TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-107
miRNA Sequence: AGCAGCAUUGUACAGGGCUAUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511258 ------
NM_000020chr122188 104 11892 ----
NM_000021chr1441035 1022 807 294 ------
NM_000024chr51339 ------
NM_000037chr82752 727 12209 --12369
NM_000038chr51342 11330 --1735
NM_000081chr131813 1366 1158 ------
NM_000084chrX116503 6469 5465 5391 4734 4366 4305 2057 1655 676 56 --26035 617 --
NM_000088chr17----1352 --
NM_000089chr71518 ------
NM_000090chr21173 ------
NM_000092chr213079 --14191 23583 178
NM_000104chr22751 92 12209 ----
NM_000108chr721745 1534 --21310 274 --
NM_000109chrX11071 12372 ----
NM_000110chr14889 772 51 24 --2463 336 --
NM_000112chr565110 4093 3999 1971 1674 1469 23707 383 15504 1427
NM_000115chr1321677 1657 1533 --12421
NM_000125chr643744 2659 1339 675 31272 997 42 13853 --
NM_000129chr631092 1025 998 ------
NM_000141chr101383 --1528 --
NM_000142chr431193 232 53 1258 1623 --
NM_000163chr542097 1768 1707 147 ------
NM_000165chr631532 1465 217 159 ----
NM_000168chr752916 2146 944 797 373 ----11254
NM_000176chr543847 3733 3028 2749 ------
NM_000192chr122406 155 ------
NM_000194chrX1499 1162 ----
NM_000202chrX43310 1581 1335 1147 --13189 --
NM_000208chr19103658 3618 3443 3321 3207 3134 2978 1218 582 233 44603 3925 3853 1654 ----
NM_000210chr22658 580 --1693 179
NM_000214chr2011711 ------
NM_000217chr1233431 1848 904 1151 ----
NM_000222chr432104 2074 507 --11575 --
NM_000232chr463083 2658 2549 2488 1086 901 22679 121 ----
NM_000248chr322965 698 ----12448
NM_000252chrX--11524 --11402
NM_000259chr15105883 5786 5582 4857 4322 4230 637 575 481 191 ----26364 2496
NM_000264chr942095 997 923 755 --1351 --
NM_000266chrX----2910 271 --
NM_000267chr1721257 89 13157 33247 183 140 199
NM_000276chrX32277 2078 293 21790 384 ----
NM_000282chr131218 ------
NM_000293chr162290 106 ------
NM_000297chr431723 1425 1376 162 ----
NM_000304chr172240 147 ------
NM_000310chr121209 824 ------
NM_000314chr1053121 2754 1038 1021 542 --1957 11089
NM_000319chr122436 276 1944 ----
NM_000321chr131276 ----11343
NM_000322chr661625 1604 1549 1405 1363 466 --21654 404 --
NM_000329chr1------1785
NM_000332chr646185 5458 4614 793 12387 ----
NM_000334chr1741505 862 638 219 ------
NM_000335chr342173 1659 544 305 ------
NM_000337chr545449 5023 1833 1355 15573 45249 4102 2094 1902 1564
NM_000338chr153270 237 74 ------
NM_000345chr42319 225 ----11043
NM_000346chr1711656 ------
NM_000362chr2233513 3439 2807 --21076 146 13600
NM_000368chr964806 4405 4020 3481 1205 755 33929 3798 427 ----
NM_000386chr173779 165 101 ------
NM_000387chr32147 35 --1291 --
NM_000397chrX62101 1839 1710 1654 540 39 ------
NM_000408chr233020 2567 2507 23416 174 12614 --
NM_000428chr1422218 982 --12332 12494
NM_000430chr1773718 2640 2540 2481 2311 1387 327 --11229 --
NM_000442chr1741282 1182 498 177 ------
NM_000449chr12393 163 1467 ----
NM_000451chrX1792 ------
NM_000461chr333302 2939 1003 34078 3964 3469 1500 --
NM_000462chr1531417 1316 565 ------
NM_000489chrX43171 2582 862 735 --22223 194 --
NM_000492chr711364 --11018 11168
NM_000495chrX31160 139 99 1408 ----
NM_000503chr831829 1648 127 ------
NM_000509chr42153 128 ------
NM_000523chr21169 11076 ----
NM_000533chrX----163 --
NM_000539chr331470 1444 374 ------
NM_000552chr12130 ------
NM_000554chr1953350 2305 1015 952 295 ------
NM_000555chrX107756 7740 5782 5185 5122 4811 1644 1587 621 151 --11104 --
NM_000575chr21176 ------
NM_000586chr41216 ------
NM_000599chr233153 1464 852 14553 ----
NM_000600chr7183 ------
NM_000601chr71342 ------
NM_000602chr711243 1557 ----
NM_000615chr11--1222 --11952
NM_000618chr1245494 4844 4292 220 11380 ----
NM_000618chr1245494 4844 4292 220 11380 ----
NM_000627chr22296 263 ------
NM_000641chr1921472 348 --11397 --
NM_000673chr41282 1319 ----
NM_000681chr1061167 1027 1000 542 184 159 --11345 --
NM_000685chr31829 1658 ----
NM_000685chr31829 1658 ----
NM_000687chr202483 34 1153 ----
NM_000719chr1276237 4266 2530 2260 1959 1115 682 25065 1701 16057 1742
NM_000722chr7--1282 --1209
NM_000724chr102288 134 11657 ----
NM_000726chr23418 321 118 --1573 --
NM_000756chr81470 ------
NM_000767chr1951335 1285 1222 484 256 11389 ----
NM_000780chr82792 123 --11110 --
NM_000782chr2021228 63 ------
NM_000801chr2031022 918 842 11057 ----
NM_000812chr42365 84 --1409 --
NM_000813chr555599 3851 3481 1599 261 --1390 24084 1395
NM_000814chr1524077 4057 ------
NM_000816chr51205 ------
NM_000817chr2----3424 349 75 --
NM_000826chr432448 2174 1875 --1113 --
NM_000829chr11--21787 744 ----
NM_000831chr144794 3801 2228 1424 16274 21909 1644 12443
NM_000832chr9162 ------
NM_000838chr662106 1914 1830 700 147 129 ----12780
NM_000840chr71415 ------
NM_000841chr64715 706 333 129 ----1637
NM_000844chr311006 ------
NM_000857chr41459 ------
NM_000859chr541627 1407 1121 524 --1216 --
NM_000868chrX32646 592 101 11691 --11959
NM_000875chr1555080 5069 2144 726 132 ------
NM_000883chr71158 1284 ----
NM_000883chr71158 1284 ----
NM_000885chr2--1847 ----
NM_000891chr1763609 2943 2293 1190 1008 219 22819 425 ----
NM_000899chr1243270 919 360 294 --23764 1697 13036
NM_000910chr421859 130 ----21970 523
NM_000912chr852653 2290 1173 882 317 --1490 --
NM_000922chr11--1881 1291 1238
NM_000933chr20--11207 ----
NM_000939chr2177 ------
NM_000945chr222048 2011 11511 11645 --
NM_000949chr51218 ------
NM_000950chrX43433 2794 1446 1158 22922 2394 12753 1434
NM_000958chr531236 831 303 ----11186
NM_000959chr153426 2913 2836 2770 1524 13963 ----
NM_000965chr3183 ------
NM_001001132chr2121312 1196 ----21135 436
NM_001001323chr1232242 2041 684 22308 832 1192 --
NM_001001331chr311866 --2737 180 --
NM_001001342chr1051448 1388 1082 1029 114 ------
NM_001001344chrX22311 2161 32256 2166 448 ----
NM_001001396chr184477 4230 3904 3892 1726 1058 1034 386 --1710 --
NM_001001419chr555091 5058 3230 1108 793 23606 543 14624 24817 810
NM_001001420chr555091 5058 3230 1108 793 23606 543 14624 24817 810
NM_001001481chr823033 165 1824 ----
NM_001001484chr102655 414 ------
NM_001001549chr721065 180 1981 --1897
NM_001001550chr721065 180 1981 --1897
NM_001001555chr721065 180 1981 --1897
NM_001001664chr234088 3043 868 ----12704
NM_001001668chr1984298 3981 3889 3675 1575 1542 1397 115 --24199 4175 --
NM_001001706chr63809 303 206 ------
NM_001001740chr11231 ------
NM_001001740chr11231 ------
NM_001001787chr11412 --161 --
NM_001001933chr11130 ------
NM_001001971chr1031149 562 362 ------
NM_001001974chr10--22269 484 21978 1553 --
NM_001001995chrX31604 1213 660 11565 ----
NM_001002026chr332431 617 434 ------
NM_001002032chr173725 658 25 --1645 --
NM_001002033chr173825 758 125 --1745 --
NM_001002243chr21250 ------
NM_001002244chr171108 ------
NM_001002245chr172143 53 ------
NM_001002246chr172143 53 ------
NM_001002247chr172143 53 ------
NM_001002248chr172143 53 ------
NM_001002249chr172143 53 ------
NM_001002258chr23810 752 22 1730 1217 --
NM_001002264chr13126 ------
NM_001002838chrX1380 2661 548 ----
NM_001002843chr152501 78 11272 ----
NM_001002860chr1464365 4294 3946 3607 3425 1225 --24072 3049 1195
NM_001002909chr1722066 409 11703 1832 12242
NM_001002914chr1721081 200 ------
NM_001003407chr1085059 5024 4839 4234 1248 1174 968 330 21788 1254 11007 --
NM_001003408chr1085059 5024 4839 4234 1248 1174 968 330 21788 1254 11007 --
NM_001003652chr18108096 7650 5597 2345 2324 1474 1434 1234 1189 346 27979 2240 26229 2590 --
NM_001003674chr1897006 6281 5429 5295 4645 4595 965 642 597 65526 5474 4993 2589 1890 779 57052 6995 6635 4344 1309 --
NM_001003675chr1897006 6281 5429 5295 4645 4595 965 642 597 65526 5474 4993 2589 1890 779 57052 6995 6635 4344 1309 --
NM_001003679chr13680 326 152 ----1378
NM_001003688chr42765 429 ------
NM_001003694chr31441 ------
NM_001003696chr211139 ------
NM_001003697chr211139 ------
NM_001003701chr211139 ------
NM_001003703chr211139 ------
NM_001003712chr1231299 871 782 ----11612
NM_001003800chr943525 2794 1292 979 ------
NM_001003845chr2----1467 --
NM_001003940chr1533364 3202 1262 --1829 --
NM_001003942chr1533364 3202 1262 --1829 --
NM_001003943chr1533368 3206 1266 --1833 --
NM_001004065chr933790 3436 2944 2470 314 23494 2926 --
NM_001004105chr5134 ------
NM_001004303chr11178 ----1668
NM_001004303chr11178 ----1668
NM_001004317chr674497 4305 4161 3046 1807 1679 869 ------
NM_001004342chr165893 5668 4313 1823 1805 489 23718 1812 ----
NM_001004360chr231947 1299 180 ------
NM_001004419chr1233605 1554 1048 --13505 12895
NM_001004431chr17------1211
NM_001005209chr22579 256 ------
NM_001005210chr1132220 2126 462 22136 1921 129 --
NM_001005271chr1741071 1052 220 76 ------
NM_001005273chr1741071 1052 220 76 ------
NM_001005353chr161147 1061 1045 937 315 67 ------
NM_001005353chr161147 1061 1045 937 315 67 ------
NM_001005354chr124384 196 135 71 --1539 --
NM_001005360chr19190 1228 ----
NM_001005361chr19190 1228 ----
NM_001005362chr19190 1228 ----
NM_001005366chr121241 ------
NM_001005386chr231686 575 240 1489 1313 --
NM_001005404chr1733738 3182 790 ------
NM_001005407chr16------1695
NM_001005417chr1----1545 --
NM_001005463chr1021864 81 ------
NM_001005505chr32344 317 --11380 --
NM_001005609chrX62818 2741 658 408 254 76 31190 317 104 33728 3537 1318 11245
NM_001005732chr211601 ------
NM_001005733chr211558 ------
NM_001005739chr2--1589 ----
NM_001005743chr14--1987 2475 235 --
NM_001005744chr14--1987 2475 235 --
NM_001005745chr14--1987 2475 235 --
NM_001005746chr23418 321 118 --1573 --
NM_001005747chr23418 321 118 --1573 --
NM_001005781chr21601 ------
NM_001005782chr221050 173 ------
NM_001005845chr821357 1202 1479 ----
NM_001006115chr352630 2516 2011 1927 853 --1471 --
NM_001006600chr52972 526 22449 1909 ----
NM_001006612chrX1102 ------
NM_001006613chrX1102 ------
NM_001006614chrX1102 ------
NM_001006617chr921252 935 ------
NM_001006618chr9159 ------
NM_001006619chr921252 935 ------
NM_001006620chr921252 935 ------
NM_001006621chr921252 935 ------
NM_001006623chr242387 2154 691 156 --1105 --
NM_001006636chr21961 ------
NM_001006684chrX1229 ------
NM_001006935chrX2152 77 ------
NM_001006936chrX2152 77 ------
NM_001006937chrX2152 77 ------
NM_001006938chrX3602 559 505 ------
NM_001006946chr241516 1354 1312 159 ------
NM_001007024chr1773747 3491 3426 2718 1570 511 184 13527 12832 --
NM_001007025chr1773747 3491 3426 2718 1570 511 184 13527 12832 --
NM_001007027chr11193 ------
NM_001007072chr151185 ------
NM_001007097chr975044 4454 4445 3222 1016 107 85 24903 4640 2950 56 11513
NM_001007098chr12897 780 1330 ----
NM_001007102chr611595 --11399 --
NM_001007226chr172206 55 --1933 --
NM_001007227chr172206 55 --1933 --
NM_001007228chr172206 55 --1933 --
NM_001007229chr172206 55 --1933 --
NM_001007230chr172206 55 --1933 --
NM_001007237chr172898 2016 2002 1805 580 210 25 12300 --32851 2620 2037
NM_001007246chr2171958 1860 1810 1697 1264 635 239 11867 1103 --
NM_001007257chr141235 1078 205 178 11478 ----
NM_001007271chr104981 713 414 77 ------
NM_001007277chr11--1979 ----
NM_001007553chr11790 ------
NM_001007559chr1832049 1882 1819 ------
NM_001007794chr12202 109 ------
NM_001008220chr583927 3900 3810 3798 3707 3535 1519 382 11262 ----
NM_001008222chrX21099 398 2391 159 ----
NM_001008239chr1843583 2893 2574 1208 22859 668 13348 1990
NM_001008392chr363434 3239 3059 2862 997 554 ----1627
NM_001008407chr71625 ------
NM_001008408chr786279 5717 4864 2074 2047 1653 1552 697 22548 1592 23874 2497 --
NM_001008539chr865356 5000 3720 2075 771 84 35136 666 105 ----
NM_001008540chr21431 1385 ----
NM_001008541chr1022004 718 12175 ----
NM_001008541chr1022004 718 12175 ----
NM_001008564chr1322155 1814 ------
NM_001008567chr9184 ------
NM_001008660chr11185 11271 ----
NM_001008701chr1922005 1911 1899 1454 --
NM_001008726chr1431702 455 257 ------
NM_001008738chr552857 2455 1125 1100 670 ------
NM_001008895chr131914 ----1386
NM_001008925chr423170 2258 --12521 11006
NM_001008938chr111191 ------
NM_001009552chr82532 477 1238 ----
NM_001009880chr2294908 4755 4728 3685 3166 1321 1148 107 53 --11749 --
NM_001009881chr1160 ------
NM_001009882chr1160 ------
NM_001009899chr395411 5380 5152 3968 2419 1364 485 474 428 16239 --15984
NM_001009909chr1163939 3551 2647 2581 2416 867 --13396 --
NM_001009955chr11506 ------
NM_001009955chr11506 ------
NM_001009993chr284588 4212 3577 3396 2911 1629 1376 1027 168 ----
NM_001010000chr1833116 1173 937 ----13525
NM_001010857chr11112 ------
NM_001010861chr112779 --22375 2293 --
NM_001010862chrX32221 1199 980 --13284 --
NM_001010867chr1136263 6159 5528 5463 4913 4726 2181 1547 766 723 588 245 93 11770 ----
NM_001010888chrX54050 1754 802 676 93 13945 --14615
NM_001010891chr5106779 5596 5346 5282 4284 2764 2534 2383 2294 1115 141 45444 2702 1742 308 --
NM_001010908chr10----1478 --
NM_001010924chr10----1875 --
NM_001010927chr6----1481 --
NM_001010932chr71342 ------
NM_001010934chr7198 --1899 --
NM_001010986chrX32446 1698 1537 11685 ----
NM_001011513chr434044 2752 2733 --13188 23058 2697
NM_001011545chr21--1215 ----
NM_001011553chr711006 ------
NM_001011666chr776268 5356 1812 1176 451 440 150 26448 6407 36048 5204 1542 --
NM_001011705chr13181 126 ----
NM_001011713chr1411544 1153 ----
NM_001011724chr13----1281 --
NM_001011725chr13----1281 --
NM_001012329chr182370 2035 1846 1681 1671 709 685 601 --132 --
NM_001012338chr15135 ------
NM_001012393chr1133833 3719 1807 23463 1894 ----
NM_001012420chr152700 421 22956 717 ----
NM_001012423chr1522955 700 1717 ----
NM_001012506chr3------1151
NM_001012512chr181183 ------
NM_001012513chr181194 ------
NM_001012751chr103615 399 393 --1117 --
NM_001012755chrX74623 3649 3522 1720 1449 1383 1218 --11839 --
NM_001012756chr1942726 2536 2372 2221 --11195 1214
NM_001012761chr532737 2401 178 --12389 --
NM_001012958chr131460 587 187 ------
NM_001012958chr131460 587 187 ------
NM_001012968chrX32740 1990 920 1695 ----
NM_001012977chrX2905 464 ------
NM_001012989chrX1586 ------
NM_001013031chr1032626 2450 1319 23387 1023 ----
NM_001013399chr641120 833 780 756 ------
NM_001013406chr7------11136
NM_001013415chr44618 340 214 123 ------
NM_001013437chr181424 ------
NM_001013438chr3------1654
NM_001013620chr1298054 6281 5952 5519 5151 3155 3088 1474 263 11715 17037 --
NM_001013635chr121901 ------
NM_001013693chr172918 2358 2048 1915 565 467 382 22601 1150 ----
NM_001013693chr172918 2358 2048 1915 565 467 382 22601 1150 ----
NM_001013699chr121180 ----195
NM_001013703chr15166 ------
NM_001013746chr721864 1617 ------
NM_001013843chr151835 ------
NM_001014283chr1342178 1518 1473 1380 --22169 325 --
NM_001014380chr1365829 5250 4306 4151 392 209 ----11597
NM_001014765chr151953 1892 514 170 50 --11531 --
NM_001014797chr10128120 7899 7435 6242 3289 2965 2584 972 945 824 209 129 --16075 16333
NM_001014839chr1--1686 ----
NM_001014841chr1--1686 ----
NM_001015045chr452468 2193 740 507 444 ------
NM_001015508chr82672 161 ------
NM_001015877chrX42889 2179 322 192 1883 ----
NM_001015885chr20--1329 ----
NM_001015887chr331216 139 79 11601 11815 --
NM_001017369chr4--11082 ----
NM_001017371chr21336 ----11148
NM_001017395chr363416 3246 2642 2473 1059 955 22631 1000 22596 1008 --
NM_001017405chr42911 905 ------
NM_001017424chr121374 68 11528 ----
NM_001017425chr121374 68 11528 ----
NM_001017440chr797846 7254 7247 7111 6538 6383 1966 1935 755 23113 29 16234 12276
NM_001017916chr1752060 1604 507 229 138 ------
NM_001017917chr1752060 1604 507 229 138 ------
NM_001017923chr1421261 232 ------
NM_001017926chr82593 156 --11329 11392
NM_001017969chr9--1662 1545 --
NM_001017977chr13368 326 295 ------
NM_001017979chr41267 ------
NM_001017999chr14816 423 131 24 --1926 --
NM_001017999chr14816 423 131 24 --1926 --
NM_001018000chr14816 423 131 24 --1926 --
NM_001018000chr14816 423 131 24 --1926 --
NM_001018001chr14816 423 131 24 --1926 --
NM_001018004chr15----1217 --
NM_001018006chr15----1217 --
NM_001018007chr15----1217 --
NM_001018008chr152643 553 ------
NM_001018020chr15----1217 --
NM_001018037chr911225 ------
NM_001018050chr2233344 2917 2144 1680 ----
NM_001018052chr2233344 2917 2144 1680 ----
NM_001018064chr912104 1502 11577 --
NM_001018067chr164836 4680 1956 1683 1660 285 --1504 23736 1992
NM_001018068chr164836 4680 1956 1683 1660 285 --1504 23736 1992
NM_001018069chr164836 4680 1956 1683 1660 285 --1504 23736 1992
NM_001018074chr543847 3733 3028 2749 ------
NM_001018075chr543847 3733 3028 2749 ------
NM_001018076chr543847 3733 3028 2749 ------
NM_001018077chr543847 3733 3028 2749 ------
NM_001018108chr1531703 669 641 ----1561
NM_001018111chr761597 1427 1394 1316 414 225 23801 951 ----
NM_001020658chr12665 233 ------
NM_001020658chr12665 233 ------
NM_001020818chr1961726 1645 1391 596 229 205 ------
NM_001020819chr1961726 1645 1391 596 229 205 ------
NM_001020820chr1961726 1645 1391 596 229 205 ------
NM_001020821chr1961726 1645 1391 596 229 205 ------
NM_001020825chr541322 1208 503 224 ------
NM_001023560chr6--1793 1874 --
NM_001023567chr1512356 12348 ----
NM_001024094chr543847 3733 3028 2749 ------
NM_001024380chr8----12057 --
NM_001024381chr8----12057 --
NM_001024455chrX42244 1895 1743 67 12642 1843 --
NM_001024463chr151778 ----1882
NM_001024647chr1267458 6555 4983 936 782 510 14668 21165 166 --
NM_001024668chr121743 ------
NM_001024680chr211125 ------
NM_001024808chr1262593 1768 1025 972 295 185 1302 ----
NM_001024912chr1921447 162 --11839 --
NM_001024947chr5--184 ----
NM_001024948chr143446 2620 1323 1059 --12165 --
NM_001024957chr112131 22 ------
NM_001025076chr10175910 5869 5467 5320 4482 4327 4049 3995 3802 2158 2110 1938 1465 1360 1259 784 441 1260 ----
NM_001025077chr10177268 7227 6825 6678 5840 5685 5407 5353 5160 4577 2823 2718 2617 2142 1799 1352 1243 11618 ----
NM_001025079chr344015 3710 1627 214 1757 --11083
NM_001025105chr511169 --11520 1178
NM_001025108chr254217 2709 2654 1599 1072 --12926 --
NM_001025205chr31107 ------
NM_001025266chr364828 3976 1840 1616 1202 145 14462 23065 82 --
NM_001025356chr1232208 806 726 ------
NM_001025366chr62489 281 ------
NM_001025366chr62489 281 ------
NM_001025367chr62489 281 ------
NM_001025367chr62489 281 ------
NM_001025368chr62489 281 ------
NM_001025368chr62489 281 ------
NM_001025369chr62505 297 ------
NM_001025369chr62505 297 ------
NM_001025370chr62489 281 ------
NM_001025370chr62489 281 ------
NM_001025579chr171755 1424 172 1990
NM_001025580chrX32763 715 289 --13461 11587
NM_001025595chr411031 11688 ----
NM_001025603chr12393 163 1467 ----
NM_001025616chr41517 1322 ----
NM_001025780chr911114 ----1290
NM_001029863chr642047 984 909 62 --1314 --
NM_001029882chr11494 ------
NM_001029882chr11494 ------
NM_001029998chr431025 903 498 --188 --
NM_001030006chr1742329 1665 232 81 --42601 851 269 33 --
NM_001030007chr1623984 2853 1599 ----
NM_001030055chr1484236 3599 1555 1536 1215 1186 677 515 24674 247 --13116
NM_001030287chr1--1739 1483 --
NM_001031679chr1221398 572 ------
NM_001031684chr211362 11456 ----
NM_001031694chr13799 352 216 ------
NM_001031694chr13799 352 216 ------
NM_001031695chr2254286 2071 1378 545 423 13857 25375 4979 --
NM_001031700chr42547 431 --32372 2090 316 --
NM_001031702chr32780 115 --1274 --
NM_001031732chr443313 2936 2612 2328 23213 931 1419 --
NM_001031803chr17------1224
NM_001031804chr1643938 3429 992 540 ------
NM_001031812chr531667 828 50 52102 1736 880 706 681 ----
NM_001031835chr162290 106 ------
NM_001032280chr641343 1299 111 99 ------
NM_001032282chr831000 994 330 ------
NM_001032288chr2051357 1338 1321 1222 348 ------
NM_001032293chr17157 ----1502
NM_001032296chr1342638 2441 1802 1065 2933 170 ----
NM_001032367chr15--1432 1462 --
NM_001032393chrX1480 ------
NM_001032394chr632863 757 459 ------
NM_001032395chr632730 624 326 ------
NM_001032999chr20115055 4090 4019 3243 1563 1398 1130 1013 811 540 176 1589 ----
NM_001033057chr321578 249 ------
NM_001033059chr651889 1658 432 237 76 ------
NM_001033081chr131718 1704 337 21822 218 21907 628 --
NM_001033082chr131718 1704 337 21822 218 21907 628 --
NM_001033087chr2063259 3197 3104 2448 907 226 21315 789 11038 --
NM_001033117chr374431 4378 4261 4246 4227 2960 227 --14781 11015
NM_001033506chr111163 1409 196 --
NM_001033507chr121793 639 --1129 11881
NM_001033518chr742423 1987 478 70 ------
NM_001033519chr742423 1987 478 70 ------
NM_001033520chr742423 1987 478 70 ------
NM_001033551chr1793931 3334 3235 3092 2850 1600 1561 1292 909 22967 476 ----
NM_001033557chr231175 522 130 1342 ----
NM_001033566chr172985 678 --1660 --
NM_001033568chr172985 678 --1660 --
NM_001033602chr1362577 2347 2123 1726 978 422 22693 874 1386 22464 1058
NM_001033659chr1721342 1269 ----11208
NM_001033723chr812372 2523 274 ----
NM_001033756chr63727 423 215 ------
NM_001033756chr63727 423 215 ------
NM_001033925chr1031587 627 336 ------
NM_001034837chr52643 273 1775 1327 --
NM_001034838chr52643 273 1775 1327 --
NM_001034841chr1684600 4053 1872 1800 1694 1139 1119 952 --14219 --
NM_001034845chr4--1506 ----
NM_001034852chr1441762 1471 424 395 ----1340
NM_001034954chr1042540 610 340 199 13248 ----
NM_001034955chr1042540 610 340 199 13248 ----
NM_001034956chr1042540 610 340 199 13248 ----
NM_001034957chr1042540 610 340 199 13248 ----
NM_001035254chr952051 865 820 774 178 --12474 --
NM_001035256chr2177 ------
NM_001035260chr1021461 441 11251 ----
NM_001035534chr951187 1004 555 440 332 124 ----
NM_001037132chr721713 1613 1112 ----
NM_001037133chr721713 1613 1112 ----
NM_001037164chr721936 152 11819 ----
NM_001037172chr31933 51387 1035 926 912 169 ----
NM_001037317chr112779 --22375 2293 --
NM_001037331chr18--1348 ----
NM_001037332chr52673 187 21676 1649 ----
NM_001037333chr52673 187 21676 1649 ----
NM_001037334chr18101970 1586 962 864 696 498 475 383 320 199 --12278 --
NM_001037339chr11231 1717 ----
NM_001037340chr11231 1717 ----
NM_001037341chr11231 1717 ----
NM_001037341chr11231 1717 ----
NM_001037533chr12665 341 ------
NM_001037738chr51207 ------
NM_001037954chr114834 597 569 560 ------
NM_001038493chr221090 1063 ----11344
NM_001038707chr122063 703 --168 --
NM_001038707chr122063 703 --168 --
NM_001039140chr203429 383 159 --167 --
NM_001039350chr731621 1318 662 11488 ----
NM_001039372chr72254 217 ------
NM_001039459chr71854 1899 11168 --
NM_001039479chr1431807 1679 1572 12377 21752 257 --
NM_001039538chr213520 23676 883 ----
NM_001039547chr382814 2649 2370 1877 1810 1406 791 658 ----13216
NM_001039550chr24872 713 197 102 ------
NM_001039574chr121068 1059 --21020 716 --
NM_001039577chr143689 1178 140 21 23882 251 21160 1142 --
NM_001039585chr163683 3170 3093 3027 2644 214 14220 1146 --
NM_001039590chrX73784 2470 1411 947 370 259 157 12780 13106 1645
NM_001039591chrX73784 2470 1411 947 370 259 157 12780 13106 1645
NM_001039618chr1164689 2144 1615 1470 453 328 15047 15381 --
NM_001039690chr1611826 --11563 --
NM_001039709chr20115055 4090 4019 3243 1563 1398 1130 1013 811 540 176 1589 ----
NM_001039711chr121116 990 1963 ----
NM_001039712chr121116 990 1963 ----
NM_001039771chr143965 876 348 1232 --11212
NM_001039772chr113542 357 22 ------
NM_001039802chr111297 ------
NM_001039840chrX56018 5193 4578 2287 89 11768 35390 710 317 --
NM_001039844chr1042991 2807 2465 845 --12745 --
NM_001039888chr11600 ------
NM_001039916chr121799 ------
NM_001039917chr121799 ------
NM_001039918chr121799 ------
NM_001039919chr121799 ------
NM_001039920chr121799 ------
NM_001039937chr1343807 2986 1228 1017 ------
NM_001040001chr612004 11913 ----
NM_001040057chr731448 995 181 --21139 174 --
NM_001040092chr81360 ------
NM_001040100chr3----145 --
NM_001040101chr461408 544 474 466 363 157 --1136 1274
NM_001040113chr16------1937
NM_001040142chr21405 --12155 1567
NM_001040143chr21405 --12155 1567
NM_001040144chr1611826 --11563 --
NM_001040146chr1611826 --11563 --
NM_001040151chr1174562 3740 3372 1262 1199 950 344 --13297 --
NM_001040152chr745120 1557 1515 311 15072 33614 3116 172 --
NM_001040153chr132972 85 ------
NM_001040157chr432911 2698 721 ------
NM_001040167chr751193 1171 804 405 65 ------
NM_001040181chr32461 426 ------
NM_001040182chr32461 426 ------
NM_001040183chr32461 426 ------
NM_001040199chr32461 426 ------
NM_001040200chr32461 426 ------
NM_001040284chr1685641 5233 4227 3625 1923 1077 1055 887 21021 732 ----
NM_001040402chr482972 2931 2511 2134 264 164 128 70 --191 --
NM_001040424chr2152999 2949 2176 916 590 ------
NM_001040429chr1332524 1156 389 11118 1110 --
NM_001040441chr143992 3930 1545 177 1196 1707 --
NM_001040446chr531848 667 86 ----12521
NM_001040450chr1512394 --22330 221 --
NM_001040453chr1512394 --22330 221 --
NM_001040455chr1151183 973 247 234 77 ------
NM_001040619chr13283 241 107 11189 ----
NM_001040624chr842633 2476 708 448 11758 ----
NM_001040625chr842633 2476 708 448 11758 ----
NM_001040626chr842633 2476 708 448 11758 ----
NM_001040627chr842633 2476 708 448 11758 ----
NM_001040628chr842633 2476 708 448 11758 ----
NM_001040629chr842633 2476 708 448 11758 ----
NM_001040630chr842633 2476 708 448 11758 ----
NM_001040633chr72980 137 ----1237
NM_001040665chr735012 4472 1603 --186 --
NM_001040666chr72714 174 ------
NM_001040694chr115915 748 359 146 83 1161 ----
NM_001040708chr8160 ------
NM_001040709chr111976 32571 2359 307 --12522
NM_001040712chr931320 883 380 1685 --1358
NM_001040876chr431331 334 323 ------
NM_001042355chr1665367 3983 3535 2026 1144 1109 ------
NM_001042368chr91629 ------
NM_001042388chr181673 2803 623 1820 --
NM_001042412chr1665367 3983 3535 2026 1144 1109 ------
NM_001042413chr934078 904 435 1943 23453 44 13983
NM_001042414chr131210 ------
NM_001042425chr641343 1299 111 99 ------
NM_001042453chrX21516 240 ------
NM_001042473chr1031552 1478 1415 ------
NM_001042475chr6----147 --
NM_001042486chr2011578 11407 11356 --
NM_001042492chr1721257 89 13157 33247 183 140 199
NM_001042494chr1563131 2960 2779 2716 2542 394 1532 --13776
NM_001042495chr1563131 2960 2779 2716 2542 394 1532 --13776
NM_001042496chr1563131 2960 2779 2716 2542 394 1532 --13776
NM_001042497chr1563131 2960 2779 2716 2542 394 1532 --13776
NM_001042506chrX2905 464 11129 ----
NM_001042510chr81541 22170 1353 1140 12055
NM_001042511chr81541 22170 1353 1140 12055
NM_001042537chrX92456 2282 1996 1595 963 887 593 464 247 ------
NM_001042555chr1262975 1353 1290 885 605 271 --14025 --
NM_001042585chr12630 512 ------
NM_001042599chr266774 6743 6651 6111 2835 2211 15964 37268 5551 287 --
NM_001042601chr363082 782 398 375 258 203 --1705 --
NM_001042603chr1262037 1534 1490 994 755 137 --21039 94 --
NM_001042604chr361359 1064 1046 590 563 538 13528 54802 4480 4262 3547 158 --
NM_001042616chr42554 400 1213 --124
NM_001042632chr203759 650 257 22532 1742 1452 --
NM_001042633chr203759 650 257 22532 1742 1452 --
NM_001042669chr41517 1322 ----
NM_001042749chrX31907 1638 745 ------
NM_001042750chrX31907 1638 745 ------
NM_001042751chrX31907 1638 745 ------
NM_001043318chr1483932 3478 2877 1103 999 778 770 397 34008 3336 1190 ----
NM_001043351chr1111916 1800 1660 1596 1431 922 877 753 586 270 24 ------
NM_001044305chr621322 506 11222 ----
NM_001044385chr241425 1211 1170 165 --23153 2817 13168
NM_001044722chr531667 828 50 52102 1736 880 706 681 ----
NM_001044723chr531667 828 50 52102 1736 880 706 681 ----
NM_001046chr542999 2597 2259 1930 ------
NM_001049chr1422039 120 --12497 --
NM_001066chr142162 1416 263 209 --1459 --
NM_001079874chr141761 1344 172 154 11897 --12011
NM_001083620chr432446 2172 1873 --1113 --
NM_001095chr1231611 1453 344 21339 630 1271 --
NM_001106chr3139655 9382 9350 8023 7374 6955 3396 3105 2687 2381 2332 289 259 17248 37785 2971 1284 2971 409
NM_001113490chrX2734 425 --12962 11129
NM_001117chr18----11927 12127
NM_001119chr431321 1296 550 11231 1993 --
NM_001121chr1021667 741 ------
NM_001122chr9159 --128 --
NM_001122679chr511258 ------
NM_001124chr112467 288 ------
NM_001126chr13285 230 221 ------
NM_001128chr1623984 2853 1599 ----
NM_001144chr1621268 452 --11358 --
NM_001146chr81277 1486 ----
NM_001148chr422060 824 --11779 1385
NM_001149chr1031267 941 538 1490 1281 --
NM_001152chrX141 ------
NM_001153chr22689 583 ------
NM_001154chr4128 ------
NM_001157chr101231 ------
NM_001167chrX106112 5868 5733 5680 5544 2118 2055 1344 450 29 16711 12613 --
NM_001173chr1484236 3599 1555 1536 1215 1186 677 515 24674 247 --13116
NM_001174chrX32288 228 141 ----138
NM_001187chr211420 1191 1149 --
NM_001198chr632270 1475 597 ------
NM_001204chr232951 1860 449 37759 6420 5044 --37524 6555 5967
NM_001206chr943146 3070 958 468 ------
NM_001222chr1031944 1587 600 3694 653 195 ----
NM_001233chr732343 2072 688 --1645 --
NM_001235chr112642 211 1443 ----
NM_001238chr191489 165 ----
NM_001241chr251906 449 228 196 64 1957 --11675
NM_001241chr251906 449 228 196 64 1957 --11675
NM_001249chr141151 ------
NM_001256chr1732480 1119 45 11850 12665 --
NM_001257chr1611435 --1588 --
NM_001259chr766379 5469 2339 742 285 120 35602 1982 1822 24466 315 --
NM_001260chr13132 ----142
NM_001270chr5------1195
NM_001271chr1533199 2436 2413 43245 2837 1099 982 2477 111 --
NM_001273chr121120 ------
NM_001274chr113383 50 42 ------
NM_001278chr104998 972 54 43 ------
NM_001282chr1742329 1665 232 81 --42601 851 269 33 --
NM_001284chr5----1169 --
NM_001290chr41746 ------
NM_001293chr111411 ------
NM_001299chr19144 ------
NM_001300chr101305 ------
NM_001304chr1763516 2984 1413 805 769 308 13021 --1891
NM_001310chr1242436 2265 693 253 12567 11945 --
NM_001315chr62803 302 195 ----
NM_001316chr201350 --1139 --
NM_001329chr10--21594 539 --2344 131
NM_001331chr111704 22726 273 12624 1390
NM_001332chr511079 ------
NM_001343chr531329 1315 128 ------
NM_001345chr12184 ------
NM_001356chrX32445 1905 1778 1221 ----
NM_001363chrX2678 71 ------
NM_001364chr1133562 1031 864 194 ----
NM_001365chr17----1753 --
NM_001379chr192286 60 ------
NM_001385chr81168 ------
NM_001390chr1843520 2986 2362 1143 33368 3253 3138 22268 373 --
NM_001394chr82737 628 --1846 --
NM_001396chr2162555 2324 2267 922 620 318 ------
NM_001399chrX62818 2741 658 408 254 76 31190 317 104 33728 3537 1318 11245
NM_001400chr12953 92 1110 ----
NM_001406chr1741504 1212 1178 136 11632 ----
NM_001408chr121579 421 11630 --1670
NM_001417chr12--11527 1162 --
NM_001418chr112300 42 ------
NM_001418chr112300 42 ------
NM_001419chr1994130 3251 3124 3043 2995 1949 750 613 418 --11802 --
NM_001420chr1922992 2563 11929 ----
NM_001422chr113912 305 117 --1552 --
NM_001427chr711879 1390 ----
NM_001430chr241826 1801 1723 417 ------
NM_001432chr442806 1345 975 84 ------
NM_001438chr162627 2288 1159 958 533 36 12314 --12253
NM_001453chr631719 1179 423 11761 ----
NM_001457chr331275 125 49 ------
NM_001460chr143308 1066 467 155 ------
NM_001463chr21782 --1288 --
NM_001482chr151349 ------
NM_001483chr71861 1112 ----
NM_001493chrX2571 26 ------
NM_001497chr932668 397 51 --12568 1936
NM_001527chr664317 4089 3399 3161 3100 471 14738 13631 --
NM_001542chr172898 2016 2002 1805 580 210 25 12300 --32851 2620 2037
NM_001543chr574348 3756 3632 3565 3101 2984 989 ------
NM_001546chr631076 912 249 ------
NM_001570chr331177 547 119 ----11407
NM_001584chr11----11118 1833
NM_001587chrX32277 2078 293 21790 384 ----
NM_001614chr172709 173 132 ----
NM_001614chr172709 173 132 ----
NM_001616chr272602 1343 908 796 768 506 444 12970 1150 --
NM_001619chr111748 2424 167 ----
NM_001620chr111591 ----1811
NM_001621chr73987 810 223 --1794 1969
NM_001621chr73987 810 223 --1794 1969
NM_001634chr651889 1658 432 237 76 ------
NM_001635chr721069 211 ----11031
NM_001650chr1833290 3052 2585 ----14115
NM_001654chrX----195 --
NM_001656chr51442 --11483 --
NM_001660chr32592 135 --2678 164 1672
NM_001662chr71393 ------
NM_001663chr141859 1429 --32328 790 465
NM_001668chr15853 740 484 300 159 ------
NM_001674chr1--1739 1483 --
NM_001677chr151050 858 852 422 314 ------
NM_001679chr34539 195 186 33 ------
NM_001681chr123730 614 99 1262 ----
NM_001682chr1221956 398 22022 546 ----
NM_001683chr311866 --2737 180 --
NM_001684chr184194 3947 3621 3609 1443 775 751 103 --1427 --
NM_001685chr211139 ------
NM_001689chr23810 752 22 1730 1217 --
NM_001693chr831167 859 493 3257 227 154 ----
NM_001699chr1931423 676 613 11447 21768 321 --
NM_001701chr9--11005 ----
NM_001704chr61588 1561 ----
NM_001706chr321067 416 ------
NM_001709chr1182648 2600 2518 942 672 501 249 238 22329 2086 1305 --
NM_001718chr6--11152 1934 --
NM_001722chr82216 45 ------
NM_001730chr1331498 1203 1146 1210 11210 --
NM_001730chr1331498 1203 1146 1210 11210 --
NM_001742chr72721 170 ------
NM_001743chr2------1212
NM_001748chr11928 --11080 --
NM_001753chr71382 11147 11195 --
NM_001755chr1652077 1724 728 566 71 --12057 --
NM_001759chr1285164 5106 4347 3725 1768 1024 913 611 ----14680
NM_001761chr1671599 1585 1498 1435 1167 681 180 ------
NM_001773chr131416 1263 446 ------
NM_001777chr344015 3710 1627 214 1757 --11083
NM_001788chr711006 ------
NM_001791chr111297 ------
NM_001797chr161764 ------
NM_001798chr1231002 851 385 ------
NM_001800chr191548 1101 ----
NM_001821chr133800 410 126 --21456 24 --
NM_001823chr142172 33 ------
NM_001826chr12335 141 --183 --
NM_001827chr9------1274
NM_001829chr43950 357 163 --1976 --
NM_001830chrX53889 2473 451 315 247 11420 12991 --
NM_001833chr9185 ------
NM_001839chr1--2723 192 ----
NM_001842chr91408 1565 ----
NM_001845chr1311325 ------
NM_001854chr11590 1283 ----
NM_001858chr624840 1807 --13856 31693 1375 1332
NM_001859chr913912 13954 13154 --
NM_001860chr91240 11125 ----
NM_001875chr22329 296 ------
NM_001876chr11----1496 --
NM_001882chr52580 27 ------
NM_001892chr511169 --11520 1178
NM_001895chr2011177 1342 1801 --
NM_001896chr163294 280 26 ------
NM_001903chr5--1593 ----
NM_001904chr321035 280 ------
NM_001915chr1752060 1604 507 229 138 ------
NM_001918chr1128361 8191 8152 7791 7102 6406 5634 3579 3428 3254 1336 244 13316 12114 --
NM_001923chr112267 53 ------
NM_001933chr1431118 509 325 1949 2414 109 --
NM_001935chr21351 ------
NM_001936chr731621 1318 662 11488 ----
NM_001938chr121281 417 ----11917
NM_001939chrX53635 2647 1280 885 345 1270 13679 --
NM_001944chr1852401 1956 1855 812 178 22152 1860 ----
NM_001946chr12------1208
NM_001949chr622496 335 1653 ----
NM_001964chr511026 ------
NM_001967chr32519 40 ------
NM_001968chr4------1838
NM_001969chr1433869 3280 3004 12986 --23562 39
NM_001970chr171405 ------
NM_001977chr421409 580 ------
NM_001978chr821015 42 ------
NM_001980chr1251837 1790 629 568 115 ------
NM_001981chr112066 --12337 1580
NM_001987chr1223354 388 1846 1837 --
NM_001991chr1732089 1485 71 --1837 --
NM_001995chr43954 402 71 1381 --1193
NM_001999chr541348 1053 960 141 ------
NM_002006chr495604 3563 1837 1687 1243 1118 1041 752 218 --25645 5071 --
NM_002009chr1522192 400 --1648 --
NM_002010chr132160 107 ------
NM_002015chr1323211 220 1225 ----
NM_002017chr1121378 155 ------
NM_002024chrX31803 1720 1528 1759 ----
NM_002025chrX98326 8008 3082 2944 2568 2250 1835 1568 531 16717 --17118
NM_002028chr1431265 1113 1090 11119 ----
NM_002035chr1842863 1300 616 54 1947 12476 --
NM_002040chr2142988 2820 606 405 --1417 --
NM_002056chr22761 273 1282 ----
NM_002063chrX--11255 ----
NM_002072chr921000 198 ------
NM_002074chr151555 1282 1163 560 410 31270 624 204 ----
NM_002076chr1252860 2800 2592 2431 2368 33259 2597 648 ----
NM_002077chr932072 1927 246 12105 ----
NM_002080chr162932 811 ----1711
NM_002086chr1761987 1689 1650 1526 487 238 ------
NM_002091chr181183 ------
NM_002107chr12486 470 ------
NM_002111chr451397 1077 493 380 307 43858 2645 649 254 ----
NM_002114chr61178 ------
NM_002126chr1744161 3144 1580 593 --24122 756 --
NM_002128chr1342445 2262 2013 992 12525 ----
NM_002129chr4------1334
NM_002131chr631024 526 315 ----11185
NM_002133chr221403 ------
NM_002134chr161108 --1395 --
NM_002137chr72841 618 11916 22418 725 --
NM_002140chr931090 927 178 ------
NM_002147chr171643 --1850 --
NM_002156chr21179 ------
NM_002157chr2----138 --
NM_002158chr221483 166 12636 13492 --
NM_002163chr1611242 ----1215
NM_002167chr12371 38 ------
NM_002181chr21534 135 ----
NM_002193chr211877 ------
NM_002196chr201754 ------
NM_002196chr201754 ------
NM_002199chr41139 1276 ----
NM_002203chr531219 1073 55 --1517 --
NM_002204chr173972 914 455 --1340 --
NM_002205chr12195 1987 1915 --
NM_002207chr31493 --1116 --
NM_002211chr101167 ------
NM_002214chr744603 3856 2057 1363 --1350 --
NM_002221chr15782 530 398 387 368 ------
NM_002222chr321126 100 --1480 --
NM_002223chr1243732 943 359 131 --23506 988 --
NM_002226chr141750 ------
NM_002227chr11391 --11144 1864
NM_002232chr11152 --124 --
NM_002241chr132577 2101 1971 11131 ----
NM_002242chr211568 --1253 --
NM_002247chr1011778 1601 1808 --
NM_002264chr373230 1974 1964 1510 1471 810 662 ----11109
NM_002267chr131764 12309 1785 --
NM_002268chr321208 476 31642 598 137 ----
NM_002271chr13--2984 159 12010 12343
NM_002285chr254217 2709 2654 1599 1072 --12926 --
NM_002293chr152583 2200 2156 326 108 22575 2205 ----
NM_002296chr121133 508 21689 91 ----
NM_002298chr1321509 1164 1454 ----
NM_002310chr586381 5755 5099 2348 1901 1572 695 58 26188 1208 14213 --
NM_002313chr1085059 5024 4839 4234 1248 1174 968 330 21788 1254 11007 --
NM_002332chr12----1219 --
NM_002336chr1284789 4325 1938 1564 894 740 608 206 ------
NM_002355chr123991 482 431 --11017 --
NM_002356chr622807 2060 ------
NM_002359chr17123934 3316 3306 3185 3164 2883 2661 1336 1200 551 292 205 24266 3387 11702 --
NM_002360chr732621 2504 1044 21009 413 ----
NM_002371chr22167 155 ------
NM_002373chr1531293 845 287 11344 ----
NM_002374chr213520 23676 883 ----
NM_002380chr81101 --1379 --
NM_002381chr22823 776 ------
NM_002382chr1411267 ------
NM_002387chr574199 4191 1925 1865 1025 899 387 15075 ----
NM_002390chr1741710 771 669 480 11700 ----
NM_002397chr521463 189 ----1313
NM_002398chr211136 1959 ----
NM_002399chr1531281 399 292 --11351 --
NM_002401chr1792497 2239 2129 2100 1926 1817 676 78 57 140 1591 1748
NM_002428chr1611181 ------
NM_002430chr2232415 962 945 --1371 --
NM_002442chr121169 ------
NM_002444chrX21797 86 1592 ----
NM_002473chr2241243 462 308 102 21315 189 --11125
NM_002481chr175746 5327 3133 1629 475 309 46 25282 2792 12009 15186
NM_002499chr1541877 763 636 331 ----22430 629
NM_002500chr241210 1193 1079 430 197 ----
NM_002509chr201577 ------
NM_002515chr1421421 132 --11381 1638
NM_002518chr221018 907 1168 --1930
NM_002519chr11--1585 1144 --
NM_002520chr51125 ------
NM_002522chr1723310 742 2899 262 ----
NM_002530chr15135 ------
NM_002545chr1133833 3719 1807 23463 1894 ----
NM_002569chr1511455 --11030 --
NM_002577chr332970 1324 510 24024 2753 13643 1941
NM_002578chrX--163 ----
NM_002581chr9115529 5345 5136 2050 1275 1159 1075 853 838 672 189 ------
NM_002582chr163374 270 33 ------
NM_002583chr12------187
NM_002590chr131392 ------
NM_002594chr2042467 2423 718 621 11700 ----
NM_002595chr1231683 1576 320 21923 434 ----
NM_002600chr11231 1717 ----
NM_002607chr721124 465 --11034 --
NM_002608chr2211223 154 ----
NM_002610chr232748 2193 2055 13106 ----
NM_002612chr741585 780 507 53 --1687 --
NM_002613chr16134850 4810 4428 4379 4341 4202 3679 1723 1480 778 629 399 389 34887 4070 1209 23311 1163 --
NM_002618chr22159 126 ------
NM_002628chr321122 989 ------
NM_002645chr1142974 2604 605 220 1152 ----
NM_002646chr151653 1592 638 385 176 ------
NM_002648chr63957 506 470 11066 ----
NM_002655chr835223 4266 3370 15278 14443 14749
NM_002657chr2023437 2386 21469 450 ----
NM_002660chr2041165 951 744 36 1975 ----
NM_002670chr331212 346 261 --11646 --
NM_002687chr142870 107 --189 --
NM_002698chr19289 22 12396 ----
NM_002709chr263075 3031 2769 1134 1065 361 --12702 --
NM_002716chr1163582 3387 2614 665 650 473 1900 ----
NM_002717chr8------1613
NM_002721chr91100 --1111 --
NM_002731chr153127 2880 2815 1978 386 11148 ----
NM_002734chr1731970 819 227 ----1413
NM_002736chr71507 22139 1774 ----
NM_002738chr1611088 ------
NM_002739chr192749 496 ------
NM_002745chr2293812 3529 3515 3356 1737 1686 921 872 273 ----1545
NM_002747chr18197 ------
NM_002748chr151779 ------
NM_002753chr4--1126 ----
NM_002755chr152322 242 --1799 --
NM_002756chr172976 236 --1305 --
NM_002768chr1671289 1115 1019 470 368 87 44 --21603 330 --
NM_002806chr142243 39 ------
NM_002811chr163206 145 64 ------
NM_002813chr1261470 1330 1283 944 486 327 --11451 --
NM_002814chrX3761 133 32 ------
NM_002822chr12181 ----21382 1145
NM_002823chr22644 601 ------
NM_002825chr72670 537 ------
NM_002830chr2--1143 170 --
NM_002834chr1223837 3308 13554 23849 813 --
NM_002839chr931320 883 380 1685 --1358
NM_002840chr131513 580 269 11557 1105 --
NM_002843chr1123387 2326 11331 ----
NM_002844chr611010 ----1334
NM_002845chr181511 --1183 1447
NM_002847chr7147 ------
NM_002848chr122995 831 --11184 --
NM_002852chr3----1244 --
NM_002855chr1153468 3446 3393 3381 2663 --1449 --
NM_002858chr11203 ------
NM_002865chr81253 ------
NM_002867chr13599 548 134 ------
NM_002868chr122846 187 ------
NM_002869chr1142226 1645 1555 133 22079 536 ----
NM_002873chr51502 ------
NM_002874chr942246 961 936 498 ------
NM_002880chr34667 280 208 112 --1156 --
NM_002890chr51351 ------
NM_002892chr142439 35 2390 171 --11453
NM_002893chrX1300 ------
NM_002897chr21524 1512 --1629
NM_002902chr152493 82 ------
NM_002906chr1112121 ------
NM_002912chr6--1702 1625 --
NM_002924chr12218 64 ----1101
NM_002931chr61206 ------
NM_002940chr431331 334 323 ------
NM_002941chr311047 ------
NM_002950chr3148 ------
NM_002951chr20----1249 --
NM_002959chr163718 3556 3148 1034 1019 121 ------
NM_002968chr161789 2288 277 1806 --
NM_002970chrX--1136 174 --
NM_002973chr121115 --1227 --
NM_002976chr2150 1200 ----
NM_002994chr41245 ----11454
NM_002996chr1631623 649 249 1434 1336 --
NM_002997chr241516 1354 1312 159 ------
NM_002998chr811459 22171 779 ----
NM_003010chr1771950 1736 1677 804 766 540 205 --1647 --
NM_003011chr9------11485
NM_003016chr1741628 1286 251 116 11654 ----
NM_003017chr61437 11278 --1472
NM_003022chrX21211 101 ------
NM_003026chr931259 1146 256 --172 --
NM_003028chr973361 2793 1217 785 445 431 86 --1150 --
NM_003030chr321481 305 ------
NM_003034chr12136619 6392 6256 6185 6028 6003 2551 1422 1274 689 371 356 240 28024 5075 26037 252 17891
NM_003037chr11204 ----1103
NM_003038chr242614 2596 2496 1721 --12020 1979
NM_003043chr343898 1352 426 39 1987 ----
NM_003045chr1364997 4325 3208 1452 1215 787 --11509 --
NM_003046chr865356 5000 3720 2075 771 84 35136 666 105 ----
NM_003047chr161437 1426 1360 1120 996 928 ------
NM_003048chr232467 928 891 ------
NM_003051chr131865 1581 518 11717 ----
NM_003063chr11177 ----1148
NM_003068chr83934 345 92 ------
NM_003069chrX2733 573 ------
NM_003071chr351859 1320 689 370 274 --11963 --
NM_003072chr191296 ------
NM_003075chr12----1248 --
NM_003076chr123598 517 57 --1111 --
NM_003081chr2051010 922 884 318 126 --133 --
NM_003087chr10----1224 --
NM_003091chr20----194 --
NM_003093chr6----169 --
NM_003099chr1576466 6027 5110 4414 2398 520 408 11296 --11890
NM_003108chr276926 6585 6237 1543 1085 1004 153 17086 ----
NM_003111chr21336 ----11148
NM_003112chr732893 932 723 134 ----
NM_003115chr11371 ------
NM_003127chr9--154 ----
NM_003128chr242447 1761 1140 316 1501 12458 --
NM_003131chr652216 1715 517 232 57 ------
NM_003136chr14--1386 ----
NM_003137chr622167 463 ------
NM_003144chr62742 558 --1315 --
NM_003150chr1722270 1709 12379 ----
NM_003155chr841953 1922 1859 462 12484 12402 --
NM_003156chr113323 273 232 --1937 --
NM_003161chr1753327 3173 1133 1053 275 --32713 2402 313 --
NM_003173chrX41086 563 397 67 1380 ----
NM_003178chr352212 1647 864 118 103 --11457 --
NM_003179chrX21330 122 ------
NM_003188chr6--1134 ----
NM_003199chr1855537 4459 3747 1321 875 14926 21026 888 --
NM_003202chr5151 ------
NM_003204chr1711579 --11802 --
NM_003206chr61327 ------
NM_003211chr1221665 1397 --11191 134
NM_003220chr641343 1299 111 99 ------
NM_003221chr623181 1366 --13737 --
NM_003223chr161528 ------
NM_003247chr61797 21666 1277 11232 --
NM_003250chr171189 ------
NM_003255chr1782574 2544 2473 2205 1927 990 848 804 ----11714
NM_003257chr15--11184 11269 --
NM_003262chr374863 4673 3965 3734 3444 1053 56 ------
NM_003263chr4144 ------
NM_003269chr64844 826 438 242 11172 ----
NM_003275chr951226 1107 971 325 88 ----11455
NM_003297chr12--122 ----
NM_003298chr365688 4745 2429 2179 1145 600 25063 1797 26186 5665 12230
NM_003304chr311087 --1250 --
NM_003305chr41404 ------
NM_003309chr621783 344 --21254 210 --
NM_003314chr53396 53 45 ------
NM_003330chr1221669 22 1480 ----
NM_003337chr51255 1205 ----
NM_003338chr101729 ------
NM_003340chr41348 11069 ----
NM_003341chr31645 ------
NM_003342chr171166 --13153 --
NM_003344chr741450 1103 639 464 21637 1424 ----
NM_003345chr162527 446 ------
NM_003347chr2252338 2261 2211 1844 501 --32322 1867 775 --
NM_003348chr1221331 576 ------
NM_003349chr2051357 1338 1321 1222 348 ------
NM_003350chr81767 ------
NM_003352chr221050 173 ------
NM_003369chr1121739 1124 --1837 --
NM_003370chr19------1617
NM_003371chr92716 464 --1374 --
NM_003373chr1031209 544 444 --1478 --
NM_003374chr5180 ----1813
NM_003376chr62489 281 ------
NM_003376chr62489 281 ------
NM_003378chr7169 ------
NM_003385chr2--1300 ----
NM_003387chr242779 972 235 47 ------
NM_003390chr1121036 269 1288 --1748
NM_003392chr342818 1611 1068 741 11261 14221 --
NM_003400chr22684 637 ------
NM_003404chr2031384 550 442 --1506 --
NM_003405chr22----1798 --
NM_003406chr81620 --168 --
NM_003410chrX3706 555 384 --1108 --
NM_003411chrY21620 30 --1103 --
NM_003412chr332529 1057 710 12368 ----
NM_003418chr31581 1779 ----
NM_003423chr1912331 11056 ----
NM_003435chr192784 40 ----1121
NM_003439chr732670 1359 905 1399 32822 1083 483 --
NM_003441chr43496 414 334 ------
NM_003453chr131631 --2597 54 --
NM_003457chr17157 ----1502
NM_003458chr353956 3578 1567 1051 49 13879 1275 13471
NM_003463chr632518 214 77 1625 1799 --
NM_003467chr21431 1385 ----
NM_003468chr243739 3156 455 99 1281 --24393 3958
NM_003470chr1631200 1193 711 ------
NM_003471chr341787 672 149 104 21764 243 ----
NM_003472chr631371 978 169 11309 11282 --
NM_003474chr1031809 215 148 ------
NM_003477chr11--1261 ----
NM_003478chr1163142 2591 749 632 329 74 11101 33065 410 214 23250 193
NM_003482chr1232093 705 375 --12721 --
NM_003483chr1262832 2664 2502 2436 2082 611 1240 ----
NM_003487chr17169 ------
NM_003488chr171232 1882 1386 --
NM_003489chr2142182 458 338 146 22975 2636 12390 --
NM_003498chr1622739 82 12519 ----
NM_003506chr811259 ------
NM_003507chr231519 1369 316 21876 371 ----
NM_003508chr72295 31 ------
NM_003513chr6126 ------
NM_003557chr141395 1121 323 81 ------
NM_003558chr91213 ------
NM_003563chr172206 55 --1933 --
NM_003566chr1253451 1393 1249 1062 409 23042 422 ----
NM_003569chr6--1618 ----
NM_003574chr1865666 4323 4195 4149 364 21 11661 --11640
NM_003576chr1342638 2441 1802 1065 2933 170 ----
NM_003580chr8------1477
NM_003583chr1222839 829 --13775 33694 3516 2517
NM_003586chr16--172 ----
NM_003589chr131914 ----1386
NM_003590chr273548 2765 2693 1193 752 383 248 13034 --23071 545
NM_003591chr102422 123 ------
NM_003603chr431941 555 164 --1427 --
NM_003610chr20--1329 ----
NM_003615chr353665 3131 2629 1363 444 --22663 94 --
NM_003618chr22430 349 ------
NM_003620chr172830 72 1206 1932 --
NM_003622chr1252506 2275 1865 673 121 1262 ----
NM_003624chr193525 392 34 ------
NM_003629chr143400 3132 3040 672 ------
NM_003630chr6----1671 --
NM_003632chr171312 1823 1776 --
NM_003633chr53989 695 446 52326 1663 789 337 143 ----
NM_003637chr11485 --1157 --
NM_003644chr1786531 5689 4827 4633 4476 2419 1321 1082 14647 24944 248 --
NM_003648chr292424 2400 2372 2320 2209 1046 1020 628 298 12589 --1114
NM_003654chr112257 73 --1613 --
NM_003659chr23832 310 290 ------
NM_003663chr32390 321 --12340 --
NM_003664chr5165 ------
NM_003668chr12--1118 1247 --
NM_003671chr943125 2379 1139 1025 1612 1234 1723
NM_003672chr141661 697 427 246 ------
NM_003684chr121012 889 --1711 --
NM_003685chr193848 781 233 ------
NM_003687chr511061 --2320 231 --
NM_003690chr22594 474 ------
NM_003701chr133792 672 412 ------
NM_003702chr82301 265 ------
NM_003709chr21339 ------
NM_003710chr15--1432 1462 --
NM_003711chr51115 ------
NM_003713chr121078 60 ------
NM_003716chr3--1937 ----
NM_003718chr7----1185 --
NM_003728chr4----1270 --
NM_003740chr641813 1351 1248 266 ------
NM_003741chr31343 ------
NM_003744chr14--1987 2475 235 --
NM_003750chr103955 706 105 1224 ----
NM_003758chr1561088 624 257 247 184 122 --135 --
NM_003758chr1561088 624 257 247 184 122 --135 --
NM_003759chr453267 1219 733 617 490 ------
NM_003760chr1----1628 --
NM_003768chr131800 671 516 11484 ----
NM_003774chr1263358 1334 1247 1208 354 180 ------
NM_003780chr1----1545 --
NM_003787chr182659 434 ------
NM_003792chr91140 ------
NM_003794chr341128 1087 843 218 --11072 --
NM_003795chr61225 ----182
NM_003799chr1833367 3188 156 14499 1121 2793 585
NM_003800chr641838 909 106 58 1191 ----
NM_003809chr171510 ------
NM_003816chr81971 193 ----
NM_003818chr203916 823 292 1813 ----
NM_003819chr11200 ------
NM_003821chr8157 ------
NM_003822chr142849 2686 2441 838 21231 1087 12499 --
NM_003827chr191436 ------
NM_003829chr92878 835 --2791 87 --
NM_003831chr1841816 1794 1324 409 ------
NM_003835chr171257 ------
NM_003846chr1--1712 ----
NM_003870chr1511863 12084 11329 --
NM_003872chr221990 624 --12336 --
NM_003873chr1041809 598 358 239 ------
NM_003877chr122979 811 ------
NM_003885chr1762683 2479 2169 1734 660 586 --12100 --
NM_003893chr101469 ------
NM_003895chr2132203 2081 1602 ----11962
NM_003899chr1362573 2348 1941 1841 766 513 ----21647 929
NM_003902chr11705 ------
NM_003907chr31333 ------
NM_003908chr2041376 1322 1109 1044 --1956 --
NM_003909chr842560 2430 401 379 11202 31977 1863 314 --
NM_003913chr653882 2748 1329 1025 879 --1378 --
NM_003916chrX21350 1154 1929 11505 --
NM_003922chr15163 ------
NM_003924chr421293 106 ------
NM_003930chr73611 462 225 ------
NM_003932chr2221708 591 11654 --1673
NM_003934chr9--1358 ----
NM_003936chr221071 981 1795 ----
NM_003938chr1931134 160 127 ------
NM_003941chr741699 1568 481 120 1108 --22524 709
NM_003947chr321330 348 ------
NM_003953chr152303 1898 1852 611 251 1203 2997 908 --
NM_003956chr10140 ------
NM_003958chr6103923 3883 3823 3046 2749 2443 1161 1099 935 179 --13732 --
NM_003968chr3193 ------
NM_003972chr103227 132 29 ------
NM_003980chr621073 972 ------
NM_003983chr1654035 3216 3121 1070 848 --1670 --
NM_003994chr1243270 919 360 294 --23764 1697 13036
NM_003998chr42646 277 ------
NM_004006chrX11071 12372 ----
NM_004007chrX11071 12372 ----
NM_004009chrX11071 12372 ----
NM_004010chrX11071 12372 ----
NM_004011chrX11071 12372 ----
NM_004012chrX11071 12372 ----
NM_004013chrX11071 12372 ----
NM_004014chrX11071 12372 ----
NM_004015chrX11071 12372 ----
NM_004016chrX1985 12286 ----
NM_004017chrX11071 12372 ----
NM_004018chrX1985 12286 ----
NM_004020chrX11071 12372 ----
NM_004021chrX1985 12286 ----
NM_004022chrX1985 12286 ----
NM_004023chrX1985 12286 ----
NM_004028chr1833290 3052 2585 ----14115
NM_004035chr1775041 4991 4568 4201 3757 3710 1369 14717 23407 262 --
NM_004037chr13835 810 575 1715 173 --
NM_004050chr1471938 1115 990 782 678 499 487 ------
NM_004055chr1171691 1423 1394 807 692 298 123 1903 ----
NM_004061chr51438 ------
NM_004067chr73523 450 225 ------
NM_004068chr31107 ------
NM_004075chr122412 119 127 ----
NM_004080chr72919 63 ------
NM_004087chr331995 1847 100 ------
NM_004093chr1362890 2202 768 285 248 85 13034 --12757
NM_004094chr1423014 2648 ------
NM_004102chr1------1575
NM_004103chr82250 68 --1616 --
NM_004107chr19----155 --
NM_004112chr172526 91 11666 1543 --
NM_004113chr31822 1193 1427 --
NM_004114chrX3873 316 52 11068 ----
NM_004115chr132144 125 ------
NM_004116chr22400 40 ------
NM_004124chr1432975 2662 2476 ------
NM_004133chr822456 113 21982 472 1661 --
NM_004136chr1542679 1106 976 56 ----13276
NM_004152chr191104 ------
NM_004156chr82532 477 1238 ----
NM_004157chr33346 124 115 ------
NM_004161chr22255 223 1556 ----
NM_004170chr911850 11219 ----
NM_004171chr11128180 7330 6764 6358 6100 3477 2757 2203 1972 1612 1091 176 17552 29001 246 26618 6282
NM_004177chr11--2360 23 ----
NM_004185chr11688 ------
NM_004186chr32901 193 ------
NM_004202chrY1219 1697 1124 --
NM_004211chr11------1170
NM_004227chr752271 2208 2079 209 116 --11972 --
NM_004232chr1883643 3563 3040 1091 752 658 307 95 ------
NM_004235chr9--1547 ----
NM_004236chr15--2456 164 --1230
NM_004238chr21280 ------
NM_004240chr19141 ------
NM_004267chr31146 ------
NM_004268chr112311 103 ------
NM_004272chr531384 1313 600 21711 1367 ----
NM_004274chr1421283 801 21053 752 ----
NM_004281chr101480 --1384 --
NM_004291chr51138 ------
NM_004293chr933828 970 898 ------
NM_004294chr13--1702 ----
NM_004296chr1434022 3848 3044 13470 ----
NM_004302chr1231840 360 168 12943 1701 --
NM_004319chr142218 2120 1063 25 ------
NM_004326chr11482 1316 ----
NM_004327chr2242103 1940 615 424 ------
NM_004329chr101560 ------
NM_004330chr1541119 876 53 39 1168 ----
NM_004331chr822115 713 --1722 --
NM_004338chr1897006 6281 5429 5295 4645 4595 965 642 597 65526 5474 4993 2589 1890 779 57052 6995 6635 4344 1309 --
NM_004342chr73563 404 85 --1237 --
NM_004346chr411400 --21052 290 1103
NM_004349chr81380 --11233 --
NM_004352chr161516 ------
NM_004354chr42795 276 ------
NM_004360chr1641933 1565 1414 37 11325 ----
NM_004365chr5------133
NM_004369chr23674 650 234 1152 ----
NM_004370chr632124 1698 25 1661 ----
NM_004379chr24670 589 473 350 11196 --11292
NM_004380chr1622168 636 --1976 12560
NM_004383chr15------1539
NM_004384chr531667 828 50 52102 1736 880 706 681 ----
NM_004385chr5--1672 ----
NM_004386chr1932232 858 405 ------
NM_004388chr11333 --180 --
NM_004392chr1332202 606 265 --1777 --
NM_004393chr352165 1744 746 725 508 ------
NM_004397chr1154232 3913 1578 1242 215 23960 1173 ----
NM_004411chr74811 588 260 106 1507 ----
NM_004414chr2111078 --1131 1174
NM_004416chr121946 ------
NM_004420chr1152139 1829 1755 1534 945 12031 ----
NM_004426chr12--1597 ----
NM_004429chrX31455 1374 1081 ------
NM_004430chr852688 2294 755 662 459 ------
NM_004431chr13185 76 67 1688 ----
NM_004432chr922006 452 ------
NM_004438chr243025 2115 538 317 11181 --1309
NM_004441chr32531 148 ------
NM_004447chr1241148 1040 811 347 ------
NM_004454chr332059 1569 1478 12040 11986 11911
NM_004457chr21504 --11716 --
NM_004458chrX61977 1764 1006 759 590 307 2560 450 ----
NM_004459chr1731831 689 429 21956 405 11577 --
NM_004464chr423951 3811 34318 3961 3508 1509 --
NM_004469chrX164 --148 --
NM_004481chr132462 903 797 12580 ----
NM_004487chr31929 ------
NM_004491chr1943941 3880 3151 3027 ------
NM_004494chr1142 ------
NM_004496chr143976 534 39 ------
NM_004501chr112505 --21356 311 --
NM_004502chr171521 --1383 --
NM_004504chr222581 396 1654 --21946 277
NM_004505chr1742020 1726 809 391 ------
NM_004506chr61736 ------
NM_004508chr101814 --1877 11121
NM_004514chr1762958 2654 2546 2520 1051 321 ------
NM_004524chr17------1196
NM_004525chr231476 1459 521 --11520 --
NM_004530chr1631020 306 190 ------
NM_004535chr2021639 1624 ------
NM_004540chr211189 ------
NM_004554chr1451742 1524 1477 304 187 ------
NM_004571chr2143049 2597 2365 1299 1419 12996 --
NM_004575chr421456 621 11449 11623 --
NM_004576chr51324 ------
NM_004586chrX45254 4989 3404 137 14243 1125 13318
NM_004588chr1163652 3081 2676 2670 620 411 1821 ----
NM_004598chr52440 108 ------
NM_004599chr222666 172 1499 ----
NM_004602chr2031182 1171 188 ------
NM_004603chr731094 445 61 ------
NM_004612chr934617 3567 312 24412 3105 13977 --
NM_004616chr12----150 --
NM_004620chr11------1243
NM_004622chr262143 2023 1938 1883 892 515 11943 1713 --
NM_004634chr31441 ------
NM_004635chr351093 461 449 287 239 ------
NM_004643chr141278 ------
NM_004651chrX1363 ------
NM_004655chr17----2418 262 --
NM_004656chr331174 501 364 ------
NM_004660chrY32301 1836 1710 11522 ----
NM_004663chr15--11434 ----
NM_004667chr15161 ----1238
NM_004671chr18------1206
NM_004687chr171249 12088 21477 310 --
NM_004690chr6----1738 --
NM_004694chr171781 ------
NM_004698chr11171 ------
NM_004703chr1722581 1845 11732 --1457
NM_004705chr114838 649 594 573 ------
NM_004709chrX11686 ------
NM_004719chr1242841 2425 1799 1159 --1634 --
NM_004725chr10130 21449 207 ----
NM_004726chrX74917 4693 3611 2093 2030 1688 1063 14974 21334 271 --
NM_004729chrX--160 --12164
NM_004730chr531463 549 515 2442 365 ----
NM_004734chr1352658 2519 856 547 314 --1838 --
NM_004736chr11837 ------
NM_004737chr22------137
NM_004742chr321830 340 11339 ----
NM_004745chr846622 5560 2554 2114 11318 --12091
NM_004747chr10----21395 375 1293
NM_004748chr1534088 3767 1186 12688 ----
NM_004759chr161524 574 471 425 296 37 ------
NM_004760chr732018 2001 238 11952 ----
NM_004765chr16125 ------
NM_004768chr121140 249 ----173
NM_004772chr511214 --1529 --
NM_004776chr2062965 2837 2648 1308 963 769 --23000 2586 --
NM_004779chr52375 54 ------
NM_004781chr141243 526 280 27 --11229 --
NM_004781chr141243 526 280 27 --11229 --
NM_004788chr111386 --21968 1838 12562
NM_004792chr2178 ------
NM_004795chr1331848 1828 1818 ------
NM_004796chr1422364 2162 1257 ----
NM_004798chr2072650 2632 1466 1296 1169 656 163 13078 13028 --
NM_004799chr1--140 ----
NM_004801chr221275 544 31552 1478 1084 1265 --
NM_004815chr134463 3980 1305 ------
NM_004826chr2--1297 ----
NM_004831chr19----1195 2868 679
NM_004835chr31829 1658 ----
NM_004835chr31829 1658 ----
NM_004840chrX42344 2325 636 198 11777 ----
NM_004841chr1----193 --
NM_004845chrX64072 3478 3227 3164 2999 532 ----14007
NM_004849chr621306 1201 21105 119 ----
NM_004850chr21602 1566 11302 --
NM_004856chr15----1436 --
NM_004857chr1423246 1742 ----14460
NM_004859chr1742413 849 785 675 22329 682 ----
NM_004860chr17143 ------
NM_004865chr61377 2171 54 ----
NM_004871chr1773747 3491 3426 2718 1570 511 184 13527 12832 --
NM_004879chr11--1857 ----
NM_004884chr1521773 436 1375 ----
NM_004887chr521073 406 ------
NM_004890chr17166 ------
NM_004896chr1021376 356 11166 ----
NM_004898chr462732 2245 2041 1967 801 518 --1157 1608
NM_004904chr776268 5356 1812 1176 451 440 150 26448 6407 36048 5204 1542 --
NM_004906chr6----1235 --
NM_004912chr7------11136
NM_004926chr141627 ------
NM_004929chr811468 ------
NM_004938chr921259 84 ------
NM_004945chr19190 1228 ----
NM_004947chr322607 165 1435 12254 --
NM_004953chr31384 ------
NM_004958chr13901 800 175 --1585 --
NM_004959chr951321 1284 998 951 232 21311 1162 ----
NM_004961chrX3485 352 161 ------
NM_004968chr71276 --187 --
NM_004973chr641590 1326 1277 1075 21501 75 ----
NM_004974chr1150 ------
NM_004976chr1153856 1775 1424 619 127 13614 13978 --
NM_004978chr131731 1722 551 --21683 1379 --
NM_004985chr1254464 4390 4181 4085 318 ------
NM_004992chrX117998 7642 7619 7397 6960 6925 6363 5569 2178 1945 1384 21185 282 13186 12464
NM_004992chrX117998 7642 7619 7397 6960 6925 6363 5569 2178 1945 1384 21185 282 13186 12464
NM_004999chr631167 1072 679 13060 ----
NM_005006chr21727 ------
NM_005010chr721713 1613 1112 ----
NM_005016chr12136 ------
NM_005023chr521408 1303 ------
NM_005028chr101664 --11535 --
NM_005032chrX--1293 2839 270 --
NM_005044chrX44535 3787 3103 1609 14482 14307 1545
NM_005045chr73623 211 46 ------
NM_005054chr221399 1389 --1273 --
NM_005063chr1043386 3338 2919 2431 12966 13610 --
NM_005065chr1455408 5297 5091 3795 3664 --23717 1752 14056
NM_005066chr1--1758 ----
NM_005067chr3--1280 1212 --
NM_005078chr153387 369 244 1537 ----
NM_005093chr20115055 4090 4019 3243 1563 1398 1130 1013 811 540 176 1589 ----
NM_005099chr151181 1118 1036 973 75 ------
NM_005105chr162113 1933 1844 461 298 87 ------
NM_005109chr332240 1021 57 ------
NM_005116chr2064535 4159 3895 1718 605 148 23792 1313 --13285
NM_005117chr114842 669 225 32 1272 1650 --
NM_005120chrX--1206 ----
NM_005121chr1713735 ----23230 3111
NM_005123chr121121 ------
NM_005126chr322006 1710 ------
NM_005134chr181673 2803 623 1820 --
NM_005135chr1563131 2960 2779 2716 2542 394 1532 --13776
NM_005139chr41321 ------
NM_005151chr18101970 1586 962 864 696 498 475 383 320 199 --12278 --
NM_005153chr163739 266 219 --1759 --
NM_005156chr934175 3857 3536 11970 11562 15002
NM_005171chr1211065 ------
NM_005174chr10146 ------
NM_005180chr1031535 1289 549 ------
NM_005187chr161151 --173 --
NM_005188chr11127966 7373 6918 6739 6194 2870 2477 1899 1564 1301 772 424 12882 ----
NM_005190chr641120 833 780 756 ------
NM_005194chr201442 ------
NM_005197chr1446060 5576 5203 2353 15194 25622 734 14437
NM_005201chr33899 212 122 ------
NM_005202chr141524 909 601 22 --1562 --
NM_005204chr102635 61 ------
NM_005206chr1711176 ------
NM_005207chr22103471 3452 2988 2717 1397 837 773 382 303 25 1968 ----
NM_005219chr551607 630 474 270 143 ------
NM_005221chr7150 ------
NM_005222chr7------1689
NM_005233chr332533 1584 879 --12437 11642
NM_005235chr266774 6743 6651 6111 2835 2211 15964 37268 5551 287 --
NM_005238chr1153498 2406 2246 911 799 --23052 2723 --
NM_005243chr22192 ------
NM_005249chr142813 776 ------
NM_005252chr141274 ------
NM_005254chr152405 378 ------
NM_005257chr181952 ----11202
NM_005273chr71227 ------
NM_005277chr421781 686 ----11318
NM_005284chr61390 1460 ----
NM_005295chr71112 ------
NM_005296chrX1154 ------
NM_005311chr721065 180 1981 --1897
NM_005313chr151241 ------
NM_005318chr2211259 ------
NM_005324chr1721780 183 11331 --21797 98
NM_005328chr81109 ------
NM_005335chr3--181 ----
NM_005339chr474297 3853 3828 3470 3345 1671 687 33583 1731 389 13752 --
NM_005340chr51176 ------
NM_005342chrX72635 2218 1783 813 598 287 87 ------
NM_005347chr921595 456 122 ----
NM_005358chr13154 130 1597 --
NM_005359chr1875364 4494 4222 3999 2342 2110 135 16119 14663 --
NM_005369chrX2662 105 ------
NM_005374chr172814 214 11961 1646 --
NM_005376chr12745 229 ------
NM_005378chr22194 87 1851 ----
NM_005382chr81431 ------
NM_005385chr322559 1844 12448 1373 --
NM_005392chr9------11438
NM_005397chr761597 1427 1394 1316 414 225 23801 951 ----
NM_005398chr1031150 965 295 --11268 --
NM_005399chr144413 4275 4142 3474 --23172 2884 --
NM_005400chr2----1819 134
NM_005402chr7--1493 ----
NM_005406chr183578 274 129 ------
NM_005407chr142558 23 --11049 --
NM_005410chr51604 ------
NM_005413chr2----1302 --
NM_005415chr21309 ------
NM_005429chr4152 ------
NM_005430chr122751 727 1264 ----
NM_005431chr721582 423 11320 ----
NM_005433chr1822180 1076 ------
NM_005436chr1084116 4093 3965 3627 2728 2704 1230 765 1823 23365 1290 --
NM_005440chr1743182 846 572 202 ------
NM_005442chr33629 623 457 1169 ----
NM_005455chr121540 584 11345 1537 --
NM_005458chr9--22459 67 ----
NM_005461chr203715 656 393 ------
NM_005493chr61555 ------
NM_005497chr1765347 5305 4959 4675 4604 1298 1368 34897 4050 112 --
NM_005499chr19----1262 1175
NM_005502chr913260 12964 --22743 1305
NM_005503chr15--11121 ----
NM_005504chr1276526 5228 4432 4050 2631 1308 629 168 14580 --
NM_005506chr472240 2179 721 545 420 282 92 ------
NM_005507chr111405 --1340 --
NM_005509chr511484 11210 --1220
NM_005512chr1171988 1674 1646 1507 782 312 239 2372 147 --1763
NM_005513chr331576 209 186 1514 ----
NM_005517chr11126 ------
NM_005523chr7--11587 ----
NM_005537chr132433 62 1789 1741 --
NM_005539chr1021326 1276 11096 ----
NM_005544chr22742 380 ------
NM_005546chr521529 524 11841 31683 636 535 --
NM_005562chr131437 342 198 --21704 1670 11240
NM_005563chr12358 153 2896 241 ----
NM_005565chr52577 44 ------
NM_005573chr5--1195 ----
NM_005578chr343978 3445 3338 348 14856 ----
NM_005581chr19--1369 1483 --
NM_005586chr6--1646 ----
NM_005587chr151922 ------
NM_005595chr11188 ----1654
NM_005596chr975279 4891 4073 2418 1311 1086 544 35263 5171 1573 ----
NM_005604chr61698 --1435 --
NM_005607chr81830 ------
NM_005610chr11608 ------
NM_005613chr111975 --1123 --
NM_005618chr61110 --179 --
NM_005626chr1--196 ----
NM_005627chr61664 ------
NM_005631chr711037 1701 ----
NM_005634chrX2585 108 1147 ----
NM_005637chr1832049 1882 1819 ------
NM_005638chrX3644 500 494 ------
NM_005639chr121324 ------
NM_005647chrX53136 2763 2753 2372 647 --22976 370 --
NM_005648chr8----188 --
NM_005650chr2221164 988 ------
NM_005655chr831000 994 330 ------
NM_005657chr151149 ------
NM_005667chr21136 --1394 --
NM_005668chr543513 3333 920 693 24466 3389 ----
NM_005669chr531993 943 579 12054 2262 97 --
NM_005686chr13612 483 89 1523 ----
NM_005688chr341237 1200 1163 932 1429 ----
NM_005708chr13------1296
NM_005711chr5--1996 ----
NM_005715chr652390 2136 904 859 129 ------
NM_005717chr111251 ------
NM_005721chr21953 ------
NM_005722chr231686 575 240 1489 1313 --
NM_005724chr15168 ------
NM_005725chr122435 115 1825 ----
NM_005731chr2----181 --
NM_005734chr113751 599 506 ------
NM_005735chr22789 25 ------
NM_005736chr103503 431 356 ------
NM_005737chr262089 1114 961 678 502 323 12872 12937 --
NM_005738chr721936 152 11819 ----
NM_005742chr22689 286 ------
NM_005746chr712305 ------
NM_005748chr1223159 1191 1446 ----
NM_005759chr2144774 4684 4307 3494 3312 3137 1414 1364 1151 887 733 711 593 208 33989 1076 716 12921 --
NM_005765chrX1829 ------
NM_005766chr13--1398 ----
NM_005768chr121138 ------
NM_005776chr142845 660 ------
NM_005777chr3181 ------
NM_005778chr3198 ----1342
NM_005779chr512335 11102 23138 572 22687 968
NM_005786chr18198 1845 ----
NM_005795chr242470 2179 2102 372 12695 ----
NM_005796chr161135 ------
NM_005801chr17----1179 --
NM_005808chr363434 3239 3059 2862 997 554 ----1627
NM_005819chr13857 338 276 2477 117 1794 --
NM_005822chr621702 282 12209 ----
NM_005826chr11111 ------
NM_005828chr1764896 4355 4175 3784 362 190 14117 ----
NM_005840chrX105347 5268 4941 2768 1800 1740 964 943 700 378 32233 1973 1599 12309 --
NM_005841chr41125 --1841 --
NM_005842chr131125 1717 ----
NM_005850chr11172 ----174
NM_005852chr1741071 1052 220 76 ------
NM_005859chr52452 213 21577 1537 1631 --
NM_005862chr32882 185 11086 --1737
NM_005868chr712357 ------
NM_005871chr10----1245 --
NM_005876chr21772 ------
NM_005877chr2221940 541 12204 ----
NM_005880chr1621459 1219 ------
NM_005882chr42911 905 ------
NM_005885chr53331 192 162 ------
NM_005886chr162222 109 1262 ----
NM_005892chr17----1299 --
NM_005898chr1122163 1003 1875 ----
NM_005899chr172512 33 ------
NM_005900chr42765 429 ------
NM_005901chr18108096 7650 5597 2345 2324 1474 1434 1234 1189 346 27979 2240 26229 2590 --
NM_005902chr1564357 4141 3147 2995 2808 1496 14364 ----
NM_005903chr555091 5058 3230 1108 793 23606 543 14624 24817 810
NM_005904chr18160 ------
NM_005905chr132466 334 ------
NM_005910chr17103967 3627 3130 2664 2625 1537 1164 959 717 611 14127 ----
NM_005917chr2----1173 --
NM_005920chr153501 2662 1495 1449 665 23777 643 --1315
NM_005924chr72794 42 ----1776
NM_005930chr14165 ------
NM_005933chr1142220 1192 641 319 ----12691
NM_005935chr455238 4638 1011 976 705 ------
NM_005937chr1753361 2968 1624 565 122 ------
NM_005938chrX11329 --1320 --
NM_005941chr842981 2736 2709 208 --178 --
NM_005955chr1134983 4464 3917 3805 3511 2106 2043 1882 1757 1412 867 699 413 13617 1352 11223
NM_005962chr1022004 718 12175 ----
NM_005962chr1022004 718 12175 ----
NM_005966chr231731 346 89 1201 ----
NM_005967chr12--1506 ----
NM_005994chr172679 58 ------
NM_006007chr934423 3909 1772 ------
NM_006010chr31187 ------
NM_006011chr1543654 2908 1182 1005 ------
NM_006015chr131051 115 68 ----11024
NM_006016chr62312 246 32240 2222 1799 ----
NM_006017chr421009 392 1811 1741 --
NM_006022chr1321099 31 11066 ----
NM_006030chr32344 317 --11380 --
NM_006032chr14----1169 --
NM_006036chr232404 2072 1603 ----1648
NM_006038chr2032182 2104 793 ------
NM_006043chr161682 ------
NM_006047chr2073456 3307 2239 1059 818 573 43 2545 187 ----
NM_006048chr12455 403 ------
NM_006060chr784023 3703 3553 1244 1197 758 450 111 ------
NM_006062chr22379 197 11096 ----
NM_006076chr742909 2634 2040 975 13170 11119 --
NM_006079chr61171 ------
NM_006080chr731895 1823 766 12975 ----
NM_006086chr162282 83 ------
NM_006089chrX41495 1432 1293 596 ----11846
NM_006090chr12202 109 ------
NM_006095chr422894 435 44300 3757 3570 966 11147 1702
NM_006100chr32114 76 ------
NM_006106chr1153209 2429 2202 496 167 --12987 --
NM_006113chr141761 1344 172 154 11897 --12011
NM_006116chr2221581 385 1365 ----
NM_006122chr1532535 1111 150 --1814 --
NM_006133chr111810 32411 2149 516 1696 --
NM_006135chr11275 ------
NM_006136chr721327 101 --1441 --
NM_006139chr222775 2373 --1552 --
NM_006141chr161482 --12474 12618
NM_006148chr1722334 590 12246 ----
NM_006153chr34621 238 69 26 ------
NM_006154chr1522776 2045 1190 1213 --
NM_006157chr111322 ------
NM_006158chr83446 220 155 --11556 --
NM_006160chr17----11068 --
NM_006164chr21173 ------
NM_006166chr1221012 249 21694 505 11051 12565
NM_006178chr1711187 --2566 220 1369
NM_006180chr912104 1502 11577 --
NM_006186chr241234 942 519 180 2484 369 ----
NM_006191chr12128 --1929 --
NM_006194chr1431218 1163 258 ------
NM_006196chr22383 37 ------
NM_006197chr81474 11534 ----
NM_006198chr211254 ------
NM_006201chrX31015 903 139 ------
NM_006203chr532177 1280 1139 13503 --1852
NM_006206chr442284 1025 474 194 12759 ----
NM_006209chr81360 ------
NM_006216chr21615 ------
NM_006224chr1752308 2096 1982 887 718 1252 --1987
NM_006226chr21419 1332 --11411
NM_006237chr1351825 1473 1395 202 175 ------
NM_006238chr631956 689 252 1615 1793 --
NM_006241chr341744 1590 932 925 1524 ----
NM_006243chr1--3391 327 166 ----
NM_006246chr141974 ------
NM_006247chr191100 ------
NM_006251chr533156 3045 2099 --1696 --
NM_006252chr1106884 6379 6284 4778 2943 2352 1825 1394 487 356 --1409 12628
NM_006254chr32343 93 ------
NM_006256chr132670 998 696 1905 1959 --
NM_006257chr1021007 983 --1921 --
NM_006258chr101568 1273 1127 --
NM_006264chr4------1169
NM_006265chr821482 296 1980 ----
NM_006266chr91629 ------
NM_006275chr202536 436 ------
NM_006281chr81181 1313 ----
NM_006281chr81181 1313 ----
NM_006282chr2044561 4101 3297 3070 13180 24265 923 --
NM_006283chr8114816 4678 4292 4280 1959 1440 1104 737 225 154 137 11512 21827 542 --
NM_006292chr112207 200 1232 ----
NM_006293chr1541026 701 374 133 ------
NM_006306chrX44443 2201 1105 223 11734 --13925
NM_006312chr121749 ------
NM_006313chr1251523 1294 1215 345 272 ------
NM_006315chr434506 3717 770 14396 34097 2969 470 --
NM_006320chr4196 1193 1176 --
NM_006321chr331983 828 203 21770 696 1448 21799 73
NM_006323chr4--1617 1208 --
NM_006325chr122822 132 1257 ----
NM_006330chr8--21625 1369 2540 392 --
NM_006333chr22680 627 --1560 --
NM_006334chr9------2287 26
NM_006343chr21136 150 ----
NM_006345chr421365 386 ------
NM_006352chr141663 1550 578 491 --12031 --
NM_006353chr621371 112 ------
NM_006357chr2--157 1414 --
NM_006359chrX92456 2282 1996 1595 963 887 593 464 247 ------
NM_006372chr6----1507 --
NM_006375chrX41596 1564 1500 404 1212 ----
NM_006377chr921233 443 ------
NM_006380chr1753475 3301 1531 1349 74 --21454 982 --
NM_006386chr2242400 2122 844 304 12350 ----
NM_006390chr122564 109 ------
NM_006391chr11123 ------
NM_006393chr1054217 3519 3238 1349 231 2930 769 14032 --
NM_006405chr14126 ------
NM_006420chr2032564 2525 440 31236 195 26 ----
NM_006421chr83915 206 173 ------
NM_006424chr431900 1838 715 ------
NM_006434chr1042540 610 340 199 13248 ----
NM_006439chr41405 ------
NM_006451chr52275 106 ------
NM_006454chr483068 2945 2819 2319 1205 1048 129 103 1316 --1981
NM_006457chr434044 2752 2733 --13188 23058 2697
NM_006459chr1041986 1791 1398 1340 11704 ----
NM_006465chr1512290 21462 167 ----
NM_006466chr202817 127 ------
NM_006469chr121160 1092 --199 1149
NM_006471chr18136 ------
NM_006482chr1222839 829 --13775 33694 3516 2517
NM_006489chr1421421 132 --11381 1638
NM_006496chr1164 1292 ----
NM_006504chr103757 680 303 12482 22875 618 --
NM_006517chrX22209 2026 ------
NM_006526chr2031861 1743 565 1635 ----
NM_006527chr41127 1679 ----
NM_006534chr2022595 212 --13322 --
NM_006537chr153578 397 212 ------
NM_006538chr233483 989 627 24149 3349 --12845
NM_006540chr831194 619 284 ------
NM_006544chr1435541 4141 1873 --24745 300 --
NM_006545chr3132 ------
NM_006546chr1736661 2198 1496 --11619 --
NM_006555chr741951 1531 1490 26 ------
NM_006557chr94613 593 563 366 ------
NM_006559chr1177 ------
NM_006561chr10175910 5869 5467 5320 4482 4327 4049 3995 3802 2158 2110 1938 1465 1360 1259 784 441 1260 ----
NM_006565chr162239 181 11273 ----
NM_006572chr1753099 2813 969 644 439 22195 202 1694 --
NM_006589chr12172 159 2205 110 ----
NM_006593chr2--1223 ----
NM_006595chr111154 --1779 --
NM_006599chr1647342 7284 2887 1056 1169 1161 15849
NM_006601chr12--11005 --1107
NM_006603chrX31907 1638 745 ------
NM_006609chr212574 ------
NM_006614chr343277 3196 141 98 --1342 --
NM_006618chr131467 1120 570 --11166 --
NM_006622chr53557 372 86 ------
NM_006624chr1021630 1609 1247 11467 --
NM_006625chr1--163 ----
NM_006625chr1--163 ----
NM_006625chr1--163 ----
NM_006628chr1554628 3698 3635 2975 134 --1988 11762
NM_006629chr1832153 2033 1884 ------
NM_006634chr22226 190 1178 ----
NM_006646chr1341976 1217 1071 335 1207 12964 --
NM_006650chr583927 3900 3810 3798 3707 3535 1519 382 11262 ----
NM_006654chr1262975 1353 1290 885 605 271 --14025 --
NM_006675chr1242150 1179 919 36 12109 11128 --
NM_006677chr32200 23 ------
NM_006690chr2031575 1459 811 ----1625
NM_006699chr12860 826 ------
NM_006702chr19--1155 ----
NM_006703chr6--1438 1150 --
NM_006706chr52792 654 ------
NM_006711chr162519 169 --1185 --
NM_006717chr922434 1051 --23138 1243 --
NM_006720chr1085059 5024 4839 4234 1248 1174 968 330 21788 1254 11007 --
NM_006722chr322965 698 ----12448
NM_006726chr411059 1862 --1408
NM_006727chr5----152 --
NM_006729chrX35572 4148 1584 25217 4679 11215 --
NM_006732chr1922143 856 11464 --12047
NM_006734chr631070 566 526 ------
NM_006736chr281882 1723 1207 648 521 504 338 172 --1484 --
NM_006738chr1544326 3395 1272 62 14165 23960 1368 14488
NM_006741chr1241084 836 724 304 ------
NM_006745chr4--11082 ----
NM_006749chr831207 1093 521 --11232 --
NM_006751chr21344 ------
NM_006754chr731205 133 36 --2786 53 --
NM_006761chr171577 --1560 --
NM_006763chr141552 1335 759 228 --2642 42 --
NM_006766chr832714 1895 396 1107 ----
NM_006769chr1----1575 --
NM_006775chr633037 2432 950 1866 22219 530 --
NM_006777chrX12113 21120 759 12377 --
NM_006788chr1851942 1853 1463 793 404 --11889 --
NM_006791chr152477 206 ----1245
NM_006802chr12389 146 11128 ----
NM_006803chr821599 730 21587 1284 ----
NM_006805chr521687 678 ------
NM_006806chr21131 ------
NM_006807chr171247 ------
NM_006811chr202332 261 ------
NM_006813chr6--195 ----
NM_006814chr20--22356 173 1391 12594
NM_006815chr1211091 11295 2513 217 --
NM_006823chr821287 477 1112 --11004
NM_006826chr21924 1206 ----
NM_006827chr1473366 2748 2384 2318 1175 858 412 22516 947 12176 --
NM_006828chr6----1194 --
NM_006832chr141945 --173 --
NM_006838chr122384 83 --21477 1251 --
NM_006846chr5----1252 --
NM_006851chr122945 553 --1355 --
NM_006852chr1732794 2784 2268 --12435 --
NM_006854chr731718 1389 723 1115 --1245
NM_006874chr42892 193 1828 ----
NM_006884chr321481 305 ------
NM_006885chr1634077 2862 981 23355 869 ----
NM_006887chr2149 ------
NM_006888chr1473242 2975 2786 2398 1232 806 613 ------
NM_006892chr202544 387 --11167 --
NM_006892chr202544 387 --11167 --
NM_006908chr711343 11141 ----
NM_006910chr161128 1112 ----
NM_006912chr121972 252 2517 42 11923 --
NM_006915chrX42577 2492 1746 619 ------
NM_006920chr212004 --11828 1577
NM_006922chr222056 208 21759 845 ----
NM_006924chr1753889 3112 788 294 35 --14006 --
NM_006927chr163804 711 114 ----195
NM_006931chr1231321 731 691 --21564 102 --
NM_006936chr2151123 994 905 477 43 11226 ----
NM_006940chr1211605 ------
NM_006941chr221930 1241 ----
NM_006946chr113188 112 99 ------
NM_006947chr441307 1216 718 276 --11139 --
NM_006951chr10--1776 1128 --
NM_006963chr10--11234 ----
NM_006965chr1811127 ------
NM_006981chr91625 11866 12491 12715
NM_006982chr12187 ------
NM_006990chr151929 1849 1598 885 653 1261 ----
NM_006997chr10262 33 ------
NM_007005chr931263 1160 1150 --1511 11355
NM_007006chr1632785 2243 707 1512 13336 1338
NM_007007chr1234624 1540 950 13890 1195 1938
NM_007008chr21814 1298 ----
NM_007011chr1576661 6509 4546 2353 1495 591 449 --26612 750 --
NM_007015chr13181 126 ----
NM_007017chr51677 ------
NM_007026chr17--1557 ----
NM_007030chr5105184 5115 5099 5069 4328 3934 1498 819 560 353 14409 ----
NM_007034chr11954 --1804 1971
NM_007038chr2174657 4563 4550 3913 3682 1758 557 ----15611
NM_007039chr1431699 895 323 ----12264
NM_007050chr20117888 6921 5492 3080 2432 1934 1511 465 353 180 42 25105 2866 27181 195 --
NM_007054chr573850 3065 2903 2846 2482 1062 747 23879 523 22419 420 --
NM_007067chr17180 --11305 --
NM_007084chr132350 307 1460 ----
NM_007087chr162795 287 ------
NM_007096chr9185 ------
NM_007107chr31719 1254 --12388
NM_007118chr51856 1229 ----
NM_007124chr64415 122 115 44 --11649 --
NM_007125chrY41202 1041 178 152 ------
NM_007126chr92522 477 1165 1364 --
NM_007135chr9----1174 --
NM_007137chrX85304 5099 4722 3667 3495 3357 901 245 34281 3964 3514 ----
NM_007144chr172499 294 ----11318
NM_007146chr1712565 ------
NM_007150chrX2609 82 ------
NM_007158chr11790 ------
NM_007159chr3160 11538 ----
NM_007166chr11185 11271 ----
NM_007172chr2222063 40 ----12759
NM_007174chr1252265 1816 1799 1542 817 ------
NM_007184chr35546 397 359 209 168 ------
NM_007197chr1211050 --1153 --
NM_007198chr82570 435 --11510 --
NM_007200chr1544326 3395 1272 62 14165 23960 1368 14488
NM_007203chr933790 3436 2944 2470 314 23494 2926 --
NM_007207chr1128 ------
NM_007212chr132207 794 102 ------
NM_007214chr6298 53 ------
NM_007216chr112365 321 ------
NM_007217chr31123 ----1341
NM_007218chr81115 ------
NM_007222chr82593 156 --11329 11392
NM_007224chr121630 ------
NM_007236chr1551738 1675 851 368 265 1120 1623 --
NM_007249chr1368867 2259 1697 1152 259 232 17500 ----
NM_007255chr53571 534 507 ------
NM_007257chr851921 1858 1133 483 416 ------
NM_007269chr12188 42 --167 --
NM_007270chr731570 1539 1261 --11513 --
NM_007282chr3--1205 --1716
NM_007285chr161437 ------
NM_007292chr1775041 4991 4568 4201 3757 3710 1369 14717 23407 262 --
NM_007294chr1751341 1166 1128 514 287 ------
NM_007295chr1751341 1166 1128 514 287 ------
NM_007296chr1751341 1166 1128 514 287 ------
NM_007297chr1751341 1166 1128 514 287 ------
NM_007298chr1751341 1166 1128 514 287 ------
NM_007299chr1751341 1166 1128 514 287 ------
NM_007300chr1751341 1166 1128 514 287 ------
NM_007302chr1751341 1166 1128 514 287 ------
NM_007303chr1751341 1166 1128 514 287 ------
NM_007304chr1751341 1166 1128 514 287 ------
NM_007305chr1751341 1166 1128 514 287 ------
NM_007322chr193525 392 34 ------
NM_007324chr1--140 ----
NM_007327chr91377 ------
NM_007331chr462326 2192 2089 621 425 285 --32640 2000 821 --
NM_007345chr1811810 ------
NM_007347chr1563107 2492 2429 2262 1100 553 ------
NM_007349chr7173 ------
NM_007350chr1253364 1181 1115 888 870 13702 23209 1814 --
NM_007358chr12748 410 ------
NM_007363chrX1141 --2975 865 --
NM_007373chr1031790 1480 1133 31720 1126 359 ----
NM_007374chr141470 --1409 --
NM_007375chr142642 1819 1103 239 1593 --11113
NM_009585chr31829 1658 ----
NM_009585chr31829 1658 ----
NM_012064chr123400 244 159 ------
NM_012069chrX42544 2085 2022 261 ------
NM_012081chr543218 1374 1330 972 --13631 --
NM_012082chr83953 708 46 ----1836
NM_012084chrX----1553 --
NM_012089chr131129 1117 306 152 ----
NM_012090chr121265 1061 --11083 --
NM_012092chr241626 1530 702 510 ------
NM_012096chr363234 3180 2953 2886 2861 79 1729 ----
NM_012098chr931423 457 121 ------
NM_012104chr1143759 3608 1110 272 12590 ----
NM_012104chr1143759 3608 1110 272 12590 ----
NM_012110chr4137 ------
NM_012120chr642776 2703 740 217 32858 2642 881 2696 571 --
NM_012129chr72522 147 12472 ----
NM_012134chr131358 1285 102 1673 11295 --
NM_012141chr1343807 2986 1228 1017 ------
NM_012156chr2063452 2288 1345 985 699 211 13393 23319 2742 --
NM_012158chr1321287 1255 167 ----
NM_012164chr9136016 5073 4701 2913 2470 2407 2001 1942 1322 1072 664 431 246 ------
NM_012177chr6199 ------
NM_012189chr181479 ------
NM_012193chr1195046 4543 4187 3493 3407 2140 2004 719 542 1185 ----
NM_012197chr941459 1250 130 51 --11061 --
NM_012199chr134153 3541 1602 ----24379 800
NM_012200chr112365 152 ------
NM_012207chr102267 229 1183 ----
NM_012214chr2106421 6310 4530 4130 2571 1851 1787 1751 996 936 ----25644 5248
NM_012215chr1041797 1580 595 250 ------
NM_012218chr1973008 2966 2790 2117 1131 987 127 12020 22135 1186 --
NM_012234chr362616 1288 895 611 342 291 --2120 70 --
NM_012236chr13799 352 216 ------
NM_012238chr1011358 ------
NM_012242chr10--1271 ----
NM_012243chr11105 1280 ----
NM_012244chr1421350 229 11384 11220 --
NM_012249chr263236 1379 1149 1021 904 285 ------
NM_012252chr744262 1913 1259 46 --182 --
NM_012255chr201326 --1163 1184
NM_012257chr71376 --11027 --
NM_012262chr164678 4592 4428 3781 3749 3334 33821 1318 532 25199 4095 1959
NM_012264chr2271804 1761 855 292 281 268 27 ----1565
NM_012264chr2271804 1761 855 292 281 268 27 ----1565
NM_012278chrX----1141 --
NM_012281chr722417 522 ------
NM_012286chrX1466 ------
NM_012288chr674332 3897 1063 740 544 338 265 14837 ----
NM_012290chr221408 1138 --11558 31505 1437 1360
NM_012296chr1153886 3529 2402 1492 670 ------
NM_012297chr44991 961 600 367 32521 967 327 ----
NM_012300chr521899 532 12569 ----
NM_012302chr11263 ------
NM_012304chr511812 12554 1963 --
NM_012309chr1134923 657 60 --13296 24786 4534
NM_012316chr145555 4472 2139 115 25664 2063 ----
NM_012319chr181134 ----179
NM_012320chr1641018 249 149 45 11297 21399 231 --
NM_012321chr192388 24 ------
NM_012325chr2071571 1433 1095 522 383 311 288 ------
NM_012326chr23280 254 193 2570 116 ----
NM_012329chr1731305 1226 552 11687 ----
NM_012334chr594681 4111 4084 1722 1677 1131 1051 923 516 2851 784 --12938
NM_012338chr71211 --2907 103 --
NM_012343chr51826 ------
NM_012347chr622578 286 12168 ----
NM_012383chr9138 1121 ----
NM_012388chr1563048 2365 1974 591 398 106 ----1171
NM_012395chr71568 ----23341 2977
NM_012405chr163645 3093 2910 1308 1242 872 13676 12499 --
NM_012412chr71657 ------
NM_012416chr921254 277 --1481 --
NM_012428chr152362 225 --1235 --
NM_012445chr42533 404 ----175
NM_012448chr173978 891 868 ------
NM_012454chr6----1481 --
NM_012464chr472698 2257 1849 1059 944 885 760 ------
NM_012479chr741962 1002 706 199 1931 12432 --
NM_012482chr1--1619 ----
NM_012484chr5192 --156 --
NM_013230chrY31162 560 145 ----11711
NM_013231chr1464255 2818 1094 772 554 345 11741 23466 2927 --
NM_013233chr22464 260 --1920 --
NM_013242chr161135 1109 1381 --
NM_013243chr151114 --1265 --
NM_013250chr1141075 546 145 69 ------
NM_013254chr122269 175 ------
NM_013255chr798833 6703 5732 5383 2843 1952 1280 1218 400 27646 6031 27591 2356 13408
NM_013261chr423626 909 ------
NM_013264chr11182 ------
NM_013269chr1233532 1481 975 --13432 12822
NM_013275chr162741 58 ------
NM_013279chr112165 109 ------
NM_013281chr2031249 348 188 ------
NM_013283chr52863 374 1296 1685 --
NM_013286chr332491 247 217 1430 12549 --
NM_013293chr71152 ----1531
NM_013305chr182194 48 --1262 --
NM_013316chr71312 ------
NM_013322chr751190 1123 407 162 133 ------
NM_013361chr19--2580 190 ----
NM_013372chr1523272 2860 1422 ----
NM_013374chr332257 670 191 1198 ----
NM_013381chr1242318 718 609 306 1276 ----
NM_013390chr9124 --21240 1146 --
NM_013392chr2--3423 377 55 ----
NM_013396chr2121003 83 1277 11348 --
NM_013410chr161147 1061 1045 937 315 67 ------
NM_013433chr1921985 571 1729 ----
NM_013436chr22596 40 1682 ----
NM_013437chr8----11357 --
NM_013438chr921261 103 --11540 1439
NM_013444chrX1792 1329 1310 --
NM_013446chr731286 272 114 11396 ----
NM_013448chr141496 1487 --173
NM_013449chr122756 738 --2511 83 --
NM_013450chr211203 ------
NM_013958chr82368 21 137 ----
NM_013959chr82368 21 137 ----
NM_013960chr8--1673 ----
NM_013961chr82368 21 137 ----
NM_013962chr82368 21 137 ----
NM_013986chr22192 ------
NM_013995chrX11614 1504 12236 --
NM_014000chr1031209 544 444 --1478 --
NM_014001chr1751625 1033 478 269 158 31640 1480 443 1234 --
NM_014007chr92863 374 ------
NM_014011chr22900 145 1729 ----
NM_014016chr311266 31514 1204 313 11534 --
NM_014021chr153319 2853 2840 2160 1161 13007 ----
NM_014023chr1082464 2265 2255 1814 1780 953 581 493 12302 22554 1828 --
NM_014028chr633218 2604 477 12408 12542 --
NM_014034chr621274 577 ------
NM_014035chr521363 470 21291 1136 ----
NM_014043chr321244 410 ------
NM_014048chr1675117 5077 4383 3295 3280 3247 111 197 --14529
NM_014060chrX1100 146 ----
NM_014071chr202399 192 ------
NM_014079chr32434 411 1290 ----
NM_014089chr1322155 1814 ------
NM_014106chr151831 12719 ----
NM_014112chr865340 3918 2179 1961 1287 431 34437 4021 995 15291 --
NM_014117chr1621876 379 --131 --
NM_014153chr161629 ------
NM_014154chr321179 142 ----1202
NM_014155chr11146541 5585 4907 2882 2715 2397 2263 1783 1283 1115 1017 703 486 216 1691 25839 5397 --
NM_014157chr1652629 2569 2435 1608 1302 3949 857 461 --12779
NM_014181chr21210 1730 12884 --
NM_014184chr1--1138 ----
NM_014188chr11344 --1388 --
NM_014189chr431321 1296 550 11231 1993 --
NM_014190chr421673 1648 11583 21345 42 --
NM_014191chr12--1973 11003 --
NM_014212chr123961 796 315 ------
NM_014217chr121374 68 11528 ----
NM_014223chr12676 238 ------
NM_014225chr19--1299 ----
NM_014231chr1211521 --1183 --
NM_014232chr1731585 1570 1232 ------
NM_014232chr1731585 1570 1232 ------
NM_014240chr373294 3109 3100 2932 1631 211 52 --13463 --
NM_014243chr421841 141 --22121 248 --
NM_014248chr222123 62 ------
NM_014251chr72792 25 --2909 784 --
NM_014263chr10----21397 1135 --
NM_014271chrX183 ------
NM_014278chr41178 1359 ----
NM_014279chr92790 65 ------
NM_014280chr12376 255 ------
NM_014282chr921115 1045 1130 1102 --
NM_014283chr111327 ------
NM_014284chr1--1686 ----
NM_014309chr2254276 2061 1368 535 413 13847 25365 4969 --
NM_014319chr124591 468 378 175 11706 ----
NM_014331chr457020 6512 5509 1498 1315 --12190 --
NM_014333chr1192345 2321 2137 1817 703 627 319 188 145 ------
NM_014342chr1131466 925 67 ------
NM_014345chr61403 ------
NM_014351chr2211219 11247 ----
NM_014363chr1331260 1168 513 2869 61 ----
NM_014365chr12----1819 1263
NM_014368chr932165 1349 457 --11368 --
NM_014372chr11142 --11617 11948
NM_014376chr52673 187 21676 1649 ----
NM_014392chr461408 544 474 466 363 157 --1136 1274
NM_014393chr822272 207 ------
NM_014408chr11542 ------
NM_014415chr321706 610 ------
NM_014423chr554344 4287 1937 869 800 15291 24716 1632 --
NM_014445chr312241 --22362 887 --
NM_014447chr411030 11687 ----
NM_014449chr121209 ------
NM_014454chr63840 406 303 --3827 747 257 --
NM_014456chr102419 411 ------
NM_014469chr111597 ------
NM_014470chr121297 1668 ----
NM_014472chr101703 ------
NM_014482chr21104 ------
NM_014488chr11160 --1263 --
NM_014491chr71939 ------
NM_014494chr1642162 1881 605 560 1588 1511 --
NM_014498chr31282 ------
NM_014502chr11--1321 ----
NM_014504chr732089 719 478 ------
NM_014517chr35488 441 412 312 265 --11779 --
NM_014520chr172361 133 ------
NM_014521chr23365 65 24 11245 11274 11585
NM_014554chr123795 207 99 ------
NM_014562chr22748 65 175 ----
NM_014572chr1321697 1644 --1331 --
NM_014574chr1421243 372 ------
NM_014575chr31475 --166 --
NM_014577chr222887 239 ------
NM_014584chr1431533 1220 1139 11604 ----
NM_014585chr221239 186 ------
NM_014592chr52643 273 1775 1327 --
NM_014601chr1931501 1045 28 ------
NM_014612chr931471 1095 31 21074 1000 ----
NM_014613chr532287 1239 750 1151 2970 180 --
NM_014615chr162982 382 13621 13523 --
NM_014616chr383269 3243 3064 2696 2428 1386 415 294 ------
NM_014618chr91330 1278 ----
NM_014620chr121234 ------
NM_014621chr2176 ------
NM_014629chr841340 954 946 23 1290 1895 --
NM_014630chr15103490 3163 2577 1533 823 740 461 364 307 149 22998 633 1868 23723 3027
NM_014634chr2232912 1269 1088 --22887 1413 --
NM_014635chr221367 1357 --1237 1683
NM_014636chr943362 3353 770 101 34296 4117 488 --24025 3809
NM_014646chr1892566 2541 2531 2278 1263 871 458 438 271 33216 2250 2154 ----
NM_014647chr1642253 1925 1885 1844 ------
NM_014655chr13723 613 27 12316 ----
NM_014659chr151778 ----1882
NM_014660chr721027 389 ------
NM_014661chr1083775 3765 3324 3275 614 309 152 35 13354 ----
NM_014665chr853221 2536 1441 1432 603 --22772 1364 --
NM_014666chr521269 60 11128 ----
NM_014667chr332168 291 137 ------
NM_014670chr221223 165 ----1230
NM_014671chr761432 1151 1072 974 502 438 ------
NM_014676chr12665 233 ------
NM_014677chr821210 98 --11366 --
NM_014678chr22------1119
NM_014679chr112893 95 1253 ----
NM_014682chr831821 908 662 12323 ----
NM_014686chr1972395 2348 1898 1879 806 776 349 ------
NM_014699chr161392 ------
NM_014701chr1553143 3096 2665 1134 784 1822 1664 --
NM_014705chr772123 2115 1842 816 596 585 346 --11404 1149
NM_014707chr711572 ------
NM_014709chr2----154 --
NM_014711chr16------1768
NM_014713chr21107 ----167
NM_014717chr191310 1785 ----
NM_014718chr121692 ------
NM_014720chr1051753 1511 1323 1289 204 1408 1479 --
NM_014721chr6107029 6355 5302 4847 1337 1084 1008 609 580 216 45590 5078 1061 722 --35819 5685 2677
NM_014729chr851525 923 271 262 250 ------
NM_014732chr16125827 5420 4788 4528 4368 3887 3823 3658 1201 912 828 125 25714 1521 21703 1601 --
NM_014739chr621072 176 ----13200
NM_014740chr17142 ------
NM_014741chr1151637 768 380 329 218 ------
NM_014743chr421967 851 1938 ----
NM_014746chr294268 3376 3313 2888 1630 1097 901 361 259 32752 709 649 11489 --
NM_014747chr195211 4367 3841 3826 3663 2209 1616 1250 378 1109 25078 4042 --
NM_014748chr21406 ------
NM_014751chr811588 --21931 820 --
NM_014752chr1121889 369 ------
NM_014754chr82874 841 ------
NM_014755chr253746 1646 1307 536 269 21205 508 21259 606 1263
NM_014756chr111191 ------
NM_014757chr521824 387 11918 1866 --
NM_014761chr161171 ------
NM_014764chr121110 ------
NM_014765chr142398 2157 1032 516 21924 404 --12248
NM_014772chr1833076 2785 2457 --1457 --
NM_014774chr132855 2554 2402 12980 ----
NM_014776chr1242156 2025 1176 616 --12264 13006
NM_014781chr821153 491 ------
NM_014784chr131083 724 248 --1160 --
NM_014787chr112583 2826 27 11779 12670
NM_014790chr51348 ----1190
NM_014795chr2171 ------
NM_014800chr71854 1899 11168 --
NM_014802chr122946 279 ----1938
NM_014807chr112817 533 ------
NM_014810chr1----22274 908 --
NM_014819chr562280 2222 1981 1888 492 197 ------
NM_014822chr4------128
NM_014824chr1142024 1245 1233 452 ------
NM_014827chr161458 1276 1257 1151 1069 602 11207 ----
NM_014828chr14--1185 1840 --
NM_014830chr1232796 540 51 13810 1344 --
NM_014832chr1341739 1693 210 120 12114 1741 22034 635
NM_014835chr2022088 187 ------
NM_014839chr14978 564 458 48 11943 11815 --
NM_014841chr631156 1101 75 ------
NM_014850chr374431 4378 4261 4246 4227 2960 227 --14781 11015
NM_014860chr242236 1038 853 231 32004 1629 805 ----
NM_014862chr1554105 1355 603 443 383 21565 28 11646 13347
NM_014868chr121852 2371 80 ----
NM_014871chr121477 1173 ----
NM_014872chr982363 2027 1763 896 881 741 576 158 1163 --12142
NM_014873chr194685 4246 3657 1788 1619 1565 1465 1402 316 2531 508 13705 14638
NM_014874chr161836 1184 1178 603 184 42 --31789 1521 625 --
NM_014876chr22102224 2094 1686 1626 1562 833 770 607 344 56 --2514 368 --
NM_014877chr17106575 5939 5680 5352 3095 2426 2313 1589 402 139 --15359 1549
NM_014883chr452468 2193 740 507 444 ------
NM_014892chr62619 235 ------
NM_014897chr1732724 2498 670 ------
NM_014901chr532271 2152 545 ------
NM_014902chr2011578 11407 11356 --
NM_014904chr1033483 2935 264 --13070 13831
NM_014906chr1754103 3353 2630 1277 424 13123 ----
NM_014907chr91126 ------
NM_014912chr1043110 2872 2570 694 1888 --1680
NM_014917chr12970 890 ------
NM_014920chr61588 --23753 2518 13299
NM_014921chr1922005 1911 1899 1454 --
NM_014923chr13--11573 1441 --
NM_014924chr1462758 2064 998 367 352 246 --23087 576 13131
NM_014929chr22179 155 ------
NM_014932chr341802 649 565 501 --1474 --
NM_014934chr1343715 3679 2875 230 --23823 399 --
NM_014935chr12661 167 --136 --
NM_014938chr1272458 2378 1999 916 297 288 213 12219 ----
NM_014942chr642318 1989 1071 426 ------
NM_014945chr541824 1492 373 191 ------
NM_014946chr21882 1324 ----
NM_014947chr163106 2968 1969 1916 1176 948 23073 329 21114 625 --
NM_014949chr121029 89 ------
NM_014962chr2032831 2020 533 ------
NM_014964chr1742262 746 283 37 --21855 324 12309
NM_014974chr1051733 1702 1141 1104 575 ------
NM_014982chr1453847 3654 2132 1237 699 ------
NM_014988chr421779 849 ------
NM_014989chr621902 218 ----11527
NM_014991chr432390 2030 841 12947 ----
NM_014994chr1542026 1542 267 188 11479 1711 --
NM_014997chr752940 2576 1155 1120 734 22001 575 ----
NM_014999chr1241237 1087 673 496 ------
NM_015002chr1251880 1540 1528 129 30 1100 1189 --
NM_015008chr363416 3246 2642 2473 1059 955 22631 1000 22596 1008 --
NM_015015chr1931834 1784 72 ------
NM_015017chr151291 1229 485 422 274 ------
NM_015020chr16103733 3232 3039 2490 1457 1424 1395 704 371 308 ----13885
NM_015023chr141806 1528 1513 424 ------
NM_015024chr831257 947 433 11448 ----
NM_015025chr272727 2688 2640 2418 2330 473 427 162 --11830
NM_015026chr1234718 4265 1184 13579 ----
NM_015027chr1651990 1384 597 430 210 ------
NM_015032chr1321120 1104 22658 2608 --12172
NM_015035chr20116513 6244 5039 4926 4407 2533 2409 1198 1177 830 82 34453 661 587 16583 --
NM_015039chr154332 3595 3359 1613 1266 ------
NM_015040chr253216 3173 2383 2277 576 12717 12596 --
NM_015042chr1563621 3375 820 766 359 68 ------
NM_015044chr1662817 2759 2524 2199 440 55 1591 ----
NM_015045chr104365 357 338 36 ------
NM_015046chr951869 521 291 243 108 --12648 --
NM_015049chr252864 2440 2356 2077 932 12871 --1102
NM_015051chr912203 12307 ----
NM_015059chr1573633 3612 3560 3335 2762 2656 304 11583 ----
NM_015068chr733972 409 367 23924 1567 12466 --
NM_015071chr5106381 6205 5046 4979 4530 2276 2146 1894 1172 116 --11035 16324
NM_015073chr1932007 1462 55 ------
NM_015074chr194326 3722 3578 3571 3357 1660 1374 402 197 14905 14147 --
NM_015076chr653598 3000 2764 1803 1181 13353 13655 1326
NM_015079chr1563205 3135 2864 2428 1265 558 --1113 --
NM_015091chr142740 307 ------
NM_015092chr1633024 2941 484 14000 1763 --
NM_015094chr2294284 3152 3071 3036 2872 1427 1189 583 465 24181 314 --14206
NM_015100chr11644 ------
NM_015103chr32319 29 ------
NM_015106chr31157 ------
NM_015107chrX22405 101 11782 ----
NM_015115chr482972 2931 2511 2134 264 164 128 70 --191 --
NM_015130chr441306 1179 309 205 ------
NM_015132chr7----11613 11654
NM_015134chr173616 182 109 ------
NM_015137chr82790 231 12311 ----
NM_015138chr1522572 1030 2777 156 ----
NM_015143chr4--1376 ----
NM_015144chr1643564 3360 2812 83 --12593 1921
NM_015149chr142225 1937 1428 1365 ------
NM_015153chr6149 1243 ----
NM_015155chr1062703 2475 789 752 509 486 11059 ----
NM_015156chr1453828 3600 1122 233 182 1977 13840 13777
NM_015161chr1621356 1294 164 ----
NM_015170chr831688 1489 706 ------
NM_015171chr16135 ------
NM_015172chr151470 1365 1313 493 70 1170 ----
NM_015176chr11273 ------
NM_015178chr831850 347 30 1448 11935 --
NM_015185chrX63002 2900 2697 2598 781 457 ----1853
NM_015191chr1132522 1679 209 --2932 162 --
NM_015192chr202740 572 --12788 12061
NM_015194chr1751701 799 354 99 67 ------
NM_015197chr1493444 3345 2930 2913 2413 2198 2099 1104 240 1960 3821 591 39 --
NM_015199chr332253 794 567 --12468 1626
NM_015200chr421824 809 12485 1633 --
NM_015206chr1533417 3275 130 12740 ----
NM_015208chr1831418 1242 251 --23016 1317 --
NM_015209chr14816 423 131 24 --1926 --
NM_015215chr11952 23187 2286 1440 12277
NM_015216chr5------1510
NM_015221chr10131 1366 ----
NM_015225chr91672 1711 12320 --
NM_015230chr411713 --1347 --
NM_015233chr1362577 2347 2123 1726 978 422 22693 874 1386 22464 1058
NM_015234chr611078 11124 --1971
NM_015236chr421210 309 2602 426 2336 108 1407
NM_015247chr1665367 3983 3535 2026 1144 1109 ------
NM_015250chr931827 214 194 --1204 --
NM_015252chr2----1810 --
NM_015263chr1541006 961 799 186 --1341 --
NM_015264chr2294908 4755 4728 3685 3166 1321 1148 107 53 --11749 --
NM_015265chr222163 2114 1175 --22085 1905
NM_015267chr122729 427 11883 2415 378 --
NM_015269chr1160 ------
NM_015271chr434143 3809 2656 ----13550
NM_015275chr1211725 ----11479
NM_015277chr1821544 262 11318 ----
NM_015278chr653261 3087 2170 781 60 12190 ----
NM_015285chr1842538 1749 397 299 --160 --
NM_015288chr593764 3037 2663 2437 2385 2367 1532 649 182 13774 --13582
NM_015294chr17--21054 55 11110 1843
NM_015296chr132920 773 11212 ----
NM_015310chr886948 6794 2972 2699 2513 656 509 26 22903 1629 26109 2455 --
NM_015314chr74868 506 456 382 ------
NM_015315chr573183 2870 1394 1195 1166 555 131 21128 1046 --12494
NM_015317chr262502 2319 1855 1834 1756 859 ----11153
NM_015326chr142956 2826 2149 1902 --13017 --
NM_015327chr131186 277 189 ------
NM_015328chr762802 2143 2045 2004 708 578 22868 2076 22768 2508 --
NM_015330chr2272585 1838 1808 1661 828 650 438 1658 ----
NM_015336chr1232080 609 530 1603 ----
NM_015339chr20--21046 895 --134
NM_015349chr662990 2274 1063 972 719 585 ------
NM_015353chr1742670 2407 2027 935 --12795 --
NM_015355chr172676 284 --11230 --
NM_015359chr862769 2401 1844 658 617 324 ----1164
NM_015365chrX32763 715 289 --13461 11587
NM_015374chr22123 ----11462
NM_015375chr133589 1878 501 15030 ----
NM_015379chr7158 ------
NM_015382chr141749 ------
NM_015385chr1042540 610 340 199 13248 ----
NM_015387chr242007 1775 274 125 ------
NM_015396chr31571 1482 --1297
NM_015397chr921703 256 ------
NM_015416chr121743 ------
NM_015419chrX--1414 ----
NM_015429chr3--21037 1029 ----
NM_015435chr821496 939 ------
NM_015436chr422989 2077 --12340 1825
NM_015444chr31164 2427 89 ----
NM_015447chr92624 262 ------
NM_015455chr543830 3428 2672 1186 ----13315
NM_015458chr824796 999 24994 1626 1795 --
NM_015459chr111217 ------
NM_015460chr331839 1454 315 --11554 --
NM_015461chr18--1203 ----
NM_015464chr741015 797 405 86 ------
NM_015470chr251109 1089 1038 842 47 1874 ----
NM_015472chr3----1136 --
NM_015472chr3----1136 --
NM_015475chr2--1943 ----
NM_015477chr15----1358 --
NM_015488chr241788 1176 608 339 --11482 --
NM_015493chr1932287 404 272 1374 ----
NM_015497chr153981 854 232 ------
NM_015508chr311413 --11114 --
NM_015509chr1231547 593 548 --11185 11643
NM_015520chr322276 947 ------
NM_015527chr163833 610 272 ------
NM_015530chr23636 337 252 ------
NM_015535chr233917 1077 56 23657 3134 --1494
NM_015541chr331306 497 336 ------
NM_015542chr10144 --11213 11258
NM_015553chr675181 4282 4070 3796 3719 3453 1553 1494 24220 3672 21165 60
NM_015554chr1521971 400 3542 432 37 ----
NM_015557chr152525 2438 2248 1209 882 127 ----
NM_015564chr531438 521 421 ------
NM_015565chr2132098 885 647 ------
NM_015569chr154742 4144 3066 1576 220 ------
NM_015570chr731735 1612 178 ------
NM_015575chr273385 2681 2670 1405 1392 1356 289 23080 1009 23343 2477 --
NM_015576chr322960 2360 --22691 987 11909
NM_015577chr551469 1457 718 342 276 ----21780 1659
NM_015584chr1731162 521 406 169 ----
NM_015589chr14147 ------
NM_015601chr101877 ----1818
NM_015610chr742423 1987 478 70 ------
NM_015626chr172923 271 1354 ----
NM_015635chr921704 1540 --1387 --
NM_015640chr164836 4680 1956 1683 1660 285 --1504 23736 1992
NM_015649chr191255 ------
NM_015666chr203543 251 157 ------
NM_015678chr13--152 ----
NM_015686chrX31912 425 373 12483 ----
NM_015687chr65480 208 175 43 25 ------
NM_015691chrX32208 2042 668 1617 32521 808 276 --
NM_015695chr651982 1946 1344 821 192 ------
NM_015702chr2--125 ----
NM_015726chr121726 1558 11735 ----
NM_015866chr141235 1078 205 178 11478 ----
NM_015878chr811787 ------
NM_015879chr1888245 7884 6802 5971 5665 3195 1123 804 23163 1603 1244 2588 228
NM_015885chr11145 ------
NM_015886chr865649 3902 3766 3648 2146 1228 --1910 --
NM_015888chr122794 1126 ----1940
NM_015891chr641791 1502 532 104 ------
NM_015892chr104886 828 540 26 1466 ----
NM_015902chr82324 24 --194 --
NM_015904chr21265 ------
NM_015906chr154589 3803 3697 1553 90 --33336 1091 555 --
NM_015912chr852299 2210 1991 1020 984 11821 12133 --
NM_015915chr14----1237 --
NM_015920chr151589 ------
NM_015955chr21485 ------
NM_015975chrX1231 --11216 --
NM_015976chr11336 ------
NM_015981chr563018 2475 1985 559 297 30 12157 ----
NM_015984chr11551 ------
NM_015986chr172449 169 ------
NM_015999chr11281 ------
NM_016003chr742423 1987 478 70 ------
NM_016009chr174826 4384 3734 3087 1537 1117 1022 24156 3186 ----
NM_016018chr822123 1130 ------
NM_016019chr72870 244 --1329 --
NM_016025chr1631953 1856 1632 --1772 --
NM_016032chrX21099 398 2391 159 ----
NM_016037chr131047 415 251 ------
NM_016040chr112730 --12514 --
NM_016041chr17--176 ----
NM_016045chr201199 21248 401 --1687
NM_016048chr521000 205 ------
NM_016057chr122361 55 1323 ----
NM_016070chr17256 24 ------
NM_016072chr1212357 ------
NM_016076chr132643 2500 1028 ----22897 777
NM_016078chr1711017 ----186
NM_016081chr452196 1501 1473 557 451 ------
NM_016083chr633300 3100 938 11177 --13008
NM_016087chr73540 513 212 ----21379 1180
NM_016096chr81541 22170 1353 1140 12055
NM_016097chr182936 300 --1267 1171
NM_016098chr62170 52 ----1474
NM_016100chr20--1339 ----
NM_016120chrX1333 ------
NM_016121chr1--1906 ----
NM_016131chr211970 156 21570 779 --
NM_016132chr1573047 2485 2115 1351 1128 759 725 23081 2962 ----
NM_016133chr221666 552 ------
NM_016141chr32616 210 ------
NM_016142chr11------1938
NM_016147chr11--11114 ----
NM_016152chr3183 ------
NM_016162chr128786 649 613 604 273 154 116 77 1287 ----
NM_016169chr1011112 --13120 --
NM_016185chr173825 758 125 --1745 --
NM_016192chr2----198 --
NM_016195chr101119 ------
NM_016201chr342286 1778 1666 595 ------
NM_016203chr72980 137 ----1237
NM_016205chr451239 1199 904 562 250 --1537 --
NM_016206chr367587 7175 3240 2892 2406 1841 27017 2426 38353 6153 3005 --
NM_016217chr643599 3116 587 545 1634 33416 2322 2310 --
NM_016220chr721864 1617 ------
NM_016221chr552072 1864 408 177 73 --1789 --
NM_016227chr111327 ------
NM_016230chr6------1362
NM_016231chr1741479 1162 617 600 ------
NM_016234chr102972 750 --2690 210 --
NM_016248chr1342563 1396 938 327 12569 23048 658 --
NM_016257chr152528 1378 1087 1010 640 13300 ----
NM_016260chr256144 2450 1774 1654 90 36802 5001 1281 ----
NM_016271chr18----1308 --
NM_016277chr631579 1019 296 ------
NM_016279chr51126 ------
NM_016287chr111507 12030 ----
NM_016289chr271850 1612 931 669 171 106 45 ----12115
NM_016300chr31118 ------
NM_016303chrX1102 ------
NM_016308chr132082 2035 1878 21575 533 ----
NM_016320chr111127 ------
NM_016322chr982651 1265 1170 949 886 862 433 299 12029 12351 --
NM_016337chr141121 ------
NM_016339chr1771711 1504 1433 1311 661 559 550 --2443 330 --
NM_016356chr632589 1987 1924 ------
NM_016374chr121498 1097 ------
NM_016374chr121498 1097 ------
NM_016395chr1521920 1354 ----11864
NM_016396chr151944 --11960 --
NM_016422chr1123104 25 ------
NM_016424chr1721502 458 ------
NM_016436chr2052344 2117 2082 2033 89 --32668 1039 493 --
NM_016441chr22863 678 22238 438 ----
NM_016451chr111109 --1205 --
NM_016454chr151301 1320 ----
NM_016470chr20------1399
NM_016472chr1441210 1147 46 33 --21124 302 --
NM_016476chr172143 53 ------
NM_016481chr9179 ------
NM_016485chr62917 634 1792 ----
NM_016506chr111174 ------
NM_016507chr1721060 182 ----13033
NM_016513chr61588 --23753 2518 13299
NM_016516chr2--1589 ----
NM_016522chr11------11113
NM_016525chr92879 382 ------
NM_016529chr13--149 1360 --
NM_016530chr1543336 1545 1424 101 32815 2692 264 ----
NM_016531chr454191 3194 1422 1058 688 ----1859
NM_016538chr171163 ------
NM_016542chrX21516 240 ------
NM_016544chr243361 2995 687 464 ------
NM_016559chr32597 188 ------
NM_016575chr12115455 4946 4881 4874 4119 3388 3325 1697 1451 475 82 --12003 --
NM_016577chr3104518 4472 3972 3919 1507 1481 1136 944 808 50 ------
NM_016578chr11--1192 ----
NM_016588chr62688 110 --1655 --
NM_016598chr321059 272 --11455 --
NM_016603chr522212 411 --1721 --
NM_016605chr552593 2458 1070 680 541 11953 ----
NM_016607chrX41103 353 209 132 ------
NM_016613chr42547 431 --32372 2090 316 --
NM_016620chr111147 1285 ----
NM_016621chr1143632 3451 3397 1697 --13368 --
NM_016623chr81548 126 ----
NM_016626chr1821100 424 21728 1470 ----
NM_016628chr103654 297 52 ------
NM_016630chr151380 1389 --1398
NM_016644chr52469 191 ------
NM_016651chr1411142 ------
NM_016654chr152405 378 ------
NM_016823chr1711046 ------
NM_016824chr1021667 741 ------
NM_016831chr122011 752 --11502 12232
NM_016834chr17103967 3627 3130 2664 2625 1537 1164 959 717 611 14127 ----
NM_016835chr17103967 3627 3130 2664 2625 1537 1164 959 717 611 14127 ----
NM_016836chr21524 1512 --1629
NM_016839chr21524 1512 --1629
NM_016841chr17103967 3627 3130 2664 2625 1537 1164 959 717 611 14127 ----
NM_016936chr1632156 185 93 ------
NM_016937chrX2999 162 --1948 --
NM_016946chr153368 3307 2293 1069 997 --11148 11424
NM_016953chr255691 5483 4525 1812 1584 --14872 15293
NM_017409chr122762 165 ------
NM_017410chr1231181 1086 156 --11050 --
NM_017413chrX31707 739 501 1116 11692 --
NM_017415chr583971 3554 3081 1639 1510 1482 108 44 11680 ----
NM_017420chr1411427 13552 12891 12819
NM_017423chr451993 1819 661 307 257 179 1508 --
NM_017424chr2261541 1375 597 533 368 274 --12123 --
NM_017425chr11199 ------
NM_017437chr1462345 2254 2191 2025 886 811 --11936 --
NM_017452chr2031182 1171 188 ------
NM_017453chr2031182 1171 188 ------
NM_017454chr2031182 1171 188 ------
NM_017455chr152362 225 --1235 --
NM_017488chr241471 1219 186 174 --1650 --
NM_017519chr63317 254 191 ------
NM_017534chr17--197 ----
NM_017544chrX1222 ------
NM_017548chr311724 2496 349 ----
NM_017563chr3125319 4887 4055 2050 1629 1326 1234 810 770 470 128 40 36277 4842 798 11152 --
NM_017582chr181639 1548 1281 1241 1222 583 551 462 --11589 164
NM_017583chr1121482 633 --11705 --
NM_017590chr2211694 21799 191 --12502
NM_017596chr174636 4542 4148 4012 3778 3000 1251 ------
NM_017599chr123817 512 230 1348 ----
NM_017602chrX2651 221 1764 ----
NM_017610chr153765 699 117 1508 ----
NM_017617chr921488 393 --1627 --
NM_017629chr141922 1849 611 595 ------
NM_017632chr41456 --1445 --
NM_017633chr643419 3001 2593 829 33768 3677 326 ----
NM_017637chr9149314 8753 8077 8014 7735 7721 7280 6626 5759 3621 3494 2619 750 404 22946 1386 26436 1699 --
NM_017641chr12168 --31186 854 35 --
NM_017643chr171777 1470 ----
NM_017644chr354382 3914 3546 2014 605 11514 ----
NM_017645chr9188 --12773 13054
NM_017649chr102414 337 --1921 1103
NM_017650chr765345 5311 4281 3683 1376 812 15617 15256 --
NM_017657chr21250 ------
NM_017658chr1474362 3740 3254 3191 805 434 404 11387 13400 --
NM_017661chr152501 78 11272 ----
NM_017670chr116862 209 185 149 31 23 ------
NM_017681chrX----151 --
NM_017686chr1--188 11020 --
NM_017693chr1341386 1289 1271 1095 ------
NM_017694chr221834 1808 ------
NM_017699chr341296 1168 459 46 --1354 --
NM_017704chr112844 293 ------
NM_017709chr152989 2830 1180 926 442 ----1648
NM_017715chr7160 --295 23 --
NM_017719chr322489 896 11838 1173 12001
NM_017724chr31735 1710 1227 --
NM_017728chr1763020 2658 2111 757 452 360 11995 ----
NM_017730chr31185 ------
NM_017736chr1641249 993 251 215 2223 108 2117 55 11159
NM_017737chr132155 275 32 2704 453 1874 --
NM_017739chr13467 427 90 --1388 --
NM_017742chr183780 299 257 11298 ----
NM_017745chrX1700 ------
NM_017753chr921010 377 ------
NM_017754chr654568 3632 1015 874 86 --1673 15002
NM_017758chr173485 260 151 ------
NM_017762chr1592227 2172 2150 2129 1588 916 824 254 145 22355 628 --1847
NM_017769chr1422447 2410 ------
NM_017778chr811084 11321 ----
NM_017787chr1032864 2045 850 1414 12599 --
NM_017789chr21755 ------
NM_017793chr152238 223 ------
NM_017794chr91317 ------
NM_017798chr202953 810 1109 1861 --
NM_017799chr141739 ----11253
NM_017810chr16163 ------
NM_017811chr942836 2687 2045 1957 22212 416 ----
NM_017813chr885301 4523 4212 2330 2143 1358 505 58 15754 11787 1870
NM_017816chr4157 ------
NM_017824chr102654 104 22675 949 1331 --
NM_017831chr1844177 2955 1697 1298 11283 155 --
NM_017845chr4--1103 ----
NM_017848chrX24645 908 ------
NM_017866chr81451 ------
NM_017880chr2129 ------
NM_017896chr2073419 3266 3243 2149 856 631 325 --11315 --
NM_017902chr1075677 4704 4012 3924 1859 1105 789 11996 ----
NM_017919chr964131 3810 2012 1685 735 56 13869 ----
NM_017921chr1742019 1630 1547 565 --1345 --
NM_017922chr141579 ------
NM_017926chr145301 263 170 54 40 ------
NM_017933chr231569 426 195 --11320 --
NM_017934chr6186 ------
NM_017938chrX52163 1967 1425 521 340 11995 12137 1759
NM_017943chr141735 ----1343
NM_017944chr1122110 188 1666 ----
NM_017955chr1451067 973 932 473 100 ------
NM_017972chr145301 263 170 54 40 ------
NM_017974chr221263 89 ------
NM_017987chr102737 57 --1721 --
NM_017988chr121758 1931 ----
NM_017994chr742822 2610 2203 107 12927 ----
NM_018004chr3--1390 ----
NM_018011chr133676 495 63 ------
NM_018014chr22409 368 11264 ----
NM_018026chr1131427 1367 466 --1929 --
NM_018027chr1022869 2192 --1694 --
NM_018028chr1921366 874 ------
NM_018030chr1821061 283 --1381 --
NM_018032chr162940 245 1787 1967 --
NM_018036chr1434259 1562 241 24013 593 13980 24397 572
NM_018045chr132957 2500 166 --12826 --
NM_018046chr531512 689 593 --1458 --
NM_018061chr12473 308 ------
NM_018064chr6--2239 51 ----
NM_018070chr11506 ------
NM_018078chr41400 ------
NM_018084chr252936 2703 2098 2062 880 ----1468
NM_018085chr1117448 5833 5354 5024 2774 2465 2180 2114 1350 479 186 26602 5657 16924 15922
NM_018086chr241199 345 325 36 11857 ----
NM_018092chr16----11262 --
NM_018094chrX1158 ------
NM_018095chr111174 ------
NM_018098chr32955 342 ------
NM_018103chr1----1288 --
NM_018110chr1651379 1002 955 405 46 1970 ----
NM_018117chr102753 168 ------
NM_018120chr811292 --11036 1132
NM_018121chr1022246 641 21003 981 1717 --
NM_018124chr1641856 639 270 44 --131 --
NM_018128chr172929 460 ------
NM_018144chr104266 241 230 118 ------
NM_018150chr1----1867 --
NM_018157chr1242837 2553 2355 933 ----13224
NM_018159chrX21497 30 ------
NM_018164chr12----197 --
NM_018181chr1831713 1403 682 21579 109 ----
NM_018182chr172756 407 11813 ----
NM_018184chr321353 605 11532 --11621
NM_018189chr35567 505 341 169 72 ------
NM_018195chr112838 791 1697 ----
NM_018206chr162630 98 ------
NM_018211chr151649 737 610 480 52 11855 ----
NM_018214chr64342 286 140 43 --21231 1081 --
NM_018216chr11105 ------
NM_018227chr422247 2093 --12268 --
NM_018243chr443815 3772 3529 156 --11492 --
NM_018244chr2021175 368 1918 1394 --
NM_018246chr882704 2093 1870 1832 990 680 417 332 12354 ----
NM_018247chr642541 2041 2016 73 12165 1327 21247 693
NM_018254chr122220 240 22038 2020 1566 --
NM_018257chr2041603 400 71 60 ------
NM_018263chr242417 2158 712 676 12090 ----
NM_018266chr311056 ------
NM_018287chr1021161 178 1187 --1404
NM_018293chr362499 2455 2078 900 504 172 ----12787
NM_018299chr823033 165 1824 ----
NM_018302chr442482 2450 626 41 --22394 165 --
NM_018307chr172985 678 --1660 --
NM_018312chr11--198 ----
NM_018315chr44618 340 214 123 ------
NM_018320chr1111235 ------
NM_018323chr441393 275 242 77 --1462 --
NM_018330chr1031070 551 505 ----11705
NM_018334chr7----1151 --
NM_018339chr921647 136 ------
NM_018348chr163853 433 66 --1391 --
NM_018351chr1233810 3377 3151 --11724 --
NM_018361chr833849 1102 1047 11476 ----
NM_018362chr1133432 3199 1611 1518 ----
NM_018364chr163774 3615 1022 757 368 224 --11377 --
NM_018367chr111311 1956 21882 136 1736
NM_018374chr745128 4739 4443 1235 --1940 --
NM_018388chrX1486 2521 109 ----
NM_018400chr1174562 3740 3372 1262 1199 950 344 --13297 --
NM_018403chr332546 1595 1366 13479 22743 1100 --
NM_018413chr12----1117 --
NM_018416chr1211825 12573 1155 --
NM_018425chr1032217 1055 600 12591 ----
NM_018427chr1621488 357 1500 ----
NM_018439chr182916 576 1636 32427 2136 1930 --
NM_018440chr8118666 7629 5829 5786 5676 5630 3319 1979 1822 888 552 26779 249 199 12272
NM_018442chr13368 326 295 ------
NM_018444chr842259 1594 885 339 ------
NM_018445chr15----1172 --
NM_018452chr6_random52855 2823 2682 2432 175 11234 ----
NM_018457chr124384 196 135 71 --1539 --
NM_018462chr31636 ------
NM_018469chr17--1204 11004 11458
NM_018482chr842439 1795 90 50 --1263 --
NM_018488chr17137 ------
NM_018489chr13798 596 125 --22229 764 --
NM_018509chr1721467 22 ------
NM_018534chr21622 --155 1240
NM_018557chr211466 --21147 237 125
NM_018566chr145015 4135 4120 3535 13322 --15130
NM_018569chr441253 595 544 115 ------
NM_018571chr2151 ------
NM_018638chr1255142 4824 4809 1093 278 14102 15212 --
NM_018650chr11843 ------
NM_018682chr72249 176 ----1262
NM_018689chr1592573 2305 1787 1082 715 324 225 215 166 1656 ----
NM_018691chr53838 293 145 ----1314
NM_018695chr52972 526 22449 1909 ----
NM_018700chr521209 302 ------
NM_018703chr161128 1112 ----
NM_018704chr151704 1583 801 663 255 ------
NM_018710chr82973 186 ----11351
NM_018717chr442517 2177 667 70 ------
NM_018718chr712333 --11893 --
NM_018841chr133375 793 239 --12642 --
NM_018890chr711343 11141 ----
NM_018898chr511893 ------
NM_018899chr511893 ------
NM_018900chr511893 ------
NM_018901chr511893 ------
NM_018902chr511893 ------
NM_018903chr511893 ------
NM_018904chr511893 ------
NM_018905chr511893 ------
NM_018906chr511893 ------
NM_018907chr511893 ------
NM_018908chr511893 ------
NM_018909chr511893 ------
NM_018910chr511893 ------
NM_018911chr511893 ------
NM_018945chr6--1712 ----
NM_018947chr764985 4710 4634 3121 3073 1284 23840 1451 14504 --
NM_018948chr12992 165 11430 1158 --
NM_018951chr751238 469 298 195 92 ------
NM_018953chr123791 743 104 1644 ----
NM_018979chr1242566 887 699 49 1101 ----
NM_018999chr1044938 4080 3141 1544 14619 ----
NM_019001chr361359 1064 1046 590 563 538 13528 54802 4480 4262 3547 158 --
NM_019004chr732119 749 628 1869 22388 810 --
NM_019006chr152627 552 1705 ----
NM_019008chr22113718 3057 2971 2655 870 635 520 324 272 138 98 --1450 --
NM_019009chr1172319 1853 1713 910 754 490 221 1300 172 --
NM_019015chr7--198 ----
NM_019024chr2131 ------
NM_019027chr4180 ----1266
NM_019045chrX1903 ------
NM_019046chr101856 --1724 --
NM_019048chr2170 ------
NM_019053chr102999 49 ------
NM_019063chr242255 2126 622 546 ------
NM_019072chr521267 429 11384 1558 --
NM_019083chr1----1118 --
NM_019084chr101350 12230 ----
NM_019091chr22851 115 153 --1756
NM_019096chr64786 774 118 31 1917 2947 67 --
NM_019102chr71351 1360 ----
NM_019102chr71351 1360 ----
NM_019106chr22113454 3419 3142 2727 2288 2099 1331 1273 704 679 358 12265 ----
NM_019114chr922455 1790 --12025 --
NM_019116chr1693066 2988 1347 1336 1328 730 657 326 277 --11123 --
NM_019117chrX22922 593 --12677 --
NM_019555chr31118 11613 ----
NM_019558chr2----156 --
NM_019590chr10--197 ----
NM_019593chr2062944 2399 2036 939 860 557 12647 --1662
NM_019597chrX1480 ------
NM_019610chr11561 11525 ----
NM_019854chr123610 254 229 ------
NM_019857chrX41751 1550 1521 355 ----1389
NM_019858chr121209 ------
NM_019895chr32461 426 ------
NM_019903chr1021667 741 ------
NM_020039chr1231611 1453 344 21339 630 1271 --
NM_020062chr2011034 ------
NM_020063chr12256 62 ------
NM_020116chr411264 21419 1206 ----
NM_020117chr531065 743 253 ------
NM_020122chr275873 5144 4376 3843 1581 888 312 34638 727 38 ----
NM_020123chr101612 ------
NM_020134chr2--1213 ----
NM_020144chr7------11729
NM_020148chr1832912 2171 537 --1160 --
NM_020150chr1022095 207 11946 1196 --
NM_020151chr211434 2108 67 11213 11252
NM_020156chr71416 --1525 --
NM_020159chr421188 226 ------
NM_020177chr52918 279 --1894 --
NM_020179chr111488 --199 --
NM_020182chr2033390 2570 606 13325 ----
NM_020185chr62151 53 ------
NM_020193chr1121295 1247 --1143 --
NM_020198chr1741280 1263 593 374 ------
NM_020201chr172567 79 1127 1699 --
NM_020205chr163368 2602 1241 974 154 83 1800 --23443 2273
NM_020211chr1551410 1244 1123 381 133 ------
NM_020225chr42355 128 ------
NM_020226chr41758 ------
NM_020231chr3------1139
NM_020235chr31117 ------
NM_020238chr115915 748 359 146 83 1161 ----
NM_020239chr122063 703 --168 --
NM_020244chr12133 ------
NM_020248chr182370 2035 1846 1681 1671 709 685 601 --132 --
NM_020310chr1762644 2205 2111 948 378 362 1183 12147 --
NM_020336chr2033215 3143 446 12892 13645 --
NM_020337chr432505 2344 1089 11002 ----
NM_020340chr611756 2876 71 ----
NM_020341chr2031313 1275 1251 ------
NM_020342chr232130 2030 1801 --22563 2291 --
NM_020346chr1111198 21717 120 ----
NM_020354chr10145 --187 --
NM_020362chr1--1138 1316 --
NM_020365chr12116 52 ------
NM_020374chr12266 22 --11553 --
NM_020381chr641814 794 731 567 11935 ----
NM_020390chr354232 1184 1121 867 133 1448 ----
NM_020403chr1361265 1136 591 479 411 282 ------
NM_020416chr43960 739 577 1393 ----
NM_020429chr772923 2433 2077 2052 2042 1991 288 2732 294 --11960
NM_020431chr1442714 417 205 173 ------
NM_020432chr742265 2170 2061 1748 ------
NM_020437chr221326 ------
NM_020443chr176444 5998 5949 2503 2320 2293 2200 22743 163 ----
NM_020449chrX1200 1275 ----
NM_020455chr632863 757 459 ------
NM_020456chr1331892 1831 615 --1118 --
NM_020457chr16--1250 ----
NM_020463chr23589 422 413 ----145
NM_020465chr1651917 1812 1752 1558 372 1563 --1147
NM_020478chr82752 727 12209 --12369
NM_020482chr61241 ------
NM_020532chr21814 1298 ----
NM_020640chr311763 --21933 345 --
NM_020647chr872234 2025 1687 655 582 494 248 1722 ----
NM_020651chr231655 1511 306 1369 ----
NM_020655chr161226 1557 ----
NM_020673chr2047574 6228 3097 2829 --1815 17458
NM_020689chr2031450 1361 113 11688 ----
NM_020697chr831160 1073 909 --11173 --
NM_020698chr1253039 2877 2273 2168 2087 ----11096
NM_020699chr143938 3472 371 202 21301 1233 25323 1421 --
NM_020703chr11411 ------
NM_020708chr2012217 ------
NM_020715chr1452210 1486 771 581 518 11608 ----
NM_020717chrX54576 1840 1696 1459 1418 1276 11514 --
NM_020718chr1665290 4493 4431 1694 1566 1079 35996 2238 959 25876 1987 --
NM_020732chr63317 254 191 ------
NM_020734chr1213307 --2788 81 --
NM_020739chr1534088 3767 1186 12688 ----
NM_020742chrX12274 ------
NM_020747chr51295 --1163 1880
NM_020748chr1721982 1443 136 11381 --
NM_020752chr1012894 12906 ----
NM_020760chr221710 118 ------
NM_020761chr172116 87 141 ----
NM_020762chr121130 ----1261
NM_020765chr1------199
NM_020766chrX104379 4345 4025 3972 3964 3610 3396 913 540 238 23741 1391 11158 12858
NM_020769chrX199 ------
NM_020772chr17118033 7255 6786 6123 6047 5686 2816 2235 950 537 356 47766 5636 2845 1294 16367 --
NM_020774chr1844892 4532 1562 1355 16212 24159 1397 11827
NM_020783chr1842439 2321 1816 120 ------
NM_020791chr1731305 942 478 21318 1276 ----
NM_020794chr121016 449 ------
NM_020796chr552960 2334 1858 1215 625 1606 --11906
NM_020799chr10--1258 ----
NM_020801chr532561 1899 776 2889 651 --11702
NM_020804chr642573 2310 1642 196 ----12404
NM_020805chr182622 378 ------
NM_020808chr12814 110 --11056 --
NM_020809chr1122227 688 12044 22290 900 --
NM_020810chr1472975 2850 2829 2599 1041 864 769 ------
NM_020818chr141331 ------
NM_020819chr641038 1011 842 82 --1768 --
NM_020824chr101646 1240 ----
NM_020825chr1643857 574 427 375 12378 --12565
NM_020839chr32638 571 1528 ----
NM_020841chr1231299 871 782 ----11612
NM_020844chr8137046 6742 6446 5136 5130 5113 5107 2709 2520 2484 2267 1638 497 11307 22992 349 --
NM_020845chr1232469 2149 1752 11618 ----
NM_020854chr1821550 1178 1163 1571 --
NM_020858chr1542170 834 215 62 11734 --21810 1669
NM_020860chr421046 983 ------
NM_020861chr631071 993 399 ------
NM_020866chr133832 772 134 ------
NM_020868chr231947 1299 180 ------
NM_020871chrX21017 788 ------
NM_020872chr321692 425 --21155 560 --
NM_020873chr3----1293 --
NM_020899chr1712297 ------
NM_020917chr1943308 3047 352 121 2906 579 ----
NM_020918chr1063605 2792 1335 594 583 391 ------
NM_020920chr14--139 ----
NM_020922chrX1380 2661 548 ----
NM_020925chr111110 1481 ----
NM_020927chr1631778 696 419 ----193
NM_020935chr243925 676 259 50 --12889 --
NM_020940chr1042626 2261 181 171 1117 11986 --
NM_020947chr1621909 1711 ------
NM_020951chr1931891 1589 460 --1193 --
NM_020958chr14143 --1133 --
NM_020964chr1864526 4324 4254 4070 3634 34 21892 63 ----
NM_020975chr102453 48 11744 ----
NM_020977chr422060 824 --11779 1385
NM_020987chr1031267 941 538 1490 1281 --
NM_020988chr162484 52 1940 --1179
NM_020993chr1262593 1768 1025 972 295 185 1302 ----
NM_021003chr141810 ------
NM_021007chr21405 --12155 1567
NM_021009chr12--161 ----
NM_021032chr31822 1193 1427 --
NM_021033chr1343377 3118 3074 1408 11051 13019 22763 897
NM_021035chr2011210 ----1915
NM_021038chr352418 2101 646 233 197 33365 3029 737 12621 23190 2405
NM_021069chr431941 555 164 --1427 --
NM_021072chr532530 1949 1820 ------
NM_021097chr262459 2099 1231 1172 1064 389 --1949 --
NM_021098chr16------1695
NM_021101chr352149 1859 1753 356 29 11687 1867 --
NM_021111chr921307 1096 11326 11265 --
NM_021120chrX93109 3054 2670 2370 1272 1001 983 846 439 22413 725 ----
NM_021131chr931451 929 378 ------
NM_021132chr1031121 973 519 ------
NM_021136chr141244 ------
NM_021140chrX11186 ------
NM_021145chr72321 140 ------
NM_021148chr732214 869 634 ----11747
NM_021153chr18----1170 --
NM_021159chr42268 237 ----11698
NM_021168chr1631577 1477 1035 ------
NM_021183chrX--11734 32279 137 67 --
NM_021188chr141446 ------
NM_021189chr1--1934 ----
NM_021190chr11327 --1137 --
NM_021198chr22306 262 --1290 --
NM_021205chr132872 2860 1059 12398 ----
NM_021244chr6153 ----164
NM_021249chr1451696 1593 1543 1438 1375 ------
NM_021252chr1031363 826 306 11888 ----
NM_021255chr1443500 2815 1573 1173 1182 188 12834
NM_021260chr1441171 448 328 94 ------
NM_021267chr1951343 1280 1229 978 330 ------
NM_021569chr91377 ------
NM_021574chr2242103 1940 615 424 ------
NM_021622chr10--22269 484 21978 1553 --
NM_021627chr321215 401 ------
NM_021629chr335086 4517 1533 --23866 3541 --
NM_021637chrX--1232 ----
NM_021639chr12582 93 ------
NM_021643chr211765 11405 --11271
NM_021644chr102267 229 1183 ----
NM_021784chr20--198 ----
NM_021800chr10----151 --
NM_021807chr721027 488 ------
NM_021809chr2092036 1954 1641 519 378 356 269 256 22 12223 22326 2160 --
NM_021813chr664819 4794 3700 3660 1140 82 11713 34988 4731 3881 24512 3621
NM_021814chr641645 391 295 264 188 ----
NM_021818chr1421487 1017 11278 193 --
NM_021825chr11121 ------
NM_021905chr631785 453 43 ------
NM_021911chr555599 3851 3481 1599 261 --1390 24084 1395
NM_021912chr1524077 4057 ------
NM_021913chr1931423 676 613 11447 21768 321 --
NM_021925chr251454 1366 1346 1162 709 ------
NM_021935chr32991 687 ------
NM_021940chr621322 506 11222 ----
NM_021943chr621905 1761 ------
NM_021945chr632799 2243 661 --12623 --
NM_021949chrX22606 2456 32551 2461 743 ----
NM_021952chr11143 ------
NM_021954chr1331430 1096 176 12744 ----
NM_021956chr621514 330 1976 ----
NM_021959chr61150 ------
NM_021961chr1166948 5555 5253 5167 5037 1287 --14939 14523
NM_021964chr344806 2596 1906 197 32309 1291 85 14735 --
NM_021967chr521001 390 ------
NM_021984chrX3485 352 161 ------
NM_021987chrX3485 352 161 ------
NM_021988chr2051357 1338 1321 1222 348 ------
NM_021990chrX3485 352 161 ------
NM_021998chrX11030 ----11119
NM_021999chr13--1543 ----
NM_022037chr23767 272 187 ------
NM_022041chr1642574 894 239 99 1362 11713 --
NM_022044chr221116 ------
NM_022048chr1586412 6396 5735 5727 5628 3918 1520 228 1749 11182 --
NM_022051chr13639 516 168 1143 ----
NM_022066chr173296 243 146 --21035 174 --
NM_022072chr31246 ------
NM_022079chr101877 ----1818
NM_022080chr2042734 1074 871 152 1102 1304 --
NM_022085chr62641 559 --11155 --
NM_022093chr11676 ------
NM_022114chr154074 3660 1632 1623 692 --13063 14719
NM_022121chr6134 ------
NM_022130chr521283 238 ----11077
NM_022133chr841712 1245 1222 181 ------
NM_022137chr1441762 1471 424 395 ----1340
NM_022140chr54629 447 407 346 --11688 --
NM_022143chr711110 --1264 --
NM_022153chr10103618 3351 3237 3164 2419 1383 988 751 223 185 --23506 728 --
NM_022166chr16105752 5647 4558 4355 4315 4212 1625 1509 1077 385 15396 ----
NM_022169chr1191243 1204 1029 1002 960 944 488 323 290 ------
NM_022170chr72445 347 1188 ----
NM_022173chr23767 272 187 ------
NM_022307chr71276 --187 --
NM_022351chr813440 ------
NM_022362chr101333 1141 1279 --
NM_022372chr16----1528 --
NM_022374chr2--1197 --2120 97
NM_022437chr2--1139 ----
NM_022442chr2051357 1338 1321 1222 348 ------
NM_022456chr1267458 6555 4983 936 782 510 14668 21165 166 --
NM_022457chr11231 ------
NM_022459chr1365394 4449 4081 2283 998 185 24042 776 11551 14712
NM_022465chr1242182 1128 1078 480 --21980 1118 --
NM_022474chr1452318 2278 2080 708 27 32357 2049 1021 ----
NM_022482chr2032454 2245 1785 22528 565 12399 --
NM_022483chr541796 786 677 516 ------
NM_022484chr7------177
NM_022497chr333914 2547 411 1824 ----
NM_022572chr241788 1176 608 339 --11482 --
NM_022574chr752006 1715 816 717 294 ------
NM_022644chr17127 ------
NM_022648chr264163 3973 3044 1342 1160 554 --13592 --
NM_022650chr51351 ------
NM_022652chr12------1208
NM_022658chr1211068 ------
NM_022659chr81510 ------
NM_022716chr1103147 3021 2795 2710 2348 2158 1273 1108 808 519 ------
NM_022719chr2263118 1548 1183 932 215 148 23787 3125 1732 --
NM_022726chr621786 1674 --11512 11409
NM_022735chr151247 1234 344 251 225 11370 ----
NM_022737chr1941023 309 216 198 ------
NM_022745chr112295 1405 ----
NM_022749chr82287 137 1572 ----
NM_022753chr12899 76 12549 12650 --
NM_022756chr141096 1019 369 242 ------
NM_022757chr31963 ------
NM_022763chr342867 2334 1997 1220 ------
NM_022766chr2252434 2256 1947 1682 75 ------
NM_022771chr12--140 ----
NM_022778chr131405 1343 180 ------
NM_022781chr942640 1295 929 855 32416 624 293 --1549
NM_022787chr142534 1983 1952 92 --21757 1748 --
NM_022802chr10--21594 539 --2344 131
NM_022822chr112840 78 --1876 --
NM_022823chr2------1436
NM_022824chr51331 ------
NM_022826chr21171 ------
NM_022828chr521757 124 ------
NM_022831chr11487 --11674 --
NM_022833chr951187 1004 555 440 332 124 ----
NM_022836chr12539 400 ------
NM_022838chrX2309 103 ------
NM_022841chr151687 1122 ----
NM_022844chr16------1937
NM_022845chr1652031 1678 682 520 25 --12011 --
NM_022893chr242584 2318 2194 337 --1427 1485
NM_022894chr231212 390 225 ----2639 175
NM_022897chr521044 78 ------
NM_022898chr1484760 4655 3968 3436 3331 777 436 62 --11098 --
NM_022901chr941803 1233 1172 762 ------
NM_022910chr1651917 1812 1752 1558 372 1563 --1147
NM_022912chr233048 1107 995 1420 1389 12273
NM_022917chr92398 129 --1836 --
NM_022918chr112515 59 11331 21561 178 --
NM_022965chr431193 232 53 1258 1623 --
NM_022970chr101383 --1528 --
NM_022977chrX61977 1764 1006 759 590 307 2560 450 ----
NM_022978chr521001 390 ------
NM_023000chr142439 35 2390 171 --11453
NM_023001chr142439 35 2390 171 --11453
NM_023012chr121548 1102 ----
NM_023016chr212315 --1804 --
NM_023037chr13251 43 11041 21007 225 --
NM_023039chr5--1280 ----
NM_023068chr2021157 504 ------
NM_023071chr12--11125 ----
NM_023074chr192965 44 ------
NM_023929chr842357 791 600 100 --1117 131
NM_024007chr512760 --11932 12308
NM_024015chr17--11171 --21009 979
NM_024034chr2041000 762 372 46 --1182 --
NM_024050chr191238 ----1185
NM_024052chr1792759 2705 2654 2627 2136 1921 1147 893 569 --12082 --
NM_024069chr192565 99 --1703 --
NM_024076chr1942366 2193 1874 1829 11752 ----
NM_024082chrX1111 ------
NM_024085chr23919 755 693 1909 ----
NM_024090chr421842 227 1553 ----
NM_024092chr112775 356 ------
NM_024107chr171696 ------
NM_024111chr151214 ------
NM_024117chr921252 935 ------
NM_024122chrX----1249 --
NM_024293chr22160 58 ------
NM_024295chr83713 205 53 ----11685
NM_024312chr1221381 1155 11611 1132 --
NM_024319chr1124 ------
NM_024329chr121180 641 ------
NM_024408chr141280 1179 960 661 --23603 49 --
NM_024429chr72980 137 ----1237
NM_024494chr11688 ------
NM_024496chr14--1629 ----
NM_024511chr453205 2757 2290 725 517 ------
NM_024520chr2142 ------
NM_024523chr7173 2966 943 1170 --
NM_024524chr333119 762 581 22684 2551 --12564
NM_024525chr11578 1512 ----
NM_024529chr1------11083
NM_024539chrX----1311 11216
NM_024551chr1221018 897 12569 ----
NM_024551chr1221018 897 12569 ----
NM_024554chr151778 1586 1456 172 109 ------
NM_024556chr11--1376 --1154
NM_024563chr531737 1437 704 ------
NM_024569chr152380 1975 1929 688 328 1280 21074 985 --
NM_024582chr411008 --1151 --
NM_024595chr1--153 ----
NM_024612chr171414 ------
NM_024613chr811823 ----11374
NM_024618chr111549 ------
NM_024624chr231452 1263 32 ------
NM_024626chr121617 1181 1395 1402 --
NM_024627chr2264932 4634 4197 3972 745 217 34781 3871 232 34792 3501 27 --
NM_024636chr752440 2258 2182 2016 1173 --11960 --
NM_024645chr821502 435 ------
NM_024646chr133570 3295 824 ------
NM_024659chr21961 ------
NM_024665chr374544 4193 1317 1138 655 232 216 14659 ----
NM_024681chr22--1263 ----
NM_024686chr12499 94 ------
NM_024692chr221393 756 1290 ----
NM_024698chr1151339 1203 1197 1131 179 ------
NM_024713chr1521049 467 1260 ----
NM_024721chr822683 151 ------
NM_024740chr1143348 3130 1460 491 --14011 14049
NM_024742chr1631215 723 82 ------
NM_024744chr232215 1898 148 12041 ----
NM_024745chr16167 2156 84 149 --
NM_024755chr151835 ------
NM_024761chr944675 4315 1652 185 --21668 1284 --
NM_024771chr113990 611 514 --1737 --
NM_024779chr1221249 410 ------
NM_024780chr161390 ------
NM_024811chr1131318 763 725 ------
NM_024818chr311196 1349 11386 --
NM_024828chr911513 ------
NM_024834chr1021916 340 1360 1283 --
NM_024835chr171291 ------
NM_024837chr1521851 483 ------
NM_024863chrX2152 77 ------
NM_024877chr192169 106 11040 ----
NM_024884chr1454564 1832 1187 1124 958 --12894 --
NM_024887chr122136 516 11630 ----
NM_024893chr201996 --1974 181
NM_024900chr462099 1936 873 866 555 437 11557 ----
NM_024900chr462099 1936 873 866 555 437 11557 ----
NM_024915chr852006 1817 1772 129 114 11104 12231 --
NM_024922chr1641613 1603 1379 725 ------
NM_024930chr532775 2123 2019 1281 ----
NM_024939chr1621478 534 21123 635 --11537
NM_024944chr21----1183 --
NM_024946chr161526 --159 --
NM_024947chr3139450 8252 7564 7501 7336 7198 6446 3723 3119 2392 1757 1265 711 28353 2850 18562 --
NM_024948chr10143 ------
NM_024949chr424649 4541 --2522 249 --
NM_024953chr1232568 2305 2022 ------
NM_024989chr277748 6238 6070 2440 2378 921 731 26940 5371 14993 --
NM_024991chr1042540 610 340 199 13248 ----
NM_024993chr231234 1195 1164 --11346 --
NM_025054chr83655 383 180 --12661 --
NM_025073chr164231 4123 4060 3211 3186 196 --23158 1058 --
NM_025074chr453012 2836 2787 1061 1047 --1808 --
NM_025076chr23617 285 271 ------
NM_025083chr1551557 695 597 40 30 ------
NM_025106chr1--11522 ----
NM_025125chr1011568 1427 11622 1650
NM_025126chr122513 293 ------
NM_025133chr21361 ------
NM_025138chr131193 --11110 --
NM_025146chr342733 2305 700 557 ------
NM_025154chr731508 1197 1165 ------
NM_025160chr173339 3000 2869 1276 641 338 222 ------
NM_025164chr1122196 152 --11681 --
NM_025179chr183817 3713 3251 3205 1795 529 307 106 14467 ----
NM_025181chr2--1730 ----
NM_025184chrX1222 ------
NM_025191chr132555 2167 1306 13387 2467 166 1773
NM_025202chr221026 83 ------
NM_025211chr9----175 --
NM_025222chr312655 1143 1327 --
NM_025234chr15----1164 128
NM_025248chr1753145 3062 2909 2665 2365 --12954 --
NM_025263chr631680 450 313 1167 ----
NM_030579chr1643318 3053 2685 2412 12701 ----
NM_030583chr81101 --1379 --
NM_030594chr15--11242 ----
NM_030621chr1452978 1172 995 603 503 34032 1540 556 22845 2589 54169 4117 1642 1143 1041
NM_030625chr1042595 725 77 58 12357 ----
NM_030627chr534149 3284 1641 ------
NM_030629chr1621871 559 ------
NM_030645chr131390 910 396 1875 1502 --
NM_030647chr766294 5999 5112 4506 1197 1029 11059 15593 24573 144
NM_030648chr435260 2094 1419 14280 197 13788
NM_030650chr222719 1299 23970 3317 ----
NM_030652chr61290 ------
NM_030664chr102655 414 ------
NM_030667chr122995 831 --11184 --
NM_030668chr122995 831 --11184 --
NM_030669chr122995 831 --11184 --
NM_030670chr1222027 1863 --12216 --
NM_030671chr1222027 1863 --12216 --
NM_030674chr1225211 1285 15422 ----
NM_030751chr101390 --195 --
NM_030751chr101390 --195 --
NM_030761chr132645 2257 1988 22394 1684 12629 --
NM_030762chr1221372 1256 --11610 --
NM_030763chrX2768 48 ------
NM_030772chr1----1455 --
NM_030786chr12524 227 ------
NM_030790chr16--2254 224 ----
NM_030791chr142589 438 ------
NM_030795chr82460 338 ------
NM_030796chr72321 197 --11581 11645
NM_030799chr512083 184 ----
NM_030803chr221263 89 ------
NM_030805chr231148 1060 961 --21201 223 --
NM_030806chr1118180 7904 7027 6695 3660 3234 2614 2248 1192 1135 222 27945 243 1582 --
NM_030808chr17--1338 --1904
NM_030809chr122238 95 ----12494
NM_030810chr62641 559 --11155 --
NM_030881chr2242400 2122 844 304 12350 ----
NM_030885chr312214 128 --12065
NM_030893chr12630 512 ------
NM_030906chr112589 93 ------
NM_030915chr231969 888 284 ------
NM_030916chr1--1677 2844 308 --
NM_030918chr1135052 4868 4782 3739 3604 3490 3384 2092 1538 340 322 308 196 --12030 --
NM_030934chr131871 1602 1419 ------
NM_030945chr541707 1644 155 126 199 --1741
NM_030948chr6166 --130 --
NM_030953chr511007 --11551 --
NM_030962chr111503 --21028 46 --
NM_030963chr61579 ------
NM_030964chr543443 3271 2831 1170 11471 ----
NM_030978chr9--1445 ----
NM_030981chr1141044 365 235 158 ----1336
NM_031216chr1852229 1719 482 37 29 145 ----
NM_031243chr72841 618 11916 22418 725 --
NM_031262chr931033 870 121 ------
NM_031263chr931090 927 178 ------
NM_031267chr7----1185 --
NM_031268chr16134850 4810 4428 4379 4341 4202 3679 1723 1480 778 629 399 389 34887 4070 1209 23311 1163 --
NM_031296chr461998 1718 1045 984 461 116 12453 ----
NM_031305chr41517 1322 ----
NM_031371chr121498 1097 ------
NM_031371chr121498 1097 ------
NM_031372chr421501 1461 ------
NM_031411chr511893 ------
NM_031412chr121183 --1936 --
NM_031417chr1952465 2176 938 900 422 ------
NM_031418chr11----32714 2522 572 22754 905
NM_031427chr1455943 5335 3630 2066 842 ------
NM_031431chr1341848 1707 134 124 ------
NM_031435chr1223190 2209 --22624 2327 --
NM_031438chr52305 116 ------
NM_031439chr831581 1393 265 11935 ----
NM_031442chrX22442 2151 --12992 1227
NM_031450chr11143 --1244 --
NM_031468chr797846 7254 7247 7111 6538 6383 1966 1935 755 23113 29 16234 12276
NM_031475chr1--1726 1244 --
NM_031476chr1682618 2315 2252 2087 1786 1773 983 673 12768 ----
NM_031483chr2022415 1235 169 ----
NM_031844chr112505 --21356 311 --
NM_031845chr213520 23676 883 ----
NM_031847chr213520 23676 883 ----
NM_031849chr511893 ------
NM_031850chr31829 1658 ----
NM_031850chr31829 1658 ----
NM_031857chr511893 ------
NM_031858chr172512 33 ------
NM_031860chr511893 ------
NM_031862chr172512 33 ------
NM_031890chr2232603 2263 323 1806 1823 --
NM_031899chr331074 285 97 ------
NM_031940chr8----12057 --
NM_031953chr4----1169 --
NM_031989chr12136 ------
NM_031992chr72445 347 1188 ----
NM_032012chr954496 4208 1259 364 169 11201 35213 3813 753 --
NM_032017chr151845 1660 742 88 31 1811 1285 --
NM_032041chr842633 2476 708 448 11758 ----
NM_032049chr31829 1658 ----
NM_032049chr31829 1658 ----
NM_032052chr221397 --31332 1070 441 --
NM_032102chr1132823 648 609 23067 635 13094 --
NM_032105chr165879 5460 1762 608 442 179 25415 2925 12142 15319
NM_032116chr1365829 5250 4306 4151 392 209 ----11597
NM_032128chr41886 ----11032
NM_032144chr221501 1412 1385 ----
NM_032145chr611812 ------
NM_032153chr322295 2272 12358 12342 --
NM_032160chr1843972 3872 3646 386 ------
NM_032181chr21229 ----1720
NM_032182chr1021442 1131 ------
NM_032186chr111147 1285 ----
NM_032189chr1364528 4249 1322 1193 716 266 --2428 328 --
NM_032192chr172593 200 1741 ----
NM_032195chr211404 1506 ----
NM_032199chr1043749 2449 1303 68 ----12896
NM_032205chr8----172 --
NM_032208chr242399 2311 677 504 --33310 670 380 --
NM_032211chr10129 ------
NM_032213chr2--1260 11157 --
NM_032229chr131726 1811 134 --
NM_032236chr121007 763 ------
NM_032239chr4--1589 ----
NM_032246chr15133 11063 ----
NM_032268chr1673187 2815 2616 2329 1260 383 376 13097 --22469 1297
NM_032272chr81197 1467 ----
NM_032281chr1922992 2563 11929 ----
NM_032291chr11786 ------
NM_032295chr721074 63 ------
NM_032298chr192463 318 ------
NM_032312chr2--193 ----
NM_032321chr232793 2714 2047 ----12183
NM_032327chr102410 339 --1439 --
NM_032329chr284343 4132 3657 3583 3473 2687 1615 864 ------
NM_032364chr1231015 380 144 --1318 --
NM_032373chr1055409 858 807 721 161 1367 25751 5506 --
NM_032389chr114825 792 716 275 --1812 --
NM_032410chr81247 ------
NM_032424chr1131044 362 208 ------
NM_032435chr142392 1965 261 164 22351 2187 185 --
NM_032438chr611595 --11399 --
NM_032439chr1011157 ----1257
NM_032440chr1011842 1733 --22541 166
NM_032445chr1531956 580 430 ----11675
NM_032446chr573066 2509 1413 332 266 219 49 ----1952
NM_032449chr152291 1884 1823 1140 122 1826 1396 --
NM_032452chr143508 481 293 ------
NM_032457chr443745 3255 1230 662 ------
NM_032458chrX63219 2509 652 522 135 64 11213 ----
NM_032466chr821709 1396 --11582 --
NM_032468chr821709 1396 --11582 --
NM_032499chr1561697 1384 1229 1206 310 118 --1584 --
NM_032509chr8--1584 ----
NM_032521chr2041126 522 340 242 --1688 --
NM_032539chrX----2576 41 --
NM_032547chr4135 11411 ----
NM_032569chr161342 ----11325
NM_032575chr1631968 1268 222 11884 ----
NM_032582chr1721734 402 ------
NM_032590chr122722 413 ------
NM_032594chr14--1830 ----
NM_032595chr17--1498 ----
NM_032596chr91122 ------
NM_032622chr431253 1075 335 ------
NM_032632chr1421919 1357 ------
NM_032646chr1721655 118 ------
NM_032663chr1252053 1720 1622 686 75 ------
NM_032682chr333534 2247 459 13560 --23227 862
NM_032701chr192617 234 ------
NM_032711chr17123934 3316 3306 3185 3164 2883 2661 1336 1200 551 292 205 24266 3387 11702 --
NM_032727chr102648 326 ------
NM_032731chr1711475 ------
NM_032758chr221645 143 ----
NM_032777chr841484 1433 1425 532 11372 ----
NM_032784chr6----137 --
NM_032800chr152537 2152 1982 785 458 ------
NM_032803chrX----122 --
NM_032808chr153854 843 145 ------
NM_032812chr10--1116 ----
NM_032813chr131947 --1997 --
NM_032826chr754288 2011 1957 358 103 11493 ----
NM_032828chr19124260 3377 3244 3183 1902 1579 927 464 396 334 121 90 11616 ----
NM_032838chr191147 ------
NM_032842chr731554 644 581 --11681 --
NM_032859chr1331095 634 283 ------
NM_032869chr831849 1802 400 1697 ----
NM_032870chr6----1414 --
NM_032875chr173774 701 533 ------
NM_032876chr144841 401 45 23 --1339 11880
NM_032900chr1032500 2389 395 22781 104 --11501
NM_032905chr1021121 135 197 ----
NM_032906chr42868 714 ----1338
NM_032927chr41502 --130 --
NM_032932chr17116294 6005 5992 5356 5306 4874 4771 4290 2576 2257 1388 25362 2129 --11592
NM_032936chr7133 ------
NM_032947chr53882 500 121 1974 11238 --
NM_032949chr131392 ------
NM_032961chr41494 1551 ----
NM_032968chrX3982 578 335 ------
NM_032969chrX3982 578 335 ------
NM_032971chrY1934 --2950 267 --
NM_032972chrY1934 --2950 267 --
NM_032973chrY3982 578 335 ------
NM_032975chr1843520 2986 2362 1143 33368 3253 3138 22268 373 --
NM_032980chr1843520 2986 2362 1143 33368 3253 3138 22268 373 --
NM_032982chr732504 1596 968 1537 ----
NM_032991chr411400 --21052 290 1103
NM_032995chr241341 1188 582 485 1295 1433 --
NM_032998chr121116 990 1963 ----
NM_033012chr133792 672 412 ------
NM_033016chr2211223 154 ----
NM_033018chrX31015 903 139 ------
NM_033020chr154589 3803 3697 1553 90 --33336 1091 555 --
NM_033023chr721100 441 --11010 --
NM_033025chr193400 277 93 ------
NM_033027chr32181 40 ------
NM_033030chr22505 223 ------
NM_033044chr121265 1061 --11083 --
NM_033056chr101688 ------
NM_033058chr82371 131 ------
NM_033082chr121170 --1213 --
NM_033083chr333389 2713 860 12773 ----
NM_033088chr11676 179 ----
NM_033089chr203961 523 229 ------
NM_033102chr13143 131 104 --1889 --
NM_033102chr13143 131 104 --1889 --
NM_033103chr1961352 1099 1036 865 480 45 1222 ----
NM_033119chr162814 193 ------
NM_033121chr1221453 479 11806 2660 59 --
NM_033124chr12----1109 --
NM_033132chr1331891 1866 1513 2806 555 ----
NM_033133chr1753743 3628 2849 2363 1090 12441 ----
NM_033138chr73563 404 85 --1237 --
NM_033139chr73563 404 85 --1237 --
NM_033140chr73563 404 85 --1237 --
NM_033143chr444282 4142 2934 2857 34649 4292 3839 1840 --
NM_033157chr73563 404 85 --1237 --
NM_033161chr941310 738 598 504 ----11954
NM_033181chr633300 3100 938 11177 --13008
NM_033182chr151953 1892 514 170 50 --11531 --
NM_033211chr52338 229 168 ----
NM_033222chr91106 ------
NM_033224chr786858 6795 3151 2418 2212 1370 893 441 22342 2175 ----
NM_033225chr862880 2692 2260 2052 1970 326 ----12960
NM_033260chr61546 ----1601
NM_033285chr833549 1544 81 --1165 --
NM_033290chrX43770 3092 2629 658 23400 2400 --12387
NM_033305chr911225 ------
NM_033326chr1122180 331 12379 1389 --
NM_033331chr943125 2379 1139 1025 1612 1234 1723
NM_033345chr1151 ------
NM_033360chr1254585 4511 4302 4206 439 ------
NM_033380chrX31160 139 99 1408 ----
NM_033381chrX31160 139 99 1408 ----
NM_033387chr932491 420 132 22133 1728 ----
NM_033389chr1774379 4353 4062 1332 1222 754 286 --43416 1626 1024 1010 --
NM_033394chr221313 1065 11533 ----
NM_033401chr162394 218 ------
NM_033420chr19----166 --
NM_033425chr114834 597 569 560 ------
NM_033427chr71177 ------
NM_033430chr463994 3775 3322 2886 2762 471 1118 1605 --
NM_033437chr463994 3775 3322 2886 2762 471 1118 1605 --
NM_033449chr541942 1351 857 748 1634 134 --
NM_033480chr622578 286 12168 ----
NM_033481chr622578 286 12168 ----
NM_033495chrX1941 --1288 127
NM_033503chr1533364 3202 1262 --1829 --
NM_033505chr286672 6417 5622 5335 4604 1439 959 282 56450 5889 5790 4410 2076 34747 4654 2715 --
NM_033512chr842940 767 407 83 --1943 12266
NM_033515chr61159 --11275 11181
NM_033516chr921093 317 ------
NM_033546chr18--188 ----
NM_033549chr521005 113 ------
NM_033551chr573183 2870 1394 1195 1166 555 131 21128 1046 --12494
NM_033624chr1251880 1540 1528 129 30 1100 1189 --
NM_033631chr153524 3032 2447 1396 556 --1769 --
NM_033632chr44618 340 214 123 ------
NM_033642chrX3873 316 52 11068 ----
NM_033644chr521899 532 12569 ----
NM_033645chr521899 532 12569 ----
NM_033655chr941079 714 155 120 ------
NM_033656chr2153790 3764 3686 671 602 --25458 4078 --
NM_044472chr14660 505 220 28 1530 ----
NM_052827chr1231002 851 385 ------
NM_052832chr832295 678 60 1316 12836 12936
NM_052834chr1842538 1749 397 299 --160 --
NM_052840chr15----11532 --
NM_052845chr1253167 3008 2001 894 679 1284 --1830
NM_052851chr132526 149 --12044 --
NM_052854chr112568 513 ------
NM_052855chr17----1619 --
NM_052869chr1721655 118 ------
NM_052879chr1253923 3050 2756 297 191 --33233 3074 1400 --
NM_052905chr241731 1254 373 348 ------
NM_052906chr2254893 3949 1555 605 270 --13128 --
NM_052907chr1234150 2859 53 23286 3209 ----
NM_052910chr1321519 1505 1518 11666 --
NM_052911chr182975 963 ------
NM_052913chr631104 1054 806 ------
NM_052917chr22998 782 --13419 1876
NM_052918chr1022825 2649 23586 1222 ----
NM_052925chr19----2807 292 --
NM_052927chr532230 379 159 --12065 --
NM_052932chr1121644 683 --141 --
NM_052933chr7189 ------
NM_052934chr131558 633 385 1395 124 --
NM_052937chr821945 216 2488 465 11090 --
NM_052940chr11223 ------
NM_052950chr1321984 333 1257 1701 --
NM_052968chr112540 149 ------
NM_053001chr81294 1145 ----
NM_053002chr32982 410 ------
NM_053016chr987706 7355 6692 6681 2810 1895 541 425 27880 1013 22798 463 17984
NM_053023chr114896 416 209 187 12409 --12545
NM_053024chr321444 1311 ------
NM_053025chr321639 1460 --11801 --
NM_053026chr321639 1460 --11801 --
NM_053027chr321639 1460 --11801 --
NM_053028chr321639 1460 --11801 --
NM_053031chr321639 1460 --11801 --
NM_053032chr321639 1460 --11801 --
NM_053042chr433136 2912 1259 --23018 967 --
NM_053043chr786279 5717 4864 2074 2047 1653 1552 697 22548 1592 23874 2497 --
NM_053046chr194176 143 94 66 ------
NM_053053chr11147 --1894 --
NM_053056chr1162974 2712 2402 2206 2038 912 ------
NM_053280chr111193 ------
NM_054016chr11283 12021 1157 187
NM_054016chr11283 12021 1157 187
NM_054016chr11283 12021 1157 187
NM_054033chr22529 169 ------
NM_057158chr82737 628 --1846 --
NM_057164chr23674 650 234 1152 ----
NM_