TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-10a-3p
miRNA Sequence: CAAAUUCGUAUCUAGGGGAAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116805 6269 5981 5432 5155 4969 4775 1992 1145 876 791 35966 5338 645 ----
NM_000216chrX104082 3961 3420 3306 3279 2565 2509 1602 321 294 12828 --1550
NM_000217chr12115272 5161 4557 4460 4391 3830 1990 1145 697 637 161 14799 ----
NM_000332chr6127036 6090 5217 5051 4784 4368 2611 1792 1768 1334 972 725 24801 1547 12312 --
NM_000452chr1362036 404 348 334 117 27 ----11300
NM_000618chr12166338 5805 5782 5466 5210 5141 4865 4443 2484 2189 1983 1610 1468 1162 408 63 24344 4044 1524 --
NM_000618chr12166338 5805 5782 5466 5210 5141 4865 4443 2484 2189 1983 1610 1468 1162 408 63 24344 4044 1524 --
NM_000809chr4158127 7709 7662 7549 6810 6484 6138 3666 2536 1465 1287 1231 1119 661 465 29175 7632 ----
NM_000899chr12124414 4196 3741 3335 2906 1585 1568 1238 1157 695 548 203 14366 ----
NM_000926chr11108423 5885 5861 3324 2248 1747 1051 996 304 79 89442 7890 6423 3393 2443 1167 540 227 ----
NM_001001396chr1154412 4085 4078 3959 3535 3286 3271 3147 2931 925 631 623 459 286 72 ------
NM_001001556chr15111606 1513 1340 1248 1170 1051 1042 618 577 368 331 11551 ----
NM_001001664chr273480 3015 2884 1618 1340 1044 388 13856 ----
NM_001002860chr1494560 3702 3611 3405 3299 1805 1574 1171 290 12888 ----
NM_001004317chr683638 3216 1752 1081 433 274 127 101 13010 1576 --
NM_001005473chr596579 6426 6278 5831 4365 4138 4040 1351 1121 24608 2504 ----
NM_001007097chr9115085 4873 4815 4625 4466 4434 3661 3625 1896 1200 510 13918 ----
NM_001008925chr473387 3203 3153 2959 675 639 164 --13021 --
NM_001013620chr1287354 6395 3398 2690 2367 2162 721 89 58068 6022 5731 5396 1609 11889 13338
NM_001018065chr9116020 5348 5305 5142 5113 4544 3912 2337 1792 1212 829 24634 2076 ----
NM_001018066chr9116020 5348 5305 5142 5113 4544 3912 2337 1792 1212 829 24634 2076 ----
NM_001024948chr193391 3269 2806 2572 599 442 367 288 260 ------
NM_001025580chrX93573 2862 2747 1574 1252 1225 496 437 278 1865 ----
NM_001037165chr7158776 8329 7863 7645 7638 7523 7387 7082 6567 5589 5475 2741 1855 895 657 17775 ----
NM_001039547chr3127324 7136 7028 6635 5167 5053 2748 1960 1394 1312 1273 479 ------
NM_001039618chr11105595 4994 4805 3663 2298 1948 1817 1642 1249 658 22081 1211 ----
NM_001039840chrX95911 5788 5325 5041 4370 2116 2031 1326 746 --15676 12264
NM_001040152chr774832 4556 4352 3979 3920 3440 907 1529 14004 --
NM_001040665chr7125027 4700 4314 4117 4091 3967 3206 1904 526 347 191 146 ------
NM_001042533chr373181 2959 2821 2347 2103 839 84 1718 --1645
NM_001100108chr1147995 7533 7161 6127 5980 5130 5096 1976 1945 1902 1832 1665 1164 418 18134 ----
NM_001106chr3139369 9281 8292 8182 7917 7578 6730 6477 6021 1468 1302 1076 475 23153 1980 18719 --
NM_001167chrX145699 5243 4656 4428 2437 2287 2177 1387 897 545 328 314 164 89 26470 6399 1862 --
NM_001204chr2117634 7050 6835 6711 6171 5579 3102 2830 1967 990 642 15960 ----
NM_001304chr17113278 3110 3045 2818 2810 2709 934 631 519 489 147 12835 ----
NM_001650chr1884107 3426 3328 2836 2660 1137 926 190 23572 412 ----
NM_001684chr1134129 3802 3795 3676 3252 3003 2988 2864 2648 642 348 340 176 ------
NM_001858chr6104714 4326 4278 4009 1987 1938 1685 514 382 248 11488 ----
NM_002006chr495579 4867 4529 4302 3820 3649 1362 781 744 2489 434 ----
NM_002025chrX199293 8969 8531 8482 8340 7291 7182 7030 5720 3469 3328 3313 3010 2978 2921 2512 1186 969 501 58150 5648 3067 2197 1778 ----
NM_002044chr15111606 1513 1340 1248 1170 1051 1042 618 577 368 331 11551 ----
NM_002092chr4124837 4759 4699 4458 4141 3422 3408 3215 1818 1710 555 398 1845 ----
NM_002214chr785476 4745 3770 3460 1724 1561 1186 862 34323 3620 361 ----
NM_002264chr373674 3215 1523 1068 824 788 409 13328 --14780
NM_002336chr1295053 4189 3581 1851 1761 1513 1227 818 711 34364 3931 1328 ----
NM_002655chr885297 4806 4064 1784 1389 1258 1134 488 14774 14952 --
NM_003034chr12107875 6378 6287 5549 5149 1472 1006 826 312 93 31909 734 678 ----
NM_003108chr2117280 6899 6634 6422 6297 6110 5845 5801 5549 4884 2118 56145 5790 5378 4861 778 ----
NM_003262chr385096 5064 4762 4094 3354 1947 1366 47 23192 1649 ----
NM_003298chr3106256 6159 6117 6078 5723 5349 4427 4160 819 617 31999 1914 1432 14942 --
NM_003338chr1061814 1690 1246 745 685 529 11261 ----
NM_003411chrY71801 1471 1456 1436 732 254 96 11767 11554 --
NM_003566chr1293446 3016 2854 2535 1192 1148 945 654 602 1549 ----
NM_003574chr1895743 5358 3588 1512 1393 1321 1121 541 505 15263 ----
NM_003663chr382958 2795 2554 2159 843 761 698 682 1941 ----
NM_003994chr12124414 4196 3741 3335 2906 1585 1568 1238 1157 695 548 203 14366 ----
NM_004028chr1884107 3426 3328 2836 2660 1137 926 190 23572 412 ----
NM_004232chr1883778 3621 1096 648 537 495 264 226 33873 1054 473 ----
NM_004501chr193899 3867 3673 3498 3421 2965 2562 1244 447 21330 342 ----
NM_004504chr282808 2040 940 898 710 694 492 196 13059 ----
NM_004726chrX125068 4625 4452 3790 3597 3584 2049 2020 1624 1618 857 229 24365 338 ----
NM_004748chr15114092 4075 3762 3683 3485 1632 1231 1091 941 916 41 ------
NM_004815chr174797 3768 3137 1398 1192 1039 843 24707 1326 ----
NM_004857chr1474778 4073 3321 3229 3030 2948 2937 23960 1068 ----
NM_004866chr5124398 4091 3813 3567 3447 3208 3068 1809 1003 705 452 265 23289 1672 ----
NM_005065chr14115380 5301 4983 4387 4246 3539 1318 1275 976 670 130 24177 926 1749 --
NM_005197chr14125750 5017 4926 4867 4489 4008 3964 1441 1370 1162 747 192 34879 2113 1182 ----
NM_005339chr484301 3376 3186 2749 1380 890 328 316 21289 441 13003 --
NM_005504chr12146368 6064 5745 5164 4547 4415 4361 4125 1079 814 484 263 170 76 ------
NM_005596chr964497 4006 2082 2036 1842 1658 32443 1119 966 --1987
NM_005665chr184878 4632 4519 4063 3725 3434 943 346 23603 29 ----
NM_005668chr584502 4316 4214 3578 3553 2953 2934 500 24447 1555 1848 --
NM_005748chr12133297 2616 2371 1302 1203 1184 590 535 313 292 238 147 119 ----1340
NM_005941chr883757 3683 3543 3093 1416 1338 983 39 23809 477 ----
NM_006037chr2124800 4068 4053 1728 1655 1584 1543 1499 1298 700 641 342 13979 1669 --
NM_006095chr454016 3031 2973 949 203 13813 11198 11587
NM_006106chr11113190 2885 2765 2643 2456 2211 2189 2139 2103 1208 21 ------
NM_006252chr1167466 7426 7072 6446 5883 5836 5523 5340 5322 5217 4927 2958 2197 1596 646 112 ------
NM_006283chr8134508 3738 3325 3236 3162 1576 1535 1364 1341 1145 965 660 273 ------
NM_006380chr17104394 4105 3809 3463 3288 2882 1505 1307 93 38 23744 343 ----
NM_006599chr16118162 8115 7903 6394 5948 5875 5311 2768 2102 1810 246 ------
NM_006620chr674713 3997 3804 3533 1637 769 748 44684 4594 1356 249 ----
NM_006626chr951786 1689 859 567 373 12526 1658 1687
NM_006731chr9145802 5698 5667 5544 4457 4370 4098 3951 3563 1160 951 563 173 26 34127 3657 902 11600 --
NM_006750chr16147516 7389 5809 5627 5253 3133 2970 2910 2794 2316 1842 1095 539 382 25141 497 ----
NM_006873chr262953 2821 2716 1159 789 534 43233 2892 2854 1361 ----
NM_006924chr17114251 4214 3961 3752 3544 3145 2787 1579 1496 1281 118 12997 ----
NM_007007chr1284464 4181 3991 3781 3699 3327 1600 598 13934 ----
NM_007011chr15106638 6458 6309 6260 5096 2758 2584 2369 1288 691 16906 15356 --
NM_007249chr13139297 8921 7977 7805 7716 7632 7396 7228 2804 2725 2576 1971 1705 29322 8939 ----
NM_007373chr10111827 1746 1545 690 664 575 554 504 431 207 159 ------
NM_012072chr2084262 4000 3708 3518 2967 789 770 227 24419 3509 ----
NM_012164chr9137521 7458 7191 6559 5951 5615 2810 2738 2230 1970 1460 968 648 16952 25062 2507 --
NM_012214chr2106425 6276 5408 4248 4070 1982 1252 918 633 36 25562 4897 ----
NM_012252chr7125231 5005 4662 4425 4181 3920 3566 1990 1510 1032 571 182 13979 ----
NM_014028chr693222 2830 1322 1305 1212 881 758 746 144 12048 ----
NM_014331chr4147722 7241 7127 6625 5965 5851 5833 5438 2419 2205 1884 1020 608 57 56764 5089 2256 2083 673 ----
NM_014721chr666626 5904 5759 2710 1516 86 57465 4946 1499 517 509 ----
NM_014797chr692458 1329 1117 908 799 687 671 505 61 ------
NM_014877chr1797261 7219 7028 6757 6462 6267 5660 3074 1243 47528 6645 1579 846 ----
NM_014904chr1074030 3338 2666 1464 1131 859 842 32606 1407 834 ----
NM_014934chr1393746 3394 3118 2490 1151 870 453 361 327 ------
NM_015000chr1283096 3043 2515 2505 2390 2336 1134 145 33052 855 585 ----
NM_015026chr1283983 3871 3400 1643 1635 984 912 422 11468 ----
NM_015230chr491758 1738 1531 1431 1299 1209 1201 526 99 1494 ----
NM_015310chr896973 6965 5678 5409 3147 2943 1612 1123 260 68373 7621 6027 3370 2547 363 ----
NM_015365chrX93573 2862 2747 1574 1252 1225 496 437 278 1865 ----
NM_015455chr594047 3164 2911 2851 1331 1219 1042 743 88 1442 ----
NM_015569chr184768 4732 4399 3955 3741 1937 1328 38 24001 962 ----
NM_015886chr865447 4600 4029 2152 1443 76 2950 376 1593 --
NM_016206chr3167577 6834 6658 6422 6389 5993 5876 2942 2699 2693 2230 2087 2066 1035 851 712 88525 8094 6445 3483 2334 2053 1377 1296 ----
NM_016248chr1383674 3303 2637 1581 1416 1081 1007 852 33411 3157 3063 ----
NM_016260chr2116638 5950 5284 5274 4945 3026 2933 2897 2650 2345 382 2576 252 12323 --
NM_016422chr11102886 2811 2780 2376 2104 1020 785 703 689 268 33223 2905 2315 ----
NM_017637chr9109402 9007 8381 6189 3741 3449 3013 2879 2444 197 39043 3568 2129 ----
NM_017643chr1792720 2213 2111 1993 993 920 428 239 37 52493 2068 1120 1022 265 ----
NM_017644chr3114668 4472 4438 4090 4073 3580 3401 1782 1397 1062 277 ------
NM_017705chr1583679 3539 3069 2615 650 643 372 130 13807 ----
NM_017813chr885833 5147 4527 1964 1371 932 442 268 35123 3785 1875 ----
NM_018155chr373450 3112 2796 2719 908 894 798 12902 12892 --
NM_018448chr125997 516 354 271 52 ----11105
NM_018566chr164731 4540 4402 4274 4124 558 24472 961 ----
NM_018638chr12115336 5146 5012 4253 4176 4060 1841 1175 593 521 288 13886 13561 --
NM_019117chrX73485 3378 3192 3013 1225 198 187 11378 ----
NM_020177chr5102889 2715 2276 2243 2143 1203 944 344 207 38 13040 ----
NM_020390chr393963 3680 3351 1568 1489 1339 1302 1011 198 14011 ----
NM_020651chr281527 1478 587 526 221 213 189 120 ------
NM_020718chr16106242 5758 5553 5143 4749 2315 1761 1609 1575 853 36515 6184 2433 ----
NM_020739chr15114092 4075 3762 3683 3485 1632 1231 1091 941 916 41 ------
NM_020772chr1797624 7030 5806 3071 3012 2451 2396 2331 1711 --17135 --
NM_020792chr372391 2101 1932 526 174 124 115 12610 ----
NM_020810chr14113557 3122 2949 2514 2225 1283 1191 1045 1029 601 55 --1699 --
NM_020921chr1493065 2852 1175 1019 956 472 298 163 117 32241 1107 218 ----
NM_021255chr1483546 3358 3060 2918 2795 1460 1197 868 33185 633 254 ----
NM_021629chr395092 4223 4134 3785 3618 1036 470 385 249 24277 3916 ----
NM_021964chr3146296 6082 5997 5895 5782 5682 5157 4917 4697 4681 4644 4547 4169 2522 45833 4812 4348 1925 ----
NM_022459chr13115482 5363 5239 4501 3867 1939 1609 1289 354 110 52 26305 1231 ----
NM_024345chr995891 5571 4956 4653 3987 2043 826 651 395 1718 ----
NM_024524chr3103056 3038 2257 1118 1067 1057 1023 948 256 64 12280 ----
NM_024744chr281058 981 965 872 745 703 692 410 31883 262 24 ----
NM_024947chr3137845 6364 6227 5917 3519 2751 2679 2527 2097 2028 1635 1243 607 19344 ----
NM_025040chr1972266 1996 1602 1572 930 912 534 11641 12005 --
NM_025054chr884156 3796 3752 3434 3340 1216 442 198 3957 832 818 ----
NM_025160chr184074 3663 2727 1359 948 453 226 67 23973 3819 ----
NM_030647chr7116338 4960 2449 2252 2222 1853 1658 1596 1269 560 268 ------
NM_030648chr4105476 5356 4135 3914 3555 2228 1322 1007 981 617 1787 ----
NM_030650chr293980 3816 1508 796 751 598 535 439 120 23846 1157 ----
NM_030674chr12115730 5416 4703 4456 4304 4234 1688 1515 1436 1109 435 ------
NM_031427chr1495948 5924 5888 5579 5472 4455 2183 2161 826 32139 1154 631 ----
NM_031844chr193899 3867 3673 3498 3421 2965 2562 1244 447 21330 342 ----
NM_032373chr1084526 4457 2060 1981 1961 1529 991 957 54721 4228 3809 1830 1783 ----
NM_032446chr543707 3560 3450 1297 43872 3131 3101 2830 --12700
NM_032778chr373181 2959 2821 2347 2103 839 84 1718 --1645
NM_033224chr7168050 7488 7321 6902 6613 6504 6496 6208 5841 2513 2009 1592 1503 1177 1035 994 27380 7116 --15590
NM_033430chr4113578 2767 2557 1443 1364 1307 1224 1020 837 484 360 ------
NM_033437chr4113578 2767 2557 1443 1364 1307 1224 1020 837 484 360 ------
NM_033656chr2195764 5635 5282 5213 4989 3782 981 355 265 55958 5815 4346 820 661 ----
NM_052917chr2123291 3188 3037 2681 2144 2126 2070 903 594 550 491 86 1777 ----
NM_052937chr872361 1979 1847 1811 760 675 376 22259 2138 ----
NM_053016chr9107857 6990 5624 4864 2527 2521 2257 1625 1509 126 15699 ----
NM_133646chr2125484 4856 4757 4736 4593 4248 4238 4151 3593 1848 1551 787 13411 ----
NM_138468chr295396 4297 4021 2512 2118 469 378 259 190 25894 74 ----
NM_138713chr16118162 8115 7903 6394 5948 5875 5311 2768 2102 1810 246 ------
NM_138714chr16118162 8115 7903 6394 5948 5875 5311 2768 2102 1810 246 ------
NM_139182chr491758 1738 1531 1431 1299 1209 1201 526 99 1494 ----
NM_144571chr4105708 4392 4263 1891 1405 1170 1050 822 654 447 12297 ----
NM_144578chr1495423 4584 4276 3777 2126 1882 1490 1471 285 35320 4405 1510 ----
NM_145259chr2106752 6713 6389 5603 4797 4682 2402 2387 1975 1844 26876 5579 ----
NM_145307chr10114159 3429 3127 2955 1727 1552 1157 595 390 272 164 23397 764 ----
NM_152437chr1282344 2172 2054 1938 1921 1910 1794 745 --12303 --
NM_152624chr5157180 7157 5931 5592 2880 2766 2666 2363 1941 1247 1167 1123 537 385 49 27188 552 1163 --
NM_152641chr1292429 2348 2163 1916 1844 1180 1089 1053 107 12034 ----
NM_152699chr373524 3481 2288 1313 770 761 81 23704 3313 --11399
NM_152754chr7113231 3168 3109 2866 2767 1187 832 633 538 272 102 33767 373 281 1320 --
NM_152924chr15106638 6458 6309 6260 5096 2758 2584 2369 1288 691 16906 15356 --
NM_152999chr7125027 4700 4314 4117 4091 3967 3206 1904 526 347 191 146 ------
NM_153182chr373181 2959 2821 2347 2103 839 84 1718 --1645
NM_153332chr8112337 2085 1312 1199 1076 711 509 442 250 180 71 ------
NM_172070chr251941 754 607 592 448 ----148
NM_172071chr1136950 6856 6460 6272 5639 5491 5473 5209 2792 1826 1699 1663 1066 26682 1422 ----
NM_173214chr16118162 8115 7903 6394 5948 5875 5311 2768 2102 1810 246 ------
NM_173468chr4125878 4908 4775 4613 4321 2443 2409 1627 1367 563 261 62 11117 13869 --
NM_173511chr2103773 3651 3614 2651 2635 2516 1425 1074 1036 284 13478 ----
NM_173582chr11146281 6254 6125 5679 5635 4900 4765 2196 2154 1310 1164 1005 835 303 44588 1902 1664 982 ----
NM_173602chr1261311 997 829 654 340 319 2991 333 ----
NM_178011chr1083249 3060 2520 1192 1146 724 567 167 1611 ----
NM_182515chr1976707 5220 4486 4082 1905 1739 868 35431 1405 1244 --25331 5006
NM_182757chr683487 3366 2322 2309 2292 2282 1114 815 22951 2408 ----
NM_182762chr795849 5346 4390 3844 3791 2495 2209 1835 970 36239 2355 1784 ----
NM_194247chr283850 3588 3211 1549 1413 1293 511 374 34114 3765 694 ----
NM_194283chr5114079 3797 3125 3054 2881 2851 799 660 349 209 189 24124 760 ----
NM_194434chr1895743 5358 3588 1512 1393 1321 1121 541 505 15263 ----
NM_198270chrX82674 2573 2489 1324 1149 727 658 129 12724 ----
NM_198581chr275806 4779 3010 2938 1716 1593 1377 27551 6074 ----
NM_198968chr1393746 3394 3118 2490 1151 870 453 361 327 ------
NM_206855chr6116166 6151 5253 5074 4412 4080 3991 3931 1089 812 271 34111 2521 2272 ----
NM_206909chr896973 6965 5678 5409 3147 2943 1612 1123 260 68373 7621 6027 3370 2547 363 ----
NM_207303chr10113944 3422 3350 2732 2675 2527 1586 1451 1183 171 78 --13659 --
NM_207361chr13106115 5639 5255 4297 2426 1978 1574 608 153 143 36085 1858 1781 ----
NM_212558chr994206 4175 3529 3351 2976 1633 1290 848 824 ------