TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1179
miRNA Sequence: AAGCAUUCUUUCAUUGGUUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51260 1157 ----
NM_000038chr51418 22040 1923 ----
NM_000045chr61111 ------
NM_000052chrX53064 2260 1268 1053 596 --13149 --
NM_000067chr81455 ------
NM_000084chrX65475 4611 4365 2706 1684 615 46831 2453 2247 526 35761 5275 1159 --
NM_000088chr173966 471 350 ------
NM_000089chr7----1517 --
NM_000090chr23884 197 121 ------
NM_000092chr254391 1626 1558 1355 175 --14189 --
NM_000093chr951972 1829 1575 990 432 1611 ----
NM_000096chr31360 ----184
NM_000097chr331058 838 444 --21138 158 --
NM_000103chr1521293 522 ------
NM_000109chrX32268 768 91 ------
NM_000110chr151147 888 858 831 461 ------
NM_000115chr1332108 1698 1676 --1793 --
NM_000125chr624042 3851 --24248 1620 --
NM_000141chr1041468 1384 1027 526 11487 ----
NM_000142chr441351 991 621 301 ------
NM_000161chr1431368 1324 567 31407 541 427 ----
NM_000163chr572268 1767 1553 661 384 146 81 --1179 --
NM_000165chr641531 1403 1236 1168 11123 ----
NM_000167chrX21802 1696 11224 21486 509 1184
NM_000176chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_000183chr21462 ------
NM_000190chr111231 ------
NM_000192chr1231349 405 125 --1154 --
NM_000208chr1984670 4237 4066 3993 3590 3320 1846 699 13937 11634 --
NM_000210chr221910 657 11543 --1808
NM_000217chr1244513 2048 1518 339 --1124 15266
NM_000222chr421922 562 11390 ----
NM_000232chr453082 3041 2657 2548 2330 --1574 --
NM_000237chr851484 750 523 443 261 --11220 --
NM_000240chrX42178 1845 1668 1530 22205 649 21740 713 --
NM_000242chr1052426 2021 1806 755 286 ------
NM_000245chr741515 1404 517 372 1763 ----
NM_000248chr332972 2173 390 32947 2196 1972 22931 2445 --
NM_000252chrX21399 600 ------
NM_000259chr15136361 5618 5581 5556 5490 5447 4830 4447 4433 4358 4321 4254 814 16269 25112 574 --
NM_000264chr932928 2787 996 22458 488 43003 2447 2326 922 --
NM_000267chr1753245 2844 1108 181 96 12975 ----
NM_000271chr181159 --1507 --
NM_000297chr431516 1424 1375 11475 --32029 576 104
NM_000314chr1072842 2802 2325 2283 1288 1086 955 23150 942 32317 1028 518 --
NM_000317chr113364 259 123 ------
NM_000318chr892742 2486 2190 1835 1168 699 489 276 101 32094 749 190 22829 1143 --
NM_000321chr1341693 1340 1213 698 1180 ----
NM_000329chr14782 739 275 135 ------
NM_000332chr697112 5163 5132 4470 2384 2018 2004 1919 1329 11866 ----
NM_000345chr42885 63 --11040 --
NM_000351chrX73644 3522 3081 2809 1281 915 606 --23964 2864 11505
NM_000358chr52446 24 --181 --
NM_000362chr2293607 3597 3579 3504 2954 1446 1074 811 659 ------
NM_000368chr951901 1310 151 99 62 --34821 1204 754 --
NM_000369chr142222 129 1390 11531 --
NM_000393chr231308 832 503 --11346 12149
NM_000399chr1031065 831 412 21076 884 ----
NM_000408chr232853 2566 95 22965 2875 11272 --
NM_000428chr1442491 981 640 221 --1277 --
NM_000430chr1783678 2808 1275 1239 1227 1103 709 43 21203 143 ----
NM_000441chr751954 1628 1564 444 275 1859 1318 --
NM_000448chr1173201 3154 2854 2185 1160 568 144 1136 11180 --
NM_000451chrX21369 500 12058 ----
NM_000459chr92371 226 ----2622 362
NM_000461chr3104522 4369 4142 3972 1568 1416 1398 1002 544 164 --1215 --
NM_000462chr1511682 11624 1649 --
NM_000489chrX63407 2581 2349 2221 1009 492 1845 ----
NM_000492chr721165 1144 ------
NM_000495chrX41118 831 731 65 ------
NM_000503chr8--11270 1235 --
NM_000525chr1131599 1573 1355 11611 --11517
NM_000533chrX61737 1406 508 399 379 61 11335 12012 --
NM_000555chrX126737 6694 6495 6450 5298 5184 4956 2437 856 605 381 253 11257 17755 --
NM_000575chr231035 1025 175 11075 1132 --
NM_000586chr4180 ----1223
NM_000594chr64688 506 203 181 ------
NM_000601chr72144 67 1379 ----
NM_000615chr1142497 2105 742 613 11887 ----
NM_000618chr12105342 5090 4843 4596 4453 4291 2512 2067 621 241 25742 4884 11475 --
NM_000618chr12105342 5090 4843 4596 4453 4291 2512 2067 621 241 25742 4884 11475 --
NM_000633chr1874535 4370 3453 1779 1772 1757 1083 ------
NM_000636chr63505 202 142 ------
NM_000683chr41472 ------
NM_000693chr1551291 369 341 185 44 11607 ----
NM_000700chr91191 ------
NM_000719chr12106050 5805 4534 2492 2398 1761 1553 1534 775 44 15175 14686 --
NM_000724chr1031760 1502 1332 31576 574 193 ----
NM_000726chr22959 571 2966 53 11091 --
NM_000729chr32244 211 ------
NM_000756chr81348 --1469 --
NM_000767chr1941284 483 270 169 ----21342 1083
NM_000780chr851123 1108 1048 135 122 1178 1257 --
NM_000792chr12831 160 11040 ----
NM_000794chr52830 708 1822 ----
NM_000806chr551779 1668 1435 691 428 1610 ----
NM_000809chr488467 8377 7607 1976 1570 1379 61 48 47136 7038 6898 1216 ----
NM_000813chr515598 11468 21377 253 14801
NM_000826chr472550 2367 2173 1685 822 190 146 32000 1908 709 11874 --
NM_000828chrX61818 1579 1508 714 624 597 ----11738
NM_000831chr1116310 6090 6023 5567 5194 4531 4508 2348 1180 816 653 11893 11434 --
NM_000838chr652777 2560 2105 762 195 ------
NM_000859chr551674 1396 1120 1110 205 ------
NM_000866chr331676 246 63 ------
NM_000868chrX32645 2387 241 12363 1591 --
NM_000872chr1051561 1252 981 370 56 1168 ----
NM_000875chr15116903 6727 5694 5652 5272 5079 4892 4519 2266 1452 1383 --25167 4712 12068
NM_000880chr83634 596 109 --2193 89 1707
NM_000891chr1752889 2292 1392 1007 900 13446 1317 --
NM_000899chr12104159 3895 3762 3562 3544 1407 924 918 486 359 --1179 --
NM_000901chr422363 1651 ------
NM_000902chr342890 645 606 234 ------
NM_000914chr6177 1401 ----
NM_000917chr102932 690 1772 ----
NM_000919chr52619 44 ------
NM_000922chr111289 --1449 --
NM_000924chr123887 852 200 ------
NM_000944chr441867 668 498 242 2298 280 ----
NM_000945chr231850 1643 79 21663 839 22017 1508 --
NM_000949chr53678 82 73 ----1837
NM_000950chrX53560 2821 2751 1418 82 22614 2470 12793 --
NM_000956chr1411030 11120 ----
NM_000959chr163062 3007 2835 2769 2584 1535 ------
NM_000962chr972763 1911 1902 547 478 277 86 --2189 58 --
NM_000963chr152067 2040 1552 403 338 --42434 2299 2087 1979 --
NM_000990chr1173831 3550 2919 2680 768 480 293 131 ----
NM_001001132chr2151411 1269 1051 1018 201 --1433 --
NM_001001323chr12103121 2835 2481 2438 1195 1186 959 419 190 136 --12040 1303
NM_001001331chr372457 2118 2095 794 483 332 178 21007 868 12500 --
NM_001001394chr2----1554 --
NM_001001395chr1231854 1733 1116 --22726 190 --
NM_001001419chr574622 4147 3829 3603 1107 919 807 11945 24970 3533 --
NM_001001420chr574622 4147 3829 3603 1107 919 807 11945 24970 3533 --
NM_001001436chr164814 693 348 279 ------
NM_001001481chr823032 1141 12161 --11016
NM_001001484chr1062151 1853 897 825 429 376 ------
NM_001001549chr762713 2450 2326 2176 1775 526 --22511 894 --
NM_001001550chr762713 2450 2326 2176 1775 526 --22511 894 --
NM_001001555chr762713 2450 2326 2176 1775 526 --22511 894 --
NM_001001664chr243732 3042 2701 1612 12849 12543 --
NM_001001665chr243202 2939 2465 470 23218 1236 33081 1351 939 --
NM_001001668chr19104297 4173 3980 2767 1675 1375 1342 1324 1129 875 1293 44197 3888 3674 1541 --
NM_001001715chr13--1416 ----
NM_001001787chr12469 411 --159 --
NM_001001890chr2173764 3640 3139 1639 1241 454 349 --24015 332 --
NM_001001924chr862113 2041 2019 2011 1998 359 ----11581
NM_001001925chr862113 2041 2019 2011 1998 359 ----11581
NM_001001928chr2288308 7933 3117 3000 2900 1296 433 200 ------
NM_001001931chr862113 2041 2019 2011 1998 359 ----11581
NM_001001933chr11482 ------
NM_001001971chr1021135 864 ------
NM_001001974chr1052117 1976 1751 341 315 1373 1923 --
NM_001002006chr22913 211 ------
NM_001002026chr332220 771 283 --12472 --
NM_001002243chr22832 687 ------
NM_001002257chr252621 2176 754 187 49 32887 2831 2419 11319 --
NM_001002259chr122235 101 ------
NM_001002759chr101561 1537 ----
NM_001002838chrX41598 633 414 215 21635 1570 1277 --
NM_001002843chr1531243 1179 500 156 11236 --
NM_001002860chr1484070 3716 3633 3606 3047 1367 729 192 14398 1512 --
NM_001002909chr172830 51 1262 ----
NM_001002926chr742426 1747 867 63 1583 12419 --
NM_001003407chr1074897 4838 4556 3651 3375 368 329 --11237 --
NM_001003408chr1074897 4838 4556 3651 3375 368 329 --11237 --
NM_001003652chr18138283 8069 8019 7391 6810 6448 6227 5307 2746 2736 2097 1964 1188 16168 28095 1924 --
NM_001003674chr18187050 7005 6280 5428 5386 5160 5115 4910 4661 4629 4342 2583 1386 1380 1301 964 596 540 14368 26513 277 --
NM_001003675chr18187050 7005 6280 5428 5386 5160 5115 4910 4661 4629 4342 2583 1386 1380 1301 964 596 540 14368 26513 277 --
NM_001003681chr221771 ----11341
NM_001003712chr1263797 3606 1609 1346 870 244 43638 2619 377 352 ----
NM_001003760chr622352 2310 ------
NM_001003810chr41712 ------
NM_001003845chr22465 371 ------
NM_001003936chr9174 ------
NM_001004065chr933277 3221 2665 13919 ----
NM_001004106chr51266 ------
NM_001004308chrX11265 11316 ----
NM_001004317chr674378 3713 3444 1512 1286 721 288 ------
NM_001004328chr1241916 628 183 39 --12347 --
NM_001004329chr122129 89 ----1413
NM_001004360chr231974 746 89 1701 21684 770 --
NM_001004419chr1274642 4607 3878 3604 2892 1578 1553 ----11655
NM_001004720chr2----1929 --
NM_001004722chr21829 --11098 --
NM_001005242chr1241580 1404 1235 1149 ------
NM_001005353chr131060 1044 936 --11146 --
NM_001005353chr131060 1044 936 --11146 --
NM_001005365chr8154 ----1127
NM_001005375chrY41824 1606 680 48 ----1335
NM_001005386chr251977 990 907 311 35 1538 ----
NM_001005407chr161692 ------
NM_001005463chr1052600 2257 2103 1668 355 2689 126 ----
NM_001005473chr5106267 5742 5557 4315 860 691 672 492 426 400 14260 24127 1919 --
NM_001005609chrX83726 3535 3147 2845 2787 1242 961 75 --2597 555 --
NM_001005739chr23349 180 69 --1323 --
NM_001005746chr22959 571 2966 53 11091 --
NM_001005747chr22959 571 2966 53 11091 --
NM_001005849chr171430 ------
NM_001006118chrY--2211 67 ----
NM_001006120chrY--2211 67 ----
NM_001006600chr52896 423 1990 ----
NM_001006605chr13899 343 271 ------
NM_001006605chr13899 343 271 ------
NM_001006610chr161999 ------
NM_001006681chrX167 ------
NM_001006682chrX167 ------
NM_001006683chrX167 ------
NM_001006935chrX2151 127 ------
NM_001006936chrX2151 127 ------
NM_001006937chrX2151 127 ------
NM_001007075chr42986 262 3758 385 289 --11062
NM_001007094chr1064496 4058 485 401 323 147 --1936 --
NM_001007097chr9105043 4966 4680 3365 1848 1510 639 261 106 54 1669 ----
NM_001007099chr11862 1823 1876 --
NM_001007100chr11862 1823 1876 --
NM_001007102chr631281 1111 173 1640 ----
NM_001007157chr71103 ------
NM_001007226chr171931 11053 ----
NM_001007227chr171931 11053 ----
NM_001007228chr171931 11053 ----
NM_001007229chr171931 11053 ----
NM_001007230chr171931 11053 ----
NM_001007237chr132617 1159 209 ------
NM_001007245chr72448 221 ------
NM_001007246chr2141957 634 506 307 41849 1838 697 341 ----
NM_001007269chr192373 61 --1214 --
NM_001007270chr192373 61 --1214 --
NM_001007277chr11----1299 --
NM_001007466chr683698 3553 3349 2040 1220 1084 460 390 31985 1721 1256 --1345
NM_001007471chr93815 277 124 ------
NM_001007526chrY--2211 67 ----
NM_001007794chr11108 1729 ----
NM_001008220chr523926 1412 ------
NM_001008239chr1843644 3346 1049 987 13532 ----
NM_001008392chr3113520 3475 3433 3058 3046 2966 2870 2861 2299 701 126 13508 12519 1414
NM_001008397chr52503 114 1199 1226 --
NM_001008401chr1931236 1214 173 1446 ----
NM_001008405chr72666 209 --11190 --
NM_001008408chr746235 6169 4711 274 --12279 --
NM_001008539chr875278 5240 3892 925 577 486 398 --13505 --
NM_001008541chr10--11670 ----
NM_001008541chr10--11670 ----
NM_001008564chr1351844 1813 1377 903 235 ------
NM_001008566chr221129 ------
NM_001008738chr552486 2193 1853 912 669 12705 ----
NM_001008777chr172451 196 ----2273 59
NM_001008779chr21270 ------
NM_001008801chr1972092 1915 1722 1510 453 182 98 1810 ----
NM_001008925chr422871 1003 ----12884
NM_001009554chr474751 4649 4529 4400 4022 3285 2981 13839 23348 1461 --
NM_001009554chr474751 4649 4529 4400 4022 3285 2981 13839 23348 1461 --
NM_001009899chr366188 5981 5571 1378 427 137 14833 ----
NM_001009909chr1193938 3550 3535 3418 2957 2937 2878 2646 2430 33280 549 271 13394 --
NM_001009958chr72253 42 198 ----
NM_001009959chr252436 2076 2051 651 315 12542 --1923
NM_001009960chr782822 2143 2052 2029 925 347 257 168 12423 ----
NM_001009993chr283384 1709 1509 1382 1375 995 291 106 --23395 1628 13112
NM_001010844chr6163 ------
NM_001010861chr162373 2291 2186 1929 753 562 1947 12108 --
NM_001010888chrX74612 4558 4141 4049 1745 675 462 --11491 --
NM_001010891chr5136778 6546 6153 5442 5345 5131 2763 2548 2327 2168 794 540 339 24440 2033 --1208
NM_001010924chr1011126 1153 ----
NM_001010932chr72144 67 1379 ----
NM_001010934chr71149 1358 1897 --
NM_001010942chr1251307 1292 1086 983 289 21319 1153 ----
NM_001010986chrX42468 2462 928 102 ------
NM_001010989chr161506 --1395 --
NM_001010990chr161506 --1395 --
NM_001011537chr382202 2148 2048 1971 1741 1690 638 586 12375 ----
NM_001011546chr201684 143 ----
NM_001011663chr1041003 951 838 174 ------
NM_001011666chr7186163 6089 5788 5429 5377 5202 4915 4500 4222 2506 2495 2367 2110 1935 1748 858 713 149 36570 4991 4080 36046 1836 1785 --
NM_001011708chr232844 1896 472 11888 ----
NM_001011713chr1421045 621 1284 ----
NM_001011885chr1521539 349 ------
NM_001012393chr1154957 3832 3267 2029 1924 14714 ----
NM_001012398chr161778 1281 ----
NM_001012420chr1562863 2702 2172 1900 1849 714 32925 1950 365 --1100
NM_001012423chr1572863 2702 2496 2172 1900 1849 714 32925 1950 365 --1100
NM_001012751chr104614 503 392 137 ----11412
NM_001012754chr1331999 1842 58 --31530 592 452 --
NM_001012755chrX64726 1837 1448 1232 1153 1052 13857 ----
NM_001012761chr532520 2387 231 ------
NM_001012958chr1----31459 586 186 --
NM_001012958chr1----31459 586 186 --
NM_001012968chrX52046 1989 1944 832 370 12429 ----
NM_001012979chrX2205 158 ------
NM_001013031chr1043480 1358 1276 1268 ------
NM_001013399chr651119 832 779 755 203 1960 ----
NM_001013406chr721262 622 ------
NM_001013437chr183423 48 38 ------
NM_001013439chr3153 1266 ----
NM_001013620chr12148374 8309 7438 6205 5518 5122 3264 3087 2874 2640 1864 1447 1062 262 57428 6565 6253 6015 5737 23318 288 --
NM_001013690chr1242473 2295 172 110 --11882 1859
NM_001013699chr124562 404 217 136 ------
NM_001013703chr151499 --165 --
NM_001013746chr761616 485 405 321 153 68 --11863 --
NM_001013843chr151814 ------
NM_001014380chr1332296 2164 1594 14293 24537 4305 --
NM_001014434chr12857 630 ------
NM_001014797chr1097599 7492 6073 5661 5498 5242 5125 5109 1298 37293 6596 6397 1128 15537
NM_001014839chr111101 ------
NM_001014841chr111101 ------
NM_001014972chr21231 ------
NM_001015045chr442563 2442 2309 1625 12053 1739 11605
NM_001015048chr1432076 1272 912 13198 ----
NM_001015049chr1432076 1272 912 13198 ----
NM_001015877chrX52975 2575 2146 969 625 12563 ----
NM_001015880chr1061703 1294 1146 532 69 33 ------
NM_001015887chr351813 1749 179 138 43 11804 178 --
NM_001017371chr2--1470 ----
NM_001017395chr3103392 3245 2913 2594 1006 807 786 246 136 42 --12775 --
NM_001017420chr831427 1314 1090 11358 1254 --
NM_001017440chr7136990 6405 6294 6232 6157 6091 3306 2958 2569 2273 214 151 110 11700 47253 7246 6641 6382 --
NM_001017523chr1231809 1766 499 11818 122 --
NM_001017916chr1721823 1576 --1137 11894
NM_001017917chr1721823 1576 --1137 11894
NM_001017923chr1451313 1248 489 179 151 ------
NM_001017926chr851625 1389 1281 1166 155 11302 ----
NM_001017962chr102932 690 1772 ----
NM_001017969chr9170 ------
NM_001017973chr5----1114 --
NM_001017974chr5----1114 --
NM_001017977chr13325 294 30 ------
NM_001017979chr43712 701 523 ------
NM_001017999chr132305 858 815 11824 ----
NM_001017999chr132305 858 815 11824 ----
NM_001018000chr132305 858 815 11824 ----
NM_001018000chr132305 858 815 11824 ----
NM_001018001chr132305 858 815 11824 ----
NM_001018008chr152615 573 ------
NM_001018054chr121164 218 --1948 --
NM_001018065chr9105836 5015 5005 4470 4366 3814 1771 1550 1397 1251 14879 ----
NM_001018066chr9105836 5015 5005 4470 4366 3814 1771 1550 1397 1251 14879 ----
NM_001018067chr195347 4868 4821 4016 3933 3733 1682 1445 744 ------
NM_001018068chr195347 4868 4821 4016 3933 3733 1682 1445 744 ------
NM_001018069chr195347 4868 4821 4016 3933 3733 1682 1445 744 ------
NM_001018072chr1231809 1766 499 11818 122 --
NM_001018074chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_001018075chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_001018076chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_001018077chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_001018111chr733080 2545 224 --23863 1596 --
NM_001020658chr151466 1308 1185 1162 79 11257 ----
NM_001020658chr151466 1308 1185 1162 79 11257 ----
NM_001020825chr531291 502 96 31371 1059 211 ----
NM_001023560chr62958 872 ------
NM_001023567chr1552355 2255 1619 1578 414 22317 365 --1100
NM_001024094chr543816 3291 3027 2621 33896 3584 2736 --12484
NM_001024218chr142657 645 2786 260 ----
NM_001024382chr111231 ------
NM_001024647chr12127257 6534 4689 3070 2417 1502 1267 1222 1163 334 282 224 1272 47593 7235 6011 1822 --
NM_001024649chr522769 2763 2987 388 --32833 2556 808
NM_001024660chr331436 1254 63 --1558 --
NM_001024808chr1222592 1767 --12683 --
NM_001024847chr362474 2387 2204 1813 1698 90 --21606 795 12395
NM_001024934chr63179 72 36 --2540 485 --
NM_001024935chr63179 72 36 --2540 485 --
NM_001024936chr63179 72 36 --2540 485 --
NM_001024947chr52297 214 3979 940 240 11103 --
NM_001024948chr183165 2612 2498 2180 2163 1409 1058 323 23088 395 ----
NM_001025068chr321560 71 11701 ----
NM_001025069chr321560 71 11701 ----
NM_001025076chr1034872 1359 830 35515 1810 658 21464 440 --
NM_001025077chr1036230 2717 2188 26873 2016 22822 1798 --
NM_001025079chr322962 1197 ----13021
NM_001025100chr1893907 2881 2774 2579 1350 759 409 228 120 11376 13293 --
NM_001025108chr263577 3518 2768 1598 1098 1071 34198 3308 373 ----
NM_001025201chr2129 --148 --
NM_001025232chr12190 ------
NM_001025248chr1511280 --11055 --
NM_001025249chr1511280 --11055 --
NM_001025252chr863198 1247 1121 828 337 38 23234 2595 ----
NM_001025253chr863198 1247 1121 828 337 38 23234 2595 ----
NM_001025266chr3104827 4459 3975 3763 3432 3100 1839 1630 855 80 24627 1035 ----
NM_001025356chr1282885 2783 2108 1953 1164 1080 725 75 32972 2930 228 ----
NM_001025366chr61620 2456 450 1514 --
NM_001025366chr61620 2456 450 1514 --
NM_001025367chr61620 2456 450 1514 --
NM_001025367chr61620 2456 450 1514 --
NM_001025368chr61620 2456 450 1514 --
NM_001025368chr61620 2456 450 1514 --
NM_001025369chr61636 2472 466 1530 --
NM_001025369chr61636 2472 466 1530 --
NM_001025370chr61620 2456 450 1514 --
NM_001025370chr61620 2456 450 1514 --
NM_001025580chrX23459 3182 34327 2975 2694 ----
NM_001025595chr411643 --21507 1030 --
NM_001025616chr421478 1240 31284 304 190 1754 --
NM_001025780chr931056 308 287 --11586 --
NM_001029858chr653408 3388 3083 1242 205 ----12509
NM_001029863chr622076 908 1642 12046 --
NM_001029998chr441094 1024 497 333 11106 186 --
NM_001030001chr141431 ------
NM_001030007chr16113968 3230 3207 2844 2502 1551 1468 1378 1370 912 552 ------
NM_001030055chr1433065 676 370 23014 1355 24635 3113 13160
NM_001030272chr111494 ------
NM_001030273chr111494 ------
NM_001031623chr641821 1667 1552 550 1372 ----
NM_001031692chr71296 ------
NM_001031695chr2254574 4540 4285 3813 2135 13886 15049 --
NM_001031716chr211165 1441 ----
NM_001031723chr4--1438 ----
NM_001031732chr443219 417 282 254 23266 643 33143 1323 689 --
NM_001031803chr171221 1283 ----
NM_001031804chr1631288 362 40 23228 691 23713 1456 23286 1540
NM_001031812chr532296 2239 2149 --1229 --
NM_001032282chr82993 69 ------
NM_001032283chr121174 ------
NM_001032284chr121174 ------
NM_001032293chr171463 ------
NM_001032296chr1332324 1165 507 --1986 11797
NM_001032363chr142010 1941 1731 116 21431 105 --1825
NM_001032363chr142010 1941 1731 116 21431 105 --1825
NM_001032380chr1041965 1530 636 606 11324 ----
NM_001032394chr692841 2777 2107 756 606 569 458 250 67 ------
NM_001032395chr682708 2644 1974 623 473 436 325 117 ------
NM_001033030chr33255 209 100 ------
NM_001033031chr33255 209 100 ------
NM_001033032chr33255 209 100 ------
NM_001033045chr234468 4347 3956 22905 755 13524 --
NM_001033047chr442600 2219 2054 1912 12620 ----
NM_001033049chr2132388 2204 396 ------
NM_001033057chr341878 1632 1329 248 1433 --12102
NM_001033059chr641888 1766 87 75 1488 2199 58 --
NM_001033081chr141905 1177 626 127 1316 3450 401 215 --
NM_001033082chr141905 1177 626 127 1316 3450 401 215 --
NM_001033112chr51151 1572 ----
NM_001033117chr374779 4544 4260 3949 3907 3606 1012 13561 1226 --
NM_001033503chr51516 1194 ----
NM_001033507chr141923 1878 519 199 --2638 127 --
NM_001033557chr241174 521 290 122 ------
NM_001033561chr173876 746 676 ------
NM_001033566chr172732 337 --159 --
NM_001033568chr172732 337 --159 --
NM_001033581chr11372 ------
NM_001033581chr11372 ------
NM_001033582chr11372 ------
NM_001033756chr61554 2390 384 1448 --
NM_001033756chr61554 2390 384 1448 --
NM_001033925chr1072061 1586 1564 1557 1509 626 117 --11927 --
NM_001033952chr111261 ------
NM_001034841chr1675088 4775 4067 1871 1799 523 32 --14351 --
NM_001034845chr431392 503 376 --21237 523 --
NM_001034850chr5--11431 ----
NM_001034954chr1022547 401 ------
NM_001034955chr1022547 401 ------
NM_001034956chr1022547 401 ------
NM_001034957chr1022547 401 ------
NM_001035003chr421466 1102 --1449 --
NM_001035004chr421466 1102 --1449 --
NM_001035260chr1041503 440 287 257 ------
NM_001037132chr752177 1606 592 318 185 11566 21447 41 1433
NM_001037133chr752177 1606 592 318 185 11566 21447 41 1433
NM_001037164chr731935 590 180 32004 421 405 11577 1107
NM_001037165chr7128818 8789 8502 7460 7244 7029 6808 5935 5723 3059 1315 330 --11195 --
NM_001037174chr221683 44 1427 1402 1347
NM_001037317chr162373 2291 2186 1929 753 562 1947 12108 --
NM_001037334chr1882452 2264 1969 1855 1596 967 695 497 21481 43 1961 --
NM_001037339chr121800 1523 --11468 --
NM_001037340chr121800 1523 --11468 --
NM_001037341chr121800 1523 --11468 --
NM_001037341chr121800 1523 --11468 --
NM_001037535chrX61497 1399 1355 1337 1092 967 11430 ----
NM_001037536chrX61497 1399 1355 1337 1092 967 11430 ----
NM_001037540chrX61497 1399 1355 1337 1092 967 11430 ----
NM_001037553chr2164676 4329 3736 3694 3442 73 14208 21260 897 --
NM_001037582chr451414 1267 558 253 160 --1137 --
NM_001037738chr52317 269 ------
NM_001037872chr24224 83 48 23 ------
NM_001037954chr111353 --32985 2630 2549 --
NM_001038493chr211089 ----11510
NM_001039366chr22178 ------
NM_001039465chr14--1348 ----
NM_001039479chr1442456 1750 1696 803 ------
NM_001039538chr263178 3042 3024 2459 2421 696 11042 ----
NM_001039570chr2224630 582 14662 11852 --
NM_001039571chr2224630 582 14662 11852 --
NM_001039573chr172440 200 ------
NM_001039577chr194151 3694 3330 1298 1128 1112 1047 1021 603 1297 11197 --
NM_001039585chr183319 3264 3092 3026 2841 2643 153 144 ------
NM_001039590chrX73271 3000 2921 1326 946 842 258 23763 219 ----
NM_001039591chrX73271 3000 2921 1326 946 842 258 23763 219 ----
NM_001039618chr11105141 4537 4384 2337 2143 1608 1550 931 464 155 25826 4676 15525 --
NM_001039690chr1612126 --11561 --
NM_001039715chr12831 160 11040 ----
NM_001039716chr12895 224 11104 ----
NM_001039762chr1032116 1933 473 ------
NM_001039802chr141360 1296 960 59 ------
NM_001039840chrX76066 5540 5192 4245 2414 690 378 45435 4274 1888 1417 ----
NM_001039937chr1342959 2925 517 417 --13768 --
NM_001040001chr632003 1870 151 --21372 1320 --
NM_001040020chr731560 1377 240 1470 1545 --
NM_001040057chr741173 965 212 172 ----11318
NM_001040092chr81164 197 ----
NM_001040110chr731604 739 693 ------
NM_001040142chr262153 1931 1885 1792 1709 717 ------
NM_001040143chr262153 1931 1885 1792 1709 717 ------
NM_001040144chr1612126 --11561 --
NM_001040146chr1612126 --11561 --
NM_001040151chr11154518 4377 4071 3736 3471 2985 1779 1768 1619 1534 1500 1344 1261 1048 343 --14469 13052
NM_001040152chr764499 3114 1850 1556 562 79 ----14692
NM_001040153chr135862 847 833 774 304 --2983 926 --
NM_001040157chr44980 735 464 317 ------
NM_001040158chr52413 174 1588 ----
NM_001040159chr421456 325 1259 --11334
NM_001040202chr422512 121 12028 ----
NM_001040214chr622339 750 ----12240
NM_001040272chr932265 2253 563 --32234 1991 1742 --
NM_001040284chr1695914 4331 2001 1871 1504 1482 1406 886 286 23644 1716 14226 14770
NM_001040402chr452971 2822 2510 2133 829 12702 23076 2365 --
NM_001040429chr1343033 2333 235 108 12627 ----
NM_001040440chr5--2441 247 --136
NM_001040441chr194186 3991 3892 3720 3699 3344 2186 705 420 45513 3599 1440 1126 ----
NM_001040446chr572698 2518 2282 2218 994 583 33 ------
NM_001040450chr1562585 2550 2393 2328 569 219 1427 --1824
NM_001040453chr1562585 2550 2393 2328 569 219 1427 --1824
NM_001040624chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040625chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040626chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040627chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040628chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040629chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040630chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_001040633chr77979 968 952 431 332 234 96 ------
NM_001040665chr795011 4206 4066 4025 1981 1891 1645 1602 1193 1320 ----
NM_001040666chr71713 ------
NM_001040694chr114926 863 809 255 ----1289
NM_001040708chr81173 2840 436 ----
NM_001040712chr953488 3402 2599 2316 1094 12400 31319 478 355 --
NM_001041chr31366 1159 ----
NM_001042355chr1685366 4684 4441 1475 1152 1143 350 134 11013 ----
NM_001042357chr1011249 ------
NM_001042358chr1011249 ------
NM_001042360chr1011249 ------
NM_001042363chr1011249 ------
NM_001042389chr1011249 ------
NM_001042390chr1011249 ------
NM_001042392chr1011249 ------
NM_001042395chr1011249 ------
NM_001042404chr111673 11696 ----
NM_001042410chr21209 ------
NM_001042412chr1685366 4684 4441 1475 1152 1143 350 134 11013 ----
NM_001042413chr974055 3980 3451 2789 1460 1039 903 --13959 --
NM_001042414chr131193 --1209 --
NM_001042415chr83930 232 159 ------
NM_001042416chr83930 232 159 ------
NM_001042424chr442965 2341 2118 276 --1333 --
NM_001042453chrX31231 239 74 ------
NM_001042481chr1462008 1898 817 412 314 51 1857 ----
NM_001042492chr1753245 2844 1108 181 96 12975 ----
NM_001042493chr61401 51349 807 796 757 726 ----
NM_001042494chr1563773 3209 2959 2778 393 226 ----1313
NM_001042495chr1563773 3209 2959 2778 393 226 ----1313
NM_001042496chr1563773 3209 2959 2778 393 226 ----1313
NM_001042497chr1563773 3209 2959 2778 393 226 ----1313
NM_001042537chrX32510 1594 96 1115 12455 --
NM_001042543chr411022 31590 1518 369 11385 --
NM_001042550chr951655 1379 1370 682 233 197 ----
NM_001042555chr12124384 4023 3794 3439 3427 3231 3084 2974 1883 912 406 63 12998 ----
NM_001042585chr13629 609 505 ------
NM_001042599chr2147758 7266 7123 6707 6124 5637 5549 5300 3103 2885 2798 1353 285 211 37549 7481 1796 ----
NM_001042601chr352878 2827 781 703 527 --13198 12044
NM_001042603chr1284764 4156 3952 3585 1943 1037 270 136 14905 21518 92 --
NM_001042604chr3124865 4800 4742 4478 3694 1741 1358 1096 1063 910 452 87 21706 1415 ----
NM_001042646chr331766 1287 695 ------
NM_001042669chr421478 1240 31284 304 190 1754 --
NM_001042681chr141844 1709 1031 894 --2908 386 --
NM_001042682chr141844 1709 1031 894 --2908 386 --
NM_001042682chr141844 1709 1031 894 --2908 386 --
NM_001042683chr611136 1562 ----
NM_001042749chrX31786 744 495 1422 ----
NM_001042750chrX31786 744 495 1422 ----
NM_001042751chrX31786 744 495 1422 ----
NM_001043351chr162009 1915 1723 1659 921 235 22219 625 ----
NM_001044305chr64477 435 415 308 1657 21252 592 --
NM_001044722chr532296 2239 2149 --1229 --
NM_001044723chr532296 2239 2149 --1229 --
NM_001046chr562973 2962 2173 1038 994 390 22560 879 22258 1929 --
NM_001071775chr133703 233 75 --1766 1754
NM_001078chr12719 111 ------
NM_001079874chr172053 2008 1662 595 337 171 153 --11750 --
NM_001083620chr482548 2365 2171 1684 821 203 190 146 31998 1906 708 11872 --
NM_001092chr175980 675 595 245 143 12523 ----
NM_001096chr172558 112 ------
NM_001099678chr376449 5829 4665 4268 2054 1945 1377 56443 4688 2302 1447 1426 --14537
NM_001105518chr12849 109 ------
NM_001106chr3129697 8945 8142 7696 7323 7192 6564 3091 1282 968 406 271 29136 8383 11273 11612
NM_001109977chr43644 199 103 ----165
NM_001113490chrX63299 2960 1303 733 223 40 --11001 --
NM_001121chr1021749 1650 31918 1908 1880 1451 --
NM_001122679chr51260 1157 ----
NM_001124chr112619 582 --1287 --
NM_001126chr13666 262 148 11021 ----
NM_001128chr16113968 3230 3207 2844 2502 1551 1468 1378 1370 912 552 ------
NM_001144chr1611356 --11267 --
NM_001146chr832177 845 204 1539 ----
NM_001148chr431777 1728 567 11844 1382 --
NM_001149chr1031058 1040 537 ----11028
NM_001151chr41272 ------
NM_001153chr23789 688 180 --194 --
NM_001167chrX126615 6335 5867 5732 5558 4869 2611 2117 1902 1629 1497 52 36325 4350 1429 ----
NM_001173chr1433065 676 370 23014 1355 24635 3113 13160
NM_001174chrX52115 2081 1520 211 140 11702 21668 1511 --
NM_001178chr111494 ------
NM_001186chr2163225 2976 2615 2547 2451 965 33258 2905 452 1943 --
NM_001187chr211147 1434 ----
NM_001198chr632437 1976 596 12395 12269 --
NM_001200chr20--11121 ----
NM_001201chr473720 3641 2855 1302 874 317 195 1443 126 --
NM_001202chr141205 ------
NM_001204chr277660 7598 6436 2610 2359 792 509 11643 27342 2950 --
NM_001219chr73841 734 419 ----12197
NM_001233chr761684 929 860 643 168 141 ------
NM_001241chr232010 942 227 22391 1786 ----
NM_001241chr232010 942 227 22391 1786 ----
NM_001256chr1752722 2269 1006 519 44 --1636 --
NM_001257chr1631520 1165 318 --2586 231 --
NM_001259chr7106371 5182 4758 4464 3907 2483 2126 2073 1749 1670 14140 2741 313 13868
NM_001260chr132319 93 --139 --
NM_001270chr53767 255 138 ------
NM_001271chr1523198 952 --2475 344 --
NM_001284chr51167 ------
NM_001286chr122106 1142 22832 1766 --22014 929
NM_001289chrX31552 592 287 11222 ----
NM_001304chr1773678 2695 2535 2331 1340 1125 845 --22686 1394 --
NM_001310chr1242470 2012 507 260 12879 2933 892 --
NM_001315chr632160 2006 1535 --1239 --
NM_001316chr201137 ------
NM_001326chr111439 ------
NM_001329chr1021226 341 11431 ----
NM_001330chr162995 405 ------
NM_001331chr1162825 2622 2357 2090 891 808 ------
NM_001343chr551415 1348 1328 1167 164 11387 ----
NM_001344chr14----147 --
NM_001346chr312482 ----12152
NM_001356chrX62542 2368 2206 1961 1910 364 12430 11904 --
NM_001358chr41295 1373 ----
NM_001363chrX1579 --1677 --
NM_001380chr10--11079 ----
NM_001386chr842219 2154 1693 972 12169 ----
NM_001391chr1821082 123 --11071 --
NM_001396chr2122408 921 ------
NM_001399chrX83726 3535 3147 2845 2787 1242 961 75 --2597 555 --
NM_001400chr131087 1025 436 --1952 --
NM_001412chrX63446 3030 2825 2512 167 100 --1873 --
NM_001418chr112217 98 ------
NM_001418chr112217 98 ------
NM_001419chr1974445 3741 1730 1357 417 172 152 1190 ----
NM_001420chr1942221 1010 520 312 ------
NM_001423chr1232042 1687 214 ------
NM_001426chr21484 ------
NM_001427chr7----12031 --
NM_001430chr231800 225 169 ------
NM_001432chr463550 1063 755 291 249 135 13702 12680 23760 1388
NM_001438chr192969 2250 1382 1319 1219 1148 1024 719 613 12408 ----
NM_001451chr1631197 492 482 1218 ----
NM_001482chr153348 249 99 --2742 621 --
NM_001491chr682677 2626 2445 2371 1760 687 328 240 189 ----
NM_001493chrX1725 ------
NM_001497chr932566 2288 684 31876 807 476 1396 --
NM_001498chr651369 1304 1045 495 351 ------
NM_001527chr6104868 4701 4316 4103 4029 3160 1204 1117 935 61 --13629 --
NM_001530chr145948 835 433 187 162 ------
NM_001542chr132617 1159 209 ------
NM_001546chr621189 1044 ----1498
NM_001550chr72448 221 ------
NM_001554chr1----1526 --
NM_001584chr1151116 948 454 426 25 1135 1830 --
NM_001616chr252202 1342 795 260 148 22750 119 42653 2334 2141 496 --
NM_001620chr112808 793 1742 ----
NM_001621chr732952 792 519 12979 1966 --
NM_001621chr732952 792 519 12979 1966 --
NM_001634chr641888 1766 87 75 1488 2199 58 --
NM_001650chr1843832 2972 2584 224 34030 4007 3724 11354 --
NM_001656chr52371 102 32073 657 559 22007 441 --
NM_001660chr32322 162 ------
NM_001663chr1442365 983 787 274 12125 22325 233 --
NM_001677chr131107 1049 156 --1874 --
NM_001678chr1751662 1536 1452 434 49 --139 --
NM_001679chr3132 ------
NM_001682chr1282835 2549 2195 2152 909 900 673 133 ------
NM_001683chr372457 2118 2095 794 483 332 178 21007 868 12500 --
NM_001690chr342354 1678 670 522 12257 22234 563 --
NM_001693chr83858 370 224 21277 211 ----
NM_001695chr864295 3538 3439 3137 2919 1010 ------
NM_001696chr22178 ------
NM_001699chr1971718 1540 1422 1259 675 462 319 1378 ----
NM_001701chr931564 1491 77 ------
NM_001704chr61587 --1432 --
NM_001706chr331066 340 78 --1945 --
NM_001709chr1132900 745 237 12028 12313 --
NM_001717chr1521507 73 ------
NM_001723chr65913 822 273 253 144 1710 ----
NM_001730chr1331452 1208 1202 11169 1203 --
NM_001730chr1331452 1208 1202 11169 1203 --
NM_001741chr111261 ------
NM_001742chr751767 1536 726 720 610 ------
NM_001746chr522769 2763 2987 388 --32833 2556 808
NM_001752chr111494 2551 163 ----
NM_001753chr731881 1754 381 ------
NM_001754chr2173764 3640 3139 1639 1241 454 349 --24015 332 --
NM_001755chr1632076 2001 1991 21423 670 ----
NM_001759chr1275300 5163 5105 4401 4346 1753 277 ------
NM_001777chr322962 1197 ----13021
NM_001791chr141360 1296 960 59 ------
NM_001792chr183960 716 108 11174 ----
NM_001797chr16--1725 ----
NM_001798chr122394 329 11037 21095 850 --
NM_001802chr162863 688 193 ----
NM_001806chr1962783 2562 2007 1948 408 308 42212 814 236 166 --143
NM_001813chr43398 369 160 ------
NM_001821chr124259 22 34771 4692 4088 --24705 115
NM_001822chr2129 --148 --
NM_001826chr11137 ------
NM_001829chr45974 949 716 274 162 ------
NM_001830chrX63459 3426 3397 2702 1417 1110 23667 963 1314 --
NM_001839chr12485 189 ------
NM_001854chr111334 11006 ----
NM_001855chr9174 ------
NM_001858chr665105 4900 4839 1547 1161 1028 14486 1484 --
NM_001859chr933911 2959 1151 23148 2725 13965 --
NM_001881chr101364 ------
NM_001882chr5----1579 --
NM_001896chr16----1279 --
NM_001901chr63744 695 246 1712 --1203
NM_001902chr1----1377 --
NM_001903chr53281 188 178 --1895 --
NM_001904chr321046 230 --1176 --
NM_001915chr1721823 1576 --1137 11894
NM_001918chr1148360 8058 7878 7006 6947 6750 6650 6431 6405 3253 2112 1299 1164 962 25802 2846 26527 6056 17532
NM_001932chr171638 --1350 --
NM_001935chr21350 1962 ----
NM_001938chr1273 38 --11582 --
NM_001939chrX63626 3070 2803 1466 1413 219 1575 11279 --
NM_001944chr1832400 1675 149 ------
NM_001946chr1221152 30 ------
NM_001948chr1511280 --11055 --
NM_001951chr8189 ------
NM_001964chr521159 929 1342 11025 --
NM_001967chr34449 107 31 25 1497 --1604
NM_001968chr4--1124 ----
NM_001969chr1453559 1241 1111 364 36 1921 ----
NM_001977chr41110 11735 ----
NM_001978chr81836 ------
NM_001980chr1271478 1467 871 814 628 411 228 12039 2343 114 11458
NM_001981chr142037 1814 1806 766 --1577 --
NM_001987chr1254233 3564 3424 835 569 ------
NM_001992chr541674 1378 738 243 1226 ----
NM_001995chr411069 11081 11432 1153
NM_001999chr51265 --1140 --
NM_002006chr455643 5107 1793 1242 1040 14929 ----
NM_002009chr1562779 2191 2146 864 646 495 --12018 --
NM_002014chr12------1262
NM_002015chr1321215 809 --12816 1966
NM_002017chr1121175 154 --145 --
NM_002024chrX51555 1527 858 674 589 2627 422 ----
NM_002025chrX66742 6697 3213 2115 1328 1313 49038 841 603 586 38183 7685 2249 16198
NM_002032chr111384 ------
NM_002033chr1174067 3810 3320 3093 2892 1161 621 13391 11032 --
NM_002035chr18103702 2862 2681 2474 806 754 730 575 138 126 --11299 --
NM_002040chr2172891 2531 2212 1966 605 497 43 ------
NM_002045chr31386 ------
NM_002054chr2--167 ----
NM_002069chr72611 93 1536 ----
NM_002076chr1273020 2859 2649 2339 1260 1206 747 ------
NM_002082chr51229 ------
NM_002089chr42562 485 1623 ----
NM_002092chr465001 4574 4413 1738 1606 629 24495 1759 21870 405 --
NM_002107chr11469 ------
NM_002114chr61511 ------
NM_002120chr62377 93 ------
NM_002126chr1794160 2618 1597 1579 1419 1377 1304 1208 592 ------
NM_002128chr1362518 2341 2261 991 905 163 --1435 --
NM_002129chr4268 32 ------
NM_002130chr531733 1362 455 ----1626
NM_002131chr621044 997 --11182 --
NM_002137chr772416 2251 2041 1773 880 723 617 2331 98 ----
NM_002138chr41712 ------
NM_002139chrX2551 465 2513 221 ----
NM_002140chr961108 926 768 449 443 195 11229 ----
NM_002158chr273774 3470 3056 3040 1208 747 328 13363 13572 11313
NM_002187chr53451 172 56 1166 1320 --
NM_002194chr2--1153 ----
NM_002203chr563814 3189 1475 1218 423 311 33344 2644 1177 --11227
NM_002211chr103166 144 34 11132 ----
NM_002214chr774602 4365 4171 1852 1645 348 275 22224 724 1978 1798
NM_002223chr1242832 852 514 358 ----14025
NM_002226chr141135 ------
NM_002228chr12850 827 21107 923 ----
NM_002232chr121248 411 ----11179
NM_002235chr1211669 ------
NM_002239chr22155 31 ------
NM_002247chr1032184 2169 1498 --11714 --
NM_002253chr441414 1261 927 191 ------
NM_002264chr3134993 4968 4824 4773 4237 3862 3384 1963 1683 1470 953 638 99 13342 1661 --
NM_002265chr1731200 882 359 --298 91 --
NM_002268chr331886 485 475 11221 1265 --
NM_002270chr595430 4796 4760 4177 3739 3487 1865 1697 1373 31893 1317 88 --15676
NM_002271chr1332340 2008 594 ------
NM_002285chr263577 3518 2768 1598 1098 1071 34198 3308 373 ----
NM_002293chr151825 623 574 553 63 12019 12582 --
NM_002296chr141686 1329 673 507 11529 11132 1308
NM_002298chr1351661 1637 1031 172 60 ----11603
NM_002310chr556063 5438 4570 2364 1757 26139 4447 35976 4815 1126 14693
NM_002313chr1074897 4838 4556 3651 3375 368 329 --11237 --
NM_002336chr1244982 1937 994 956 24720 565 --11358
NM_002345chr122216 118 ------
NM_002349chr231383 279 259 ------
NM_002356chr642126 1129 997 305 12687 ----
NM_002358chr42617 590 ------
NM_002374chr263178 3042 3024 2459 2421 696 11042 ----
NM_002380chr84973 726 377 100 ----1858
NM_002381chr26822 775 412 320 123 88 1790 ----
NM_002383chr162742 138 ------
NM_002387chr5115046 4896 4694 4658 4190 2023 1924 1648 1170 386 139 --11024 --
NM_002389chr181637 1543 1513 1502 526 264 244 205 ------
NM_002395chr631403 1233 1132 ------
NM_002397chr552246 1949 1878 428 188 1467 1503 12226
NM_002398chr231505 1367 238 1549 ----
NM_002399chr1521349 291 1270 11258 --
NM_002401chr1712002 ------
NM_002430chr2232474 690 610 22379 559 1805 --
NM_002449chr5--1826 135 --
NM_002451chr963633 3441 1304 1189 1000 343 1757 23904 2822 --
NM_002465chr121243 ------
NM_002480chr1221031 604 21199 1161 11127 --
NM_002481chr137824 7130 7099 --47475 6627 6277 261 12521
NM_002499chr1522427 626 --1850 --
NM_002509chr20----1267 --
NM_002515chr1461577 1420 1280 635 305 122 ------
NM_002519chr1131487 412 319 ------
NM_002520chr51124 ----1226
NM_002527chr12169 ------
NM_002544chr171253 ------
NM_002545chr1154957 3832 3267 2029 1924 14714 ----
NM_002546chr84745 729 688 318 ------
NM_002564chr11--1934 ----
NM_002567chr121286 --1728 --
NM_002568chr81351 ------
NM_002572chr11----1106 --
NM_002581chr9105444 5193 4785 4427 3922 2049 2043 1468 1101 1074 --14469 --
NM_002583chr12--166 --153
NM_002590chr13--1509 ----
NM_002593chr7159 ------
NM_002594chr2022040 897 12249 1620 --
NM_002595chr1241906 476 399 362 ------
NM_002600chr121800 1523 --11468 --
NM_002607chr73870 501 429 --11032 --
NM_002610chr272783 2618 2336 2200 2192 2054 887 ------
NM_002612chr72506 52 11920 166 --
NM_002613chr1675214 4201 3913 3531 3309 1300 1055 13562 11383 --
NM_002618chr2177 ------
NM_002641chrX31435 708 597 --1585 --
NM_002645chr1143115 2301 746 402 32767 2389 1923 --1245
NM_002655chr884891 4002 3751 1798 1772 519 477 397 14656 14397 13510
NM_002656chr6--1324 ----
NM_002657chr2023876 2385 ------
NM_002664chr221606 138 ------
NM_002667chr6--11282 ----
NM_002670chr331644 1140 1129 ------
NM_002698chr1932767 989 881 --11957 --
NM_002703chr431833 1693 557 ------
NM_002709chr253460 3349 3224 2768 745 12447 21133 1064 --
NM_002713chr131182 1144 116 ------
NM_002717chr81623 ------
NM_002718chr362345 2336 2303 1750 266 44 22654 2495 ----
NM_002729chr103766 597 49 ------
NM_002731chr133126 2814 311 13049 ----
NM_002734chr1761917 1852 818 648 276 180 ------
NM_002736chr7167 --11477 11517
NM_002738chr1621114 1031 1899 ----
NM_002740chr372707 2493 2083 1896 1740 1064 563 --11792 --
NM_002744chr11372 ------
NM_002745chr2274336 4096 3239 1751 871 793 561 23662 1485 23849 3692 --
NM_002747chr1861902 691 604 502 317 145 ------
NM_002748chr152951 463 1996 ----
NM_002755chr154797 734 709 292 ------
NM_002757chr152356 297 ------
NM_002760chrY65901 5810 5072 5031 4192 1878 14373 25791 5515 --
NM_002761chr161142 ----145
NM_002763chr1126 ------
NM_002786chr111243 ----1111
NM_002822chr1241379 685 521 217 1158 11550 --
NM_002823chr21643 ------
NM_002825chr72669 536 ------
NM_002833chr1531581 1498 460 ------
NM_002836chr201190 ------
NM_002837chr1294475 4395 3096 2953 1682 1516 690 579 224 13307 34632 4047 133 --
NM_002839chr953488 3402 2599 2316 1094 12400 31319 478 355 --
NM_002840chr141512 647 579 103 ----11549
NM_002843chr1143360 3142 2609 2540 ------
NM_002844chr621158 1009 ------
NM_002849chr1251066 397 389 306 183 ------
NM_002851chr71323 ------
NM_002852chr32501 242 1206 ----
NM_002857chr142514 1987 1679 675 22287 316 ----
NM_002858chr12481 232 1917 ----
NM_002865chr81252 ------
NM_002869chr1141911 1844 790 632 1291 ----
NM_002874chr942253 988 960 641 ------
NM_002886chr345170 5098 3589 1046 24519 852 14352 --
NM_002890chr52703 691 1281 1818 --
NM_002892chr1431472 665 655 ------
NM_002893chrX3294 33 21 140 150 --
NM_002897chr21626 1281 1673 --
NM_002902chr152492 419 ------
NM_002906chr1121979 82 1901 ----
NM_002924chr13513 63 25 ------
NM_002941chr361664 1558 1078 1046 264 89 ------
NM_002942chr31502 ------
NM_002943chr15129 ------
NM_002948chr331142 363 146 --1111 --
NM_002956chr1221174 1052 ------
NM_002959chr1104388 4081 3523 3384 3345 3086 1749 1563 1289 1205 13447 ----
NM_002968chr165921 853 804 218 45 --1274 --
NM_002971chr341173 861 256 173 ------
NM_002973chr12------1144
NM_002976chr2149 1428 ----
NM_002977chr283390 3159 3017 2663 2361 2177 642 440 13148 23381 473 --
NM_002979chr11862 1823 1876 --
NM_002982chr17--1129 ----
NM_002994chr431451 1347 490 ------
NM_003016chr1731627 1285 669 21914 407 21666 115 --
NM_003017chr63901 469 230 ----1546
NM_003022chrX2476 100 31284 923 440 ----
NM_003031chr161999 ------
NM_003032chr352547 2285 1785 1748 368 12694 ----
NM_003034chr12167888 7268 6618 6406 6184 6027 5881 2550 2484 2027 1636 1353 869 355 250 239 56149 2198 1980 1945 543 26035 3112 --
NM_003046chr875278 5240 3892 925 577 486 398 --13505 --
NM_003069chrX2540 295 1209 ----
NM_003070chr91841 ------
NM_003071chr322093 1319 ------
NM_003079chr172296 51 ------
NM_003081chr20131 --2308 125 --
NM_003100chr52391 379 ------
NM_003101chr131559 577 440 1536 ----
NM_003107chr612528 ------
NM_003108chr277235 6704 6336 5935 5780 5298 152 24679 4523 ----
NM_003111chr2--1470 ----
NM_003112chr773203 2346 1122 860 796 722 31 32311 1084 523 ----
NM_003113chr22846 159 --1675 --
NM_003128chr292681 2624 2456 2261 2020 1096 615 315 96 1821 ----
NM_003133chr13953 173 166 ------
NM_003136chr142383 369 ------
NM_003142chr21258 ------
NM_003149chr381652 1638 1500 1370 1191 1180 1096 517 ------
NM_003155chr842400 904 483 420 ------
NM_003161chr1753602 3172 2976 2641 1256 ----13527
NM_003174chr102551 175 ------
NM_003178chr352211 1455 713 196 117 --11646 --
NM_003184chr8143 ------
NM_003199chr18115536 4799 4394 3932 3746 1835 1668 1103 1024 874 250 25489 1083 15398 11075
NM_003203chr232413 2221 529 31717 1681 23 ----
NM_003211chr1231664 676 31 11129 ----
NM_003212chr311098 --1760 --
NM_003221chr664012 3633 3180 1462 392 30 1812 ----
NM_003242chr362474 2387 2204 1813 1698 90 --21606 795 12395
NM_003245chr20--1480 ----
NM_003246chr1561983 1864 1366 740 577 42 11684 ----
NM_003248chr51114 ------
NM_003253chr2141922 507 84 27 ------
NM_003262chr375141 4715 4672 4457 4004 1551 981 13419 --11875
NM_003269chr63843 348 109 ----1953
NM_003274chr21122763 2694 2591 2130 2099 1969 1084 959 718 689 574 42 --22071 1861 --
NM_003286chr201323 ------
NM_003292chr132047 385 131 21597 280 11791 --
NM_003298chr3106184 5829 5687 5663 5557 5518 5122 4049 3779 195 21283 510 11820 --
NM_003304chr371553 1435 1260 1181 648 281 271 --1334 --
NM_003305chr41403 ------
NM_003336chrX51052 1040 791 432 234 ------
NM_003337chr551722 1323 599 321 254 ------
NM_003338chr1031672 1460 1427 ------
NM_003341chr31252 ------
NM_003342chr1783322 3151 2460 2041 1322 1176 336 165 --23261 590 --
NM_003347chr2252354 2320 1865 941 894 --1773 --
NM_003348chr12--11496 ----
NM_003369chr1132101 956 835 12541 ----
NM_003372chrX2931 297 1969 189 --
NM_003374chr53810 94 79 ------
NM_003376chr61620 2456 450 1514 --
NM_003376chr61620 2456 450 1514 --
NM_003385chr241012 339 176 41 1365 ----
NM_003387chr242778 2601 2281 740 ------
NM_003390chr111871 --1745 --
NM_003392chr364219 3203 3194 3117 1067 583 ------
NM_003404chr2051815 1521 671 504 441 11263 ----
NM_003405chr222796 769 190 ----
NM_003406chr851945 1906 1879 1329 668 ------
NM_003409chr1861304 1188 950 227 133 71 ------
NM_003410chrX43071 2821 2195 997 12163 23038 1159 --
NM_003411chrY21748 1602 21720 1389 ----
NM_003412chr333018 2263 709 12426 1558 11158
NM_003413chrX51914 1875 1392 688 477 21662 1536 ----
NM_003418chr32663 220 ------
NM_003421chr1064496 4058 485 401 323 147 --1936 --
NM_003432chr5----1586 --
NM_003442chr111910 1588 ----
NM_003453chr131285 --1595 --
NM_003457chr171463 ------
NM_003458chr343069 2696 1248 273 12855 33876 2470 1050 --
NM_003463chr673226 2517 2404 2335 871 797 717 22087 1140 22955 2757 --
NM_003469chr2--1478 ----
NM_003472chr631125 977 78 ----11378
NM_003473chr101739 2322 54 ----
NM_003474chr102147 101 --1214 --
NM_003477chr111112 1176 ----
NM_003478chr1153247 3218 873 631 408 32846 2823 2580 23063 46 --
NM_003482chr1212019 ------
NM_003483chr1221963 610 ------
NM_003489chr2133113 2505 457 --22411 2388 --
NM_003496chr74829 330 196 28 ------
NM_003498chr1652738 2507 2382 270 74 ------
NM_003503chr13815 524 22 --11285 --
NM_003506chr831258 1163 836 ------
NM_003563chr171931 11053 ----
NM_003566chr1252783 2439 1248 848 336 22661 2411 --1143
NM_003574chr1845306 3937 3745 1079 32112 1158 332 11898 --
NM_003576chr1332324 1165 507 --1986 11797
NM_003580chr82474 82 191 ----
NM_003581chr2----1929 --
NM_003583chr1273773 3732 3513 2832 2514 552 187 11143 --13333
NM_003590chr293887 3683 3561 3184 2892 2692 1406 1284 244 23171 1344 --13103
NM_003595chr221129 ------
NM_003603chr41635 --1425 --
NM_003615chr3163725 3279 3258 3208 3096 2809 2628 1580 1512 1362 1067 845 443 410 276 177 12524 12661 --
NM_003620chr1731090 998 304 ------
NM_003626chr1141084 338 327 201 ------
NM_003629chr15986 717 684 383 122 ------
NM_003633chr522498 156 21574 289 ----
NM_003644chr17106545 6530 6353 5833 5688 4811 4305 4241 1320 79 --12398 --
NM_003651chr121403 --2434 159 --
NM_003657chr203788 640 282 ------
NM_003659chr22810 783 ------
NM_003663chr352598 2478 2171 2137 282 22763 2408 --12972
NM_003670chr321315 1261 11436 179 --
NM_003671chr943086 3039 2670 1064 1523 23459 568 --
NM_003672chr121263 245 11238 11392 --
NM_003675chr102511 474 ------
NM_003686chr1197 ------
NM_003688chrX------1272
NM_003692chr941027 908 721 258 ------
NM_003701chr132769 671 11018 --11057
NM_003713chr131295 138 88 ------
NM_003722chr332609 1099 1024 32583 1910 528 --12529
NM_003740chr611797 --11312 --
NM_003749chr1342415 2349 1650 388 22102 1731 ----
NM_003750chr101104 ------
NM_003758chr1541346 1037 641 246 193 ----
NM_003758chr1541346 1037 641 246 193 ----
NM_003759chr472837 1642 1218 739 732 616 489 11336 ----
NM_003760chr12626 298 1672 ----
NM_003772chr111948 1836 ----
NM_003774chr12123357 2935 2526 2314 1354 1333 1246 1143 846 798 403 319 --1179 --
NM_003790chr11189 ------
NM_003794chr321070 290 ------
NM_003797chr111131 ------
NM_003799chr1894145 3991 3787 3590 1726 680 518 463 237 --1119 --
NM_003800chr662374 1927 1541 1513 945 188 ------
NM_003809chr171509 ------
NM_003816chr81556 --1950 --
NM_003822chr153057 2848 2640 796 460 ------
NM_003825chr151524 11217 ----
NM_003828chrX----1513 --
NM_003829chr94834 272 157 61 ------
NM_003850chr131683 ------
NM_003858chr141657 ------
NM_003861chr1462415 1915 986 747 175 136 1665 ----
NM_003864chr4170 ------
NM_003872chr232334 771 89 21902 1886 --12497
NM_003873chr1072307 2208 1937 1600 1026 357 238 --11649 --
NM_003877chr124998 295 202 48 --2103 81 --
NM_003884chr341790 1772 1578 396 --21456 373 --
NM_003887chr21314 --21478 926 12157
NM_003895chr2121840 1537 11546 --11469
NM_003899chr1392572 2433 2354 1984 1020 875 475 408 363 12579 ----
NM_003908chr2041375 954 893 156 ------
NM_003909chr852559 2429 1975 486 312 22952 2236 ----
NM_003913chr6134254 4121 4063 4045 3713 3593 2648 2634 1556 1328 1141 878 376 23239 243 33881 3185 2747 --
NM_003916chrX31503 1349 926 ------
NM_003921chr121610 42 11162 --11389
NM_003924chr421397 371 --21629 1292 --
NM_003927chr18169 --1855 --
NM_003930chr762550 854 470 461 364 43 --1501 1492
NM_003931chr63179 72 36 --2540 485 --
NM_003934chr931185 461 274 11226 ----
NM_003941chr7192 32384 1847 468 2480 232 11619
NM_003947chr311363 ------
NM_003955chr1761525 1428 1246 1050 183 163 --1331 --
NM_003956chr101366 1497 ----
NM_003958chr683730 3349 2852 2748 2564 1396 1160 611 --22631 764 --
NM_003968chr32671 650 ----155
NM_003971chr17179 --1240 --
NM_003972chr101131 1198 ----
NM_003980chr611481 --1971 --
NM_003983chr1653642 3215 2901 564 137 22982 442 12774 1318
NM_003994chr12104159 3895 3762 3562 3544 1407 924 918 486 359 --1179 --
NM_003998chr42645 235 1661 ----
NM_004006chrX32268 768 91 ------
NM_004007chrX32268 768 91 ------
NM_004009chrX32268 768 91 ------
NM_004010chrX32268 768 91 ------
NM_004011chrX32268 768 91 ------
NM_004012chrX32268 768 91 ------
NM_004013chrX32268 768 91 ------
NM_004014chrX32268 768 91 ------
NM_004015chrX32268 768 91 ------
NM_004017chrX32268 768 91 ------
NM_004020chrX32268 768 91 ------
NM_004028chr1843832 2972 2584 224 34030 4007 3724 11354 --
NM_004075chr121447 ------
NM_004077chr1221372 1130 --11173 --
NM_004080chr741455 1360 1225 918 11504 ----
NM_004081chrY41824 1606 680 48 ----1335
NM_004087chr342024 1846 652 289 11473 ----
NM_004094chr1443065 2861 2395 132 --13013 --
NM_004096chr1022057 663 --12068 --
NM_004098chr1031203 1176 148 ------
NM_004099chr971919 1415 782 715 489 364 119 ------
NM_004100chr652686 2219 2112 546 439 1177 1635 11869
NM_004113chr32821 425 11428 --11530
NM_004114chrX3414 315 208 ------
NM_004124chr1473258 3194 3162 2974 2889 2589 1137 13592 ----
NM_004133chr812455 22692 308 11873 --
NM_004136chr1523273 1156 23205 2314 --1879
NM_004161chr211027 ------
NM_004162chr33458 433 195 148 ----
NM_004171chr1199411 9083 8999 8620 8435 7344 2202 579 196 36991 3009 2263 57449 2970 1611 322 244 17524
NM_004172chr5--21826 417 ----
NM_004187chrX11248 --11296 --
NM_004199chr5----1114 --
NM_004202chrY----1218 --
NM_004215chr81209 ------
NM_004229chrX52156 1987 1931 1366 467 11862 ----
NM_004232chr1863674 3217 2507 1473 995 895 13188 12672 --
NM_004236chr152449 130 ------
NM_004238chr2--170 ----
NM_004241chr10--1187 ----
NM_004267chr31153 ------
NM_004268chr114429 175 131 53 --1102 --
NM_004274chr1442164 1282 902 201 12080 --13103
NM_004275chr631512 1434 311 --11058 --
NM_004279chr71249 ----11573
NM_004280chr6139 --1151 --
NM_004281chr102382 168 1496 ----
NM_004290chr5----21353 922 --
NM_004293chr962873 2466 1132 897 652 638 --13121 21322 269
NM_004301chr31263 --195 --
NM_004302chr1222243 1059 22708 368 --11093
NM_004311chr1062384 2073 1211 1064 755 85 --11088 --
NM_004331chr822333 720 1308 ----
NM_004336chr2196 ------
NM_004338chr18187050 7005 6280 5428 5386 5160 5115 4910 4661 4629 4342 2583 1386 1380 1301 964 596 540 14368 26513 277 --
NM_004342chr742010 1778 1498 344 --1735 --
NM_004343chr191532 ------
NM_004349chr83417 343 71 1397 ----
NM_004354chr41794 1700 ----
NM_004360chr1661897 1564 1413 1322 1263 512 ------
NM_004365chr51243 --130 --
NM_004369chr22708 649 --1233 --
NM_004379chr2--11486 2575 175 --
NM_004380chr161974 1706 --12490
NM_004384chr532296 2239 2149 --1229 --
NM_004392chr132775 125 12228 22108 213 --
NM_004393chr322058 1622 ------
NM_004397chr1153912 3557 2698 1728 258 21521 655 168 --
NM_004407chr41343 1901 ----
NM_004412chr10155817 5710 5692 5575 5468 4041 3830 2265 2238 2075 2043 1710 1345 759 563 12225 1429 --
NM_004414chr2151517 1395 1295 1165 171 ------
NM_004419chr1011035 ------
NM_004422chr171333 ------
NM_004426chr1221963 389 ------
NM_004430chr852687 1812 1730 739 494 12715 ----
NM_004438chr263059 2994 2745 1081 550 306 22628 1210 ----
NM_004440chr651887 1563 1378 1357 624 11709 177 --
NM_004441chr33984 113 80 --21173 1075 --
NM_004447chr122346 80 2997 963 21039 810 --
NM_004449chr2141336 1329 1298 1160 --11447 1199
NM_004450chr141264 ------
NM_004457chr241656 1124 467 328 --21714 1626 --
NM_004458chrX82456 1850 758 589 447 338 306 91 --12271 --
NM_004459chr1722078 1522 11810 ----
NM_004464chr474315 3810 2722 2636 981 647 157 14005 ----
NM_004480chr141687 ------
NM_004482chr2----1804 --
NM_004496chr1431332 975 871 21375 1170 ----
NM_004501chr154041 3815 1415 309 231 1406 --11349
NM_004504chr232870 2271 1003 1362 11943 --
NM_004505chr1731725 1305 390 ------
NM_004506chr6----2735 574 --
NM_004508chr1021118 1012 21026 990 ----
NM_004516chr191246 ------
NM_004520chr52172 112 ------
NM_004524chr171193 1255 ----
NM_004525chr231518 1070 485 --11475 --
NM_004543chr22341 55 ------
NM_004545chr14123 ------
NM_004571chr2142968 2285 861 99 --32364 1084 707 --
NM_004575chr441603 597 461 177 ------
NM_004576chr5164 ------
NM_004586chrX105271 5242 3786 3599 3514 2083 1787 1468 642 123 ----12128
NM_004593chr34931 589 582 155 1348 ----
NM_004598chr563295 3264 3003 2847 1161 417 --33238 2551 2300 --
NM_004599chr222665 652 --1450 --
NM_004600chr131578 375 356 ------
NM_004602chr2031458 1311 476 --11101 --
NM_004612chr9114507 4279 4254 3911 3833 3299 3119 2958 1918 983 461 21687 1572 13566 --
NM_004616chr122201 48 183 ----
NM_004630chr11----1994 --
NM_004631chr121164 218 --1948 --
NM_004645chr173342 291 33 ------
NM_004654chrY31365 1287 905 ------
NM_004660chrY72300 2236 1841 1608 761 686 362 11891 11835 --
NM_004663chr1511130 --1233 --
NM_004667chr154666 505 277 235 ------
NM_004670chr1061703 1294 1146 532 69 33 ------
NM_004681chrY2625 270 1192 ----
NM_004687chr171248 ------
NM_004689chr141187 ----1396
NM_004690chr63782 736 281 1164 ----
NM_004694chr171128 ------
NM_004703chr1741729 994 977 127 1571 --11579
NM_004713chr14--2518 226 ----
NM_004715chr181189 ------
NM_004717chr731264 977 495 --21286 1106 --
NM_004719chr1272608 2400 2391 1798 465 318 244 --22840 2757 --
NM_004725chr101310 ------
NM_004726chrX115055 4935 4557 4222 4115 3747 2092 1496 1332 631 269 1213 3405 380 62 12292
NM_004729chrX22161 839 --152 11777
NM_004730chr54750 633 548 514 ------
NM_004731chr1231633 610 358 21894 728 ----
NM_004734chr13113218 2701 2613 2576 2536 2459 2239 836 546 441 215 --21197 381 --
NM_004742chr351740 1671 1371 588 552 --1236 --
NM_004744chr463799 3441 1452 1102 909 148 --23278 536 --
NM_004745chr8126826 6559 6430 5653 5205 5024 4730 2486 2342 2088 1876 1038 14693 46621 6087 4759 4385 26331 2573
NM_004747chr1021393 290 11592 ----
NM_004748chr1554232 3506 3338 2568 1687 24050 596 11185 --
NM_004755chr14186 ----1181
NM_004772chr51527 --11213 --
NM_004774chr1722068 532 ----11257
NM_004775chr182861 37 --21652 311 12070
NM_004781chr12525 279 --21242 1227 1261
NM_004781chr12525 279 --21242 1227 1261
NM_004788chr1142559 1966 191 40 12407 1385 --
NM_004795chr1341817 1768 554 365 --21827 536 11475
NM_004796chr1442445 1649 774 408 ------
NM_004797chr363533 2971 2692 1017 359 274 2391 246 ----
NM_004798chr2093630 3440 3322 3143 2890 2625 1389 1168 655 --23075 2741 --
NM_004815chr1113933 3614 3585 3366 1779 1210 900 562 421 393 306 13072 44756 412 173 76 --
NM_004824chr641222 1117 1057 374 ------
NM_004831chr193994 676 193 ------
NM_004834chr273131 3082 2835 2510 2359 2091 1030 33363 2464 2374 32982 1173 442 --
NM_004841chr12444 186 --191 --
NM_004842chr621435 467 2650 413 31396 1329 187 --
NM_004849chr611305 --21278 1200 --
NM_004850chr231300 709 601 ------
NM_004857chr1474457 4251 3441 1741 1529 1333 481 34815 4655 141 33936 3274 278 --
NM_004859chr1742211 1877 525 226 33098 632 548 ----
NM_004863chr1475355 5183 4876 4391 4281 3834 1520 25046 5040 14541 11129
NM_004865chr61426 ------
NM_004869chr1831309 529 21 21526 1364 ----
NM_004873chr1432076 1272 912 13198 ----
NM_004874chr81204 ------
NM_004879chr11----1177 --
NM_004887chr52746 311 1954 ----
NM_004893chr52413 174 1588 ----
NM_004896chr1041418 355 202 172 ------
NM_004898chr432040 1154 155 21770 166 21029 517 11928
NM_004902chr204327 318 233 158 1148 ----
NM_004904chr7186163 6089 5788 5429 5377 5202 4915 4500 4222 2506 2495 2367 2110 1935 1748 858 713 149 36570 4991 4080 36046 1836 1785 --
NM_004906chr6----1233 --
NM_004912chr721262 622 ------
NM_004926chr1431733 1526 147 11694 ----
NM_004929chr831408 1337 463 11103 --1972
NM_004932chr5--1143 ----
NM_004938chr92121 83 21132 1126 ----
NM_004947chr33953 271 24 11641 12252 --
NM_004948chr1821284 292 ----1274
NM_004956chr742898 2810 1405 357 21100 837 23189 3166 --
NM_004966chr1021007 917 1781 ----
NM_004972chr931139 847 766 2344 112 ----
NM_004985chr1284447 4261 4211 3812 3199 1402 518 141 23353 1448 34389 3488 317 --
NM_004987chr2--1265 ----
NM_004992chrX88471 7641 6750 6529 2853 1843 1022 929 --17997 --
NM_004992chrX88471 7641 6750 6529 2853 1843 1022 929 --17997 --
NM_004999chr664509 4465 1476 1058 1027 447 ------
NM_005003chr16155 ------
NM_005010chr752177 1606 592 318 185 11566 21447 41 1433
NM_005011chr731604 739 693 ------
NM_005014chr91784 1754 ----
NM_005023chr531407 1302 227 11374 ----
NM_005025chr3------1165
NM_005028chr10--22173 884 32077 663 588 --
NM_005032chrX3837 334 75 --1268 --
NM_005036chr2288308 7933 3117 3000 2900 1296 433 200 ------
NM_005045chr71656 ----1941
NM_005054chr231661 1472 418 ------
NM_005056chr12105008 4400 4196 3829 3425 2187 1281 514 380 252 15149 21762 336 --
NM_005058chrY--2211 67 ----
NM_005063chr1083732 3608 3570 3498 3170 2430 1188 570 3720 181 83 --194
NM_005065chr14105363 4827 4576 4124 3794 3663 3519 1814 1750 503 35291 4893 4261 25389 203 --
NM_005068chr621430 1137 ------
NM_005069chr2131703 1294 459 ------
NM_005077chr92430 47 ------
NM_005078chr154706 597 386 243 ------
NM_005079chr863198 1247 1121 828 337 38 23234 2595 ----
NM_005087chr3153 1266 ----
NM_005088chrX2622 125 --1763 --
NM_005095chr13777 196 56 ------
NM_005097chr102340 101 ------
NM_005105chr142233 1932 1843 143 21465 171 --12203
NM_005109chr332345 2251 475 12332 12239 --
NM_005116chr2054303 3599 2842 1717 805 23149 915 ----
NM_005121chr1753742 3295 3227 3125 1207 33159 2607 1021 1995 --
NM_005126chr332080 1680 1597 ----1268
NM_005128chr21191 ----1689
NM_005135chr1563773 3209 2959 2778 393 226 ----1313
NM_005151chr1882452 2264 1969 1855 1596 967 695 497 21481 43 1961 --
NM_005153chr162757 265 1602 ----
NM_005156chr984999 3610 3535 3435 3282 1560 1541 1357 --24978 4174 --
NM_005159chr1532221 1963 1920 1323 ----
NM_005164chr1242123 1740 947 935 12273 ----
NM_005168chr241724 1387 391 279 --11611 --
NM_005171chr1221091 1064 --1831 --
NM_005184chr1911602 --11529 --
NM_005187chr1612038 1696 171 --
NM_005188chr1198233 7982 7183 6601 5771 5684 3051 1348 210 28257 5112 47965 7484 7312 5674 --
NM_005190chr651119 832 779 755 203 1960 ----
NM_005192chr14198 ------
NM_005197chr1475821 5261 4820 4046 3978 775 622 15103 ----
NM_005204chr103719 665 137 ------
NM_005207chr2283377 2706 2380 2282 1438 1243 623 150 ------
NM_005208chr17--1104 ----
NM_005230chr123611 446 223 ------
NM_005233chr361981 1717 1653 1639 1583 722 --12283 11964
NM_005235chr2147758 7266 7123 6707 6124 5637 5549 5300 3103 2885 2798 1353 285 211 37549 7481 1796 ----
NM_005238chr11103497 2721 2542 2226 1130 944 910 832 798 475 --12245 --
NM_005243chr224352 304 91 61 ------
NM_005249chr143877 812 234 1726 ----
NM_005252chr141553 1566 1599 --
NM_005254chr153924 404 377 11430 ----
NM_005256chr114984 763 166 136 ------
NM_005277chr43609 95 34 21305 711 31921 1833 1315 --
NM_005279chr2159 1724 ----
NM_005281chr11830 --2257 193 152
NM_005311chr762713 2450 2326 2176 1775 526 --22511 894 --
NM_005313chr152409 240 ------
NM_005324chr1751680 1328 563 404 139 1667 ----
NM_005327chr43720 551 64 --177 --
NM_005328chr81694 ------
NM_005339chr4103718 3450 3344 3279 3149 3028 2779 1467 942 738 11575 ----
NM_005342chrX52813 2037 820 442 146 --1812 --
NM_005347chr961594 484 360 336 264 89 ------
NM_005359chr18106377 5792 5097 4493 3998 2540 2341 2129 1069 920 1284 36256 4661 4549 --
NM_005381chr2----1383 --
NM_005387chr111503 ------
NM_005392chr961451 1435 1172 603 525 374 ------
NM_005397chr733080 2545 224 --23863 1596 --
NM_005398chr1051311 1054 964 561 362 1185 21266 1193 --
NM_005399chr184412 4274 4176 3515 1697 1682 1062 794 11296 1139 --
NM_005402chr71244 ------
NM_005406chr1811598 ----140
NM_005410chr52778 603 ------
NM_005415chr23713 308 32 ------
NM_005424chr11373 ------
NM_005433chr1862768 2674 1075 1068 960 812 1595 12179 --
NM_005436chr10103788 3363 3145 2954 1524 1337 1317 803 764 148 22987 721 13543 --
NM_005445chr102242 222 ------
NM_005450chr171197 ------
NM_005455chr111140 1195 11428 --
NM_005458chr91856 11850 1815 --
NM_005460chr52414 205 1552 ----
NM_005475chr122241 70 ----12066
NM_005487chr221771 ----11341
NM_005494chr71647 2561 29 1517 --
NM_005497chr1795815 4837 4745 4603 4174 3914 2443 2129 1661 33747 482 430 1110 --
NM_005499chr19--2511 476 --1449
NM_005502chr942740 2722 2504 1030 11047 12980 --
NM_005504chr12125973 5951 5906 5858 4431 4049 2490 1514 1370 1307 1204 596 15430 ----
NM_005507chr11----1404 --
NM_005509chr541164 217 205 99 ------
NM_005512chr1142055 1506 781 238 --2369 311 --
NM_005513chr34511 300 52 34 11169 11575 --
NM_005520chr51117 ------
NM_005522chr73962 915 565 11384 ----
NM_005530chr153514 237 202 ----1962
NM_005537chr131739 1809 --1111
NM_005542chr711764 ------
NM_005572chr1----191 --
NM_005596chr945778 5653 4327 1877 14455 14878 16221
NM_005603chr1821724 24 --11644 --
NM_005604chr652276 2159 1977 688 416 12308 ----
NM_005611chr16--11069 1818 --
NM_005613chr132184 1578 91 1719 ----
NM_005614chr721003 708 11069 ----
NM_005618chr6--1590 177 --
NM_005638chrX11618 --11744 --
NM_005639chr1241829 1347 1202 40 11383 ----
NM_005647chrX83219 2850 2536 2488 2133 921 368 53 --12974 12806
NM_005655chr82993 69 ------
NM_005657chr151148 ------
NM_005665chr194912 3714 3627 1525 1182 986 962 759 273 11338 1546 24737 3763
NM_005667chr24339 178 135 71 2100 60 ----
NM_005668chr5103876 3275 2874 1421 1282 919 469 242 171 46 34023 3620 3399 1566 --
NM_005715chr662752 2740 2389 2012 918 91 12419 ----
NM_005720chr71198 --187 --
NM_005722chr251977 990 907 311 35 1538 ----
NM_005730chr1273302 2228 1382 860 627 170 92 --11321 13079
NM_005731chr2179 ------
NM_005732chr521465 1016 1392 ----
NM_005734chr114803 659 598 505 1579 ----
NM_005737chr272935 2759 2562 2088 960 133 33 ----11953
NM_005738chr731935 590 180 32004 421 405 11577 1107
NM_005746chr792685 2499 2287 1772 1072 981 808 663 45 ----1201
NM_005748chr1273037 2909 2304 1333 1327 665 556 1729 13332 --
NM_005751chr71321 ------
NM_005752chr1611155 11005 --1955
NM_005754chr53993 976 334 ----11089
NM_005756chrX21174 31 11521 21447 1401 --
NM_005759chr2104694 4574 3938 2902 1922 1641 1363 852 574 207 24195 1667 1592 --
NM_005776chr142679 145 ------
NM_005779chr532684 2334 2237 43226 3104 2992 2472 ----
NM_005795chr262692 2637 2178 506 203 107 32397 2374 736 --11080
NM_005801chr171598 1770 ----
NM_005807chr11119 ------
NM_005808chr3113520 3475 3433 3058 3046 2966 2870 2861 2299 701 126 13508 12519 1414
NM_005813chr22764 93 32603 1991 956 ----
NM_005822chr641957 1902 937 843 12097 ----
NM_005824chr73733 311 245 ----1610
NM_005828chr1734451 3391 189 24671 3558 ----
NM_005840chrX44940 942 699 167 25334 2219 1988 --
NM_005843chr251971 791 697 354 231 11268 ----
NM_005845chr1321521 1491 21681 117 ----
NM_005857chr141203 1074 535 204 1507 ----
NM_005862chr32734 193 --1184 --
NM_005880chr1621089 1069 ------
NM_005885chr531329 1201 258 11337 ----
NM_005895chr1274005 3120 2909 811 714 598 298 23543 55 13774 --
NM_005896chr2--1843 1554 --
NM_005898chr1142946 2817 2170 623 --13210 12609
NM_005899chr1741600 1015 980 511 11196 --11369
NM_005901chr18138283 8069 8019 7391 6810 6448 6227 5307 2746 2736 2097 1964 1188 16168 28095 1924 --
NM_005902chr1543549 3311 2940 992 --14140 --
NM_005903chr574622 4147 3829 3603 1107 919 807 11945 24970 3533 --
NM_005906chr631117 638 330 21591 1432 ----
NM_005909chr564225 1502 1417 1108 960 410 33208 1621 125 13424 --
NM_005923chr61249 1648 ----
NM_005924chr7141 ------
NM_005935chr474997 4714 4540 1715 1653 1432 935 13310 --23896 3538
NM_005937chr1733203 717 282 --14176 --
NM_005955chr1105554 5415 5050 3516 3510 2105 1896 1220 866 350 --31756 1411 1247 --
NM_005962chr10--11670 ----
NM_005962chr10--11670 ----
NM_005964chr1721158 48 1514 11006 --
NM_005966chr242393 1668 843 303 11522 ----
NM_005977chr132985 247 1188 147 --
NM_005990chr562773 2747 2601 1115 684 620 --11989 --
NM_006007chr9104422 3961 3908 3793 3186 2730 1308 1140 493 345 21562 1453 2903 883 --
NM_006011chr1554324 3653 3162 940 754 11192 24035 1095 --
NM_006016chr631646 311 125 --11796 --
NM_006022chr1321098 937 ------
NM_006024chr7--1305 196 --
NM_006033chr1832240 1805 649 12255 11856 --
NM_006036chr262544 2090 1865 1681 669 353 1497 12504 --
NM_006037chr254582 1954 1259 804 616 --11076 --
NM_006038chr2022181 610 11506 ----
NM_006042chr171463 ----1123
NM_006047chr2053179 2365 2341 2238 1327 12416 ----
NM_006060chr764022 3770 3552 3458 1330 110 11523 ----
NM_006064chrX4131 89 81 52 ----1146
NM_006076chr772613 1249 1117 974 447 226 121 ------
NM_006080chr752210 969 518 251 223 --12008 --
NM_006089chrX71843 1745 1701 1620 1494 1385 1307 ------
NM_006090chr11108 1729 ----
NM_006094chr842205 2174 1880 464 ------
NM_006095chr484462 3640 3607 3463 3178 2936 722 526 12957 --13198
NM_006099chr11223 --1923 --
NM_006106chr11123287 3138 2985 2702 2577 2252 2170 976 495 372 327 302 33347 568 470 23179 1167 --
NM_006113chr172053 2008 1662 595 337 171 153 --11750 --
NM_006135chr11274 ------
NM_006136chr7--11062 --11091
NM_006139chr232725 721 550 22654 1995 ----
NM_006141chr1622472 615 32610 2021 1104 1481 --
NM_006143chr121106 ------
NM_006148chr1712506 ------
NM_006153chr3168 ------
NM_006157chr111321 ------
NM_006158chr821577 154 31138 334 328 11775 --
NM_006159chr12----140 --
NM_006166chr1282643 2578 2495 769 734 594 424 135 12392 11011 --
NM_006178chr1721616 564 --2366 218 --
NM_006183chr122243 128 --1403 --
NM_006186chr241282 1233 518 348 --11031 --
NM_006194chr1441202 1162 1063 1050 11292 ----
NM_006195chr9--1194 21141 906 --
NM_006196chr21354 ----1285
NM_006197chr822251 358 ------
NM_006206chr452896 2843 2770 2354 2011 1685 ----
NM_006209chr81164 197 ----
NM_006223chrX2547 190 --1122 --
NM_006226chr241218 1192 231 78 ------
NM_006237chr1321472 499 ------
NM_006241chr341743 1662 1601 710 --12198 --
NM_006246chr1431264 1155 530 11204 ----
NM_006247chr19199 ------
NM_006251chr593075 2974 2261 1266 1150 961 543 120 64 ------
NM_006252chr1137507 7341 7079 6956 6883 4777 3025 2821 2625 2583 2427 1203 486 35620 953 135 12942 11526
NM_006256chr152669 799 695 580 460 ----1414
NM_006258chr104567 178 125 94 1535 --1587
NM_006264chr44463 441 166 22 ------
NM_006265chr851265 1134 977 295 42 11522 11423 --
NM_006268chr1111211 ------
NM_006275chr2042265 2205 890 535 --11723 --
NM_006282chr20114681 4560 4479 4100 3980 3484 3296 3084 1643 1088 131 14574 13454 --
NM_006287chr252456 1792 1681 87 53 --11917 11936
NM_006298chr62955 925 12865 --1603
NM_006304chr71148 ------
NM_006306chrX75199 4664 4118 2200 1580 1110 690 --25933 3745 --
NM_006310chr171130 ------
NM_006313chr1261441 1369 1293 1245 1174 120 1330 ----
NM_006315chr474095 3926 3716 2991 827 769 268 --34481 3292 2967 --
NM_006320chr421095 865 ------
NM_006324chr16171 ------
NM_006325chr122870 162 --1131 1864
NM_006330chr851646 1400 538 110 92 ------
NM_006333chr22679 441 ------
NM_006335chr13795 262 231 ------
NM_006343chr21443 --1135 --
NM_006345chr431364 1206 501 ----1544
NM_006346chr131112 ------
NM_006352chr152029 759 577 490 281 --1458 --
NM_006357chr21427 1163 ----
NM_006359chrX32510 1594 96 1115 12455 --
NM_006363chr201204 ------
NM_006364chr143987 963 146 ------
NM_006367chr1----1368 --
NM_006371chr395313 1976 1747 1542 1299 976 902 473 261 ------
NM_006375chrX61301 1199 600 403 351 209 21664 270 11499 --
NM_006379chr742076 2049 1647 41 --12252 --
NM_006380chr1761468 1385 1096 980 681 158 11056 13685 14043
NM_006386chr2252306 1894 865 574 521 --12399 --
NM_006390chr1251839 1799 1524 401 272 11789 ----
NM_006393chr1054145 4058 1291 912 681 14522 34484 3582 3345 24514 3936
NM_006403chr641786 1632 1488 364 180 ----
NM_006413chr1051477 1385 1194 575 291 ------
NM_006415chr91285 --21181 168 --
NM_006416chr6--2773 611 ----
NM_006420chr2022915 23 13401 42502 1301 481 41 --
NM_006434chr1022547 401 ------
NM_006439chr4----1404 --
NM_006451chr52301 274 ------
NM_006459chr101346 21994 264 --1289
NM_006464chr254625 4525 2912 639 485 24703 4109 ----
NM_006465chr1511954 --22324 1515 --
NM_006467chr552309 2211 1585 812 268 12008 --12124
NM_006469chr131414 1086 181 11045 1559 --
NM_006475chr13126 --1549 --
NM_006482chr1273773 3732 3513 2832 2514 552 187 11143 --13333
NM_006489chr1461577 1420 1280 635 305 122 ------
NM_006496chr131527 1264 263 1181 11497 --
NM_006504chr1052603 1110 679 616 302 1862 12873 --
NM_006517chrX12251 --22208 191 --
NM_006520chrX11472 1222 ----
NM_006532chr1921887 94 11961 12051 --
NM_006534chr2072840 2688 1228 1158 880 715 240 12907 ----
NM_006540chr831193 319 283 ------
NM_006544chr14115697 5540 4140 2351 1997 1820 1384 1218 298 243 49 33880 924 324 ----
NM_006546chr1756355 2384 1617 526 405 34264 1941 1484 26047 838 26428 4904
NM_006547chr751678 797 517 358 168 1442 ----
NM_006548chr331539 1140 37 ------
NM_006558chr81469 --1105 --
NM_006561chr1034872 1359 830 35515 1810 658 21464 440 --
NM_006570chr9130 ----1342
NM_006572chr1783098 2744 2611 1188 867 692 643 600 23421 1387 11199 --
NM_006577chr2--11097 ----
NM_006580chr31137 ------
NM_006583chr4151 1346 ----
NM_006586chr61462 ------
NM_006595chr111176 --21320 261 --
NM_006599chr16107927 7828 6639 5612 3149 2650 1717 1508 1383 1195 55939 5024 3173 2929 189 35846 809 634 15898
NM_006602chr203281 197 184 ------
NM_006603chrX31786 744 495 1422 ----
NM_006609chr242993 2627 2443 1030 22526 1866 ----
NM_006614chr343276 2479 1189 1152 23369 2761 ----
NM_006618chr1----21164 1119 --
NM_006620chr653850 3448 3380 525 64 31489 469 210 34124 3619 3597 13885
NM_006621chr132002 747 402 21469 322 1812 --
NM_006624chr1041465 846 372 166 --1756 --
NM_006625chr111125 ----1118
NM_006625chr111125 ----1118
NM_006625chr111125 ----1118
NM_006628chr1594627 3962 3697 3484 3233 1759 1616 599 307 11796 ----
NM_006629chr1842152 1883 1133 611 22526 957 ----
NM_006633chr51144 2805 738 ----
NM_006646chr1362962 2890 2794 2028 1216 569 ------
NM_006650chr523926 1412 ------
NM_006654chr12124384 4023 3794 3439 3427 3231 3084 2974 1883 912 406 63 12998 ----
NM_006681chr43153 144 126 136 ----
NM_006698chr2011472 ----1404
NM_006703chr61148 ------
NM_006706chr5140 --1822 1781
NM_006713chr5183 1593 ----
NM_006717chr953181 3136 2182 1174 1013 --32665 2433 546 --
NM_006718chr6--1324 ----
NM_006720chr1074897 4838 4556 3651 3375 368 329 --11237 --
NM_006722chr332972 2173 390 32947 2196 1972 22931 2445 --
NM_006726chr43482 405 82 1954 ----
NM_006727chr51508 ------
NM_006729chrX31350 1213 816 11930 ----
NM_006738chr15114485 4424 4343 3958 3786 3675 3408 2957 1366 459 362 ------
NM_006746chrX61497 1399 1355 1337 1092 967 11430 ----
NM_006749chr831230 1206 908 1394 11092 --
NM_006750chr16117775 7568 6595 6369 5493 2815 2210 2010 1542 1529 1125 --26994 1311 --
NM_006751chr211010 1877 ----
NM_006756chr811468 ------
NM_006761chr171558 ------
NM_006766chr83994 599 395 2976 412 1666 --
NM_006769chr12573 23 ------
NM_006775chr622514 440 13073 12431 --
NM_006777chrX52852 2552 2375 1955 983 22780 1905 1300 11156
NM_006778chr641871 1526 1305 693 1400 ----
NM_006800chrX1192 2634 610 ----
NM_006805chr511247 ------
NM_006811chr203663 331 157 --2912 103 --
NM_006822chr173758 118 74 --1106 1270
NM_006823chr841179 1001 275 64 11160 ----
NM_006827chr14113365 2969 2747 2534 2430 2383 2204 1234 987 882 489 --1857 --
NM_006828chr62529 192 1208 ----
NM_006836chr12150 --1555 --
NM_006838chr1221475 1433 2240 206 21249 339 11371
NM_006851chr1262791 2194 2168 1981 944 552 12636 ----
NM_006852chr1792793 2556 2433 2267 2083 948 665 366 351 1893 --11787
NM_006870chr201684 143 ----
NM_006873chr21215 23416 2462 ----
NM_006885chr1644076 3604 3302 3107 ------
NM_006888chr1433045 908 132 1850 12397 --
NM_006892chr2041411 1165 543 386 ------
NM_006892chr2041411 1165 543 386 ------
NM_006895chr222020 1457 22103 1707 12040 --
NM_006912chr12238 39 --11753 --
NM_006914chr94969 156 109 36 11225 ----
NM_006915chrX62576 2360 1760 946 356 318 42317 2087 748 104 12287 --
NM_006920chr241852 1826 1763 772 32035 2014 789 ----
NM_006922chr21761 42386 2354 1884 420 ----
NM_006924chr1794098 4076 4004 3992 3569 3138 2726 1203 757 1501 33405 3111 394 --
NM_006925chr14--1348 ----
NM_006931chr1272177 1712 1472 1384 730 690 545 --1100 --
NM_006937chr171430 ------
NM_006939chr1451090 1052 321 226 106 1121 ----
NM_006940chr1231672 393 343 ------
NM_006951chr101587 1280 198 --
NM_006955chr1063030 2959 2727 2493 1138 447 22793 2478 194 --
NM_006981chr962971 2871 2712 2489 1132 624 22009 302 --22606 1993
NM_006996chr161657 1618 1177 411 369 98 --21795 619 --
NM_007007chr12114714 4687 4278 4037 3766 3245 1468 1329 935 357 322 1514 13031 --
NM_007008chr24919 813 801 605 ------
NM_007011chr1576610 5745 4505 2519 1655 748 448 --14286 --
NM_007023chr2--1855 ----
NM_007027chr33552 60 36 ------
NM_007029chr8187 ------
NM_007034chr12968 802 1302 ----
NM_007039chr1432261 2092 2045 ------
NM_007045chr62487 90 ------
NM_007050chr2078057 8044 7896 5794 4919 1793 193 --16390 16154
NM_007052chrX1101 ------
NM_007064chr331436 1254 63 --1558 --
NM_007068chr22133 1972 ----
NM_007076chr121121 ------
NM_007084chr1321364 123 ------
NM_007106chr1362808 1057 1006 746 525 246 22771 1871 ----
NM_007111chr131651 --1915 --
NM_007114chr322877 34 31080 709 401 33037 2976 916 --
NM_007118chr52855 150 ------
NM_007124chr641272 1235 472 25 --1121 --
NM_007125chrY21201 151 11308 ----
NM_007126chr92476 362 ------
NM_007129chr133761 720 275 --1944 --
NM_007137chrX55303 1604 537 330 244 11187 ----
NM_007146chr1712252 ------
NM_007159chr321627 1302 --11323 11564
NM_007170chr11647 ------
NM_007172chr2232376 252 227 1163 23300 1198 --
NM_007174chr1231738 713 654 --11878 1331
NM_007175chr823165 2858 --32778 301 68 --
NM_007191chr122215 83 --172 --
NM_007195chr1893376 3214 2856 2780 2720 2633 1427 961 527 13261 --13222
NM_007200chr15114485 4424 4343 3958 3786 3675 3408 2957 1366 459 362 ------
NM_007203chr933277 3221 2665 13919 ----
NM_007207chr11881 ------
NM_007212chr132206 1824 603 21989 1635 1771 1387
NM_007214chr611127 1184 ----
NM_007218chr84637 627 238 114 ------
NM_007222chr851625 1389 1281 1166 155 11302 ----
NM_007231chrX51950 1881 1669 615 146 1851 12295 --
NM_007236chr1552317 1737 1524 850 272 11807 ----
NM_007246chr42882 666 ------
NM_007249chr1388866 8819 8372 7937 7351 2864 2258 231 26222 3542 27173 1319 --
NM_007255chr51520 --1570 --
NM_007257chr872409 2225 1920 806 738 482 259 12922 12617 --
NM_007269chr12224 65 1217 ----
NM_007270chr731569 1538 1511 ------
NM_007276chr72806 290 21070 724 ----
NM_007278chr171128 ------
NM_007282chr32713 641 2960 347 --11002
NM_007287chr342890 645 606 234 ------
NM_007288chr342890 645 606 234 ------
NM_007289chr342890 645 606 234 ------
NM_007294chr1751340 1019 938 513 286 --1457 --
NM_007295chr1751340 1019 938 513 286 --1457 --
NM_007296chr1751340 1019 938 513 286 --1457 --
NM_007297chr1751340 1019 938 513 286 --1457 --
NM_007298chr1751340 1019 938 513 286 --1457 --
NM_007299chr1751340 1019 938 513 286 --1457 --
NM_007300chr1751340 1019 938 513 286 --1457 --
NM_007302chr1751340 1019 938 513 286 --1457 --
NM_007303chr1751340 1019 938 513 286 --1457 --
NM_007304chr1751340 1019 938 513 286 --1457 --
NM_007305chr1751340 1019 938 513 286 --1457 --
NM_007315chr221417 1319 1335 ----
NM_007325chrX61818 1579 1508 714 624 597 ----11738
NM_007331chr462094 2088 2070 1784 819 71 --22638 284 --
NM_007345chr1841809 1685 623 601 1104 131 --
NM_007347chr1543069 2917 2491 437 2336 239 12040 --
NM_007349chr71369 ------
NM_007350chr1264525 3207 3077 887 363 340 11385 13363 --
NM_007358chr121934 409 1163 21737 243 --
NM_007372chr171907 ------
NM_007373chr10152 --11707 --
NM_007375chr182641 2211 2056 1835 1818 1053 590 558 --21110 970 --
NM_012062chr122694 284 ------
NM_012081chr563271 1422 1373 1329 971 404 43764 3554 3545 2422 ----
NM_012082chr83952 917 833 1280 ----
NM_012090chr11513 11244 ----
NM_012092chr241625 595 476 339 ------
NM_012096chr373592 3233 3179 2967 2860 2363 1164 ------
NM_012097chr221683 44 1427 1402 1347
NM_012102chr141844 1709 1031 894 --2908 386 --
NM_012104chr1153607 1309 1109 732 461 ------
NM_012104chr1153607 1309 1109 732 461 ------
NM_012118chr4----1306 --
NM_012120chr662520 2296 1964 569 281 28 12152 --11142
NM_012129chr732520 695 146 22004 1903 ----
NM_012137chr131871 1135 341 12339 --11838
NM_012141chr1342959 2925 517 417 --13768 --
NM_012153chr1162531 1034 788 503 366 241 --31836 1714 607 --
NM_012158chr1341851 1775 1286 1254 31300 510 341 1499 --
NM_012161chr431028 263 168 --1275 --
NM_012164chr967228 2912 2469 2256 1071 264 21593 532 24981 1941 1581
NM_012183chr11471 1585 ----
NM_012193chr1154186 3720 3560 1353 45 1975 15180 11168
NM_012197chr91101 11514 ----
NM_012199chr144291 2853 797 119 21257 321 ----
NM_012207chr102161 111 11111 ----
NM_012214chr265999 5861 5641 4974 4164 983 35369 439 323 14991 --
NM_012218chr1993007 2753 2509 2116 1976 1119 510 395 354 --11184 --
NM_012234chr353594 2441 852 610 118 --13370 --
NM_012238chr1011522 --170 1374
NM_012242chr101513 2584 46 ----
NM_012243chr12665 366 ------
NM_012247chr10--2734 714 ----
NM_012249chr273472 1422 1148 1072 621 548 523 23488 60 1158 --
NM_012252chr795403 4527 4407 3809 1912 1640 1389 1186 112 14492 --11775
NM_012259chr621107 36 11158 --11333
NM_012261chr20----1540 --
NM_012262chr174950 4274 4175 4093 3748 956 523 13506 1499 --
NM_012266chr92231 144 --11100 1291
NM_012281chr751693 902 336 324 264 11792 1662 --
NM_012287chr3104440 4377 3974 3780 3123 2907 1818 1284 823 544 --11496 --
NM_012290chr231556 1407 538 --11357 --
NM_012294chr773431 3125 2851 1551 1527 1099 53 --33323 3156 2524 --
NM_012297chr452603 2074 990 366 86 12205 ----
NM_012300chr552411 2267 1606 444 271 ------
NM_012309chr1194922 4783 4351 1877 1524 656 522 478 74 11779 ----
NM_012310chrX145 1533 ----
NM_012311chr10------1267
NM_012316chr144479 2060 1147 785 15572 23860 1278 --
NM_012319chr184943 721 374 295 1952 ----
NM_012322chr73444 124 83 ------
NM_012325chr2021432 270 11181 2382 287 --
NM_012330chr1041524 1495 663 104 ------
NM_012331chr84544 520 65 44 ------
NM_012338chr741048 832 210 101 2461 399 ----
NM_012347chr632915 530 447 --12884 --
NM_012382chr574376 4019 3352 1399 1073 1027 342 21821 332 11512 --
NM_012383chr92379 326 ------
NM_012388chr1553053 3047 2698 1973 397 ------
NM_012399chr2251937 1926 1894 616 339 --11250 --
NM_012405chr1123799 3437 2909 2694 2497 1436 1267 871 835 825 627 128 --1539 --
NM_012416chr931228 1071 234 1304 1479 --
NM_012421chr12384 131 ------
NM_012425chr1042048 2006 137 90 ------
NM_012426chr16--1371 ----
NM_012428chr151184 1824 1233 --
NM_012433chr21327 --1293 --
NM_012464chr482127 1909 1166 1058 759 480 89 33 ----11928
NM_012482chr12280 231 --176 --
NM_012484chr53250 197 91 ------
NM_013230chrY51553 1142 289 205 144 --11708 --
NM_013231chr1494152 4137 3811 3191 2925 2773 1233 986 553 2175 99 23912 3524 13838
NM_013233chr21918 ----1907
NM_013243chr1531193 981 113 1969 1999 --
NM_013255chr7168862 8580 7589 7224 6155 5731 5424 3221 2790 2679 2324 2318 2070 1978 1256 1226 58891 8052 3110 2011 1782 48903 5382 3405 399 27676 6059
NM_013261chr461348 1328 1134 908 471 400 --23792 2410 1836
NM_013262chr631422 1032 587 ------
NM_013264chr11148 ------
NM_013269chr1274569 4534 3805 3531 2819 1505 1480 ----11582
NM_013277chr122753 327 --21024 918 --
NM_013281chr2021097 502 ------
NM_013282chr1911338 11207 ----
NM_013293chr7--1246 ----
NM_013302chr1694262 4164 3880 3346 3001 1145 650 552 339 21543 968 ----
NM_013309chr1532271 541 379 3610 568 154 ----
NM_013316chr71717 --1232 --
NM_013330chr1168 ------
NM_013341chr232844 1896 472 11888 ----
NM_013352chr62661 304 1364 1821 --
NM_013354chr841482 1387 1122 907 11334 ----
NM_013357chr81723 ------
NM_013372chr1583371 2714 2169 1089 751 578 419 37 13010 22959 375 --
NM_013374chr353148 2657 2624 786 117 ------
NM_013381chr1242317 2214 1478 743 ------
NM_013386chr131687 406 179 ------
NM_013390chr93400 291 23 31485 1123 192 11238 --
NM_013396chr2131346 966 578 1561 ----
NM_013410chr131060 1044 936 --11146 --
NM_013411chr152662 2011 1885 865 337 ------
NM_013423chrX31077 1043 482 --1473 --
NM_013427chrX31077 1043 482 --1473 --
NM_013436chr2--2727 533 ----
NM_013437chr821355 1307 ------
NM_013438chr91436 11466 ----
NM_013444chrX5969 828 791 718 308 ------
NM_013448chr145610 600 495 484 157 ------
NM_013449chr1252842 2649 678 402 81 --1744 --
NM_013450chr221202 413 ------
NM_013958chr81425 ------
NM_013959chr81425 ------
NM_013961chr81425 ------
NM_013962chr81425 ------
NM_013986chr224352 304 91 61 ------
NM_013995chrX32552 2148 578 --12234 --
NM_014005chr542122 1909 595 528 2452 136 12714 --
NM_014011chr232322 1632 371 1137 1694 --
NM_014021chr173318 2466 2339 1127 384 331 237 --12159 13141
NM_014028chr643133 2746 2714 2603 43245 2763 2684 217 1952 --
NM_014034chr61399 11517 ----
NM_014035chr531409 1362 469 ------
NM_014043chr341560 1441 1162 1033 --11531 1496
NM_014048chr1665274 5156 4526 3246 1696 1477 ------
NM_014071chr201398 ------
NM_014079chr32906 410 2378 105 ----
NM_014089chr1351844 1813 1377 903 235 ------
NM_014106chr1562123 2111 2026 830 619 169 32296 949 218 ----
NM_014110chr131182 1144 116 ------
NM_014112chr874931 4672 4434 1420 1306 777 593 --15339 --
NM_014117chr1622648 662 --1349 --
NM_014141chr785306 5152 4736 4588 3868 958 633 243 23307 1579 ----
NM_014154chr311190 2317 292 11019 --
NM_014155chr1176090 6000 5837 5166 2714 1036 209 12431 15584 --
NM_014170chr3198 1373 ----
NM_014181chr282882 2823 1155 1005 736 604 426 297 32181 500 314 ----
NM_014240chr374192 3308 2888 1345 442 243 199 13043 13060 --
NM_014243chr432119 1765 140 12157 ----
NM_014245chr331053 967 754 1267 --1393
NM_014250chr221771 ----11341
NM_014253chrX22175 973 11670 --11647
NM_014263chr1031133 261 124 --122 --
NM_014264chr4--1655 ----
NM_014282chr91251 1486 ----
NM_014284chr111101 ------
NM_014286chr963216 3122 2873 1445 919 21 --13026 --
NM_014290chr91229 ------
NM_014293chr2243272 3120 1196 160 --24131 608 --
NM_014305chr132688 148 --1528 --
NM_014309chr2254564 4530 4275 3803 2125 13876 15039 --
NM_014317chr10--1316 ----
NM_014319chr1261900 1717 590 377 174 81 11593 ----
NM_014321chr16--1797 ----
NM_014323chr223945 62 54 11074 ----
NM_014325chr1222097 416 1281 21792 1762 --
NM_014333chr1132320 692 165 22841 2703 ----
NM_014342chr1131460 1308 1168 --166 --
NM_014363chr1341077 842 460 36 21129 812 11204 --
NM_014368chr922164 1512 1444 1858 --
NM_014372chr142026 1559 1319 222 22066 616 ----
NM_014382chr321698 462 1132 ----
NM_014391chr10132 ------
NM_014415chr341349 516 489 289 --1574 --
NM_014421chr41797 22014 254 ----
NM_014423chr5115595 5175 5018 4714 4511 3666 1630 1525 1024 700 208 --14286 --
NM_014426chr20133 ------
NM_014432chr621273 258 ------
NM_014445chr372415 2360 2240 1952 1753 869 589 --12031 --
NM_014447chr411642 --21506 1029 --
NM_014455chr1----1136 --
NM_014456chr1041875 1357 623 167 ------
NM_014458chr121296 919 ------
NM_014469chr112596 541 ------
NM_014472chr10144 ------
NM_014491chr7--21020 438 ----
NM_014494chr1662275 2161 1569 856 789 458 12190 1559 --
NM_014497chr21231 ------
NM_014504chr7182 --1532 1338
NM_014515chr125929 818 777 738 423 ------
NM_014517chr371977 1837 1777 1390 440 346 107 ------
NM_014554chr122861 508 ----11575
NM_014572chr1311464 1551 11110 --
NM_014574chr144627 568 471 391 ------
NM_014575chr3164 --1474 --
NM_014577chr221679 --1291 --
NM_014586chr2174442 4284 3743 3172 2957 1032 180 --1844 --
NM_014606chr461516 1177 1052 1022 370 281 ------
NM_014612chr941542 1529 1340 1279 1199 130 --
NM_014614chr231290 1167 1074 11210 ----
NM_014629chr821092 252 21248 315 1893 --
NM_014632chr114212 186 55 41 ------
NM_014633chr113594 576 72 ------
NM_014635chr231639 1444 382 ------
NM_014636chr954022 3352 3067 1684 321 13717 ----
NM_014660chr71388 ------
NM_014666chr551347 1322 1177 1111 944 2932 75 ----
NM_014670chr22227 164 ------
NM_014671chr731604 1150 40 11362 11438 --
NM_014674chr343951 3839 3383 2583 ----12468
NM_014676chr151466 1308 1185 1162 79 11257 ----
NM_014677chr8197 ------
NM_014678chr222779 116 ------
NM_014682chr822320 771 1423 1661 --
NM_014683chr1732183 860 816 --1341 --
NM_014685chr161506 --1395 --
NM_014689chr21238 ------
NM_014701chr1573434 2195 1259 943 662 524 288 12302 1743 12998
NM_014705chr761949 1637 1440 815 744 345 ------
NM_014707chr72508 164 21603 720 ----
NM_014711chr1641327 729 714 422 31791 1295 605 12044 --
NM_014712chr161240 ------
NM_014717chr193843 823 103 ------
NM_014720chr1081864 1767 1752 1737 1710 1317 1212 304 --11510 11359
NM_014721chr6147181 6223 5753 5235 4797 2945 2594 2018 1437 1058 225 201 153 92 11679 36723 5816 648 --
NM_014727chr191317 ------
NM_014729chr831623 796 270 --1457 --
NM_014730chr1284625 4126 1911 1645 1277 887 547 470 23527 1841 11018 --
NM_014730chr1284625 4126 1911 1645 1277 887 547 470 23527 1841 11018 --
NM_014732chr16145194 5132 4887 4832 4550 4432 4325 3886 3672 1543 1465 911 357 261 15807 34105 1479 620 --
NM_014733chr511797 1288 1733 --
NM_014735chrX31859 720 155 ------
NM_014736chr15158 ------
NM_014738chr172716 250 --189 --
NM_014739chr674210 3496 2639 1339 550 350 82 33168 1253 639 ----
NM_014743chr433075 2908 2891 --11002 --
NM_014746chr284267 4256 3918 3375 1487 1216 1047 167 ------
NM_014747chr185428 5350 5076 4040 3766 2045 1444 602 ------
NM_014751chr831954 1929 1769 ------
NM_014752chr11--21622 104 11510 --
NM_014755chr2143499 3166 3148 3135 2649 1715 1376 1210 819 707 604 268 260 162 13948 13293 --
NM_014757chr522117 386 ------
NM_014761chr1611149 ------
NM_014764chr1241092 1020 866 237 ------
NM_014765chr1132490 2397 2245 2156 1929 1876 1026 831 743 569 374 321 131 ------
NM_014766chr753791 3036 2616 2587 499 13665 12573 --
NM_014774chr142763 2626 1287 1188 ------
NM_014776chr1263003 2755 2043 1231 1175 615 --42344 2238 2033 1921 --
NM_014781chr821010 58 1365 ----
NM_014783chr1551708 1419 493 288 129 11158 ----
NM_014787chr182667 2309 1935 1767 1728 838 158 43 --12721 --
NM_014790chr52509 21 ------
NM_014791chr91279 ------
NM_014803chr1032227 685 572 32051 1812 178 ----
NM_014810chr162283 2272 1459 1437 1355 906 --194 132
NM_014812chr111673 11696 ----
NM_014819chr532400 1887 545 1102 22279 196 --
NM_014820chr332013 1813 419 11627 11271 --
NM_014824chr1142023 1698 1424 787 ------
NM_014827chr121639 594 --21494 1457 --
NM_014828chr1472456 2203 1981 1636 1539 962 198 22042 430 1838 --
NM_014832chr1342031 1692 437 31 --1739 --
NM_014836chr1041965 1530 636 606 11324 ----
NM_014839chr142453 1813 563 322 32483 2444 545 ----
NM_014840chr1243038 2850 1370 347 22879 614 41059 1029 768 554 --
NM_014850chr374779 4544 4260 3949 3907 3606 1012 13561 1226 --
NM_014857chr1--1226 ----
NM_014862chr1553562 1644 1201 465 421 --54135 3344 2877 442 382 --
NM_014873chr194776 4708 4643 4635 4565 3853 1618 1464 850 14017 ----
NM_014877chr17147273 6203 5794 5783 5357 5351 5091 2524 2113 1718 1639 1078 885 546 23019 738 26989 31 --
NM_014883chr442563 2442 2309 1625 12053 1739 11605
NM_014884chr19144 --1216 --
NM_014887chr132708 192 1554 ----
NM_014888chr731560 1377 240 1470 1545 --
NM_014892chr62618 234 ------
NM_014899chr562679 2336 1136 732 304 223 --12627 --
NM_014904chr1073924 3828 3482 3068 2979 2633 201 23280 1316 ----
NM_014905chr241747 1622 639 627 1262 11681 11417
NM_014906chr1753365 2629 1352 1092 423 2989 788 21445 1425 --
NM_014907chr9195 ------
NM_014912chr1023507 1329 23353 2769 23248 1051 --
NM_014915chr101903 51371 1292 1094 1044 145 ----
NM_014917chr11960 ------
NM_014918chr1541537 629 363 267 ------
NM_014923chr1341826 439 179 141 32261 459 427 1727 --
NM_014926chr331111 1026 26 1260 ----
NM_014927chrX--1109 ----
NM_014929chr21154 1109 ----
NM_014932chr362006 1793 1383 564 472 383 11755 ----
NM_014934chr1333957 3714 86 1682 ----
NM_014946chr243026 2649 891 464 22418 2314 ----
NM_014947chr183070 2991 2327 2196 1048 962 782 667 1113 31175 853 470 --
NM_014950chr1421146 1118 ------
NM_014951chr1032133 1861 1667 11802 ----
NM_014962chr2042890 2536 1777 64 ----12838
NM_014974chr1061701 1508 1268 1212 1121 304 ------
NM_014978chr1041596 1124 584 226 --1692 --
NM_014988chr422398 362 ------
NM_014990chr141851 ------
NM_014991chr432218 2029 1007 --13194 --
NM_014992chr144713 635 593 123 ------
NM_014996chr3149 ------
NM_014997chr742436 1825 560 76 2297 36 22123 762 12404
NM_014999chr123495 283 208 2538 160 11448 --
NM_015000chr1212823 ------
NM_015002chr1252256 1533 914 187 128 22214 2206 12024 --
NM_015008chr3103392 3245 2913 2594 1006 807 786 246 136 42 --12775 --
NM_015015chr1911557 11797 ----
NM_015017chr141290 1056 875 484 1953 1273 --
NM_015018chr61160 ------
NM_015020chr1653290 2757 2489 370 156 13711 43231 3038 1456 1423 --
NM_015024chr841174 1045 516 432 ------
NM_015025chr292240 2087 1827 566 548 351 335 242 41 --12417 --
NM_015026chr1264140 4018 1243 1052 575 46 34239 1201 569 ----
NM_015027chr16--1773 11383 --
NM_015032chr13102819 2506 2194 2169 2060 1929 1103 602 299 281 ----1877
NM_015039chr144369 3546 3436 908 ------
NM_015040chr213084 21058 450 12125 --
NM_015045chr1031401 879 35 1816 1426 --
NM_015046chr972189 1885 1868 801 658 520 242 2862 386 1290 --
NM_015051chr943221 2905 2202 2091 13258 ----
NM_015052chr73869 342 305 ------
NM_015054chr122428 125 1474 ----
NM_015055chr1152924 2534 2257 872 801 --12710 --
NM_015056chr2172388 2355 2015 334 132 71 45 --11964 --
NM_015057chr133674 539 58 ------
NM_015068chr733351 702 408 ----13544
NM_015071chr596406 6321 6252 6204 5315 4066 2014 1488 1033 1494 66083 5510 4766 4333 2259 136 --
NM_015074chr184145 3197 1512 1500 1482 1373 995 242 13106 34272 850 783 --
NM_015076chr674416 3653 2999 2786 1706 1497 378 ----11468
NM_015077chr1754421 1774 1725 1077 462 14104 11005 --
NM_015090chr163838 2455 2143 1847 1323 575 ------
NM_015091chr141662 ----1845
NM_015092chr1654593 3335 1303 761 323 --24265 3696 --
NM_015093chr651595 1543 1490 1396 1194 1135 11466 --
NM_015097chr32810 339 --1356 --
NM_015100chr111345 2441 346 11509 --
NM_015115chr452971 2822 2510 2133 829 12702 23076 2365 --
NM_015122chr191208 ------
NM_015124chr2222525 433 ----12322
NM_015130chr4--1352 11035 --
NM_015132chr731813 1611 535 ------
NM_015134chr172615 141 ------
NM_015138chr1532717 1081 927 12857 12796 --
NM_015143chr431429 1317 1283 ----11447
NM_015144chr1652934 2811 2711 2450 510 21373 1358 33985 2591 918 --
NM_015149chr112128 --11427 --
NM_015155chr1072852 1079 1056 568 508 485 325 11226 ----
NM_015156chr1483838 3774 3699 3482 3039 2590 1499 714 --23906 2549 --
NM_015158chr92815 79 1688 ----
NM_015161chr16--186 ----
NM_015170chr832038 1687 1488 --11752 --
NM_015172chr131095 287 69 --11179 --
NM_015173chr421544 1251 --21734 672 --
NM_015176chr14671 494 475 272 ------
NM_015184chr33532 476 153 ------
NM_015185chrX63001 2985 2838 2597 780 586 --12272 --
NM_015186chr92439 118 --133 --
NM_015192chr2032786 2500 218 --12058 --
NM_015197chr1473097 2098 819 787 552 239 130 ------
NM_015199chr342501 2466 623 566 1124 12252 --
NM_015200chr431701 865 631 22579 2365 ----
NM_015206chr1563650 3274 1034 863 447 129 13768 23416 2528 --
NM_015208chr1853240 1627 1218 1100 43 13733 11537 --
NM_015209chr132305 858 815 11824 ----
NM_015213chr111680 ------
NM_015215chr143157 3127 2528 2081 --33168 438 183 --
NM_015216chr561465 1423 989 169 157 92 1308 ----
NM_015225chr912838 11129 2671 27 --
NM_015247chr1685366 4684 4441 1475 1152 1143 350 134 11013 ----
NM_015250chr922004 193 --21826 530 --
NM_015263chr1541041 960 339 166 11184 11078 1846
NM_015265chr212588 12296 ----
NM_015267chr123728 709 376 2588 123 1413 --
NM_015268chr32677 636 ------
NM_015271chr4124142 3872 3822 3761 3704 3547 3274 2655 1702 1148 806 139 21496 754 24231 3896 --
NM_015272chr1632088 424 43 21961 528 ----
NM_015275chr1221367 141 ------
NM_015278chr652516 2424 1306 399 59 --22642 290 --
NM_015285chr1842326 1941 686 396 --12544 --
NM_015293chr6129 ----1652
NM_015296chr131949 --1180 --
NM_015308chr111715 195 ----
NM_015310chr8178249 6947 6107 5997 5622 5144 3033 2882 2526 2453 2163 2127 2033 655 508 488 25 17499 16342 --
NM_015313chr1174617 4422 4125 1667 1619 973 85 ------
NM_015314chr742398 1581 326 182 ------
NM_015315chr522898 2491 ------
NM_015317chr272501 2026 1854 1790 1109 1074 253 12777 ----
NM_015326chr173015 2920 2825 2747 2512 1023 842 11825 ----
NM_015330chr2272608 2584 2436 2404 1675 827 300 ------
NM_015336chr1271856 760 608 582 557 478 347 21953 391 22196 2079 --
NM_015344chr832077 1803 84 2485 318 1670 --
NM_015347chr1242506 2399 2148 1149 --2842 698 --
NM_015349chr653053 2940 679 668 273 --1739 --
NM_015355chr1741985 1861 1719 1228 1671 ----
NM_015358chr2131349 510 240 1411 ----
NM_015359chr852938 657 323 260 161 --21843 635 --
NM_015365chrX23459 3182 34327 2975 2694 ----
NM_015375chr164745 4718 3711 3063 992 261 ------
NM_015379chr72256 57 ------
NM_015380chr22--1135 ----
NM_015382chr141804 ------
NM_015385chr1022547 401 ------
NM_015393chr453646 3011 2856 1026 52 43698 3676 3574 2691 32338 1367 523 --
NM_015396chr3--1525 ----
NM_015423chr11170 1305 21618 528 --
NM_015429chr33921 909 805 1709 ----
NM_015435chr851399 1233 1125 938 925 ------
NM_015446chr151651 1590 1484 1261 601 ----1244
NM_015455chr5124140 3906 3829 3558 3298 3097 3084 2920 2520 1549 1054 814 ------
NM_015458chr895223 4886 4832 4795 4450 3364 1204 793 432 15348 14991 --
NM_015460chr331552 1404 446 --11701 --
NM_015461chr181716 ------
NM_015464chr73893 724 214 1669 ----
NM_015488chr241787 1630 1500 1116 --1607 --
NM_015497chr154888 853 817 306 ------
NM_015508chr321252 145 2285 136 ----
NM_015509chr1231612 1183 592 ------
NM_015520chr362576 2330 2027 946 677 622 11131 --12800
NM_015525chr631023 799 152 1980 ----
NM_015534chr1--1693 ----
NM_015535chr283916 3704 3093 1671 927 558 545 202 1354 ----
NM_015550chr7103621 3426 3220 2883 2803 2541 988 877 580 202 32402 1373 180 1264 --
NM_015553chr684924 4582 4084 1969 786 674 557 394 34364 3974 3806 34281 1183 455 1325
NM_015554chr1552760 2317 694 239 213 ------
NM_015555chr641821 1667 1552 550 1372 ----
NM_015564chr52236 197 13294 ----
NM_015565chr213884 646 192 22289 2137 ----
NM_015569chr154741 4427 4239 3065 1581 1449 1837 --
NM_015570chr71161 11466 1616 --
NM_015571chr662539 2353 1796 1770 114 83 ------
NM_015576chr392738 2663 1906 985 725 342 323 308 264 --12689 --
NM_015577chr571731 1694 1656 1575 1299 1135 275 --21127 363 --
NM_015578chr1941998 1904 1563 815 ------
NM_015602chr151701 1688 1262 229 121 31396 1377 594 ----
NM_015626chr1741209 1190 823 798 ------
NM_015627chr131877 500 290 ------
NM_015630chr2163 --11102 --
NM_015635chr931554 1463 385 12118 --11950
NM_015640chr195347 4868 4821 4016 3933 3733 1682 1445 744 ------
NM_015642chr32255 93 ------
NM_015646chr1251307 1292 1086 983 289 21319 1153 ----
NM_015670chr172303 131 ------
NM_015678chr1331287 500 49 ------
NM_015693chr41325 1262 ----
NM_015833chr2132388 2204 396 ------
NM_015850chr862316 1637 933 790 725 448 --11850 --
NM_015852chr7172658 1248 1239 1158 1074 990 906 822 676 654 570 486 402 318 234 150 66 23541 806 ----
NM_015878chr842199 1481 876 455 2821 407 ----
NM_015879chr18168615 8573 8393 8155 8105 7487 6960 6801 5674 3342 3336 3194 3160 1122 630 88 12968 27956 225 --
NM_015885chr11----1798 --
NM_015886chr8134584 4544 4472 4056 3647 3640 3576 3497 1862 1665 1620 1370 961 --1716 --
NM_015888chr153229 2966 1219 525 310 22717 705 --22957 2945
NM_015891chr631400 712 103 1190 --11535
NM_015902chr84867 818 306 92 ------
NM_015904chr21144 ------
NM_015906chr1114769 4760 4588 4310 4195 3334 3138 1714 1431 1105 1059 13074 1809 --
NM_015912chr872017 1980 1694 1631 838 561 32 --21818 983 --
NM_015941chr81399 1129 ----
NM_015975chrX41357 1214 708 230 11807 11608 --
NM_015986chr1731453 462 168 ------
NM_015990chr42986 262 3758 385 289 --11062
NM_016009chr164939 4606 4367 3944 3733 808 --2483 205 11431
NM_016018chr842592 622 223 28 --1546 --
NM_016023chr832141 1630 318 21723 84 ----
NM_016025chr1631855 770 471 --1176 --
NM_016040chr122530 1788 12508 ----
NM_016048chr52970 819 1103 ----
NM_016061chr211232 1357 ----
NM_016070chr17190 --155 --
NM_016071chr7187 ------
NM_016072chr1251907 1687 965 247 104 --12314 --
NM_016073chr1531091 980 402 ------
NM_016075chr1372621 2578 1204 637 610 409 202 1956 ----
NM_016083chr663614 3411 3299 3005 1337 155 13354 12915 --
NM_016087chr741622 1506 1376 211 11076 --11396
NM_016093chr52174 78 ------
NM_016097chr182935 168 ------
NM_016103chr51516 1194 ----
NM_016106chr14138 ------
NM_016121chr13925 913 743 1391 ----
NM_016125chr174496 190 121 101 ------
NM_016131chr221989 606 ------
NM_016132chr1543438 2484 1368 724 1145 ----
NM_016133chr251351 1318 551 519 100 21559 328 1372 --
NM_016169chr1042823 2463 572 409 --23118 2453 --
NM_016179chr13270 51 192 ----
NM_016203chr77979 968 952 431 332 234 96 ------
NM_016205chr431457 1386 249 ------
NM_016206chr3178812 7967 7946 7863 7436 7133 6985 6672 5963 3239 3003 2405 963 596 538 529 353 --38351 7154 6396 --
NM_016217chr653254 1322 1219 544 427 22416 362 23598 3414 --
NM_016220chr761616 485 405 321 153 68 --11863 --
NM_016224chr682029 1618 1606 1552 1495 735 550 26 ------
NM_016230chr61139 1448 --1463
NM_016231chr1721216 616 1161 ----
NM_016248chr1373634 2967 1604 1395 1032 656 326 1959 12837 --
NM_016252chr21709 --2312 301 --
NM_016255chr643043 913 632 157 11195 ----
NM_016258chr11600 1283 1728 --
NM_016260chr2127517 6545 6408 6083 2522 2449 2200 2068 2043 1386 445 89 --11773 --
NM_016269chr411004 ----1288
NM_016271chr18--21521 455 ----
NM_016277chr671632 1578 1512 526 295 159 148 ----1254
NM_016284chr161220 --1893 --
NM_016287chr131506 765 83 11540 ----
NM_016289chr242112 1849 930 371 --2891 790 1833
NM_016297chr223173 2714 --33709 2848 669 --
NM_016308chr121268 710 --11967 --
NM_016312chr122578 211 ------
NM_016315chr21100 11431 ----
NM_016316chr24224 83 48 23 ------
NM_016322chr952650 2496 2349 2299 298 12056 ----
NM_016333chr16134 1176 ----
NM_016338chr511111 1454 ----
NM_016356chr652806 2781 2588 1986 642 12833 --12763
NM_016374chr121497 1064 11349 ----
NM_016374chr121497 1064 11349 ----
NM_016376chr1773805 3238 3170 1684 1089 1061 668 --31752 1098 766 --
NM_016377chr621435 467 2650 413 31396 1329 187 --
NM_016395chr153776 603 318 195 1637 --
NM_016396chr1522507 40 ------
NM_016422chr1153044 2342 768 725 64 12538 --12621
NM_016426chr2231980 530 432 --2770 573 --
NM_016436chr2042666 858 809 94 ------
NM_016451chr111224 --1203 --
NM_016472chr1441421 1209 993 300 --21376 45 --
NM_016475chr1451231 1069 796 125 38 ------
NM_016480chr51151 1572 ----
NM_016481chr92209 78 ------
NM_016488chr1231944 1828 333 ------
NM_016507chr1742264 993 545 291 --13030 --
NM_016512chr81223 ------
NM_016516chr23349 180 69 --1323 --
NM_016530chr1524122 3469 24068 396 23195 1634 --
NM_016531chr452910 1192 1057 348 214 12947 13614 1246
NM_016542chrX31231 239 74 ------
NM_016562chrX21251 1042 ------
NM_016587chr72806 290 21070 724 ----
NM_016588chr61109 2814 193 ----
NM_016603chr521891 1603 22013 1922 11841 --
NM_016607chrX41616 1562 352 131 --11075 --
NM_016612chr84670 621 444 262 ------
NM_016613chr442306 2158 2088 546 --12631 --
NM_016620chr11929 --11035 --
NM_016623chr82434 61 ------
NM_016626chr183700 661 423 11364 21440 629 --
NM_016628chr102559 296 ------
NM_016631chr211891 --1197 --
NM_016644chr53468 382 190 ------
NM_016651chr14----2193 107 1165
NM_016652chr2081661 1608 1366 1129 575 513 146 23 ------
NM_016654chr153924 404 377 11430 ----
NM_016656chrX4131 89 81 52 ----1146
NM_016824chr1021749 1650 31918 1908 1880 1451 --
NM_016831chr162229 2159 1500 800 751 447 --1393 22172 106
NM_016836chr21626 1281 1673 --
NM_016839chr21626 1281 1673 --
NM_016929chr664380 3714 3097 1556 1091 344 13746 1627 --
NM_016937chrX6926 327 173 161 132 80 --1792 --
NM_016950chr421456 325 1259 --11334
NM_016952chr1193569 3145 3077 1390 818 487 360 189 144 ------
NM_016953chr274870 3714 1811 1598 969 434 114 1979 15556 --
NM_017410chr1241230 1180 1150 1048 1102 ----
NM_017412chr831295 1225 1211 ------
NM_017413chrX42061 1653 463 388 12544 --1817
NM_017415chr584325 4293 4131 3912 3080 2929 2890 519 ------
NM_017420chr1463637 3319 2816 2806 2407 1426 ------
NM_017426chr41507 ------
NM_017437chr1482253 2039 1679 1558 865 810 787 168 21735 1639 ----
NM_017439chr7--1399 ----
NM_017447chr21133677 3393 3380 3210 3141 1773 1671 1608 1508 1308 1175 1028 560 1430 24056 1153 --
NM_017452chr2031458 1311 476 --11101 --
NM_017453chr2031458 1311 476 --11101 --
NM_017454chr2031458 1311 476 --11101 --
NM_017455chr151184 1824 1233 --
NM_017488chr251470 1218 1137 597 173 --1648 --
NM_017514chrX1945 --1927 --
NM_017519chr61304 1378 ----
NM_017522chr121164 218 --1948 --
NM_017544chrX1945 162 ----
NM_017545chr202558 514 ------
NM_017563chr3126402 6366 4886 4847 4054 2063 1654 1279 1053 486 400 127 16298 11150 22512 1997
NM_017569chr131321 ------
NM_017572chr19--174 ----
NM_017580chr1021650 1625 22154 1716 1598 --
NM_017582chr171753 1587 1542 1466 1221 682 461 --161 11448
NM_017583chr1131321 1204 632 --11703 --
NM_017593chr42415 49 ------
NM_017610chr1511310 31710 1687 145 1116 --
NM_017628chr4115322 4223 3549 1521 1319 951 899 431 416 182 75 13412 21354 471 1769
NM_017629chr131938 685 55 ------
NM_017632chr42455 443 --1408 --
NM_017633chr652894 1552 1531 1130 529 23883 3574 ----
NM_017634chr831686 581 42 ------
NM_017637chr9138534 8053 7806 7565 7086 6434 6122 5758 3036 2932 2824 1923 1555 37692 6944 739 17534 22282 1121
NM_017641chr12167 1424 133 --
NM_017643chr1732145 776 574 13144 ----
NM_017644chr3124787 4381 4324 3913 3715 3363 2013 1877 1723 1392 437 429 24502 4252 15064 14641
NM_017645chr973164 3040 2771 2747 2729 2647 2146 22722 766 ----
NM_017650chr786079 5529 5216 5090 2032 683 167 31 12325 25254 2298 --
NM_017651chr621620 1291 1415 ----
NM_017657chr22832 687 ------
NM_017658chr14124682 4641 4489 4456 3791 3398 3202 2976 1640 804 459 394 21076 1058 1433 --
NM_017661chr1531243 1179 500 156 11236 --
NM_017662chr951991 1746 1376 236 29 11914 ----
NM_017672chr153902 494 304 150 1959 --
NM_017673chr12849 109 ------
NM_017680chr91991 --1356 --
NM_017693chr1311391 ------
NM_017694chr231864 1710 360 ------
NM_017709chr193900 3106 3041 2988 2793 1730 1467 746 572 23125 358 21308 807 --
NM_017719chr342488 895 803 339 ------
NM_017724chr3129 1590 ----
NM_017737chr161874 889 872 578 293 118 11797 ----
NM_017742chr185634 309 256 173 167 11908 1544 --
NM_017745chrX1211 1476 ----
NM_017753chr92674 125 --1990 --
NM_017754chr6104999 4953 4864 4647 4567 3939 1686 671 105 85 11659 ----
NM_017758chr1731222 348 259 ------
NM_017761chr121531 1313 ------
NM_017769chr1473270 3056 2446 2409 2156 538 363 32790 1259 1216 ----
NM_017776chrX81141 1047 630 496 340 331 256 172 11331 1248 --
NM_017779chr172546 2381 1722 1101 472 424 66 ------
NM_017780chr85937 587 346 262 77 ------
NM_017794chr91316 ------
NM_017802chr72814 118 1579 ----
NM_017811chr972635 2044 1996 1193 837 413 206 1887 1305 --
NM_017813chr8105019 3596 1990 1886 1567 1484 1462 504 162 57 14288 ----
NM_017824chr1032501 2235 653 --1946 --
NM_017831chr1854356 3151 1155 443 53 1324 14614 --
NM_017848chrX94644 4595 4327 4032 3484 1140 933 878 90 13557 24540 3463 --
NM_017893chr1031381 1344 24 --1499 --
NM_017902chr10135720 4117 4089 4080 3923 3531 2211 1858 1742 1714 1167 457 326 ------
NM_017905chr131259 ------
NM_017909chr62379 64 ------
NM_017913chr92314 137 130 ----
NM_017919chr954054 3940 3619 3587 3556 34940 3711 376 13866 14255
NM_017922chr14----1538 --
NM_017923chr43843 750 665 --1281 --
NM_017925chr921200 186 21762 1213 121 --
NM_017933chr221318 589 ----1385
NM_017934chr6------1108
NM_017938chrX31750 1506 1424 1828 11545 --
NM_017943chr142375 340 --3853 831 809 --
NM_017952chr293457 3232 1653 1611 1089 730 566 398 327 24066 1268 1643 --
NM_017964chr21714 2194 103 ----
NM_017987chr1012200 12152 --149
NM_017988chr121309 ------
NM_018014chr231064 451 408 ------
NM_018015chrX1758 11117 ----
NM_018018chr1221178 727 31379 667 645 11693 187
NM_018023chr311972 ------
NM_018028chr1911365 11283 --1455
NM_018030chr182795 443 11106 21126 395 --
NM_018036chr14104394 4002 3766 3666 3535 3387 3103 1397 848 203 --1569 --
NM_018043chr1141466 1347 1070 431 --1299 --
NM_018048chr1241764 1554 724 87 11327 ----
NM_018060chr11330 ------
NM_018061chr11279 21681 1560 --1422
NM_018063chr101464 ------
NM_018064chr61270 ------
NM_018078chr44973 850 356 207 ------
NM_018084chr283178 2973 2545 2097 2081 484 465 401 13146 ----
NM_018085chr167586 5951 5919 5732 1349 841 13210 37447 5023 185 13036
NM_018086chr271793 1713 1667 1389 1212 665 607 1715 2226 35 --
NM_018087chr1163 ------
NM_018089chr21209 ------
NM_018105chr811049 ------
NM_018112chr9--1286 ----
NM_018117chr101702 --1215 --
NM_018120chr831291 1215 1034 11196 ----
NM_018121chr1053180 2303 2286 1172 95 --21229 480 --
NM_018126chr431240 533 266 11604 ----
NM_018128chr173928 459 427 ------
NM_018131chr103935 636 222 ------
NM_018132chr62584 42 ------
NM_018133chr351701 1501 840 636 423 --1590 --
NM_018147chr33255 209 100 ------
NM_018151chr21719 ------
NM_018155chr353275 2816 758 685 572 12909 ----
NM_018157chr1233150 2552 2343 ------
NM_018159chrX21054 600 ------
NM_018164chr121253 ------
NM_018178chr152047 2018 1533 580 342 ------
NM_018181chr1821941 1379 --1681 --
NM_018184chr361973 1769 1725 864 604 510 ------
NM_018191chr1342099 1427 463 441 --132 --
NM_018211chr162205 1873 759 599 502 262 ------
NM_018227chr442266 723 353 51 --12818 2880 241
NM_018237chr10----170 --
NM_018243chr463214 3014 1334 1295 638 436 1328 2201 155 --
NM_018247chr692865 2762 2528 2207 1244 846 618 499 246 --3722 690 72 --
NM_018254chr16655 564 473 239 183 55 21566 854 ----
NM_018287chr10157 --1235 --
NM_018290chr421279 483 11318 ----
NM_018293chr332784 2213 662 22443 554 12140 12869
NM_018299chr823032 1141 12161 --11016
NM_018302chr462316 2004 1805 1628 783 71 --22176 1591 --
NM_018307chr172732 337 --159 --
NM_018313chr332308 663 563 --12545 --
NM_018318chr123905 813 387 1381 1836 --
NM_018323chr441315 460 383 136 1197 1341 --
NM_018325chr941591 1364 1208 1096 11544 ----
NM_018327chr2031452 576 511 --11572 --
NM_018328chr21517 --1185 --
NM_018330chr1031610 1273 1147 --1550 --
NM_018339chr921237 135 11656 11839 --
NM_018340chr1683808 3270 3259 1960 871 815 595 277 ------
NM_018351chr1234221 1699 419 34735 3134 894 11722 --
NM_018362chr1143629 3431 1563 294 33946 1328 504 ----
NM_018364chr164088 4021 3568 1375 1083 756 ----11171
NM_018368chr6131 --1237 --
NM_018370chr1272237 2194 1906 570 183 102 33 22290 57 11555 11870
NM_018373chr1456337 5466 1968 1746 1093 14199 ----
NM_018374chr794738 4442 3537 3183 1583 1070 1012 923 647 15185 1375 --
NM_018387chr9------156
NM_018393chr112205 68 ------
NM_018400chr11154518 4377 4071 3736 3471 2985 1779 1768 1619 1534 1500 1344 1261 1048 343 --14469 13052
NM_018403chr343246 1365 736 556 33747 3582 794 1140 --
NM_018409chr452404 2112 2021 772 440 135 13244 --
NM_018412chr71124 ------
NM_018416chr1222560 153 1408 12657 --
NM_018425chr1062475 2114 2083 1748 599 380 --1184 --
NM_018429chr5--22065 889 1309 --
NM_018438chr12493 167 ------
NM_018440chr887424 6470 5785 5675 3173 1526 954 734 35927 2864 1705 68313 7990 6581 3318 2269 1901 --
NM_018442chr13325 294 30 ------
NM_018448chr122318 106 1334 ----
NM_018452chr6_random53856 2605 2375 1334 28 12333 ----
NM_018469chr1721002 445 --11037 --
NM_018475chr41650 ------
NM_018489chr142227 1992 1847 1545 12012 ----
NM_018490chr111429 1281 ----
NM_018553chr1761800 1771 742 660 328 158 ------
NM_018557chr231248 1145 235 11592 ----
NM_018566chr195127 4974 4351 4086 1850 1578 1022 761 103 13727 14095 21420 700
NM_018569chr461485 1160 594 543 123 61 21392 44 ----
NM_018571chr21463 ------
NM_018584chr14931 814 498 446 --11003 --
NM_018590chr1031483 343 169 11702 21138 1105 --
NM_018602chr152197 48 ------
NM_018638chr12145641 5282 5210 4282 3868 3699 2243 2127 1884 1706 1537 844 745 39 65234 3758 1807 1698 756 721 ----
NM_018640chr1231854 1733 1116 --22726 190 --
NM_018650chr161774 616 351 335 323 63 ------
NM_018652chr15------1176
NM_018657chr33571 158 139 ------
NM_018684chrX11282 ------
NM_018686chr12--192 ----
NM_018689chr1542556 2310 714 224 --12304 --
NM_018693chr2187 ------
NM_018695chr52896 423 1990 ----
NM_018704chr131692 523 414 12170 --21598 488
NM_018710chr841348 1161 972 151 ------
NM_018715chr142251 2123 1762 216 ------
NM_018718chr752313 2126 1736 1552 31 --22332 646 --
NM_018834chr5--159 --11041
NM_018840chr20122 --1469 --
NM_018841chr173619 3574 2640 1461 957 792 112 --11152 --
NM_018844chr71451 11364 21432 1336 --
NM_018847chr931667 671 223 ------
NM_018898chr542283 1529 810 437 --11836 11483
NM_018899chr542283 1529 810 437 --11836 11483
NM_018900chr542283 1529 810 437 --11836 11483
NM_018901chr542283 1529 810 437 --11836 11483
NM_018902chr542283 1529 810 437 --11836 11483
NM_018903chr542283 1529 810 437 --11836 11483
NM_018904chr542283 1529 810 437 --11836 11483
NM_018905chr542283 1529 810 437 --11836 11483
NM_018906chr542283 1529 810 437 --11836 11483
NM_018907chr542283 1529 810 437 --11836 11483
NM_018908chr542283 1529 810 437 --11836 11483
NM_018909chr542283 1529 810 437 --11836 11483
NM_018910chr542283 1529 810 437 --11836 11483
NM_018911chr542283 1529 810 437 --11836 11483
NM_018947chr774984 4709 3072 1811 1122 293 267 14887 ----
NM_018955chr17--1121 ----
NM_018964chr2111053 ------
NM_018970chr721930 302 32129 735 296 ----
NM_018976chr1261889 1074 814 349 135 82 12311 --12856
NM_018979chr1252454 838 698 569 98 22370 1699 2135 48 --
NM_018999chr1074937 4780 4567 4251 3715 3140 181 33428 3235 1319 24168 3347 --
NM_019000chr5--11431 ----
NM_019001chr3124865 4800 4742 4478 3694 1741 1358 1096 1063 910 452 87 21706 1415 ----
NM_019002chr2198 1279 ----
NM_019003chrX167 ------
NM_019004chr71808 --32386 2046 667 --
NM_019015chr7--1120 ----
NM_019026chr12241 181 ------
NM_019027chr441945 1869 812 474 ----1115
NM_019045chrX1643 ------
NM_019050chr442215 2155 1647 1465 1793 --12240
NM_019063chr232329 2125 803 ------
NM_019072chr574086 3765 2914 2902 1542 651 556 33515 545 510 1674 --
NM_019084chr1061995 1649 1619 375 349 233 21988 993 --22591 775
NM_019087chr51618 ------
NM_019091chr23818 753 221 --1114 --
NM_019094chr1283610 3363 3280 3229 1495 1285 1009 147 13758 ----
NM_019096chr631112 797 218 ------
NM_019106chr2243301 2786 2287 357 13327 23141 3131 --
NM_019114chr942375 1789 1747 1551 ------
NM_019116chr1643005 2987 1410 1121 ------
NM_019117chrX53345 2675 1292 818 812 32233 1040 280 ----
NM_019555chr32626 576 --21790 1773 --
NM_019590chr1021236 83 1117 ----
NM_019592chr9----2869 632 --
NM_019593chr2052943 2589 2474 2373 659 32552 644 269 12398 11166
NM_019610chr132112 1611 560 2521 227 12182 --
NM_019857chrX21422 632 11611 11520 --
NM_019859chr1051592 1283 1012 401 87 1199 ----
NM_019860chr1051640 1331 1060 449 135 1247 ----
NM_019903chr1021749 1650 31918 1908 1880 1451 --
NM_020066chr11748 ------
NM_020116chr42522 480 11430 11799 --
NM_020119chr783871 3615 2829 2556 997 831 302 29 32941 873 518 --11221
NM_020122chr244049 1960 1660 1296 11040 25143 4528 --
NM_020123chr1021350 212 --11256 1371
NM_020132chr2164676 4329 3736 3694 3442 73 14208 21260 897 --
NM_020133chr695648 4379 4067 2384 2312 2101 1880 455 405 21207 1187 ----
NM_020141chr152087 1854 1617 563 241 1825 1466 12246
NM_020144chr712014 ------
NM_020148chr1833068 712 536 --22589 158 --
NM_020156chr71523 ------
NM_020159chr43464 407 299 11345 ----
NM_020178chr1751186 1105 1090 962 69 140 ----
NM_020193chr1161246 1013 891 850 374 189 --1327 --
NM_020199chr52440 70 1292 ----
NM_020204chr12857 630 ------
NM_020205chr142270 1399 876 105 13353 22343 153 --
NM_020207chr941348 1270 847 831 ------
NM_020238chr114926 863 809 255 ----1289
NM_020245chr683604 3459 3255 1946 1126 990 366 296 31891 1627 1162 --1251
NM_020337chr432877 1236 111 --12637 --
NM_020341chr2032064 1779 1698 --11274 --
NM_020342chr242618 2561 2289 428 --1939 137
NM_020346chr1131741 1197 599 ------
NM_020348chr1062475 1798 912 877 668 323 1407 2975 109 --
NM_020357chr311649 1449 ----
NM_020361chr81284 --1255 --
NM_020362chr11736 ------
NM_020390chr384723 4072 3667 3645 3269 1183 968 849 14814 ----
NM_020403chr1351809 1135 590 576 150 11355 ----
NM_020420chrY41824 1606 680 48 ----1335
NM_020425chr61401 51349 807 796 757 726 ----
NM_020429chr732989 2576 2490 --11957 --
NM_020432chr762191 1977 1747 1659 1471 567 ------
NM_020440chr142510 2434 2265 392 13294 ----
NM_020443chr146469 5997 936 539 26203 1661 15218 --
NM_020455chr692841 2777 2107 756 606 569 458 250 67 ------
NM_020456chr1372314 1945 1891 1680 704 116 47 ------
NM_020463chr2142 21491 1140 ----
NM_020465chr1642015 1691 1480 144 --11895 --
NM_020466chr674919 3494 3142 1759 707 251 188 --14021 --
NM_020473chrX31435 708 597 --1585 --
NM_020474chr1821808 98 11558 31678 1579 671 --
NM_020532chr24919 813 801 605 ------
NM_020640chr361674 1521 1427 826 343 24 1764 1873 --
NM_020647chr831969 1829 475 1751 31631 603 202 --
NM_020651chr231126 702 305 --1445 --
NM_020654chr341623 1528 1171 391 21112 560 1302 --
NM_020673chr2077573 7269 6227 5479 2468 1743 813 17790 27455 1792 --
NM_020676chr31744 ------
NM_020689chr2031360 1270 660 --11571 --
NM_020697chr841171 537 323 253 ----1288
NM_020698chr1233038 2977 2382 --42272 2167 2086 745 --
NM_020699chr1105321 4793 4607 3937 3314 2029 1587 1419 1173 576 11983 11602 --
NM_020708chr2032469 2180 686 --12456 12097
NM_020711chr252436 2076 2051 651 315 12542 --1923
NM_020713chr2033168 2682 268 ------
NM_020718chr16126291 5957 5821 5636 5597 4668 4635 4394 2115 1985 1821 565 24652 4295 ----
NM_020727chr2194016 3727 3709 3379 3072 2641 2633 2602 244 13964 12444 --
NM_020728chr732227 900 661 3846 546 83 12102 --
NM_020732chr61304 1378 ----
NM_020734chr1262700 2187 1286 1046 786 79 1876 195 --
NM_020739chr1554232 3506 3338 2568 1687 24050 596 11185 --
NM_020742chrX----1114 --
NM_020747chr52813 161 --1917 --
NM_020748chr1761717 1710 1442 823 803 401 12063 ----
NM_020749chr862113 2041 2019 2011 1998 359 ----11581
NM_020754chr33457 414 367 --1260 --
NM_020762chr124860 371 258 138 ------
NM_020766chrX34310 3963 1693 --23402 1748 14200
NM_020771chr641459 1357 1149 115 31244 1021 234 11327 --
NM_020772chr17128465 8387 7763 6550 6122 5712 5533 5462 3189 2693 2565 304 --37450 2018 536 16221
NM_020774chr1835513 4157 1338 35218 2132 2019 25436 4036 --
NM_020776chr1853053 2637 2015 737 345 ------
NM_020778chr1564975 4719 3336 1267 1059 836 ----11943
NM_020782chr12104790 4626 4063 3456 3379 2957 1436 1100 890 659 23702 1815 ----
NM_020794chr1146 1160 11195 --
NM_020800chr311455 ------
NM_020801chr542495 2044 1898 338 12468 --1873
NM_020802chr1142669 2257 1107 326 12569 13272 --
NM_020803chr441965 572 556 268 1118 ----
NM_020805chr1841929 1905 1257 640 ------
NM_020806chr142657 645 2786 260 ----
NM_020808chr141140 290 236 212 1445 11054 --
NM_020809chr1152141 2127 1483 898 695 --1422 --
NM_020810chr1462828 2235 1299 915 839 486 23463 2467 --12673
NM_020819chr66991 841 766 149 81 48 ------
NM_020824chr101645 ------
NM_020825chr1653856 3827 3680 2755 718 ------
NM_020830chr223017 2699 23231 3159 1330 --
NM_020841chr1263797 3606 1609 1346 870 244 43638 2619 377 352 ----
NM_020843chr15--1391 1170 --
NM_020854chr1821571 1549 --21177 569 --
NM_020858chr1532224 1839 809 ------
NM_020859chr4113673 3600 3460 3396 3048 1393 991 973 791 340 66 --33835 2722 198 --
NM_020860chr431148 129 99 ------
NM_020861chr63992 512 185 ------
NM_020868chr231974 746 89 1701 21684 770 --
NM_020871chrX32490 2190 1016 32129 901 806 --12443
NM_020872chr351153 708 424 247 56 2519 367 ----
NM_020873chr32308 291 --1558 --
NM_020888chr1--11935 11548 --
NM_020899chr1732201 1764 335 ----11670
NM_020917chr1963605 3398 2918 1181 1117 198 11563 22638 1440 --
NM_020918chr1083604 3269 2675 2485 610 533 434 390 23528 1308 12752 --
NM_020922chrX41598 633 414 215 21635 1570 1277 --
NM_020925chr131349 1296 403 1926 2330 50 --
NM_020927chr1642237 1563 90 24 11746 ----
NM_020935chr211852 23199 1274 22887 161 1972
NM_020940chr1072700 1846 1835 645 390 180 170 12785 ----
NM_020948chr153689 2256 1300 1075 991 11407 ----
NM_020952chr93815 277 124 ------
NM_020958chr142304 131 ------
NM_020977chr431777 1728 567 11844 1382 --
NM_020981chr21647 1660 --1164
NM_020987chr1031058 1040 537 ----11028
NM_020988chr1611018 --21362 176 --
NM_020993chr1222592 1767 --12683 --
NM_021003chr142549 308 ------
NM_021007chr262153 1931 1885 1792 1709 717 ------
NM_021032chr32821 425 11428 --11530
NM_021033chr1373102 3017 2475 2243 1407 568 89 ----13068
NM_021038chr353187 1206 1108 1075 585 12236 ----
NM_021047chr196498 285 201 120 38 29 ------
NM_021069chr41635 --1425 --
NM_021072chr532366 904 549 1706 ----
NM_021078chr17135 ------
NM_021083chrX63066 3055 2400 1111 1038 644 33612 3523 3077 13401 --
NM_021090chr2294627 4586 4448 4375 3269 1962 1831 831 137 24761 419 21466 652 13645
NM_021097chr273036 2711 2098 1171 1063 579 330 ------
NM_021098chr161692 ------
NM_021111chr951306 1263 1122 947 225 1188 125 --
NM_021116chr799026 7899 7159 6587 5813 2221 1333 1059 996 49015 7651 7347 3480 28790 45 --
NM_021120chrX72669 2369 1060 901 722 645 408 197 12594 --
NM_021132chr1021023 518 ------
NM_021136chr142739 39 1753 1769 --
NM_021140chrX1835 ------
NM_021144chr91480 --1143 --
NM_021159chr441695 537 368 260 11454 ----
NM_021161chr141542 ------
NM_021165chr12777 281 ------
NM_021174chr82637 246 ------
NM_021183chrX32033 464 65 --1203 --
NM_021189chr11141 ------
NM_021191chr1232424 2276 565 1426 --1497
NM_021205chr142605 2487 2254 1932 32887 1116 712 12871 --
NM_021215chr2032109 2038 779 ------
NM_021229chr122125 118 1358 ----
NM_021237chr31100 ------
NM_021238chr1251595 1515 487 447 127 --1474 --
NM_021239chr143539 527 481 ------
NM_021240chr91214 1246 1221 --
NM_021252chr103825 570 523 1169 ----
NM_021253chr621165 474 147 --1920
NM_021255chr1453499 3139 1361 1063 86 1262 11258 --
NM_021572chr62936 853 ------
NM_021622chr1052117 1976 1751 341 315 1373 1923 --
NM_021627chr31292 ----1460
NM_021629chr3115115 5085 4925 4508 4304 3864 2037 1673 1540 598 294 2899 52 ----
NM_021632chr191361 ------
NM_021633chr151290 1234 895 218 81 ------
NM_021638chr474695 4679 4083 1462 1183 677 621 24092 3095 --1269
NM_021639chr11581 ------
NM_021643chr231892 1378 634 11540 11596 --
NM_021644chr102161 111 11111 ----
NM_021647chr474751 4649 4529 4400 4022 3285 2981 13839 23348 1461 --
NM_021648chr622523 1062 ------
NM_021738chr102551 175 ------
NM_021785chrX2357 304 ------
NM_021813chr6115674 5129 4958 4793 4729 4509 3879 3618 2124 2107 1139 1581 35039 3659 365 --
NM_021814chr641549 682 390 71 ------
NM_021815chr232907 2353 107 32505 1071 225 ----
NM_021818chr1451486 1275 1157 1016 91 11496 ----
NM_021828chr101317 ------
NM_021911chr515598 11468 21377 253 14801
NM_021913chr1971718 1540 1422 1259 675 462 319 1378 ----
NM_021914chr1452308 1696 544 341 219 1895 11645 --
NM_021925chr231836 1365 74 11708 11453 1423
NM_021940chr64477 435 415 308 1657 21252 592 --
NM_021943chr621585 744 149 ----
NM_021954chr1333596 1002 170 32783 2691 899 ----
NM_021956chr631500 1138 512 11097 165 1254
NM_021958chr11339 ------
NM_021961chr11137257 7164 6090 5579 5036 4937 4712 2436 1957 1925 879 624 543 27362 602 25635 1583 --
NM_021962chr175980 675 595 245 143 12523 ----
NM_021963chrX--1297 1172 --
NM_021964chr386413 6381 4805 4733 4506 2225 1393 846 46183 5226 4517 1716 21340 82 16157
NM_021970chr42660 614 1713 ----
NM_021979chr14--1398 ----
NM_021998chrX31307 363 326 11490 ----
NM_021999chr131563 ------
NM_022037chr22897 186 ------
NM_022041chr1682573 2411 2377 2258 1711 1029 138 21 1509 ----
NM_022044chr22----1115 --
NM_022048chr15125934 5862 5627 5393 5289 5166 4763 4704 2162 1473 1147 1024 13951 16411 --
NM_022051chr11718 ------
NM_022062chr1131958 1613 1580 11915 ----
NM_022068chr18--2191 31 ----
NM_022080chr2072101 995 982 933 367 302 76 ----12388
NM_022100chr11499 1131 1266 --
NM_022114chr174757 4716 4636 4301 3061 2971 691 23073 1511 14073 --
NM_022118chr131239 ------
NM_022123chr14----1623 --
NM_022124chr101623 1244 ----
NM_022138chr651446 1348 1113 1039 261 ------
NM_022154chr431257 429 180 ------
NM_022166chr1696308 6094 5646 5301 4701 2427 2051 2022 968 15262 26075 5426 --
NM_022173chr22897 186 ------
NM_022343chr941041 1023 363 354 11079 ----
NM_022351chr81225 33872 3497 219 ----
NM_022368chrX1309 ------
NM_022373chr72947 673 ------
NM_022443chr3----1135 --
NM_022456chr12127257 6534 4689 3070 2417 1502 1267 1222 1163 334 282 224 1272 47593 7235 6011 1822 --
NM_022458chr742400 2346 2217 395 33050 2715 329 ----
NM_022459chr13146365 6050 5393 5346 4709 4448 2497 2341 2076 1650 1549 957 773 487 14527 34080 2405 2282 --
NM_022473chr1534370 3072 858 2575 217 --13234
NM_022474chr1442692 2678 1748 810 22480 885 ----
NM_022475chr4----1467 1556
NM_022476chr161778 1281 ----
NM_022483chr51785 21196 490 1547 21962 1641
NM_022484chr741439 888 369 208 --1261 --
NM_022491chr1233500 3225 552 2700 88 1169 --
NM_022495chr14137 --1507 --
NM_022566chr151124 1633 ----
NM_022572chr241787 1630 1500 1116 --1607 --
NM_022574chr751961 1780 1436 1393 881 ------
NM_022648chr234574 4162 2845 ------
NM_022650chr52703 691 1281 1818 --
NM_022652chr1221152 30 ------
NM_022658chr1221297 1179 11239 ----
NM_022659chr82509 335 ------
NM_022716chr153020 2709 2157 1272 191 ------
NM_022735chr131922 1466 1233 --2619 250 --
NM_022739chr171789 --1264 --
NM_022745chr142595 975 869 807 --11872 12811
NM_022755chr952616 2085 1860 822 186 11955 31604 200 98 --
NM_022756chr141095 348 293 241 ------
NM_022757chr33730 244 61 1676 1962 --
NM_022763chr383208 2993 2944 2866 2708 1996 663 592 133 --12956
NM_022771chr121848 ------
NM_022776chr31129 11084 ----
NM_022781chr963255 2442 1294 997 525 408 --1928 --
NM_022783chr83526 315 159 1633 --1764
NM_022802chr1021226 341 11431 ----
NM_022826chr2187 2747 413 ----
NM_022828chr551756 1744 1626 671 56 ------
NM_022841chr1552776 2754 2558 804 686 ------
NM_022843chr1321286 32 --1539 --
NM_022845chr1632030 1955 1945 21377 624 ----
NM_022875chr52412 51 1460 ----
NM_022877chr52412 51 1460 ----
NM_022893chr262741 2525 2262 1038 727 261 11965 1169 --
NM_022894chr281738 1673 1524 1163 636 510 290 172 1458 --11404
NM_022897chr53409 261 96 ------
NM_022898chr1484759 4654 4045 4002 3981 3476 1600 1137 1386 161 --
NM_022900chr731095 1003 223 --11208 --
NM_022910chr1642015 1691 1480 144 --11895 --
NM_022912chr242612 2053 1951 994 12592 32801 2548 98 --
NM_022913chr51326 ------
NM_022918chr1161977 1559 1363 569 514 34 ----1482
NM_022965chr441351 991 621 301 ------
NM_022970chr1041468 1384 1027 526 11487 ----
NM_022977chrX82456 1850 758 589 447 338 306 91 --12271 --
NM_023000chr1431472 665 655 ------
NM_023001chr1431472 665 655 ------
NM_023015chr11808 ------
NM_023016chr262913 2256 1111 1100 802 334 11121 ----
NM_023033chr121509 ------
NM_023037chr1331005 365 42 ------
NM_023074chr19----21250 43 --
NM_023105chr862316 1637 933 790 725 448 --11850 --
NM_023106chr862316 1637 933 790 725 448 --11850 --
NM_023110chr862316 1637 933 790 725 448 --11850 --
NM_023111chr862316 1637 933 790 725 448 --11850 --
NM_023925chr122235 101 ------
NM_023929chr821892 1805 --128 --
NM_023938chr143179 2969 1143 1040 --12908 --
NM_024007chr572985 2365 2305 2098 1930 1119 495 ------
NM_024016chr171719 ------
NM_024052chr1763003 1146 1081 1008 892 568 ----1141
NM_024061chr72253 42 198 ----
NM_024090chr441511 1382 510 203 ------
NM_024104chr192221 40 --2986 81 --
NM_024311chr172290 283 ------
NM_024315chr7--1135 ----
NM_024337chr5162 ------
NM_024420chr1135 ----1374
NM_024423chr1873501 3458 3271 3184 1668 938 662 2399 227 34091 3971 3123 --
NM_024429chr77979 968 952 431 332 234 96 ------
NM_024490chr152509 103 143 ----
NM_024496chr142677 650 1752 2728 298 --
NM_024501chr21649 ------
NM_024511chr493108 2911 2141 1211 1121 1111 887 365 177 ----12876
NM_024524chr362767 2573 2561 2164 761 502 ----12152
NM_024529chr131080 467 113 ------
NM_024539chrX51213 968 859 832 116 1874 ----
NM_024546chr1311278 1350 ----
NM_024551chr1262314 2279 641 519 448 202 ------
NM_024551chr1262314 2279 641 519 448 202 ------
NM_024561chr1331262 1051 953 11404 ----
NM_024563chr551899 1881 717 703 202 ------
NM_024573chr64953 784 743 279 ------
NM_024590chr421237 683 --1658 --
NM_024594chr551717 1536 1337 696 178 21563 478 1125 --
NM_024595chr11489 ------
NM_024613chr811822 21765 391 ----
NM_024620chr1931416 303 127 --11360 --
NM_024624chr211589 --11451 --
NM_024639chr652914 1904 1797 967 322 --1635 --
NM_024665chr351197 1040 503 215 37 ------
NM_024670chr1021357 214 151 ----
NM_024700chr11181 21126 810 ----
NM_024707chr192373 61 --1214 --
NM_024713chr1531341 1180 1048 ------
NM_024715chr551892 1872 698 603 144 161 11525 --
NM_024721chr822527 202 32474 855 329 --12067
NM_024722chr17----1581 --
NM_024740chr1133347 1497 1459 23191 2644 24009 2671 --
NM_024744chr252673 2348 2235 494 378 ------
NM_024751chr461629 1570 1491 1349 181 50 --12057 --
NM_024755chr151814 ------
NM_024759chr83861 268 78 1599 ----
NM_024761chr965211 3377 1860 1410 1282 758 --1184 --
NM_024770chr276717 6196 6062 5886 5358 1685 1465 ----25158 2339
NM_024779chr1231618 1248 400 ----1257
NM_024785chr21611 --21106 395 11304
NM_024803chr10128 --1362 --
NM_024808chr133910 732 171 --1279 --
NM_024817chr1585255 5159 4616 4447 1464 1045 836 146 11559 25665 4407 --
NM_024824chr1441579 1086 688 440 ----1571
NM_024828chr921371 324 ------
NM_024834chr1061858 1852 1413 786 339 281 ------
NM_024835chr172368 290 1382 ----
NM_024837chr1511941 ------
NM_024841chr1162150 923 538 338 317 101 ------
NM_024863chrX2151 127 ------
NM_024884chr1441831 1186 972 54 23263 341 ----
NM_024899chr181149 2473 254 ----
NM_024911chr12670 98 ------
NM_024913chr72508 355 --21139 573 --
NM_024920chr421490 1434 21613 438 --11389
NM_024921chrX11279 21425 1362 11867 --
NM_024939chr1641658 1477 1120 444 1564 ----
NM_024942chr1041394 1122 377 272 11046 ----
NM_024947chr3119400 8629 8100 7563 6734 3777 3722 1854 1822 1281 710 --58921 6287 3127 1756 1520 --
NM_024949chr484867 3552 3286 3193 1112 629 489 247 --21479 520 --
NM_024953chr1231853 977 944 22017 1032 ----
NM_024971chr93815 277 124 ------
NM_024989chr2116797 6237 6136 5635 5299 2539 2439 2227 2125 752 153 22904 1783 38204 8071 5734 --
NM_024991chr1022547 401 ------
NM_024993chr261447 1280 1194 1163 558 52 21436 1360 ----
NM_025054chr8104205 4009 3759 3608 2659 569 508 501 382 298 33708 2811 2779 131 --
NM_025069chr8--1163 ----
NM_025073chr1114535 4399 4375 4122 3911 3678 3066 1844 1289 1056 707 51879 1320 1210 818 640 14458 --
NM_025106chr111458 --11721 --
NM_025107chr652281 1805 1792 1454 756 ------
NM_025129chr191218 ------
NM_025135chr181466 ------
NM_025140chr122615 578 ------
NM_025146chr342232 2159 1991 1865 --11830 --
NM_025152chr1421871 127 1182 --11618
NM_025154chr731500 1472 1164 11532 ----
NM_025160chr184324 2868 2778 865 829 789 415 365 14109 --13234
NM_025179chr154845 3112 1794 831 528 14306 13816 13164
NM_025181chr23855 323 84 ------
NM_025191chr142625 2554 2317 770 ------
NM_025221chr421466 1102 --1449 --
NM_025222chr352929 2654 1961 412 318 12900 12094 --
NM_025230chr1421929 1682 --182 1312
NM_025238chr1521336 146 1544 ----
NM_025244chr2295 77 1106 ----
NM_025246chr3374 61 30 ------
NM_025248chr1722177 2145 ------
NM_030579chr1633689 3226 3116 ------
NM_030583chr84973 726 377 100 ----1858
NM_030621chr1473140 2650 1627 1140 962 502 292 --21639 267 --
NM_030623chr231660 1455 73 --21353 277 --
NM_030625chr1062571 2405 2113 1053 527 246 12320 12617 --
NM_030627chr553363 3237 792 758 450 44077 4060 2785 913 23283 2669 --
NM_030634chr142320 1650 892 274 1318 21631 284 1176
NM_030637chr143599 513 481 ------
NM_030647chr786293 5679 5111 4083 3960 1491 441 141 11115 ----
NM_030648chr475523 5449 3808 2093 1827 1619 367 34147 1094 903 ----
NM_030650chr252686 1345 612 549 216 23526 1202 ----
NM_030664chr1062151 1853 897 825 429 376 ------
NM_030665chr171951 11309 ----
NM_030670chr12--11789 22214 46 --
NM_030671chr12--11789 22214 46 --
NM_030674chr1275059 3753 3618 1965 924 341 170 11868 15399 --
NM_030762chr1231585 620 577 --11848 --
NM_030763chrX1767 ------
NM_030780chr871355 1146 1138 543 412 327 158 21114 236 21580 1399 --
NM_030791chr1431807 518 242 --1231 --
NM_030799chr531867 297 214 1240 ----
NM_030802chr17------1833
NM_030806chr189250 8179 7780 7344 6248 3006 2403 324 11042 46694 6448 3233 1191 11693
NM_030809chr1242491 986 979 237 12167 ----
NM_030820chr63967 905 864 --1769 --
NM_030821chr43703 270 66 ------
NM_030881chr2252306 1894 865 574 521 --12399 --
NM_030885chr342245 2213 2062 396 ------
NM_030893chr13629 609 505 ------
NM_030895chr8--21184 1149 ----
NM_030917chr4176 ------
NM_030920chr132021 1660 29 ------
NM_030934chr131861 1582 458 ------
NM_030938chr1721007 231 ------
NM_030939chr661158 887 406 294 220 37 ------
NM_030940chr931381 1076 1052 ------
NM_030953chr521549 1022 188 ----
NM_030962chr1141539 1026 515 487 11124 ----
NM_030963chr6----1541 --
NM_030964chr543725 2830 339 25 --12476 1949
NM_030965chr13844 790 662 --1208 --
NM_031216chr1862228 1853 1843 1718 732 276 --1481 --
NM_031226chr1521293 522 ------
NM_031243chr772416 2251 2041 1773 880 723 617 2331 98 ----
NM_031244chr641156 1090 911 463 --1966 --
NM_031262chr961051 869 711 392 386 138 11172 ----
NM_031263chr961108 926 768 449 443 195 11229 ----
NM_031268chr1675214 4201 3913 3531 3309 1300 1055 13562 11383 --
NM_031305chr421478 1240 31284 304 190 1754 --
NM_031369chr41712 ------
NM_031370chr41712 ------
NM_031371chr121497 1064 11349 ----
NM_031371chr121497 1064 11349 ----
NM_031372chr441500 1441 510 267 ------
NM_031407chrX1430 ------
NM_031411chr542283 1529 810 437 --11836 11483
NM_031418chr1152712 2431 2311 1031 902 --22751 2520 167
NM_031422chr181217 ------
NM_031427chr1475942 5611 4041 3668 3629 841 329 1747 --15958
NM_031431chr1351821 1706 754 479 133 1451 ----
NM_031435chr1262679 2622 2325 1374 1243 604 32586 1290 373 ----
NM_031439chr831498 1448 169 --1281 --
NM_031445chr263408 2990 2892 2435 2155 1333 1120 12767 --
NM_031453chr1072375 2165 1840 1668 1012 555 158 ------
NM_031461chr842294 1501 601 349 1441 ----
NM_031468chr7136990 6405 6294 6232 6157 6091 3306 2958 2569 2273 214 151 110 11700 47253 7246 6641 6382 --
NM_031476chr1672805 2731 2314 2101 672 525 308 ------
NM_031483chr2063513 2894 2330 984 131 48 53488 3203 2635 2507 695 11065 --
NM_031492chr111577 ------
NM_031844chr154041 3815 1415 309 231 1406 --11349
NM_031845chr263178 3042 3024 2459 2421 696 11042 ----
NM_031847chr263178 3042 3024 2459 2421 696 11042 ----
NM_031849chr542283 1529 810 437 --11836 11483
NM_031857chr542283 1529 810 437 --11836 11483
NM_031858chr1741600 1015 980 511 11196 --11369
NM_031860chr542283 1529 810 437 --11836 11483
NM_031862chr1741600 1015 980 511 11196 --11369
NM_031889chr411198 11958 11735 --
NM_031911chr472667 2627 1900 1880 791 476 228 2437 261 ----
NM_031935chr1--11027 ----
NM_031942chr241232 1198 1139 255 ------
NM_031966chr51138 ------
NM_032041chr872271 2254 2105 2015 1001 881 181 --32587 447 169 11081
NM_032042chr562728 2415 1986 595 566 168 12039 ----
NM_032047chr351945 1573 864 665 69 22356 541 1136 --
NM_032050chr223945 62 54 11074 ----
NM_032052chr2251330 447 439 151 66 11459 ----
NM_032102chr1133092 2577 608 22914 2806 1647 1896
NM_032116chr1332296 2164 1594 14293 24537 4305 --
NM_032127chr11----1118 --
NM_032128chr431029 832 133 1915 1407 1340
NM_032144chr241767 1700 642 484 1141 ----
NM_032145chr691903 1860 1658 1533 785 478 462 184 125 ------
NM_032153chr342459 2365 1902 1733 ------
NM_032154chr1041003 951 838 174 ------
NM_032156chr122235 101 ------
NM_032160chr1863971 3871 3660 3557 1575 509 21672 1189 ----
NM_032168chr2--180 ----
NM_032182chr1021048 346 11375 ----
NM_032186chr11929 --11035 --
NM_032199chr1042989 2893 949 410 23903 2481 23748 67 --
NM_032208chr283308 3268 2598 2310 1200 503 378 276 ------
NM_032217chr41902 ------
NM_032221chr2061774 1750 1505 1361 463 427 21988 1554 ----
NM_032228chr1173424 3305 2297 1078 977 376 158 ------
NM_032239chr4--1410 ----
NM_032246chr1521010 848 1425 1515 --
NM_032268chr1652905 2833 2814 937 925 ------
NM_032281chr1942221 1010 520 312 ------
NM_032288chr382202 2148 2048 1971 1741 1690 638 586 12375 ----
NM_032289chr521845 1630 ------
NM_032291chr151657 1640 552 504 366 21367 527 ----
NM_032294chr1731789 1508 180 --21743 1226 --
NM_032295chr731309 348 77 11411 ----
NM_032303chr921751 73 11376 --11820
NM_032312chr21709 1910 ----
NM_032320chr114813 702 635 112 ------
NM_032324chr13176 150 35 ------
NM_032329chr2124342 4170 3602 3570 3472 2969 2792 1716 1518 1340 1167 725 --23097 851 14284
NM_032352chr1421416 115 --1404 --
NM_032373chr10105749 4984 4931 4891 4419 3823 1989 875 720 326 --15820 --
NM_032383chr37898 818 479 405 233 151 60 ------
NM_032408chr73974 363 35 ------
NM_032410chr831134 390 246 ------
NM_032424chr1131598 1154 29 1604 ----
NM_032434chr231139 624 43 --21598 337 --
NM_032438chr631281 1111 173 1640 ----
NM_032439chr1041529 1132 262 254 ------
NM_032440chr1072538 2214 2141 1147 867 699 646 --1163 --
NM_032445chr151579 --11672 --
NM_032446chr533783 1369 527 13089 13494 195
NM_032457chr432650 1473 986 13712 12600 --
NM_032458chrX63305 2905 2476 1299 955 134 12893 ----
NM_032466chr821714 1708 ------
NM_032468chr821714 1708 ------
NM_032487chr32107 31 ------
NM_032505chr352688 2681 2581 2456 699 1664 172 --
NM_032510chr1862240 2208 2069 483 286 228 22189 1722 ----
NM_032521chr2063011 1285 1125 922 536 34 22498 747 ----
NM_032538chr642726 2221 2010 914 --12707 --
NM_032539chrX2574 128 --2273 39 --
NM_032547chr4----1259 --
NM_032549chr71103 1169 ----
NM_032557chr42242 132 3824 670 375 ----
NM_032569chr1621954 694 --11322 --
NM_032582chr1731733 1324 401 ------
NM_032594chr1451072 821 398 344 144 ------
NM_032626chr161357 ------
NM_032638chr3----1166 --
NM_032682chr353547 3533 1360 859 744 11422 --1713
NM_032717chr431067 996 297 --1698 --
NM_032727chr1021522 27 11139 --11104
NM_032777chr8----11561 --
NM_032780chr1111185 ------
NM_032793chr1--1362 ----
NM_032800chr132732 2064 39 ------
NM_032804chr1042495 1974 922 897 ------
NM_032812chr102297 233 ------
NM_032813chr132971 175 ------
NM_032826chr795488 4683 3639 3617 3592 3584 1269 659 102 --24419 2010 --
NM_032828chr19114259 3376 3243 3031 1901 1455 647 502 395 183 114 13935 189 --
NM_032829chr12----11108 --
NM_032838chr193987 950 146 ----11031
NM_032859chr1353881 3010 2766 1084 1069 --2633 59 --
NM_032869chr851941 1910 1801 824 399 21988 463 ----
NM_032870chr63535 514 412 1134 ----
NM_032906chr42846 756 --1103 --
NM_032947chr531299 1236 881 11293 ----
NM_032949chr13--1509 ----
NM_032961chr41493 ------
NM_032968chrX3981 905 192 13252 13684 --
NM_032969chrX3981 905 192 13252 13684 --
NM_032973chrY3981 905 192 23247 433 13676 --
NM_032978chr1821082 123 --11071 --
NM_032979chr1821082 123 --11071 --
NM_032981chr1821082 123 --11071 --
NM_032982chr762610 2297 2231 2202 1014 80 12443 1241 --
NM_032983chr763424 3111 3045 3016 894 399 13257 11055 --
NM_033012chr132769 671 11018 --11057
NM_033020chr1114769 4760 4588 4310 4195 3334 3138 1714 1431 1105 1059 13074 1809 --
NM_033023chr73846 477 405 --11008 --
NM_033030chr221467 1413 21620 1608 ----
NM_033044chr11513 11244 ----
NM_033055chr131066 884 722 ------
NM_033071chr6129 ----1652
NM_033089chr2011465 --1960 --
NM_033117chr91134 --1241 --
NM_033131chr111774 11763 ----
NM_033133chr1793742 3692 3456 3373 2848 2388 1169 556 187 13785 ----
NM_033136chr51254 11503 ----
NM_033137chr51254 11503 ----
NM_033138chr742010 1778 1498 344 --1735 --
NM_033139chr742010 1778 1498 344 --1735 --
NM_033140chr742010 1778 1498 344 --1735 --
NM_033143chr484646 4141 3053 2967 2933 1312 978 488 14336 ----
NM_033157chr742010 1778 1498 344 --1735 --
NM_033181chr663614 3411 3299 3005 1337 155 13354 12915 --
NM_033211chr531976 1599 793 1586 1228 1322
NM_033222chr91896 41071 922 474 236 ----
NM_033224chr787702 6857 5743 2785 2614 948 743 720 --12066 --
NM_033225chr833002 2259 524 12326 1636 --
NM_033227chr5--1603 1537 --
NM_033228chr5--1643 1577 --
NM_033253chr22913 211 ------
NM_033254chr31574 ------
NM_033259chr31891 ------
NM_033260chr65805 598 545 516 32 ------
NM_033281chr5--1242 ----
NM_033300chr121164 218 --1948 --
NM_033326chr1141926 960 559 412 --22130 2063 --
NM_033331chr943086 3039 2670 1064 1523 23459 568 --
NM_033360chr1284568 4382 4332 3933 3320 1523 639 262 23474 1569 34510 3609 438 --
NM_033380chrX41118 831 731 65 ------
NM_033381chrX41118 831 731 65 ------
NM_033389chr1794863 4481 4451 4378 3537 3414 3193 1088 38 --11624 --
NM_033393chr462882 2340 2101 997 672 213 --12443 --
NM_033394chr2--11275 11372 1195
NM_033401chr162441 91 --177 --
NM_033425chr111353 --32985 2630 2549 --
NM_033427chr74854 154 119 93 1806 ----
NM_033429chr1543205 3037 2333 799 1498 ----
NM_033430chr452827 2761 2650 811 470 --53993 3774 1357 380 160 11148
NM_033437chr452827 2761 2650 811 470 --53993 3774 1357 380 160 11148
NM_033480chr632915 530 447 --12884 --
NM_033481chr632915 530 447 --12884 --
NM_033495chrX4821 286 264 24 --1174 --
NM_033505chr2134745 4652 4603 2526 1638 1384 819 776 307 281 247 226 42 21775 1083 --12708
NM_033512chr832831 2109 1034 22646 2199 22728 2210 12257
NM_033515chr621026 897 21125 192 21273 1178 1519
NM_033535chr431028 263 168 --1275 --
NM_033549chr511020 ------
NM_033551chr522898 2491 ------
NM_033624chr1252256 1533 914 187 128 22214 2206 12024 --
NM_033631chr173557 3239 3172 2522 1245 767 392 13321 13876 --
NM_033642chrX3414 315 208 ------
NM_033644chr552411 2267 1606 444 271 ------
NM_033645chr552411 2267 1606 444 271 ------
NM_033656chr21145923 5886 5456 5156 4753 3763 3727 1851 1761 698 670 601 543 132 75619 4359 4014 3959 1577 1477 769 11586 --
NM_033666chr101937 1272 1899 --
NM_044472chr14659 297 237 159 ------
NM_048368chr181308 ------
NM_052827chr122394 329 11037 21095 850 --
NM_052832chr852720 2374 2294 2242 694 12062 1613 --
NM_052834chr1842326 1941 686 396 --12544 --
NM_052851chr1332035 1716 1543 1949 1148 --
NM_052879chr1263922 3072 1642 597 464 190 14042 23231 2755 13193
NM_052885chr1224878 4688 23132 352 13415 13518
NM_052886chr831912 1472 820 ----1167
NM_052898chr821784 605 ------
NM_052900chr841697 1580 1439 539 11661 1220 --
NM_052905chr241730 629 600 521 --11846 11459
NM_052907chr1263568 3265 1380 962 913 437 33140 1395 779 23049 52 --
NM_052913chr64805 420 259 251 2845 772 ----
NM_052917chr293417 2423 2270 1258 997 873 507 275 152 12508 ----
NM_052918chr1043679 1475 1467 196 ------
NM_052923chr61184 ------
NM_052927chr54779 507 378 318 32220 1389 107 12229 --
NM_052932chr1182277 2249 2150 742 682 423 339 39 ------
NM_052934chr122154 35 11666 12164 --
NM_052937chr881957 1795 1088 947 515 435 248 215 12613 ----
NM_052940chr1------1151
NM_052958chr81723 ------
NM_052965chr121353 1325 ------
NM_052971chr5147 --1172 --
NM_052978chr1441633 1468 417 244 ------
NM_053016chr9117981 7733 7705 5963 5426 5087 2990 2298 987 532 461 21672 1197 22021 1102 --
NM_053023chr1111084 --12542 11115
NM_053025chr321705 334 ------
NM_053026chr321705 334 ------
NM_053027chr321705 334 ------
NM_053028chr321705 334 ------
NM_053031chr321705 334 ------
NM_053032chr321705 334 ------
NM_053035chr7187 ------
NM_053043chr746235 6169 4711 274 --12279 --
NM_053046chr191425 ------
NM_053053chr12935 745 --160 --
NM_053064chr1473043 2941 2588 2270 1064 588 168 13023 ----
NM_054016chr151981 1742 1661 95 84 1196 ----
NM_054016chr151981 1742 1661 95 84 1196 ----
NM_054016chr151981 1742 1661 95 84 1196 ----
NM_057164chr22708 649 --1233 --
NM_057165chr22708 649 --1233 --
NM_057166chr22708 649 --1233 --
NM_057167chr22708 649 --1233 --
NM_057168chr741622 1506 1376 211 11076 --11396
NM_057169chr1263003 2755 2043 1231 1175 615 --42344 2238 2033 1921 --
NM_057170chr1263003 2755 2043 1231 1175 615 --42344 2238 2033 1921 --
NM_057175chr462063 1812 973 536 395 112 ------
NM_058207chr8157 ------
NM_058229chr81185 ------
NM_058237chr1421012 281 2814 246 ----
NM_058241chr231910 842 127 22291 1686 ----
NM_058241chr231910 842 127 22291 1686 ----
NM_078629chrX1192 2634 610 ----
NM_078630chrX1192 2634 610 ----
NM_080546chr92860 260 1291 12224 --
NM_080591chr972763 1911 1902 547 478 277 86 --2189 58 --
NM_080597chr182795 443 11106 21126 395 --
NM_080629chr111334 11006 ----
NM_080630chr111334 11006 ----
NM_080669chr1784898 4802 4742 3718 3050 590 447 119 --24872 1303 --
NM_080678chr23604 508 443 --1472 --
NM_080682chr12719 111 ------
NM_080683chr44463 441 166 22 ------
NM_080684chr44463 441 166 22 ------
NM_080685chr44463 441 166 22 ------
NM_080717chr1231349 405 125 --1154 --
NM_080723chr621287 385 ------
NM_080732chr191425 ------
NM_080743chr6----11740 --
NM_080759chr132775 125 12228 22108 213 --
NM_080760chr132775 125 12228 22108 213 --
NM_080792chr2031670 1647 350 --12026 --
NM_080794chr21285 32 ------
NM_080840chr201190 ------
NM_080841chr201190 ------
NM_080867chr1444020 3823 3612 3325 44048 1434 855 531 35042 4570 505 --
NM_080872chr843973 3954 3898 315 24091 3582 --1822
NM_080927chr393223 3046 2865 2646 733 709 623 317 85 ------
NM_100264chr102559 296 ------
NM_100486chr102559 296 ------
NM_130386chr181187 ------
NM_130391chr953488 3402 2599 2316 1094 12400 31319 478 355 --
NM_130392chr953488 3402 2599 2316 1094 12400 31319 478 355 --
NM_130393chr953488 3402 2599 2316 1094 12400 31319 478 355 --
NM_130435chr1052603 1110 679 616 302 1862 12873 --
NM_130436chr2122408 921 ------
NM_130439chr10--11670 ----
NM_130439chr10--11670 ----
NM_130440chr141512 647 579 103 ----11549
NM_130469chr14----1642 --
NM_130798chr151524 11217 ----
NM_130808chr3----1369 --
NM_130809chr523157 2575 12712 22700 380 12378
NM_130811chr20131 --2308 125 --
NM_130838chr1511682 11624 1649 --
NM_130839chr1511682 11624 1649 --
NM_130846chr1251066 397 389 306 183 ------
NM_130847chr11155940 5929 5788 5385 5302 4874 4736 4599 4319 4215 3806 3774 1507 1462 191 1153 --11653
NM_130850chr141205 ------
NM_130851chr141205 ------
NM_133170chr2078057 8044 7896 5794 4919 1793 193 --16390 16154
NM_133265chrX63299 2960 1303 733 223 40 --11001 --
NM_133330chr442965 2341 2118 276 --1333 --
NM_133331chr442965 2341 2118 276 --1333 --
NM_133334chr485967 5677 5586 4135 3917 2468 1231 958 --22544 24 14280
NM_133335chr442965 2341 2118 276 --1333 --
NM_133368chr16152 ------
NM_133370chr443219 417 282 254 23266 643 33143 1323 689 --
NM_133372chr552486 2193 1853 912 669 12705 ----
NM_133433chr53315 141 119 --1294 --
NM_133445chr963807 3682 2558 1316 932 68 ------
NM_133468chr762587 2491 1646 767 566 488 ------
NM_133482chr521465 1016 1392 ----
NM_133496chr1124282 4247 3487 3164 1800 1643 1582 1397 936 725 404 336 13414 ----
NM_133507chr122880 629 ------
NM_133631chr361664 1558 1078 1046 264 89 ------
NM_133638chr52512 359 ------
NM_133646chr295414 4550 4308 3742 2070 1249 779 758 34 25375 1913 1999 11318
NM_133647chr1563773 3209 2959 2778 393 226 ----1313
NM_133650chr6129 ----1652
NM_134260chr15129 ------
NM_134261chr15129 ------
NM_134262chr15129 ------
NM_134265chr1741209 1190 823 798 ------
NM_134428chr91266 ------
NM_134442chr2--11486 2575 175 --
NM_138270chrX63407 2581 2349 2221 1009 492 1845 ----
NM_138286chr19104144 4096 4075 3046 3028 1370 1158 179 119 97 12732 ----
NM_138290chr7143 ------
NM_138317chr141542 ------
NM_138318chr141542 ------
NM_138328chr1763331 2308 2158 1045 982 133 --21305 1180 --
NM_138333chr91349 1418 ----
NM_138353chr191437 ------
NM_138357chr1031542 662 293 ----1159
NM_138370chr2--1173 ----
NM_138376chr14----1102 --
NM_138395chr23996 846 262 11120 ----
NM_138408chr6123 ------
NM_138423chr1572225 1943 1469 697 459 149 35 12152 1901 --
NM_138426chr74941 865 546 193 ------
NM_138444chr1363664 3488 3158 1235 957 843 34844 3819 1870 --13708
NM_138455chr8--1346 ----
NM_138459chr643704 3508 2588 2506 12974 --12826
NM_138468chr296340 6250 4388 2159 2143 2053 1747 755 613 12173 ----
NM_138473chr1284966 4956 4561 3184 1841 855 651 55 15019 ----
NM_138485chr3198 1373 ----
NM_138494chr782822 2143 2052 2029 925 347 257 168 12423 ----
NM_138558chr131182 1144 116 ------
NM_138559chr231054 441 398 ------
NM_138576chr1484759 4654 4045 4002 3981 3476 1600 1137 1386 161 --
NM_138609chr52413 174 1588 ----
NM_138610chr52413 174 1588 ----
NM_138633chr621435 467 2650 413 31396 1329 187 --
NM_138638chr1452308 1696 544 341 219 1895 11645 --
NM_138694chr663198 1397 1140 363 165 112 32904 1220 225 141 --
NM_138701chr72291 280 ------
NM_138713chr16107927 7828 6639 5612 3149 2650 1717 1508 1383 1195 55939 5024 3173 2929 189 35846 809 634 15898
NM_138714chr16107927 7828 6639 5612 3149 2650 1717 1508 1383 1195 55939 5024 3173 2929 189 35846 809 634 15898
NM_138731chr1424236 160 22920 1391 ----
NM_138766chr52619 44 ------
NM_138771chr74548 524 512 209 1990 1390 --
NM_138779chr131108 ------
NM_138782chr51718 31810 1750 465 ----
NM_138786chr31402 ------
NM_138821chr52619 44 ------
NM_138822chr52619 44 ------
NM_138927chr213868 219 139 ----1426
NM_138931chr331066 340 78 --1945 --
NM_138959chr166788 6142 6135 5608 2508 857 16225 24713 1538 12199
NM_138970chr1442445 1649 774 408 ------
NM_138971chr1153607 1309 1109 732 461 ------
NM_138971chr1153607 1309 1109 732 461 ------
NM_138972chr1153607 1309 1109 732 461 ------
NM_138972chr1153607 1309 1109 732 461 ------
NM_138973chr1153607 1309 1109 732 461 ------
NM_138973chr1153607 1309 1109 732 461 ------
NM_138994chr162441 91 --177 --
NM_139012chr632160 2006 1535 --1239 --
NM_139035chrX2540 295 1209 ----
NM_139045chr91841 ------
NM_139048chr331256 482 118 ------
NM_139057chr1582954 2712 2531 2400 2188 933 354 154 --1687 --
NM_139131chr111503 ------
NM_139168chr541963 1788 1382 31 21612 374 11874 --
NM_139239chr19173 ------
NM_139244chr63935 889 868 ------
NM_139283chr1242149 1780 859 334 21738 447 12458 --
NM_139312chr1031133 261 124 --122 --
NM_139321chr2083943 3689 2887 2758 2720 1645 1390 631 13503 ----
NM_139323chr2051815 1521 671 504 441 11263 ----
NM_144567chr171984 1769 1008 611 529 128 57 --1550 --
NM_144571chr486546 4597 2741 2546 1872 808 792 642 21924 915 15910 --
NM_144574chr142476 78 ------
NM_144578chr1494789 4410 1593 1585 1458 1229 1172 160 63 25407 3713 11765 --
NM_144583chr231413 732 171 11351 2223 190 --
NM_144595chr135862 847 833 774 304 --2983 926 --
NM_144599chr15105327 5100 5079 4796 3762 3526 2137 2079 878 430 11066 ----
NM_144600chr1641553 1353 269 94 21223 73 ----
NM_144628chr2043084 2603 1930 384 --22367 2144 --
NM_144636chr31712 ------
NM_144642chr321171 109 ------
NM_144658chrX--168 ----
NM_144660chr102360 100 1367 ----
NM_144664chr1171901 829 764 698 607 281 269 --1716 --
NM_144676chr16198 ------
NM_144726chr541235 1069 864 24 ------
NM_144728chr11881 ------
NM_144729chr11881 ------
NM_144767chr15114485 4424 4343 3958 3786 3675 3408 2957 1366 459 362 ------
NM_144778chr1352450 1773 525 163 23 ------
NM_144949chr232322 1632 371 1137 1694 --
NM_144963chr822016 193 11049 1902 --
NM_144969chrX3692 171 77 ------
NM_144973chr12104978 4056 3663 3503 986 487 433 318 267 153 --35092 3490 1023 --
NM_144974chr134810 793 679 219 ------
NM_144979chr42742 681 ------
NM_145018chr112276 50 ------
NM_145037chr351265 483 404 335 201 1268 ----
NM_145048chr43801 713 390 11001 ----
NM_145055chr1843644 3346 1049 987 13532 ----
NM_145115chr742043 522 467 216 12259 ----
NM_145159chr141135 ------
NM_145160chr152356 297 ------
NM_145165chr1452602 2528 2456 2376 816 ------
NM_145204chr151590 --1650 --
NM_145206chr1012663 11098 42212 1276 524 243 12580
NM_145243chr1----138 --
NM_145247chr101561 1537 ----
NM_145259chr296912 6627 5631 5177 4914 4467 1871 959 791 77020 5197 2774 2648 1567 1516 299 21240 69 --
NM_145261chr31856 ------
NM_145263chr482394 2361 2022 1868 1534 662 633 149 22312 746 ----
NM_145284chrX82537 2513 2437 1924 659 651 240 52 1125 1679 --
NM_145307chr1094518 4079 3940 3561 3280 1813 1111 708 191 --1408 --
NM_145320chr7103621 3426 3220 2883 2803 2541 988 877 580 202 32402 1373 180 1264 --
NM_145321chr7103621 3426 3220 2883 2803 2541 988 877 580 202 32402 1373 180 1264 --
NM_145322chr7103621 3426 3220 2883 2803 2541 988 877 580 202 32402 1373 180 1264 --
NM_145341chr1041875 1357 623 167 ------
NM_145647chr81199 ------
NM_145649chr682677 2626 2445 2371 1760 687 328 240 189 ----
NM_145655chr682677 2626 2445 2371 1760 687 328 240 189 ----
NM_145686chr273131 3082 2835 2510 2359 2091 1030 33363 2464 2374 32982 1173 442 --
NM_145687chr273131 3082 2835 2510 2359 2091 1030 33363 2464 2374 32982 1173 442 --
NM_145690chr851945 1906 1879 1329 668 ------
NM_145727chr62441 335 21335 553 199 1211
NM_145733chr2221090 76 11116 2930 920 --
NM_145735chr1342263 2197 898 30 22211 435 12744 --
NM_145753chr321678 1217 ------
NM_145756chr1821079 505 --1172 --
NM_145808chr752999 2869 2336 2037 473 11952 --13102
NM_145810chr241232 1198 1139 255 ------
NM_145899chr621044 997 --11182 --
NM_145901chr621044 997 --11182 --
NM_145902chr621044 997 --11182 --
NM_145903chr621044 997 --11182 --
NM_145904chr621044 997 --11182 --
NM_145905chr621044 997 --11182 --
NM_147128chr771343 1073 559 449 440 255 46 21408 1212 ----
NM_147150chr933277 3221 2665 13919 ----
NM_147171chr71321 ------
NM_147175chrX11903 ------
NM_147181chr421466 1102 --1449 --
NM_147182chr421466 1102 --1449 --
NM_147183chr421466 1102 --1449 --
NM_147185chr71321 ------
NM_147189chr842317 2087 792 119 1585 ----
NM_147192chr11357 ------
NM_148170chr1164775 4745 4564 3507 1033 241 2888 857 --25613 5085
NM_148174chr842199 1481 876 455 2821 407 ----
NM_148177chr81185 ------
NM_148894chr431265 1120 302 1404 ----
NM_148898chr7--21020 438 ----
NM_148899chr7--21020 438 ----
NM_148976chr111243 ----1111
NM_152227chr20133 ------
NM_152230chr10--178 --1222
NM_152261chr1212471 2548 224 ----
NM_152263chr146114 5816 5609 1997 45314 5194 5188 178 14399 --
NM_152265chr131202 1014 132 ------
NM_152271chr82214 86 1989 ----
NM_152272chr831327 176 89 --11129 1135
NM_152278chrX2210 42 ------
NM_152291chr42893 54 ----1326
NM_152308chr162236 107 --2830 158 --
NM_152327chr142292 82 1401 ----
NM_152330chr1462008 1898 817 412 314 51 1857 ----
NM_152332chr1462501 2241 2192 1960 1108 201 1420 ----
NM_152344chr1721376 605 ------
NM_152400chr422098 1851 21768 1504 11360 --
NM_152407chr533074 2947 948 ----12167
NM_152409chr563405 2330 2195 1368 549 309 1529 ----
NM_152414chr84657 539 417 343 ------
NM_152415chr81213 ------
NM_152417chr831286 462 49 ------
NM_152423chrX--21418 527 ----
NM_152424chrX104454 4043 3905 3509 3073 3028 2890 1743 1219 946 1795 1283 14726
NM_152437chr123910 766 187 --11537 --
NM_152444chr1421183 422 --31199 382 363 --
NM_152447chr142360 74 ------
NM_152450chr1561347 819 431 401 311 147 --11603 --
NM_152470chr1853486 3250 1319 1156 447 13706 23982 2699 --
NM_152512chr221555 1510 ----
NM_152527chr232386 1833 188 1653 22011 923 --
NM_152529chr234468 4347 3956 22905 755 13524 --
NM_152538chr351813 1749 179 138 43 11804 178 --
NM_152549chr5--2441 247 --136
NM_152556chr732005 1922 789 1278 ----
NM_152581chrX41371 1001 560 182 1969 ----
NM_152594chr1562269 2131 815 649 505 182 12058 11917 --
NM_152605chr19111252 472 388 379 296 221 212 137 61 53 44 ------
NM_152621chr41365 ------
NM_152622chr563102 3005 2873 2263 455 438 ----12247
NM_152624chr5117232 7194 6874 6844 6694 5837 5030 2915 1106 657 115 76026 2658 2552 2467 2191 2070 1360 22451 340 --
NM_152629chr974055 3980 3451 2789 1460 1039 903 --13959 --
NM_152630chrX3476 251 210 ------
NM_152636chr1193129 3105 3003 2916 2776 2621 2134 1906 548 13095 ----
NM_152638chr1251211 443 433 319 142 --11235 --
NM_152641chr1252750 2546 1896 814 130 12671 21991 773 --
NM_152665chr141227 1211 1139 437 ------
NM_152678chr352614 1754 455 312 260 1686 --1120
NM_152682chr42708 496 21571 218 1631 --
NM_152688chr61798 ------
NM_152695chrX51949 1927 1857 907 701 ------
NM_152699chr3103006 2946 2732 2528 2360 1439 1129 838 540 186 23625 2399 ----
NM_152705chr1321372 559 ------
NM_152724chr1042048 2006 137 90 ------
NM_152733chr6106384 5344 4846 4675 4381 4026 1686 1147 652 529 1568 ----
NM_152734chr6135455 5251 5142 4524 4362 3946 3636 2160 1830 1344 1155 660 294 --13926 14698
NM_152736chr62958 872 ------
NM_152737chr652081 1847 1351 659 173 ------
NM_152744chr763091 2762 2716 1187 918 553 ----1618
NM_152745chr7198 --1387 --
NM_152754chr793587 3381 3315 3067 1497 620 354 257 89 --1731 --
NM_152756chr584034 3696 3581 3299 3150 3095 779 536 13133 11275 --
NM_152758chr862440 2386 2318 1045 493 301 ------
NM_152772chr121298 ------
NM_152774chr752403 2134 815 784 723 --12449 1432
NM_152787chrX63322 3138 2908 879 596 261 23455 370 ----
NM_152789chr741173 965 212 172 ----11318
NM_152793chr795089 4612 4136 4064 2034 1286 1279 342 326 34828 1223 644 14362 --
NM_152835chr121079 440 ----12571
NM_152838chr2053179 2365 2341 2238 1327 12416 ----
NM_152857chr62981 302 ------
NM_152858chr62981 302 ------
NM_152862chr2179 ------
NM_152896chr92687 611 ------
NM_152903chr1342685 2169 990 148 1174 --12274
NM_152910chr133586 539 509 --1381 --
NM_152924chr1576610 5745 4505 2519 1655 748 448 --14286 --
NM_152989chr1231672 393 343 ------
NM_152995chr41899 ----1148
NM_152996chr12753 62 32072 1821 72 11758 22006 776
NM_152999chr795011 4206 4066 4025 1981 1891 1645 1602 1193 1320 ----
NM_153000chr182617 102 ------
NM_153013chr532445 772 680 12332 2609 260 12185
NM_153020chr621449 362 11098 ----
NM_153029chr1683947 3654 3432 3254 3225 2898 1342 137 --11385 --
NM_153042chr681799 1508 1306 1120 701 635 262 118 11548 ----
NM_153050chr2294627 4586 4448 4375 3269 1962 1831 831 137 24761 419 21466 652 13645
NM_153051chr2294627 4586 4448 4375 3269 1962 1831 831 137 24761 419 21466 652 13645
NM_153184chr341755 1480 472 250 21845 275 2571 43 --
NM_153186chr92815 79 1688 ----
NM_153188chr595430 4796 4760 4177 3739 3487 1865 1697 1373 31893 1317 88 --15676
NM_153207chr1263611 3579 3122 2704 1219 1060 13444 12730 --
NM_153223chr531448 403 338 ------
NM_153226chr1021152 451 ------
NM_153235chr652333 1702 1668 674 417 2623 134 12253 --
NM_153251chr13--1218 ----
NM_153260chr15159 ------
NM_153261chr161177 2650 360 ----
NM_153262chr133207 438 128 ------
NM_153267chr94724 612 583 350 1631 ----
NM_153341chr1------1307
NM_153354chr53916 138 123 ------
NM_153365chr472308 2261 2161 1902 933 497 50 2608 75 1331 --
NM_153371chr1352030 1934 1629 728 516 2941 259 ----
NM_153456chr13115582 4796 4594 4018 3877 2358 2303 2201 1679 531 228 --11625 --
NM_153607chr572601 2207 2027 1265 990 742 706 1250 12724 --
NM_153616chr1532224 1839 809 ------
NM_153617chr1532224 1839 809 ------
NM_153618chr1532224 1839 809 ------
NM_153619chr1563462 3077 2619 2605 742 554 1516 ----
NM_153620chr721353 1306 11775 ----
NM_153634chr126624 553 379 214 54 43 11467 ----
NM_153645chr2232376 252 227 1163 23300 1198 --
NM_153649chr162009 1915 1723 1659 921 235 22219 625 ----
NM_153686chr442353 2135 1745 1508 11882 ----
NM_153689chr262356 1608 442 350 249 177 22266 1513 12057 --
NM_153690chr33822 278 217 --1784 --
NM_153704chr81447 1290 ----
NM_153756chr1154 11234 ----
NM_153757chr43958 834 399 ------
NM_153810chr1084690 4640 4034 3368 1925 1166 955 796 34534 4437 542 54814 2016 1876 1789 1372 1717
NM_153828chr24919 813 801 605 ------
NM_170606chr741800 531 496 411 --1448 --
NM_170607chr1721216 1102 11134 ----
NM_170665chr1273684 3630 3023 1428 1222 1185 363 24493 3641 23719 1352 --
NM_170674chr1521349 291 1270 11258 --
NM_170675chr1511025 --1934 --
NM_170676chr1511025 --1934 --
NM_170677chr1521349 291 1270 11258 --
NM_170692chr12444 186 --191 --
NM_170706chr144369 3546 3436 908 ------
NM_170721chr1771063 1010 504 401 341 264 95 ------
NM_170731chr1132900 745 237 12028 12313 --
NM_170732chr1132900 745 237 12028 12313 --
NM_170733chr1132900 745 237 12028 12313 --
NM_170734chr1132900 745 237 12028 12313 --
NM_170735chr1132900 745 237 12028 12313 --
NM_170750chrX2906 834 ------
NM_170751chr641222 1117 1057 374 ------
NM_170752chr641222 1117 1057 374 ------
NM_171999chr182723 236 ------
NM_172016chr621165 474 147 --1920
NM_172020chr762012 1509 1321 752 644 203 11449 ----
NM_172037chr831448 1424 427 ------
NM_172058chr8--11270 1235 --
NM_172059chr8--11270 1235 --
NM_172060chr8--11270 1235 --
NM_172069chr241723 1503 699 400 32316 1622 423 ----
NM_172070chr21887 21791 1717 11849 --
NM_172071chr185653 4966 2945 2244 1159 1150 894 801 17302 --1931
NM_172103chr652686 2219 2112 546 439 1177 1635 11869
NM_172105chr652686 2219 2112 546 439 1177 1635 11869
NM_172193chr14--11142 ----
NM_172206chr1731789 1508 180 --21743 1226 --
NM_172225chr11357 ------
NM_172315chr1521349 291 1270 11258 --
NM_172316chr1521349 291 1270 11258 --
NM_172354chr181637 1543 1513 1502 526 264 244 205 ------
NM_172373chr1321148 186 21280 945 ----
NM_173054chr71656 ----1941
NM_173079chr1721827 140 ----11855
NM_173156chr14698 621 436 163 --12043 --
NM_173171chr241282 1233 518 348 --11031 --
NM_173172chr221590 1541 11016 11339 --
NM_173173chr241282 1233 518 348 --11031 --
NM_173177chr22679 441 ------
NM_173198chr962971 2871 2712 2489 1132 624 22009 302 --22606 1993
NM_173200chr962971 2871 2712 2489 1132 624 22009 302 --22606 1993
NM_173214chr16107927 7828 6639 5612 3149 2650 1717 1508 1383 1195 55939 5024 3173 2929 189 35846 809 634 15898
NM_173216chr352547 2285 1785 1748 368 12694 ----
NM_173217chr352547 2285 1785 1748 368 12694 ----
NM_173355chr211023 ------
NM_173359chr321578 98 ----11948
NM_173463chr4103542 3467 3402 3137 2974 2758 1164 1120 499 67 --21620 220 --
NM_173468chr4136070 5755 4691 4227 3851 3730 2390 1566 1278 894 808 645 293 11314 25397 3884 --
NM_173470chrX42837 2475 971 295 ------
NM_173473chr1042737 582 566 444 --1188 --
NM_173477chr171342 --21977 199 --
NM_173500chr1521126 983 ------
NM_173505chr181114 1291 1359 --
NM_173510chr2252892 1860 1080 802 703 21134 34 42880 2794 375 237 --
NM_173511chr2103646 2921 2913 2630 2612 2446 1451 814 391 193 1443 13674 --
NM_173519chr841920 1429 194 21 11754 --12014
NM_173539chr83930 232 159 ------
NM_173552chr341835 1615 395 184 2539 140 1258 --
NM_173556chr112334 44 --1395 --
NM_173560chr62600 467 ------
NM_173561chr6--11112 ----
NM_173576chr1022200 1435 --11895 --
NM_173582chr11105734 5528 4723 4239 4024 3871 2302 2253 1770 1578 21052 391 34182 2458 1947 --
NM_173591chr1241030 988 239 127 --1971 --
NM_173602chr1263780 3620 3246 2757 2738 672 2878 194 ----
NM_173614chr161311 ------
NM_173642chr1149211 8308 8226 7807 6403 5930 5678 3265 3038 1870 1510 1150 436 394 --37613 2235 1633 --
NM_173648chr21840 ------
NM_173666chr521143 357 --11212 11162
NM_173685chr8170 1213 ----
NM_173694chrX42534 2528 994 168 ------
NM_173698chrX31997 1735 220 --12045 --
NM_173794chrX1372 ------
NM_173797chr531003 958 207 11265 ----
NM_173802chr12294 38 1771 ----
NM_173808chr184480 3199 1487 1180 1113 662 107 45 23865 890 --11437
NM_173822chr251829 1579 1355 624 466 ------
NM_173825chr322325 533 1113 --12250
NM_173829chr596035 5079 4459 2301 1682 1297 742 528 417 35512 5457 1945 14432 --
NM_173851chr883005 2962 2881 1073 934 714 557 229 13997 33591 2758 687 --
NM_173872chr45906 881 648 206 94 ------
NM_174890chr10161 ----3803 681 148
NM_174909chr54618 161 129 21 2250 148 ----
NM_174934chr1183502 3373 3099 2408 1239 856 834 59 --1754 12520
NM_175056chr332223 2123 416 ------
NM_175061chr742027 1927 1405 743 11353 1531 --
NM_175607chr31