TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1181
miRNA Sequence: CCGUCGCCGCCACCCGAGCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX36121 1617 1281 ------
NM_000109chrX22146 41 ------
NM_000138chr152735 164 ------
NM_000210chr21499 ------
NM_000248chr312069 ------
NM_000264chr922862 984 ------
NM_000271chr181270 ------
NM_000278chr1031818 276 98 11909 11873 22114 2105
NM_000330chrX2515 35 ------
NM_000332chr636595 6310 754 ----1414
NM_000408chr212887 ------
NM_000525chr111611 ------
NM_000572chr12870 267 ------
NM_000594chr61699 ------
NM_000602chr731213 1194 471 --1270 --
NM_000615chr111735 12712 11884 --
NM_000619chr121437 ------
NM_000621chr131985 ------
NM_000726chr211405 ------
NM_000780chr821091 163 ------
NM_000813chr51103 ------
NM_000814chr1524051 1083 ------
NM_000829chr11144 ------
NM_000834chr121173 --180 --
NM_000859chr511246 ------
NM_000868chrX1357 ------
NM_000872chr101140 ------
NM_000964chr171429 ------
NM_001001331chr332448 2153 176 ------
NM_001001419chr521554 864 ------
NM_001001420chr521554 864 ------
NM_001001438chr211279 ------
NM_001001481chr812111 ------
NM_001001484chr10----12366 --
NM_001001936chr1021159 49 ------
NM_001001974chr101553 ------
NM_001002909chr17----1515 --
NM_001003688chr41482 ------
NM_001003694chr31426 ------
NM_001004065chr91228 ----1347
NM_001005207chr17161 ------
NM_001005404chr1734243 287 154 1710 ----
NM_001005473chr536440 5978 5914 ------
NM_001005476chr2----1253 --
NM_001005609chrX1156 ------
NM_001005746chr211405 ------
NM_001005747chr211405 ------
NM_001006624chr12731 134 ------
NM_001006634chr161552 ------
NM_001006946chr211321 ------
NM_001007237chr132489 2282 1894 ------
NM_001007471chr91150 ------
NM_001008222chrX11414 ------
NM_001008225chr71510 ------
NM_001008239chr182647 272 ------
NM_001008407chr71209 --1408 --
NM_001008410chr21741 ----1820
NM_001008660chr111247 ------
NM_001009554chr411739 ------
NM_001009554chr411739 ------
NM_001009959chr211892 ------
NM_001011724chr131313 ------
NM_001011725chr131313 ------
NM_001012755chrX13112 ------
NM_001013415chr411414 ------
NM_001013438chr31723 ----157
NM_001013635chr1211134 ------
NM_001013690chr1212344 12547 ----
NM_001013691chr191293 ------
NM_001013699chr12164 ------
NM_001014435chr16----1499 --
NM_001014839chr11928 1698 --11113
NM_001014841chr11928 1698 --11113
NM_001017371chr2--1955 ----
NM_001017388chr41495 ------
NM_001017989chr19131 ------
NM_001018090chr151160 ------
NM_001018091chr151270 ------
NM_001018102chr151160 ------
NM_001018111chr721076 364 ------
NM_001024809chr171429 ------
NM_001025109chr131031 238 88 ------
NM_001025242chrX----11314 --
NM_001025243chrX----11314 --
NM_001025252chr81636 ------
NM_001025253chr81636 ------
NM_001025366chr621428 230 ------
NM_001025366chr621428 230 ------
NM_001025367chr621428 230 ------
NM_001025367chr621428 230 ------
NM_001025368chr621428 230 ------
NM_001025368chr621428 230 ------
NM_001025369chr621444 246 ------
NM_001025369chr621444 246 ------
NM_001025370chr621428 230 ------
NM_001025370chr621428 230 ------
NM_001031623chr61414 ------
NM_001031695chr2234409 1637 1408 --11935 --
NM_001031732chr413363 ------
NM_001032280chr6169 ------
NM_001032289chrX162 ------
NM_001033045chr233316 1474 70 ------
NM_001033756chr621362 164 ------
NM_001033756chr621362 164 ------
NM_001034025chr121405 ------
NM_001037332chr512438 ------
NM_001037333chr512438 ------
NM_001037553chr2133455 912 116 ------
NM_001039091chrX2375 308 ------
NM_001039570chr2274572 4224 3428 3291 1611 1019 769 ------
NM_001039571chr2274572 4224 3428 3291 1611 1019 769 ------
NM_001039574chr11863 ------
NM_001039590chrX11049 ------
NM_001039591chrX11049 ------
NM_001039618chr1124441 764 ------
NM_001039693chr233940 3445 3055 ------
NM_001039711chr1----11069 --
NM_001039712chr1----11069 --
NM_001040110chr71549 ------
NM_001040167chr71362 --11181 --
NM_001040181chr31197 ------
NM_001040182chr31197 ------
NM_001040183chr31197 ------
NM_001040199chr31197 ------
NM_001040200chr31197 ------
NM_001040653chr341674 911 883 663 ------
NM_001042399chr12144 ------
NM_001042413chr911201 ------
NM_001042425chr6169 ------
NM_001042498chrX1199 ------
NM_001079874chr11527 ------
NM_001113490chrX32743 2347 1017 ------
NM_001146chr821728 198 ------
NM_001172chr141158 ------
NM_001204chr225875 1161 ------
NM_001221chr4187 ------
NM_001244chr911010 ------
NM_001256chr1712798 ------
NM_001267chr17130 ------
NM_001329chr101432 ------
NM_001383chr173812 780 242 ------
NM_001399chrX1156 ------
NM_001412chrX13179 ------
NM_001448chrX11352 ------
NM_001493chrX2281 136 ------
NM_001508chr2------1632
NM_001542chr132489 2282 1894 ------
NM_001569chrX----11314 --
NM_001663chr1412518 ------
NM_001683chr332448 2153 176 ------
NM_001709chr1112662 ------
NM_001759chr1215183 ------
NM_001773chr131397 604 454 ------
NM_001826chr11373 ------
NM_001933chr14192 ------
NM_001945chr51920 ------
NM_001949chr613189 ------
NM_001967chr32148 52 ------
NM_002069chr711832 ------
NM_002077chr922047 2019 ------
NM_002092chr414207 ----11177
NM_002134chr16192 ------
NM_002135chr121189 ------
NM_002137chr71352 ------
NM_002188chr51823 ------
NM_002193chr21304 ------
NM_002239chr21401 ----163
NM_002249chr11478 ------
NM_002264chr311830 ------
NM_002267chr131321 ------
NM_002269chr61287 ------
NM_002270chr513818 ------
NM_002398chr21354 ------
NM_002399chr1511405 ------
NM_002401chr1722188 664 --11592 --
NM_002481chr156616 5879 5751 2306 521 ------
NM_002576chr111790 ------
NM_002581chr913526 ------
NM_002618chr22397 169 ------
NM_002655chr834690 987 673 ------
NM_002716chr1123420 3315 --13229 --
NM_002719chr1432234 1960 175 ------
NM_002738chr162857 62 ------
NM_002753chr41132 ------
NM_002765chrX2375 308 ------
NM_002819chr1961361 1256 466 205 180 35 --21239 1236 --
NM_002843chr1123178 814 ------
NM_002852chr31460 ------
NM_002994chr41346 ------
NM_002997chr211321 ------
NM_003099chr1534691 1680 34 ------
NM_003106chr31210 1441 ----
NM_003107chr631816 275 174 --3872 869 177 1575
NM_003108chr266712 2735 2338 2036 2006 178 --22888 2885 --
NM_003111chr2--1955 ----
NM_003144chr61144 ------
NM_003164chr111511 ------
NM_003170chr171143 ------
NM_003178chr3--11850 ----
NM_003220chr6169 ------
NM_003253chr211526 ------
NM_003340chr411405 ------
NM_003342chr1732686 2635 1043 ------
NM_003356chr111913 ------
NM_003374chr51686 ------
NM_003376chr621428 230 ------
NM_003376chr621428 230 ------
NM_003413chrX1557 ------
NM_003468chr233824 1628 796 1118 ----
NM_003574chr1824654 99 ------
NM_003628chr2----1253 --
NM_003651chr12139 ------
NM_003654chr111278 ------
NM_003663chr31105 ------
NM_003831chr1821212 75 ------
NM_003888chr151357 ------
NM_003951chrX1264 ------
NM_003955chr1731256 568 526 ------
NM_003987chr1031818 276 98 11909 11873 22114 2105
NM_003988chr1031895 353 175 11986 11950 22191 2182
NM_003989chr1031754 212 34 11845 11809 22050 2041
NM_003990chr1031754 212 34 11845 11809 22050 2041
NM_004006chrX22146 41 ------
NM_004007chrX22146 41 ------
NM_004009chrX22146 41 ------
NM_004010chrX22146 41 ------
NM_004011chrX22146 41 ------
NM_004012chrX22146 41 ------
NM_004013chrX22146 41 ------
NM_004014chrX22146 41 ------
NM_004015chrX22146 41 ------
NM_004016chrX12060 ------
NM_004017chrX22146 41 ------
NM_004018chrX12060 ------
NM_004020chrX22146 41 ------
NM_004021chrX12060 ------
NM_004022chrX12060 ------
NM_004023chrX12060 ------
NM_004074chr111155 ------
NM_004113chr31431 ------
NM_004136chr1521031 264 ------
NM_004161chr221341 1224 ------
NM_004235chr91279 ------
NM_004272chr51622 ------
NM_004293chr911432 ----1634
NM_004311chr1012878 ------
NM_004389chr21705 ------
NM_004442chr12380 327 ------
NM_004500chr1411598 ------
NM_004515chr1178 ------
NM_004569chr141150 ------
NM_004580chr152623 443 ------
NM_004588chr1111380 ----1501
NM_004593chr31110 ------
NM_004615chrX1339 ------
NM_004630chr113828 365 316 --1322 1320
NM_004634chr31426 ------
NM_004673chr111188 ------
NM_004685chr1312728 ------
NM_004687chr171259 ------
NM_004711chr2243632 3622 3311 318 1354 ----
NM_004719chr1212164 ------
NM_004726chrX131 ------
NM_004745chr842626 2470 156 63 26744 182 --1657
NM_004774chr1712666 ------
NM_004776chr2022564 1296 ------
NM_004805chr221185 182 ------
NM_004824chr6123 ------
NM_004834chr2--1516 --1370
NM_004849chr61366 ------
NM_004860chr171497 ------
NM_004866chr524359 279 ------
NM_004906chr61570 ------
NM_004926chr1421304 500 ------
NM_004951chr13129 ------
NM_004966chr101807 ------
NM_004973chr611458 ------
NM_004976chr1154586 3511 740 133 71 129 13389 --
NM_004978chr121526 87 ----1300
NM_004979chrX11068 ------
NM_005003chr16--151 ----
NM_005011chr71549 ------
NM_005076chr133717 2791 817 ----1743
NM_005079chr81636 ------
NM_005096chrX168 1507 ----
NM_005114chr41522 ------
NM_005124chr62957 208 ------
NM_005126chr3----11794 --
NM_005156chr9--13767 ----
NM_005182chr16----1499 --
NM_005184chr1911105 --124 --
NM_005188chr1137333 7096 92 ------
NM_005197chr1411973 --14967 --
NM_005238chr1113413 ------
NM_005241chr321141 904 ------
NM_005277chr41120 ------
NM_005339chr41549 ------
NM_005397chr721076 364 ------
NM_005402chr71327 ------
NM_005413chr21327 ------
NM_005433chr1822281 255 ------
NM_005476chr91113 ------
NM_005502chr91461 ------
NM_005517chr1138 ------
NM_005595chr1----1249 --
NM_005596chr91550 --1532 15981
NM_005604chr611927 ------
NM_005607chr81344 ------
NM_005610chr11868 ------
NM_005618chr61213 ------
NM_005655chr81155 ------
NM_005667chr21111 ------
NM_005676chrX1152 ------
NM_005700chr111138 ------
NM_005734chr111228 ------
NM_005779chr51959 ------
NM_005841chr411150 ------
NM_005842chr131224 ------
NM_005900chr41482 ------
NM_005903chr521554 864 ------
NM_005909chr5--13215 ----
NM_005922chr61127 ------
NM_005955chr125327 5242 ------
NM_005963chr17124 ------
NM_005966chr222345 897 ------
NM_006007chr924306 3136 ------
NM_006015chr131019 957 456 ------
NM_006047chr2012692 ------
NM_006048chr111267 ------
NM_006067chr161791 ------
NM_006080chr712815 ------
NM_006095chr411071 ------
NM_006113chr11527 ------
NM_006135chr121348 1141 ------
NM_006148chr1722962 2003 --1454 --
NM_006166chr1212291 ------
NM_006191chr121903 ------
NM_006306chrX25819 4298 25523 1352 ----
NM_006464chr234064 2936 241 --13410 --
NM_006469chr111343 ------
NM_006474chr12731 134 ------
NM_006599chr1622873 959 ------
NM_006609chr2--1364 ----
NM_006618chr111434 ------
NM_006624chr1011483 ------
NM_006658chr7155 ------
NM_006706chr5----1289 --
NM_006717chr922310 517 ------
NM_006722chr312069 ------
NM_006724chr61127 ------
NM_006734chr621136 1006 ------
NM_006766chr812541 ------
NM_006775chr612062 ------
NM_006815chr1211271 ------
NM_006876chr111591 ------
NM_006887chr21105 ------
NM_006920chr2129 ------
NM_006924chr1713016 ------
NM_006950chrX1840 ------
NM_007011chr1566408 5730 5011 4976 1712 230 --14895 --
NM_007030chr5124967 3893 3858 3823 3788 3753 3718 3683 3648 1136 683 131 ------
NM_007033chr11206 ------
NM_007038chr2135290 5091 192 ------
NM_007068chr221922 ------
NM_007159chr311746 ------
NM_007166chr111247 ------
NM_007174chr123935 638 474 ------
NM_007182chr31736 ------
NM_007203chr91228 ----1347
NM_007218chr81195 ------
NM_007249chr1321230 571 ------
NM_007275chr311081 ------
NM_007308chr41505 ------
NM_012110chr4179 ------
NM_012193chr1133844 3537 321 ------
NM_012215chr1011818 ------
NM_012247chr101113 ------
NM_012287chr32593 37 ------
NM_012297chr41707 ------
NM_012316chr145183 4870 1008 371 ------
NM_012330chr102699 441 ------
NM_012338chr71499 ------
NM_012343chr51856 ------
NM_012381chr6155 ------
NM_013232chr51431 ------
NM_013438chr91268 ------
NM_013449chr121448 ------
NM_014038chr71328 ------
NM_014141chr745136 4678 3923 796 ------
NM_014155chr1167135 6970 6661 5793 5434 4747 ------
NM_014166chr13186 ------
NM_014178chr142416 21 ------
NM_014190chr421412 263 ------
NM_014203chr19191 ------
NM_014220chr31776 ------
NM_014253chrX1141 11710 ----
NM_014279chr9--1678 ----
NM_014284chr11928 1698 --11113
NM_014309chr2234399 1627 1398 --11925 --
NM_014372chr111367 ------
NM_014376chr512438 ------
NM_014417chr192360 266 ------
NM_014421chr41180 ------
NM_014488chr11------177
NM_014665chr861404 1309 1275 1262 1254 1020 13183 33440 3218 1415 --
NM_014705chr7125 ------
NM_014720chr102234 225 ------
NM_014743chr431168 843 495 ------
NM_014746chr214410 ------
NM_014830chr1233258 3119 2590 ------
NM_014838chr2222153 247 ------
NM_014848chr151178 ------
NM_014873chr134266 1569 1054 ------
NM_014876chr2221464 51 ------
NM_014891chr711130 ----11498
NM_014901chr5----11516 --
NM_014905chr21607 ------
NM_014908chr9125 ------
NM_014950chr141217 ------
NM_014961chr41608 ------
NM_014996chr31178 ------
NM_015002chr1221570 265 ------
NM_015023chr1----11833 --
NM_015032chr132225 143 ------
NM_015054chr121139 ------
NM_015063chr192256 228 ------
NM_015074chr134100 1330 85 ------
NM_015093chr611235 ------
NM_015100chr111474 ------
NM_015101chr11660 ------
NM_015158chr9166 ------
NM_015163chr141351 ------
NM_015170chr81209 --1494 --
NM_015238chr52630 550 ------
NM_015254chr852401 2123 1134 1015 145 ----1115
NM_015263chr151886 ------
NM_015265chr21598 ------
NM_015267chr1212002 ------
NM_015272chr161707 ------
NM_015288chr51342 ------
NM_015293chr61182 ------
NM_015313chr11122 ------
NM_015335chr1222060 227 ------
NM_015339chr202237 26 ------
NM_015526chr191305 ------
NM_015532chr151160 ------
NM_015555chr61414 ------
NM_015564chr522260 90 ------
NM_015601chr10184 ------
NM_015609chr122566 971 ------
NM_015678chr1311227 ------
NM_015691chrX22063 171 ------
NM_015898chr1922329 1801 ------
NM_015906chr123578 859 ------
NM_015995chr1545562 5135 3687 1955 ------
NM_016018chr8------1541
NM_016032chrX11414 ------
NM_016059chr61241 ------
NM_016107chr51983 ------
NM_016122chr12144 ------
NM_016169chr1033226 3172 863 ------
NM_016255chr61126 ------
NM_016257chr112272 ------
NM_016441chr2------1819
NM_016504chr17284 43 ------
NM_016545chr11820 ------
NM_016604chr51937 ------
NM_017412chr81315 ------
NM_017423chr412223 ------
NM_017432chr193339 136 69 ------
NM_017449chr12380 327 ------
NM_017450chr1741151 1019 508 142 ------
NM_017488chr21521 ------
NM_017593chr41443 ------
NM_017626chr10161 ------
NM_017628chr424218 1582 ------
NM_017637chr939197 7823 6444 ------
NM_017658chr141392 ------
NM_017668chr161727 ------
NM_017694chr211686 ------
NM_017741chr41430 ------
NM_017742chr1821291 361 ------
NM_017787chr1052850 1082 989 890 605 ------
NM_017873chr91849 ------
NM_017902chr10133 ------
NM_017933chr211417 ------
NM_018011chr131224 ------
NM_018030chr181162 ------
NM_018054chr161552 ------
NM_018077chr7149 ------
NM_018112chr91119 ------
NM_018157chr121155 ------
NM_018178chr1143 ------
NM_018216chr11109 ------
NM_018221chr21358 ------
NM_018234chr21741 ----1820
NM_018299chr812111 ------
NM_018315chr411414 ------
NM_018327chr2021428 1257 ------
NM_018440chr847845 6399 5778 536 ------
NM_018451chr131863 ------
NM_018469chr171507 ------
NM_018688chr8132 ------
NM_019027chr412322 ------
NM_019053chr101690 ------
NM_019102chr7166 ------
NM_019102chr7166 ------
NM_019106chr2223353 3239 ------
NM_019895chr31197 ------
NM_020132chr2133455 912 116 ------
NM_020211chr151190 ------
NM_020310chr1741892 982 533 309 ----12101
NM_020457chr162202 139 ------
NM_020466chr634818 1963 557 ------
NM_020644chr11123 ------
NM_020651chr211168 ------
NM_020689chr2011712 ------
NM_020699chr111848 ------
NM_020711chr211892 ------
NM_020715chr1421833 84 ------
NM_020752chr1022899 2114 ------
NM_020772chr1718124 ----17545
NM_020778chr1534954 1806 489 ------
NM_020805chr182213 56 ------
NM_020808chr12352 249 ------
NM_020899chr17--11748 12236 12001
NM_020952chr91150 ------
NM_020975chr1012041 ------
NM_021012chr1722374 2180 ----13190
NM_021032chr31431 ------
NM_021045chr10----11983 --
NM_021072chr511954 ------
NM_021079chr172184 167 ------
NM_021097chr212078 ------
NM_021120chrX32264 1136 473 ------
NM_021148chr712178 ------
NM_021177chr6140 ------
NM_021202chr2012971 ------
NM_021215chr2042425 2212 1699 190 ------
NM_021229chr121339 ------
NM_021622chr101553 ------
NM_021627chr31788 ------
NM_021647chr411739 ------
NM_021911chr51103 ------
NM_021912chr1524051 1083 ------
NM_021946chrX--1505 ----
NM_021964chr325416 4217 ------
NM_022079chr10184 ------
NM_022117chrX1110 ------
NM_022143chr711096 ------
NM_022465chr1212194 ------
NM_022470chr311260 ------
NM_022484chr711319 ------
NM_022716chr113066 ------
NM_022719chr2253165 2953 989 409 390 ------
NM_022726chr61648 ------
NM_022763chr31881 ------
NM_022802chr101432 ------
NM_022810chrX1264 ------
NM_022824chr51611 ------
NM_022913chr5--1277 ----
NM_023008chr191226 ------
NM_024007chr521976 693 ------
NM_024085chr21807 --1882 --
NM_024740chr1123645 613 ------
NM_024744chr2137 ------
NM_024770chr222173 902 ------
NM_024804chr11353 ------
NM_024814chr71268 ------
NM_024881chr1922333 32 --12761 --
NM_024887chr131529 1467 640 --11925 --
NM_024971chr91150 ------
NM_025133chr211021 ------
NM_025191chr111192 ------
NM_030576chr1712520 --11970 --
NM_030581chr16156 ------
NM_030648chr421934 101 ------
NM_030664chr10----12366 --
NM_030761chr112693 ------
NM_030806chr158113 6760 3004 1992 604 ------
NM_031243chr71352 ------
NM_031314chr1411598 ------
NM_031372chr4------11638
NM_031954chr1242914 2676 2619 373 ------
NM_031990chr1961361 1256 466 205 180 35 --21239 1236 --
NM_031991chr1961361 1256 466 205 180 35 --21239 1236 --
NM_032052chr22122 ------
NM_032144chr211249 ------
NM_032205chr8142 ------
NM_032221chr201276 ------
NM_032239chr41546 ------
NM_032320chr11146 ------
NM_032468chr811229 ------
NM_032550chr1021159 49 ------
NM_032575chr16----11827 --
NM_032632chr141124 ------
NM_032634chr91263 ------
NM_032946chrX1492 ------
NM_032998chr1----11069 --
NM_033020chr123578 859 ------
NM_033071chr61182 ------
NM_033089chr201180 ------
NM_033132chr131316 ------
NM_033224chr71170 ------
NM_033315chr1722154 101 ------
NM_033540chr3122 ------
NM_033624chr1221570 265 ------
NM_033632chr411414 ------
NM_052851chr13--151 ----
NM_052885chr12165 ------
NM_052954chr21137 ------
NM_052970chr201919 ------
NM_053067chr91268 ------
NM_053279chr852394 2363 787 765 123 ------
NM_080597chr181162 ------
NM_080927chr322889 128 ------
NM_130443chr111138 ------
NM_130787chr19191 ------
NM_133264chr1713563 ------
NM_133265chrX32743 2347 1017 ------
NM_133370chr413363 ------
NM_133468chr73977 520 38 ------
NM_133499chrX1910 ------
NM_133650chr61182 ------
NM_138278chr11200 1890 ----
NM_138288chr1411905 ------
NM_138713chr1622873 959 ------
NM_138714chr1622873 959 ------
NM_138731chr14144 ------
NM_138981chr41132 ------
NM_139015chr1211254 ------
NM_139135chr131019 957 456 ------
NM_139314chr19143 ------
NM_144571chr414490 ------
NM_144586chr21386 ------
NM_145055chr182647 272 ------
NM_145176chr612280 ------
NM_145206chr101104 ------
NM_145303chr61508 ------
NM_145686chr2--1516 --1370
NM_145687chr2--1516 --1370
NM_145733chr2221142 1028 ------
NM_145735chr1312704 --12348 --
NM_147150chr91228 ----1347
NM_147175chrX11537 ------
NM_148570chr17284 43 ------
NM_148955chr1534691 1680 34 ------
NM_152240chr311260 ------
NM_152287chr1622371 1979 12578 1424 --
NM_152344chr1711105 ------
NM_152437chr121597 ------
NM_152512chr221409 ------
NM_152529chr233316 1474 70 ------
NM_152534chr31141 ------
NM_152607chr11168 ------
NM_152629chr911201 ------
NM_152721chr181666 ------
NM_152753chr612077 ------
NM_152758chr821858 106 ------
NM_152826chr1534691 1680 34 ------
NM_152835chr1--1537 ----
NM_152838chr2012692 ------
NM_152856chrX1152 ------
NM_152860chr121589 ------
NM_152924chr1566408 5730 5011 4976 1712 230 --14895 --
NM_153186chr9166 ------
NM_153188chr513818 ------
NM_153451chr11152 ------
NM_153634chr1211395 ------
NM_153756chr111472 ------
NM_153757chr41889 ------
NM_153812chr122377 174 ------
NM_153825chr4----11591 --
NM_153831chr81344 ------
NM_170674chr1511405 ------
NM_170675chr1511081 ------
NM_170676chr1511081 ------
NM_170677chr1511405 ------
NM_170696chr151357 ------
NM_170697chr151357 ------
NM_170712chr31736 ------
NM_170713chr31736 ------
NM_170714chr31736 ------
NM_170731chr1112662 ------
NM_170732chr1112662 ------
NM_170733chr1112662 ------
NM_170734chr1112662 ------
NM_170735chr1112662 ------
NM_170751chr6123 ------
NM_170752chr6123 ------
NM_170782chr11478 ------
NM_172071chr115676 ------
NM_172127chr4198 ------
NM_172128chr4154 ------
NM_172315chr1511405 ------
NM_172316chr1511405 ------
NM_172375chr143228 151 57 ------
NM_173156chr11583 ------
NM_173157chr121189 ------
NM_173163chr161432 ------
NM_173165chr161313 ------
NM_173214chr1622873 959 ------
NM_173472chr3155 ------
NM_173475chr162632 580 ------
NM_173478chr172771 344 ------
NM_173510chr2231181 443 289 ------
NM_173576chr102667 522 ------
NM_173633chr19291 31 ------
NM_173825chr322638 1990 ------
NM_173851chr833903 1258 1208 ------
NM_174936chr111234 ------
NM_175058chr113345 256 178 ------
NM_175847chr1961361 1256 466 205 180 35 --21239 1236 --
NM_175866chr11370 ------
NM_175895chr12137 145 4389 314 210 23 --
NM_175898chr152615 198 ------
NM_176801chr421412 263 ------
NM_178006chr13--151 ----
NM_178007chr13--151 ----
NM_178314chr121538 196 ----
NM_178439chr21125 ------
NM_178505chr1033436 1409 1032 --13282 --
NM_178566chr911834 ------
NM_178586chr1432234 1960 175 ------
NM_181351chr111735 12712 11884 --
NM_181442chr202237 26 ------
NM_181458chr211185 ------
NM_181837chr6155 ------
NM_181886chr411405 ------
NM_181887chr411405 ------
NM_181888chr411405 ------
NM_181889chr411405 ------
NM_181890chr411405 ------
NM_181891chr411405 ------
NM_181892chr411452 ------
NM_181893chr411405 ------
NM_182485chr411043 ------
NM_182503chr635265 4312 1199 --14319 --
NM_182646chr411043 ------
NM_182691chr7166 ------
NM_182692chr7166 ------
NM_182700chr71619 ------
NM_182758chr1513146 ------
NM_182767chr121618 ------
NM_182915chr21741 ----1820
NM_182961chr61182 ------
NM_182972chr11254 ------
NM_182977chr51856 ------
NM_183234chr152623 443 ------
NM_183235chr152623 443 ------
NM_183236chr152623 443 ------
NM_194434chr1824654 99 ------
NM_198042chr8------137
NM_198077chr11202 ------
NM_198158chr312069 ------
NM_198159chr312069 ------
NM_198177chr312069 ------
NM_198178chr312069 ------
NM_198270chrX23431 2360 ------
NM_198463chr3197 ------
NM_198581chr21844 ------
NM_198956chr71619 ------
NM_198991chr181264 ------
NM_198995chr182233 188 ------
NM_199000chr712200 ------
NM_199168chr1011138 ------
NM_199320chr41913 ------
NM_199320chr41913 ------
NM_199327chr411150 ------
NM_199461chr101438 ------
NM_201568chr11583 ------
NM_201569chr11583 ------
NM_201591chr41120 ------
NM_201592chr41120 ------
NM_201599chrX168 1507 ----
NM_203351chr1722188 664 --11592 --
NM_203504chr41707 ------
NM_203505chr41707 ------
NM_205861chr131529 1467 640 --11925 --
NM_206853chr612912 ------
NM_206854chr614173 ------
NM_206855chr615138 ------
NM_206944chr91150 ------
NM_206945chr91150 ------
NM_206946chr91150 ------
NM_206947chr91150 ------
NM_207015chr31689 ------
NM_207171chr111474 ------
NM_207306chr154104 3817 3733 389 95 --11568 --
NM_207404chr312197 ------
NM_207577chr1122862 2500 --1923 --