802 ------
NM_018243chr414060 ------
NM_018254chr122191 54 ------
NM_018257chr20--2413 49 11953 --
NM_018293chr34742 661 552 365 143 ----
NM_018299chr823485 1157 ------
NM_018312chr1122088 1931 1387 ----
NM_018315chr421013 332 ------
NM_018318chr121970 ------
NM_018328chr22485 28 ------
NM_018364chr144043 4020 1287 1089 ------
NM_018375chr141358 ------
NM_018383chr211679 ------
NM_018387chr91529 ------
NM_018388chrX11099 ------
NM_018403chr353554 3533 3448 2721 644 11071 ----
NM_018424chr921406 408 ------
NM_018433chr21227 ------
NM_018440chr8117147 6513 5931 5674 3182 2568 1716 1525 775 199 39 --1993 --
NM_018442chr1184 ------
NM_018453chr141107 ------
NM_018462chr31138 ------
NM_018482chr862458 2372 1880 1845 1738 1591 --176 --
NM_018490chr1131877 1567 45 --21641 1285 --
NM_018492chr8122 ------
NM_018553chr1761772 1379 1273 659 543 502 ------
NM_018557chr221571 400 21250 297 ----
NM_018566chr164954 4085 3792 3624 499 170 ------
NM_018593chr61560 --1700 --
NM_018638chr1255715 4281 4002 1664 433 11813 ----
NM_018640chr123840 613 396 11031 ----
NM_018649chr102586 459 ------
NM_018650chr11624 ------
NM_018660chr812654 --22185 64 --
NM_018684chrX----21258 214 --
NM_018686chr12--1104 1307 --
NM_018691chr51154 ------
NM_018693chr2165 ------
NM_018695chr51895 ------
NM_018712chr112223 126 ------
NM_018715chr122250 1516 ------
NM_018834chr51776 ------
NM_018837chr202883 685 ------
NM_018840chr201149 --1135 --
NM_018841chr133925 3618 2520 ------
NM_018890chr711341 ------
NM_018947chr7105019 4940 4047 3071 1595 1155 983 975 954 566 23181 1821 13129 --
NM_018963chr211406 ------
NM_018970chr732610 1180 294 ------
NM_018976chr123944 899 44 11092 ----
NM_018977chrX11066 ------
NM_018979chr1272368 1697 1687 906 884 568 97 ------
NM_019000chr511495 ------
NM_019001chr343693 1906 1441 909 11735 ----
NM_019004chr752063 1871 931 865 679 ------
NM_019005chr7134 ------
NM_019006chr152547 94 ------
NM_019036chr61408 ------
NM_019045chrX1140 ------
NM_019049chr12258 214 ------
NM_019050chr411699 ------
NM_019084chr1032039 991 914 1783 ----
NM_019091chr221003 817 1385 ----
NM_019116chr1643444 3266 1165 298 ------
NM_019555chr321186 607 --11718 --
NM_019593chr2042843 2372 1954 752 ------
NM_019606chr7--125 ----
NM_019859chr103529 333 197 ------
NM_019885chr252015 1120 994 307 282 --11876 --
NM_019891chr1----11015 --
NM_019895chr32761 459 ------
NM_019903chr1011588 --11490 --
NM_020039chr1241889 1394 766 449 ------
NM_020066chr1----1884 --
NM_020116chr411553 ------
NM_020119chr733614 3345 1412 ------
NM_020122chr275831 5124 4648 4300 3757 1322 210 ------
NM_020141chr13823 562 78 ------
NM_020150chr1021894 1399 ------
NM_020154chr151234 ------
NM_020155chr111117 ------
NM_020156chr72423 175 ------
NM_020159chr4------11091
NM_020177chr521264 1152 ------
NM_020182chr2073098 2633 2620 2219 1181 644 545 ------
NM_020193chr111127 ------
NM_020198chr1731231 328 311 ------
NM_020199chr511212 ------
NM_020211chr151169 ----1264
NM_020235chr3--1350 ----
NM_020245chr664827 4130 3916 1945 1444 1055 23365 3137 ----
NM_020307chr3------155
NM_020310chr1732073 267 255 ----1307
NM_020319chr7----123 --
NM_020336chr2043460 3374 2509 1215 11439 ----
NM_020337chr41369 --12681 --
NM_020338chr1043443 3283 363 183 --22310 1116 --
NM_020340chr651591 1543 300 285 126 ------
NM_020342chr22427 242 ----12417
NM_020346chr111584 ------
NM_020354chr101774 ------
NM_020403chr131517 ------
NM_020405chr1764198 4048 3691 1653 1618 1195 ------
NM_020420chrY11605 ------
NM_020438chr911240 ------
NM_020443chr146201 5539 2783 2515 ------
NM_020449chrX1753 ------
NM_020640chr312028 ------
NM_020647chr8--1351 ----
NM_020686chr1643018 2739 2034 625 ------
NM_020699chr154084 1940 1835 675 84 ------
NM_020718chr1674973 4650 2407 1820 1252 1230 373 --12027 --
NM_020728chr723175 2611 --12065 11033
NM_020732chr61261 ------
NM_020734chr1211354 ------
NM_020739chr1544159 4001 3578 2993 ------
NM_020742chrX11953 1297 ----
NM_020755chr61112 ------
NM_020766chrX11091 12959 ----
NM_020769chrX1877 ------
NM_020772chr1778563 7077 6121 5313 2720 2543 337 1300 ----
NM_020774chr1875323 4820 4759 2130 2017 1023 812 ------
NM_020783chr1832370 1480 886 12030 1765 --
NM_020791chr1721422 522 --1100 --
NM_020794chr11111 ------
NM_020796chr552812 2613 2573 2094 589 --12259 --
NM_020800chr311389 ------
NM_020801chr511922 ------
NM_020802chr111325 ----1938
NM_020803chr462119 1877 1717 1561 1514 279 ------
NM_020819chr61148 ------
NM_020824chr101150 --1296 --
NM_020825chr1623662 3362 --11271 --
NM_020832chr13495 428 275 ------
NM_020839chr31283 --11603 --
NM_020841chr1273879 3546 3158 3017 2696 764 59 --1925 --
NM_020845chr1252494 2442 1709 687 148 --1585 --
NM_020851chr151242 11545 ----
NM_020856chr1931063 354 155 ------
NM_020861chr61447 --1899 --
NM_020866chr132782 746 ------
NM_020868chr231249 667 271 ------
NM_020919chr221005 90 ------
NM_020948chr111405 --13291 --
NM_020951chr1932334 876 726 1491 ----
NM_020964chr1864645 4397 4267 3110 3058 886 14679 13941 --
NM_020983chr1242205 1856 888 831 ------
NM_020987chr1041242 1039 260 99 ------
NM_021003chr141656 ------
NM_021007chr242126 1714 357 136 ------
NM_021012chr1752941 2537 2472 360 95 ----11016
NM_021033chr1313081 11011 ----
NM_021045chr1062617 2578 2375 1951 888 849 ------
NM_021069chr421353 211 21663 618 1462 --
NM_021083chrX43521 2923 2399 1211 ------
NM_021090chr2274772 4759 4626 4447 3119 1961 417 ----11822
NM_021096chr2273295 3076 2911 2433 1298 897 194 ------
NM_021101chr332268 1788 163 ------
NM_021148chr722440 2099 ------
NM_021159chr4--1179 --1689
NM_021183chrX32128 540 463 ------
NM_021184chr63595 568 34 155 1622 --
NM_021198chr261351 1092 1067 1035 210 113 11487 ----
NM_021202chr2022213 771 ------
NM_021238chr1221594 404 ------
NM_021240chr91213 ------
NM_021255chr1442813 434 397 373 --1403 1499
NM_021627chr311205 ------
NM_021637chrX21331 1020 --169 --
NM_021638chr444808 3576 427 142 --23883 3296 --
NM_021809chr2022290 1658 21967 684 ----
NM_021813chr695381 4950 4910 4701 4614 4543 3858 1587 671 ----13868
NM_021814chr621655 1642 1113 ----
NM_021818chr1431274 1015 968 1399 ----
NM_021871chr4127 ------
NM_021905chr61494 ----12306
NM_021911chr535608 4169 1992 ------
NM_021912chr1534010 3821 219 --2751 636 13743
NM_021940chr631503 1403 655 ------
NM_021952chr11140 ------
NM_021954chr1363657 3426 2372 1215 897 737 --12501 --
NM_021961chr1177510 5490 5266 4657 4540 2260 1956 --26070 5424 --
NM_021964chr355459 4804 4090 1392 480 ------
NM_021970chr41651 --121 --
NM_021984chrX2406 271 ------
NM_021987chrX2406 271 ------
NM_021990chrX2406 271 ------
NM_021998chrX21067 999 ------
NM_021999chr131184 ------
NM_022048chr1575394 5345 5059 4261 3949 3936 3925 --1155 --
NM_022049chr11408 ------
NM_022073chr1411609 ------
NM_022079chr102822 30 ------
NM_022166chr1645645 3950 2426 1075 1425 ----
NM_022351chr813279 ------
NM_022454chr8142 ------
NM_022459chr1365507 5283 1077 772 393 310 --11323 --
NM_022465chr1212665 ------
NM_022475chr41537 ------
NM_022476chr161121 ------
NM_022484chr7----1579 --
NM_022495chr141387 ------
NM_022497chr322463 517 --1450 --
NM_022644chr174476 443 373 165 ------
NM_022648chr244253 3905 723 27 23622 3500 14320 --
NM_022726chr6----11682 --
NM_022735chr131768 1465 383 11876 ----
NM_022739chr171993 ------
NM_022744chr1611037 ------
NM_022750chr71729 ------
NM_022756chr131094 1016 123 ------
NM_022758chr63921 520 455 --12740 --
NM_022763chr352464 1030 891 446 142 ------
NM_022770chr1611281 ------
NM_022776chr31507 --11353 --
NM_022781chr943269 2501 2024 451 ------
NM_022802chr1031429 1155 135 11102 ----
NM_022826chr22489 168 ------
NM_022827chr171180 ------
NM_022832chr412417 ------
NM_022841chr1542672 2649 2557 2330 ------
NM_022845chr1631758 1634 679 ------
NM_022893chr222636 2419 12472 ----
NM_022894chr221486 1221 ------
NM_022897chr52326 182 ------
NM_022912chr242892 993 690 167 1779 1353 --
NM_022913chr5--135 ----
NM_022918chr112513 96 ------
NM_022977chrX2606 193 ------
NM_023000chr14----1521 --
NM_023001chr14----1521 --
NM_023010chrX2775 565 --1713 --
NM_023016chr232175 1823 724 1450 ----
NM_023079chr1741690 1390 1360 368 ------
NM_023105chr842098 1636 585 447 ------
NM_023106chr842098 1636 585 447 ------
NM_023110chr842098 1636 585 447 ------
NM_023111chr842098 1636 585 447 ------
NM_023924chr52670 442 --1533 --
NM_023929chr81899 ------
NM_023943chr31160 ------
NM_024007chr542912 733 615 574 12367 ----
NM_024045chr10------128
NM_024050chr191597 1233 ----
NM_024052chr1762520 1213 1007 620 567 94 ------
NM_024060chr111247 ------
NM_024092chr1131210 946 27 ------
NM_024094chr81208 ------
NM_024117chr911089 ------
NM_024294chr63921 520 455 --12740 --
NM_024295chr8151 ----11484
NM_024348chr91325 ------
NM_024423chr1853826 3666 3044 2811 225 14282 ----
NM_024430chr1821829 34 1527 ----
NM_024503chr1137 ------
NM_024511chr463302 3252 2961 2754 886 176 ------
NM_024519chr161223 ------
NM_024551chr1242278 1874 1772 648 1437 ----
NM_024551chr1242278 1874 1772 648 1437 ----
NM_024556chr112468 60 ------
NM_024582chr41278 ------
NM_024607chr861722 1587 1555 526 305 192 ----14332
NM_024611chr1543436 2726 740 48 11473 ----
NM_024612chr1731135 1110 428 ------
NM_024617chr93804 572 88 ------
NM_024630chr63598 572 288 ------
NM_024643chr142135 126 ------
NM_024645chr811324 1387 ----
NM_024646chr141339 1125 705 249 1476 ----
NM_024659chr2163 ------
NM_024665chr324084 144 ------
NM_024670chr1021084 213 ------
NM_024686chr11377 ------
NM_024692chr231460 709 344 ------
NM_024700chr121062 999 ------
NM_024704chr203258 161 35 ------
NM_024721chr83962 893 693 --22193 2125 --
NM_024740chr1153860 2822 1496 1458 927 ------
NM_024761chr934964 1986 891 13344 ----
NM_024783chr11----1383 --
NM_024824chr1421570 687 ------
NM_024845chr1661659 1647 1420 1365 1116 147 --1324 --
NM_024909chr621587 335 11605 ----
NM_024920chr4--11072 ----
NM_024941chr511454 ------
NM_024944chr21----21073 389 --
NM_024947chr397603 6835 6108 3670 3536 2846 1423 1185 480 17360 ----
NM_024948chr101138 ------
NM_024949chr433783 3147 1273 14555 24398 3060 1473
NM_024953chr122953 734 --11937 --
NM_024989chr248060 7817 6776 5706 ------
NM_024991chr103818 620 196 ------
NM_025054chr854108 1052 782 149 134 ------
NM_025134chr1621622 76 ------
NM_025146chr332086 1024 419 ------
NM_025151chr822179 1990 ------
NM_025154chr731499 1152 101 ------
NM_025160chr123723 828 ------
NM_025164chr1131772 1418 863 ------
NM_025182chr91676 ------
NM_025191chr11643 12826 ----
NM_025221chr421350 337 ------
NM_025235chr1032214 1981 178 ------
NM_025248chr1762793 2682 2644 2208 1240 135 --12833 --
NM_030625chr102382 36 ------
NM_030627chr553816 3436 2852 2790 1333 ------
NM_030647chr735678 4017 471 ------
NM_030648chr4105487 4434 4316 4145 2092 1826 973 901 386 366 --1636 --
NM_030660chr1431341 533 261 ------
NM_030664chr10----11675 --
NM_030674chr1285820 5655 4393 4256 3705 3617 2289 1277 ------
NM_030784chr61124 ------
NM_030790chr162267 220 ------
NM_030791chr1431457 1350 144 ------
NM_030801chrX1180 ------
NM_030806chr1108920 8580 7691 7395 7117 3171 2085 803 491 150 1699 36861 6462 2889 --
NM_030817chr1221336 1284 13676 ----
NM_030881chr2232305 973 908 ------
NM_030920chr132131 1347 125 ------
NM_030927chr1021511 109 11604 1610 --
NM_030935chr71363 ------
NM_030939chr611157 ------
NM_030945chr531859 719 479 ------
NM_030964chr553462 2765 2498 686 24 ------
NM_030965chr12545 158 ------
NM_031243chr731677 634 457 ------
NM_031263chr9--131 1435 --
NM_031266chr52555 344 ------
NM_031267chr71493 ------
NM_031314chr1421365 456 ------
NM_031371chr111410 ------
NM_031371chr111410 ------
NM_031438chr531950 598 341 ------
NM_031442chrX32901 2196 784 ------
NM_031445chr253343 2589 2311 2118 868 ------
NM_031459chr121612 1171 --11435 --
NM_031461chr81377 ------
NM_031468chr757262 6471 2885 1581 213 16895 12698 --
NM_031476chr162671 123 ----11931
NM_031844chr154040 3945 3814 1140 872 ------
NM_031935chr11965 ------
NM_031954chr1242828 2712 1100 644 22752 298 1975 --
NM_031964chr171103 ------
NM_032012chr995020 4456 4157 3630 3392 1242 1002 917 468 ------
NM_032042chr522482 1865 ------
NM_032047chr342281 2192 1944 1669 ------
NM_032105chr1107142 7134 7103 6336 5751 2037 1988 1893 1174 532 ------
NM_032121chrX2622 158 22658 905 ----
NM_032124chr1841065 787 101 75 ------
NM_032128chr42913 740 ------
NM_032147chr122765 98 ------
NM_032154chr102723 404 ------
NM_032182chr10--1237 1183 11548
NM_032186chr11335 ------
NM_032189chr1344371 4247 598 393 24579 731 --11292
NM_032195chr211417 ------
NM_032199chr1043476 3289 2877 852 --12619 --
NM_032208chr222384 2346 --12493 12809
NM_032217chr421249 114 ------
NM_032228chr1132460 1389 382 1120 ----
NM_032233chr14------1834
NM_032246chr1541041 450 423 22 ------
NM_032289chr531729 1577 557 --11355 --
NM_032291chr121639 525 ------
NM_032320chr111128 1631 ----
NM_032352chr1411315 --11485 --
NM_032353chr17171 ------
NM_032373chr1055170 4807 3681 539 238 ------
NM_032410chr8--11240 ----
NM_032413chr15----186 --
NM_032421chr722043 113 1213 ----
NM_032439chr101483 ------
NM_032440chr1021074 645 ------
NM_032441chrX31071 409 109 ------
NM_032445chr1522083 684 --128 --
NM_032446chr543791 3258 3049 874 13557 ----
NM_032457chr442449 1508 1281 973 --13690 --
NM_032458chrX32831 2630 954 ------
NM_032491chr12--1897 --11240
NM_032505chr342687 2353 2159 21 ------
NM_032594chr141989 ------
NM_032632chr141689 ------
NM_032682chr32287 156 ------
NM_032689chr191565 ------
NM_032711chr1763731 3567 2880 2629 1151 379 --22687 657 --
NM_032778chr333004 1333 1182 --1250 --
NM_032801chr1152315 2119 1984 535 236 ------
NM_032810chr1021010 109 ------
NM_032826chr773800 2088 1291 721 590 101 28 --24596 4236 --
NM_032837chr1722163 1972 ------
NM_032859chr1333696 1175 74 12687 --1217
NM_032870chr61470 ------
NM_032871chr11--21511 1376 11817 --
NM_032873chr1183538 3348 3029 2841 2813 558 368 41 ------
NM_032875chr172126 90 ------
NM_032876chr14----1606 --
NM_032906chr42551 258 ------
NM_032949chr13173 ------
NM_032961chr411317 --1247 --
NM_032968chrX23250 3115 ------
NM_032969chrX23250 3115 ------
NM_032973chrY23245 3110 ------
NM_032975chr1843081 1106 245 214 ------
NM_032978chr181122 ------
NM_032979chr181122 ------
NM_032980chr1843081 1106 245 214 ------
NM_032981chr181122 ------
NM_033020chr134280 3169 506 ------
NM_033023chr741106 994 155 75 --190 --
NM_033029chr31130 1379 ----
NM_033055chr1191 ----1807
NM_033081chr2011361 11009 ----
NM_033082chr12134 ------
NM_033089chr202562 436 --11104 --
NM_033117chr91293 ------
NM_033181chr642445 2430 1336 458 11077 ----
NM_033211chr52792 672 ------
NM_033224chr757470 7067 6174 5785 1312 --11078 --
NM_033225chr842521 1122 663 380 22896 2135 ----
NM_033259chr31919 ------
NM_033260chr62804 33 1727 ----
NM_033274chr542901 2366 664 160 1958 ----
NM_033285chr872756 2724 1344 978 776 254 127 ------
NM_033300chr11921 ------
NM_033315chr1742147 817 240 228 ------
NM_033326chr111749 1137 1791 --
NM_033331chr953038 2959 2669 2205 1444 --12858 --
NM_033360chr1254257 3319 1849 1195 110 ----14466
NM_033389chr1744269 3718 3370 833 --2891 153 --
NM_033420chr1941189 962 919 424 ------
NM_033425chr1132667 2180 244 ------
NM_033429chr1552532 2297 1111 557 496 ------
NM_033430chr431598 648 515 1764 ----
NM_033437chr431598 648 515 1764 ----
NM_033480chr611962 1472 ----
NM_033481chr611962 1472 ----
NM_033495chrX1670 ------
NM_033550chr2041487 862 481 370 ------
NM_033631chr123312 1244 --13139 --
NM_033632chr421013 332 ------
NM_033637chr10104129 4088 3947 3775 3474 3389 1026 474 467 218 ------
NM_033644chr532497 940 850 --11743 --
NM_033645chr532497 940 850 --11743 --
NM_033656chr2135471 1258 893 25150 4976 ----
NM_052851chr1332204 68 56 11616 ----
NM_052855chr17--1526 140 --
NM_052874chr161507 ------
NM_052875chr1162077 2051 1471 1436 701 679 11617 ----
NM_052879chr1253463 1338 1209 779 536 ------
NM_052885chr1244949 1776 841 350 ------
NM_052898chr811396 ------
NM_052900chr831803 1360 54 ------
NM_052904chr63231 183 74 ------
NM_052911chr182935 360 ------
NM_052918chr1043046 2706 2417 394 ------
NM_052923chr6--162 ----
NM_052932chr113726 422 132 ------
NM_052998chr11139 ------
NM_053002chr331036 903 263 ------
NM_053023chr1121157 1083 ------
NM_053024chr311169 ------
NM_053025chr331794 1379 218 1104 ----
NM_053026chr331794 1379 218 1104 ----
NM_053027chr331794 1379 218 1104 ----
NM_053028chr331794 1379 218 1104 ----
NM_053031chr331794 1379 218 1104 ----
NM_053032chr331794 1379 218 1104 ----
NM_053043chr786170 5978 4283 3995 3982 2119 2044 421 25384 2206 15898 --
NM_053281chrX1325 ------
NM_054014chr201355 ------
NM_054016chr111376 --1820 --
NM_054016chr111376 --1820 --
NM_054016chr111376 --1820 --
NM_054033chr2----1232 --
NM_057175chr421811 1008 12692 ----
NM_057178chr1732682 754 25 ------
NM_057180chr121307 ------
NM_057749chr84953 445 302 89 1879 ----
NM_078469chr1041420 1271 528 343 ------
NM_078476chr631896 1513 444 1275 157 --
NM_078481chr191570 ------
NM_080599chr101412 ------
NM_080607chr201326 ------
NM_080617chr2011037 1399 ----
NM_080629chr1----2939 364 --
NM_080630chr1----2939 364 --
NM_080632chrX2775 565 --1713 --
NM_080645chr631919 1434 23 ------
NM_080669chr1753078 1544 974 463 118 ------
NM_080670chr53882 592 198 ------
NM_080671chr211899 --21992 94 --
NM_080672chr201380 1218 ----
NM_080679chr62735 355 ------
NM_080680chr62735 355 ------
NM_080681chr62735 355 ------
NM_080717chr1231443 1151 369 11466 ----
NM_080759chr1311059 ------
NM_080760chr1311059 ------
NM_080872chr833953 3196 1158 ------
NM_130385chr1151064 727 611 84 23 --1794 --
NM_130391chr953622 2816 2398 1293 1239 --1944 --
NM_130392chr953622 2816 2398 1293 1239 --1944 --
NM_130393chr953622 2816 2398 1293 1239 --1944 --
NM_130438chr2112109 ------
NM_130439chr1032224 1647 23 12037 ----
NM_130439chr1032224 1647 23 12037 ----
NM_130797chr731292 1212 432 --1473 --
NM_130811chr20----1933 --
NM_130838chr15------1550
NM_130839chr15------1550
NM_130847chr1185162 4735 4107 3856 3773 1374 1292 455 1491 25742 5613 --
NM_133265chrX32810 420 375 ------
NM_133334chr496313 6015 5796 4728 2529 2467 2404 2269 2152 ------
NM_133367chr642979 2168 757 134 ------
NM_133372chr542469 1944 350 322 11863 ----
NM_133465chr91295 ------
NM_133494chr11108 ------
NM_133496chr143795 3636 3330 1396 ------
NM_133646chr265511 3718 3632 3403 3381 833 15299 13755 --
NM_133647chr1531083 700 636 ------
NM_138286chr1943552 3467 3027 2779 23671 90 ----
NM_138328chr1743265 2488 2098 877 ------
NM_138333chr93782 225 191 ------
NM_138340chr18162 ------
NM_138357chr1031700 674 661 ------
NM_138375chr181449 1365 1896 --
NM_138423chr1512150 ------
NM_138455chr8--1134 ----
NM_138457chr642230 2185 1150 769 ----1148
NM_138459chr633432 2548 160 ------
NM_138462chr91173 ------
NM_138468chr246048 4657 1364 1295 ----14752
NM_138473chr1284560 4259 3612 3259 1678 1561 1465 185 ------
NM_138479chr131761 1416 406 ------
NM_138558chr111226 ------
NM_138559chr221075 374 ------
NM_138643chr18155 ------
NM_138644chr18155 ------
NM_138713chr1686740 6694 6516 2649 2566 1466 1194 1054 ------
NM_138714chr1686740 6694 6516 2649 2566 1466 1194 1054 ------
NM_138717chr62614 546 ------
NM_138731chr1433621 491 373 ------
NM_138735chr22995 235 ------
NM_138795chr11610 ----1111
NM_138927chr21----1418 --
NM_138931chr35833 728 683 115 96 ------
NM_138966chr181451 --1497 --
NM_138967chr151273 ----11633
NM_138969chr83896 517 39 ------
NM_138970chr1422256 1809 11514 1567 --
NM_139035chrX1226 ------
NM_139045chr91138 ------
NM_139057chr1542650 652 353 153 ------
NM_139068chr51540 ------
NM_139069chr51540 ------
NM_139070chr51409 ------
NM_139072chr22802 243 ------
NM_139076chr41152 ------
NM_139136chr121271 ------
NM_139156chr13873 847 295 --1762 --
NM_139167chr8------1129
NM_139168chr521907 710 --1800 --
NM_139207chr1222154 1814 ------
NM_139244chr61370 --1766 --
NM_139245chr341649 401 235 77 ------
NM_139280chr1721285 488 11440 1462 --
NM_139321chr2043341 2757 619 271 --197 --
NM_139323chr2031520 586 31 ------
NM_144571chr456759 6004 5680 1041 309 ------
NM_144576chr121535 ----1648
NM_144578chr1455405 4452 3711 1667 571 11086 12206 11315
NM_144586chr231192 1084 334 ------
NM_144599chr1575123 4651 3815 3572 2136 1729 661 ------
NM_144728chr13848 739 696 ------
NM_144729chr13848 739 696 ------
NM_144767chr1543769 3308 1113 515 --14551 --
NM_144775chr1743913 3763 3708 3099 1745 ----
NM_144778chr1342684 1772 625 162 ------
NM_144949chr231006 523 85 ----1363
NM_144963chr822567 100 ------
NM_144968chrX2199 147 ------
NM_145049chr5183 ------
NM_145055chr1812596 13596 ----
NM_145166chr372822 1907 990 874 627 609 91 ------
NM_145176chr642577 903 99 32 --1475 --
NM_145185chr1931966 1793 1764 --1573 --
NM_145206chr1012407 ----1944
NM_145251chr14--127 ----
NM_145259chr255721 4901 4690 2015 790 ------
NM_145284chrX52554 1888 906 650 278 ------
NM_145307chr1012985 14355 23974 213 --
NM_145313chr1031553 413 392 --11362 --
NM_145320chr723327 2611 --1157 --
NM_145321chr723327 2611 --1157 --
NM_145322chr723327 2611 --1157 --
NM_145341chr101336 ------
NM_145686chr253361 3087 2090 1310 482 ------
NM_145687chr253361 3087 2090 1310 482 ------
NM_145690chr831575 1275 304 ------
NM_145735chr1332307 1780 290 ------
NM_145800chrX2851 799 ------
NM_145802chrX2800 748 ------
NM_145808chr742998 2898 1905 1213 11174 12696 --
NM_147150chr923600 241 --11167 --
NM_147175chrX21807 160 11584 ----
NM_147181chr421350 337 ------
NM_147182chr421350 337 ------
NM_147183chr421350 337 ------
NM_148174chr81694 --167 1421
NM_148571chr17----21405 434 --
NM_148894chr4----11164 --
NM_152221chr22124 ------
NM_152222chr11--21511 1376 11817 --
NM_152253chr2233218 1460 689 ------
NM_152267chr2251883 1749 1663 653 484 ------
NM_152271chr84981 345 299 85 ------
NM_152275chr22762 180 ------
NM_152282chr311383 ------
NM_152283chr52176 96 ------
NM_152300chr1721482 768 1475 ----
NM_152305chr322067 1829 ------
NM_152330chr1452058 1668 766 648 292 ------
NM_152342chr16167 ------
NM_152380chr12324 85 ------
NM_152388chr211598 ----13379
NM_152400chr421684 828 ------
NM_152407chr512946 ----1210
NM_152409chr573622 3604 3071 2820 2629 772 631 ------
NM_152414chr82416 342 ------
NM_152455chr1532687 2657 255 ------
NM_152470chr1851432 1155 758 748 247 ------
NM_152478chr191472 ------
NM_152520chr21451 ------
NM_152538chr321213 137 ------
NM_152556chr752230 2062 638 331 276 ------
NM_152557chr741419 1329 539 383 ------
NM_152588chr1231889 582 75 1441 ----
NM_152589chr121220 ------
NM_152594chr1522210 1473 ------
NM_152599chr17124 ------
NM_152609chr11447 ------
NM_152622chr512738 ------
NM_152624chr5107104 5836 5534 5210 4540 2914 2585 2321 1149 213 12839 11573 --
NM_152629chr942788 1038 561 489 ------
NM_152641chr1232749 1822 1174 ------
NM_152647chr151116 ------
NM_152653chr32459 291 ------
NM_152660chr11340 ------
NM_152678chr352674 2545 465 311 167 ------
NM_152695chrX22000 700 ------
NM_152721chr181755 ------
NM_152734chr665250 4775 4617 4578 3811 1783 ----14515
NM_152738chr61374 ------
NM_152739chr71265 ------
NM_152744chr753339 3296 992 662 568 --1520 --
NM_152748chr7--1364 ----
NM_152756chr533580 1070 443 ------
NM_152758chr822101 975 ------
NM_152765chr831701 918 360 ------
NM_152774chr712257 ------
NM_152787chrX11319 13068 --21105 695
NM_152838chr2053070 2963 2414 2340 1326 ------
NM_152924chr1552421 2397 1897 1390 504 --14931 1887
NM_152991chr113561 217 86 ------
NM_152994chr21135 ------
NM_152999chr744024 3810 1601 1393 ------
NM_153013chr532459 405 340 ------
NM_153020chr611638 ------
NM_153029chr16114136 3946 2997 2897 2823 2733 1341 1165 563 456 109 --23662 712 --
NM_153047chr63313 298 280 ------
NM_153048chr63313 298 280 ------
NM_153050chr2274772 4759 4626 4447 3119 1961 417 ----11822
NM_153051chr2274772 4759 4626 4447 3119 1961 417 ----11822
NM_153181chr181451 --1497 --
NM_153182chr333004 1333 1182 --1250 --
NM_153184chr32249 137 ------
NM_153188chr555048 4886 4508 2235 1776 ----11218
NM_153207chr1233578 1218 441 ------
NM_153223chr53620 513 235 ------
NM_153226chr101381 1918 1841 --
NM_153262chr111292 1872 ----
NM_153321chr171445 ------
NM_153322chr171445 ------
NM_153331chr3------181
NM_153365chr442307 1012 942 786 ------
NM_153426chr41188 ------
NM_153427chr41188 ------
NM_153456chr1346093 5918 4492 2450 ------
NM_153464chr191281 ------
NM_153498chr101313 ------
NM_153607chr522539 2299 ------
NM_153634chr1221610 1050 ------
NM_153649chr122081 920 --12284 --
NM_153686chr432352 1507 790 ------
NM_153693chr121665 ------
NM_153712chr283409 3349 2755 1237 1106 339 314 208 ------
NM_153746chr63598 572 288 ------
NM_153748chr121271 ------
NM_153757chr43996 438 398 ------
NM_153769chr18155 ------
NM_153810chr1034691 3367 1165 11082 ----
NM_153827chr17--1675 ----
NM_170662chr3155 ------
NM_170663chr17--1675 ----
NM_170665chr1274380 3629 3249 3196 2924 1096 270 --11257 --
NM_170706chr141352 1321 536 134 14056 11001 --
NM_170709chr8197 ------
NM_170712chr34671 487 96 49 165 ----
NM_170713chr34671 487 96 49 165 ----
NM_170714chr34671 487 96 49 165 ----
NM_170751chr6----11318 --
NM_170752chr6----11318 --
NM_170768chr1111617 ------
NM_171999chr181758 ------
NM_172037chr82426 62 ----1263
NM_172070chr211698 ------
NM_172071chr187128 4825 4792 4753 2944 893 782 402 ------
NM_172193chr1411346 ------
NM_172240chr1211163 11285 ----
NM_173079chr1731717 1553 723 ------
NM_173083chr121245 911 --1406 --
NM_173156chr141922 1544 171 152 --2743 535 --
NM_173177chr2--1518 ----
NM_173191chr102251 23 --11007 --
NM_173192chr102251 23 --11007 --
NM_173193chr102251 23 --11007 --
NM_173194chr102251 23 --11007 --
NM_173195chr102251 23 --11007 --
NM_173198chr912943 11170 --12817
NM_173200chr912943 11170 --12817
NM_173214chr1686740 6694 6516 2649 2566 1466 1194 1054 ------
NM_173354chr2152036 2004 1514 1422 277 ------
NM_173468chr445699 5598 5377 2389 --145 --
NM_173470chrX32619 1887 175 ------
NM_173475chr163544 475 420 ------
NM_173491chr521142 386 ------
NM_173495chrX----12295 --
NM_173500chr15193 ------
NM_173505chr1821136 75 ------
NM_173531chr1933782 2697 183 ----1338
NM_173536chr435144 4872 3520 ------
NM_173552chr321793 537 12065 ----
NM_173560chr6--1540 ----
NM_173564chr71734 --1683 --
NM_173595chr1245121 3628 1440 1400 ----11169
NM_173602chr1273760 3075 2756 2452 2401 949 547 --12315 --
NM_173631chr1911319 ------
NM_173642chr158225 7523 6033 3204 425 ------
NM_173647chr211070 --1231 --
NM_173698chrX1533 ------
NM_173797chr521129 1079 ------
NM_173808chr131303 1112 106 ------
NM_173809chr1011249 ------
NM_173812chr1211015 --1488 --
NM_173814chr15--151 ----
NM_173829chr565256 4786 4458 4264 1373 1248 ----14520
NM_173848chr82816 754 ------
NM_174890chr10----1566 --
NM_174902chr11----11277 --
NM_175056chr3167 12095 ----
NM_175061chr741844 1694 869 861 ------
NM_175085chr21126 ------
NM_175566chr112433 335 ------
NM_175607chr311662 ------
NM_175610chr151471 ------
NM_175611chr21176 ------
NM_175612chr311662 ------
NM_175624chr1236252 2550 1425 26725 5237 ----
NM_175625chr1236252 2550 1425 26725 5237 ----
NM_175736chr1267855 6451 6016 5351 2622 1085 ------
NM_175768chr621475 56 ------
NM_175852chr142411 897 828 652 --12143 --
NM_175854chr13----12710 --
NM_175863chr61261 ------
NM_175876chr122282 660 ------
NM_175907chr1822830 792 --11773 --
NM_176801chr411855 --1519 --
NM_176814chr721320 584 ------
NM_176823chr173800 2561 1026 983 969 593 544 13729 31223 930 415 --
NM_177398chr121579 412 ----1499
NM_177399chr121579 412 ----1499
NM_177535chrX1180 ------
NM_177536chr16134 ------
NM_177559chr2011224 ------
NM_177560chr2011224 ------
NM_177949chrX1126 --152 --
NM_177952chr141656 ------
NM_177966chr3----11411 --
NM_177968chr2------11721
NM_177974chr1512150 ------
NM_177996chr2043382 2773 1135 983 ------
NM_178006chr1332204 68 56 11616 ----
NM_178007chr1332204 68 56 11616 ----
NM_178011chr1032925 1060 984 ------
NM_178123chr21943 ------
NM_178126chr1722134 220 ------
NM_178140chr532332 1886 236 ------
NM_178151chrX27480 2046 ------
NM_178152chrX27480 2046 ------
NM_178153chrX27480 2046 ------
NM_178234chr8----1230 --
NM_178426chr11636 ------
NM_178427chr11536 ------
NM_178502chr12------1193
NM_178507chr111749 ------
NM_178517chr17186 --1685 --
NM_178565chr821688 1479 --1236 --
NM_178578chr2032352 1062 324 --1218 --
NM_178585chr463172 2982 2697 2114 895 792 --1715 --
NM_178586chr1432332 369 228 --11978 --
NM_178812chr831199 995 284 ------
NM_178815chr1032493 2262 2253 ------
NM_178818chr162842 403 ----11605
NM_180989chr131416 ------
NM_181050chr161104 ------
NM_181077chr153719 703 490 --1685 --
NM_181332chrX11953 1297 ----
NM_181351chr1132754 723 555 12709 ----
NM_181354chr8187 ------
NM_181358chr173462 3383 1628 1498 1387 1369 173 --23072 1585 --
NM_181442chr201862 ----160
NM_181443chr2042866 2159 435 93 --22762 2131 --
NM_181457chr221118 172 ------
NM_181458chr221251 305 ------
NM_181459chr221017 71 ------
NM_181481chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_181482chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_181483chr1875401 1385 985 963 803 216 78 25233 4317 11874 --
NM_181486chr1231443 1151 369 11466 ----
NM_181504chr544106 2856 2689 1103 --13326 11471
NM_181523chr544106 2856 2689 1103 --13326 11471
NM_181524chr544106 2856 2689 1103 --13326 11471
NM_181552chr71918 ------
NM_181659chr2032905 1157 946 ------
NM_181659chr2032905 1157 946 ------
NM_181672chrX41643 1628 604 291 ------
NM_181673chrX41643 1628 604 291 ------
NM_181702chr82780 350 ------
NM_181704chr212369 324 --21442 192 --
NM_181714chr641221 725 446 265 ------
NM_181784chr231909 975 236 --22272 1746 --
NM_181787chr833478 3318 3167 ------
NM_181838chr52222 142 1594 ----
NM_181839chr8--11207 ----
NM_181844chr17--1414 ----
NM_181864chr12215 54 ------
NM_181865chr12215 54 ------
NM_181866chr12215 54 ------
NM_181897chr31111 ------
NM_182314chrX2503 296 ------
NM_182484chr212369 324 --21442 192 --
NM_182485chr433040 2978 470 ------
NM_182509chr1411421 ------
NM_182515chr1975390 5316 4938 4470 1152 619 192 ------
NM_182551chr263199 3142 2672 2620 2175 753 ------
NM_182557chr111759 --1186 --
NM_182580chr142353 2207 1980 1851 --11747 1374
NM_182643chr841553 1472 514 334 1460 1366 --
NM_182646chr433040 2978 470 ------
NM_182663chr122182 1476 --12208 --
NM_182664chr122312 1606 --12338 --
NM_182665chr122182 1476 --12208 --
NM_182666chr31505 ------
NM_182678chr2------125
NM_182756chr21409 ------
NM_182758chr1523180 1459 11434 ----
NM_182762chr765835 1412 1274 1130 449 356 ------
NM_182763chr112753 ------
NM_182765chr1022053 592 ------
NM_182767chr121400 ----11668
NM_182797chr2041246 1198 611 393 ------
NM_182898chr734499 2109 1236 11390 ----
NM_182899chr734499 2109 1236 11390 ----
NM_182918chr211255 ------
NM_182948chr152745 2154 347 310 37 1715 ----
NM_182970chr2043856 3499 3090 1347 ------
NM_182972chr142646 2368 1839 1005 ------
NM_182975chr11889 ------
NM_183075chr41308 --12606 --
NM_183078chr643498 2653 863 304 ------
NM_183238chr1273635 2851 2765 2728 1151 1107 182 1536 ----
NM_183243chr7146 ------
NM_183243chr7146 ------
NM_183244chr201380 1218 ----
NM_183246chr201380 1218 ----
NM_183353chrX2930 852 ------
NM_183416chr132074 259 49 ------
NM_184231chr3----141 --
NM_184234chr20----2774 164 --
NM_194247chr231794 1481 792 --14284 --
NM_194278chr1433326 1432 44 --2443 323 13059
NM_194314chr165375 5292 4466 4232 3870 235 14096 ----
NM_194328chr943269 2501 2024 451 ------
NM_194329chr943269 2501 2024 451 ------
NM_194330chr943269 2501 2024 451 ------
NM_194332chr943269 2501 2024 451 ------
NM_194356chr121428 1544 122 1362
NM_194434chr1855232 4705 2046 1290 462 --13832 --
NM_194439chr411257 11111 1256 --
NM_194449chr182904 748 ------
NM_197941chr552324 1171 1155 731 692 ------
NM_197955chr15----186 --
NM_197956chr941878 1674 785 593 1471 21955 623 --
NM_197962chr1132 ------
NM_197968chr131117 ------
NM_198057chrX11012 ------
NM_198086chr14----1606 --
NM_198123chr831803 1360 54 ------
NM_198124chr831803 1360 54 ------
NM_198129chr181408 ------
NM_198158chr322495 227 1726 ----
NM_198159chr322495 227 1726 ----
NM_198177chr322495 227 1726 ----
NM_198178chr322495 227 1726 ----
NM_198195chr31585 ------
NM_198215chr1021011 227 ------
NM_198220chr202140 46 ------
NM_198225chr1021249 812 11266 ----
NM_198243chr152777 747 ------
NM_198252chr93239 201 36 ------
NM_198268chr173462 3383 1628 1498 1387 1369 173 --23072 1585 --
NM_198269chr173462 3383 1628 1498 1387 1369 173 --23072 1585 --
NM_198270chrX33495 3201 907 12431 ----
NM_198279chrX11135 ------
NM_198291chr2031872 1694 749 --11444 --
NM_198321chr552496 2263 2158 2075 787 --12297 --
NM_198353chr4153 ----190
NM_198399chr331721 1193 70 --11605 --
NM_198402chr31147 ------
NM_198465chrX22392 1850 ----1883
NM_198467chr73594 582 140 1439 ----
NM_198549chr122832 30 --12004 --
NM_198560chr363807 3725 3044 2497 1533 1182 ----13483
NM_198581chr241899 1361 1256 1078 ------
NM_198595chr444808 3576 427 142 --23883 3296 --
NM_198597chr101403 ------
NM_198793chr343703 2716 929 643 ------
NM_198829chr711341 ------
NM_198859chr333353 1642 1303 13160 ----
NM_198889chr421249 114 ------
NM_198892chr4--149 ----
NM_198896chr1142183 1518 631 185 ----176
NM_198900chr1267855 6451 6016 5351 2622 1085 ------
NM_198902chr151270 1658 ----
NM_198903chr51578 ------
NM_198904chr521828 578 ------
NM_198995chr18170 ------
NM_199169chr2073098 2633 2620 2219 1181 644 545 ------
NM_199170chr2073098 2633 2620 2219 1181 644 545 ------
NM_199171chr2073098 2633 2620 2219 1181 644 545 ------
NM_199188chr1253463 1338 1209 779 536 ------
NM_199189chr51776 ------
NM_199190chr1253463 1338 1209 779 536 ------
NM_199328chr21--1759 ----
NM_199330chr151612 ------
NM_199331chr151612 ------
NM_199332chr151612 ------
NM_199334chr17----1224 --
NM_199368chr20----138 --
NM_199440chr22339 59 ------
NM_199462chr144784 4756 1599 583 --1590 --
NM_199482chr221732 1478 --1189 --
NM_201266chr242248 1926 1133 816 ------
NM_201269chr11335 ------
NM_201279chr242248 1926 1133 816 ------
NM_201413chr211277 ------
NM_201414chr211277 ------
NM_201428chr11191 1442 ----
NM_201429chr11191 1442 ----
NM_201535chr142580 535 --1655 --
NM_201536chr142580 535 --1655 --
NM_201537chr142580 535 --1655 --
NM_201538chr142580 535 --1655 --
NM_201539chr142580 535 --1655 --
NM_201540chr142580 535 --1655 --
NM_201541chr142580 535 --1655 --
NM_201568chr141922 1544 171 152 --2743 535 --
NM_201569chr141922 1544 171 152 --2743 535 --
NM_201591chr421423 1366 ------
NM_201592chr421423 1366 ------
NM_201624chr131050 522 224 ------
NM_201647chr2147 ------
NM_201995chr11----2773 575 --
NM_201998chr11----2838 640 --
NM_201999chr411005 ------
NM_203301chr1411368 21575 75 11593 --
NM_203304chr191144 ------
NM_203329chr1196686 6232 4836 4682 4522 2078 1489 1384 794 --16058 16320
NM_203330chr1196686 6232 4836 4682 4522 2078 1489 1384 794 --16058 16320
NM_203331chr1196686 6232 4836 4682 4522 2078 1489 1384 794 --16058 16320
NM_203341chr12976 36 ------
NM_203342chr11934 --22813 2223 --
NM_203343chr11934 --22813 2223 --
NM_203351chr1762494 2478 1924 1646 936 228 --1269 --
NM_203372chr241573 1523 1319 601 ------
NM_203394chr121508 ------
NM_203399chr1167 --1601 --
NM_203401chr1167 --1601 --
NM_203404chr13873 847 295 --1762 --
NM_203417chr2121170 430 ------
NM_203418chr2121170 430 ------
NM_203437chr21762 --1924 --
NM_203458chr152938 2443 2398 1459 414 11241 ----
NM_203459chr142605 2499 2338 750 ------
NM_203463chr281544 1322 1000 914 765 483 433 138 ------
NM_203464chr121068 51 --1263 --
NM_203487chr131517 ------
NM_203504chr41383 11642 ----
NM_203505chr41383 11642 ----
NM_203506chr1732195 548 297 11623 ----
NM_205768chr121487 658 ------
NM_206594chr122406 695 12490 ----
NM_206595chr122406 695 12490 ----
NM_206839chr151212 ------
NM_206853chr644023 3948 2510 754 ------
NM_206854chr665284 5209 3771 3640 2015 1128 ------
NM_206855chr656249 6174 4736 4605 2093 ------
NM_206866chr2122513 1992 ------
NM_206876chr232822 2370 65 ------
NM_206907chr543151 2574 1117 518 ------
NM_206909chr855627 5601 3116 507 112 ------
NM_206943chr22613 261 ------
NM_207012chr1033519 3443 2871 ------
NM_207042chr11615 --1456 --
NM_207045chr11615 --1456 --
NM_207046chr11615 --1456 --
NM_207123chr41639 ------
NM_207303chr1044100 3819 3508 653 ------
NM_207304chr1342571 1659 512 49 ------
NM_207337chr1211035 ------
NM_207356chr12551 142 ------
NM_207372chr1022105 336 --1299 --
NM_207397chr11691 ------
NM_207481chr231363 1014 910 1930 ----
NM_207647chr952484 2024 1980 1945 246 ------
NM_207660chr1421570 687 ------
NM_207661chr1421570 687 ------
NM_207662chr1421570 687 ------
NM_212460chr721934 179 ------
NM_212471chr173798 343 250 ------
NM_212472chr173798 343 250 ------
NM_213589chr255543 4426 1387 803 632 --1173 --
NM_213594chr12--1897 --11240
NM_213609chr31943 --1136 --
NM_213611chr123463 86 45 ------
NM_213622chr2147 ------