TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-10a-5p
miRNA Sequence: UACCCUGUAGAUCCGAAUUUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr284272 4248 3192 3098 1710 1154 1066 892 ----14129
NM_001001701chr472150 1511 1453 938 432 354 263 ------
NM_001025077chr1065999 5690 5145 1737 593 77 147 1723 --
NM_001039570chr22114605 4463 4228 4221 3222 1767 717 592 466 456 332 ------
NM_001039571chr22114605 4463 4228 4221 3222 1767 717 592 466 456 332 ------
NM_001040284chr1673837 2194 1516 656 353 329 65 --1260 --
NM_001167chrX56233 4692 1647 996 818 21606 182 25668 2043 --
NM_001759chr1274139 4132 4106 2120 1560 1321 88 ----14477
NM_002223chr1273626 3210 2846 1268 537 304 277 --21417 1405 --
NM_002740chr342582 2415 2058 394 ----1990
NM_003112chr732708 449 135 ----13147
NM_003234chr332333 2279 2006 137 12044 1165
NM_003298chr355032 4215 1733 1392 472 31870 538 405 34340 3934 3908 --
NM_003872chr2102903 2818 2806 2771 2519 2068 983 670 231 181 12512 12780 --
NM_004726chrX75134 4869 3769 1378 1285 1267 1259 11372 11394 --
NM_004992chrX158213 8050 6554 5986 5941 3165 3053 1868 1729 1667 897 848 726 473 157 --11149 --
NM_004992chrX158213 8050 6554 5986 5941 3165 3053 1868 1729 1667 897 848 726 473 157 --11149 --
NM_005596chr976017 5474 4543 2411 2031 1307 1261 --11159 --
NM_006047chr20------2443 26
NM_006252chr145935 1904 1130 931 35756 2834 1291 16672 --
NM_006306chrX65139 3836 1885 1243 235 194 13772 15367 --
NM_007030chr5135053 4680 4564 4368 3802 3732 3697 3662 3162 1670 1081 506 46 ------
NM_007050chr20147374 7322 7240 5853 5819 2510 2487 2212 2189 1873 1258 791 736 148 16464 ----
NM_014747chr1135591 4805 4789 4647 4184 3931 3642 2204 1847 1648 1479 1117 756 --12241 --
NM_014909chr14123800 3669 3552 3305 3237 2913 2851 2446 1514 1076 1057 104 1515 12491 --
NM_015035chr20145851 5788 4830 4765 4501 4315 4137 4061 1814 1787 1656 1162 1086 496 15069 ----
NM_015094chr22164229 4048 3808 1577 1560 1478 1433 1269 759 715 531 498 454 359 263 83 ------
NM_015299chr1463837 3236 1608 897 335 324 11349 34015 489 242 --
NM_017637chr988365 7710 6883 3212 2318 1798 950 252 ------
NM_017770chr612942 ----22698 413
NM_018667chr16102423 2060 2036 889 826 607 560 347 110 104 --2729 687 --
NM_020453chr431864 1318 685 ----1519
NM_021090chr2274873 4331 3406 1194 948 931 403 14787 21685 1427 --
NM_021116chr7226985 6715 6608 5870 5788 2761 2488 2280 2182 1973 1857 1806 1787 1723 1676 1629 1424 1274 1085 361 121 105 18920 28713 1191 --
NM_024698chr117904 175 139 132 125 116 37 ------
NM_030648chr465125 4603 4464 4034 707 319 1715 21891 328 --
NM_030918chr164649 3762 2143 1591 1386 212 15093 35151 2017 1847 --
NM_053016chr997776 7690 7629 7476 6919 6812 6578 3203 526 12873 15366 --
NM_133170chr20147374 7322 7240 5853 5819 2510 2487 2212 2189 1873 1258 791 736 148 16464 ----
NM_152838chr20------2443 26
NM_153050chr2274873 4331 3406 1194 948 931 403 14787 21685 1427 --
NM_153051chr2274873 4331 3406 1194 948 931 403 14787 21685 1427 --
NM_173832chr8182848 2832 2743 2624 2538 2516 1348 1323 1298 1273 1248 1223 1198 1173 1148 1123 289 97 ------
NM_174911chr863049 2773 2633 932 547 166 --1949 12711
NM_175624chr1286785 6194 5805 5127 2916 2415 2291 418 16455 --17274
NM_175625chr1286785 6194 5805 5127 2916 2415 2291 418 16455 --17274
NM_181489chr395089 2460 2413 2043 1711 1156 1128 1052 735 --24556 2450 14869
NM_201266chr2102903 2818 2806 2771 2519 2068 983 670 231 181 12512 12780 --
NM_201279chr2102903 2818 2806 2771 2519 2068 983 670 231 181 12512 12780 --