TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1182
miRNA Sequence: GAGGGUCUUGGGAGGGAUGUGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr12112178 1829 1790 1598 1580 962 826 769 694 419 338 ------
NM_000024chr53433 412 26 ------
NM_000053chr1351676 558 397 302 196 1249 ----
NM_000084chrX56659 6124 4926 2469 1015 ------
NM_000109chrX12155 ------
NM_000110chr1172 --1752 --
NM_000112chr533985 3869 1140 --25521 3656 --
NM_000125chr673947 1240 1168 1127 988 623 346 11642 --13102
NM_000139chr112756 201 --22343 1832 --
NM_000141chr1011272 --11125 11006
NM_000167chrX3320 145 133 11132 ----
NM_000178chr20286 25 ------
NM_000202chrX93933 3766 3702 2795 2589 2541 1512 1495 763 ----12805
NM_000208chr1954570 3739 3167 3072 1449 23256 94 --11702
NM_000216chrX43711 3684 112 105 1743 ----
NM_000217chr1274675 4079 3258 1913 1836 1217 193 13470 34720 1751 969 --
NM_000222chr411351 --11379 --
NM_000259chr1575825 5131 5015 5005 3905 2422 1578 ----16157
NM_000264chr933079 1121 867 23275 771 1818 --
NM_000266chrX4752 741 315 121 ----1146
NM_000280chr111179 ------
NM_000304chr1731051 921 776 --11059 --
NM_000314chr1042661 754 548 66 11192 ----
NM_000325chr4133 126 ----
NM_000332chr646661 6598 4671 1977 ------
NM_000337chr594578 4362 4292 1991 1923 1916 1627 1239 250 --2473 107 14435
NM_000346chr17--142 11493 11639
NM_000353chr16--186 21079 175 1397
NM_000368chr9114310 4064 4029 3936 3668 3656 3577 3420 3058 1130 193 --23278 1601 --
NM_000376chr12112645 2539 2490 2429 2347 1979 969 603 403 206 61 ----12519
NM_000378chr113951 318 70 --1215 --
NM_000411chr2132482 2060 619 --22147 348 --
NM_000428chr1471742 1066 842 598 537 331 294 --21695 242 --
NM_000430chr1723545 1297 ------
NM_000449chr131306 953 173 1226 21253 60 --
NM_000450chr131838 200 93 --1295 --
NM_000451chrX71984 1974 1714 1648 643 389 277 --2362 190 --
NM_000459chr92146 131 1180 152 --
NM_000461chr373461 3363 3029 1219 1207 1163 467 --11107 --
NM_000462chr1511774 ------
NM_000476chr9101406 1112 1064 1039 973 498 458 359 326 318 ------
NM_000492chr711484 ------
NM_000499chr151160 --2611 29 --
NM_000555chrX137593 7321 7172 7046 5808 5802 4850 1974 614 526 471 414 276 --37618 7332 4802 --
NM_000572chr1----1883 130
NM_000609chr1072916 2660 2402 927 706 693 596 12036 12377 --
NM_000611chr11126559 6324 5681 5456 4876 4661 4552 2406 2171 1971 1140 100 --36194 2040 506 --
NM_000618chr12126202 6082 5832 5635 5522 5132 2414 2380 1737 1241 330 47 --24942 4526 --
NM_000618chr12126202 6082 5832 5635 5522 5132 2414 2380 1737 1241 330 47 --24942 4526 --
NM_000621chr1331321 1281 1027 ----11455
NM_000633chr18104794 4502 4196 3189 2087 1259 1209 1177 1165 1033 --21252 580 --
NM_000668chr431117 507 357 ----11310
NM_000684chr101826 ------
NM_000734chr16838 694 257 229 216 35 ------
NM_000793chr1454789 4636 4487 4330 237 --24157 3774 1506
NM_000814chr1543911 3729 2924 667 --12647 --
NM_000817chr2----11138 --
NM_000820chr13--1277 ----
NM_000828chrX51500 435 191 133 68 ------
NM_000834chr123799 263 137 --11153 --
NM_000842chr11----1528 --
NM_000844chr33397 240 74 --139 --
NM_000875chr1555222 4959 4307 2012 1924 --15094 16307
NM_000899chr1223887 718 1243 ----
NM_000903chr1621572 1147 ------
NM_000921chr12----152 --
NM_000922chr113988 143 94 ------
NM_000933chr2021139 31 ------
NM_000965chr321066 288 ------
NM_001001331chr342073 1917 1871 40 --2433 160 --
NM_001001436chr16172 ------
NM_001001875chr91288 ------
NM_001001936chr1061162 784 408 369 215 43 --125 --
NM_001002762chr1092907 2286 2002 1005 619 374 285 142 80 ----12898
NM_001002814chr853411 1396 689 681 283 --43114 2529 1322 1287 --
NM_001002838chrX----1464 11323
NM_001002840chr74716 311 127 110 ------
NM_001002914chr1751104 822 336 205 105 ------
NM_001003652chr1877802 6857 6413 5791 3413 3407 1372 1614 38290 5296 1084 --
NM_001003665chr1133170 3114 2428 2388 1268 1130 538 430 416 368 76 37 26 12923 12328 --
NM_001003674chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_001003675chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_001003760chr642758 2585 1129 688 2902 634 12240 13682
NM_001003800chr983582 2984 2844 2437 1433 1414 1364 743 --1794 --
NM_001003927chr17----2534 113 --
NM_001003940chr15183676 3406 3086 2680 2595 2561 1485 1444 1409 998 991 873 729 657 628 451 399 171 --1189 --
NM_001003942chr15183676 3406 3086 2680 2595 2561 1485 1444 1409 998 991 873 729 657 628 451 399 171 --1189 --
NM_001003943chr15183680 3410 3090 2684 2599 2565 1489 1448 1413 1002 995 877 733 661 632 455 403 175 --1193 --
NM_001004065chr923122 2856 --1187 12976
NM_001004317chr611279 ----1977
NM_001004419chr1274124 4017 3689 3471 1810 1186 624 ------
NM_001005375chrY21377 93 11709 1223 11415
NM_001005404chr17123195 3079 2907 2897 2891 2871 1582 1389 714 609 464 214 --33389 2829 272 --
NM_001005463chr1021917 963 --1856 12544
NM_001005473chr566074 6043 5135 4967 4833 4065 ------
NM_001005526chr2------187
NM_001005609chrX133720 3629 3547 3297 3243 2654 2506 1500 1444 1054 736 275 186 --43576 3184 709 374 --
NM_001005785chrY21377 93 11709 1223 11415
NM_001005786chrY21377 93 11709 1223 11415
NM_001006115chr3102713 2342 2163 2064 1862 1122 1019 963 539 349 1558 ----
NM_001006657chr212730 --1935 12485
NM_001007023chr1454789 4636 4487 4330 237 --24157 3774 1506
NM_001007024chr1751769 1520 1032 140 21 11537 24096 1743 --
NM_001007025chr1751769 1520 1032 140 21 11537 24096 1743 --
NM_001007027chr111225 ------
NM_001007097chr974415 4142 4010 3667 3396 2008 1265 1349 23335 1719 --
NM_001007237chr162882 2531 2457 1927 1810 217 ------
NM_001007246chr21--11402 11580 11364
NM_001007464chr6--1157 ----
NM_001008220chr5123742 3712 3569 3408 2778 2741 2624 2485 783 649 486 387 --43968 3483 2493 501 --
NM_001008272chr3188 ------
NM_001008273chr3188 ------
NM_001008529chr1731263 256 238 --2338 204 --
NM_001008541chr101592 ----11449
NM_001008541chr101592 ----11449
NM_001008660chr113592 394 147 --11554 --
NM_001008701chr1982681 2510 2281 2251 1995 859 404 262 2158 137 1314 --
NM_001008801chr1912126 --126 --
NM_001009554chr433387 1742 1698 --1100 --
NM_001009554chr433387 1742 1698 --1100 --
NM_001009880chr2264507 4298 4281 4202 1483 851 13290 13778 --
NM_001009909chr1143799 1087 1035 170 --12841 --
NM_001009959chr222394 120 22127 1939 21695 465 --
NM_001009993chr244052 3457 178 151 --13794 14235
NM_001010853chr6--1969 12621 --
NM_001010861chr121938 1876 12013 ----
NM_001010862chrX22863 994 21275 335 --137
NM_001010891chr545624 5546 1319 734 --36314 4993 1790 1109
NM_001010917chr1071584 1493 590 509 437 423 56 ------
NM_001010922chr134024 1413 291 33869 1661 1084 --12716
NM_001010986chrX11007 --11959 --
NM_001011513chr433244 1406 115 --22662 797 --
NM_001011553chr71344 ------
NM_001011666chr796133 6121 5951 4874 2375 530 396 98 89 15167 15138 --
NM_001011708chr221152 1110 --22421 1059 1230
NM_001011885chr1511107 --11708 --
NM_001012393chr1163517 3199 1942 1773 1140 272 24131 3620 11976 --
NM_001012398chr161245 --144 --
NM_001012418chr643537 1705 807 138 24284 1172 23090 521 --
NM_001012423chr1531882 304 22 ------
NM_001012426chr6182922 2496 2325 2132 1368 1339 1231 1206 851 637 621 432 354 305 242 126 58 36 --31170 1001 255 --
NM_001012427chr6182922 2496 2325 2132 1368 1339 1231 1206 851 637 621 432 354 305 242 126 58 36 --31170 1001 255 --
NM_001012751chr1011743 ------
NM_001012761chr562545 1647 1051 1045 828 556 ------
NM_001013031chr1062554 2485 2391 1017 645 580 ------
NM_001013620chr1258217 5990 1124 580 194 17084 28136 1103 --
NM_001013635chr123803 755 134 --11009 --
NM_001013674chr11319 ------
NM_001013690chr1292394 1849 1547 981 742 626 605 453 270 --12016 --
NM_001014283chr1332030 1752 1370 11430 21807 1449 --
NM_001014342chr121439 495 125 1681 --
NM_001014380chr1335120 3950 1308 15509 11947 --
NM_001014797chr1097001 6753 6725 5643 2803 2670 2334 962 482 --26704 817 --
NM_001015508chr8--1198 ----
NM_001015882chr91749 ------
NM_001015887chr31511 ------
NM_001017368chr1752510 2427 1772 879 687 ------
NM_001017415chr1--1701 ----
NM_001017416chr1--1701 ----
NM_001017440chr7187689 7483 7461 6513 6427 6001 5954 5779 5591 5372 5219 3200 3051 2711 2506 1027 1001 528 12202 32369 423 66 --
NM_001017535chr12112645 2539 2490 2429 2347 1979 969 603 403 206 61 ----12519
NM_001017926chr831835 640 625 --1522 --
NM_001017970chr144660 477 343 305 --22064 592 --
NM_001018037chr9--11186 11272 --
NM_001018050chr22153423 3337 3107 3064 3024 2784 2629 2508 2189 2178 2130 1249 962 258 233 125 52484 1364 1289 248 169 --
NM_001018052chr22153423 3337 3107 3064 3024 2784 2629 2508 2189 2178 2130 1249 962 258 233 125 52484 1364 1289 248 169 --
NM_001018064chr941380 791 131 24 ------
NM_001018065chr985714 4577 3986 2267 2006 1567 1225 235 12236 ----
NM_001018066chr985714 4577 3986 2267 2006 1567 1225 235 12236 ----
NM_001018067chr125026 4494 ------
NM_001018068chr125026 4494 ------
NM_001018069chr125026 4494 ------
NM_001023567chr1531903 1785 304 ------
NM_001024401chr16142849 2641 2558 2288 2251 1769 1078 938 677 529 441 238 182 24 --32512 2096 1832 --
NM_001024649chr552648 1811 1036 901 198 ------
NM_001024808chr1252505 2108 1123 870 145 1623 22722 2445 --
NM_001024855chr31271 --1508 --
NM_001024947chr5152 ------
NM_001025076chr1056109 5738 1586 194 177 --14831 --
NM_001025077chr1087467 7096 2944 1552 1535 1292 1157 1030 --16189 --
NM_001025079chr323656 232 --23725 141 --
NM_001025105chr521330 156 --1575 --
NM_001025107chr152623 2609 2424 441 201 --11684 --
NM_001025107chr152623 2609 2424 441 201 --11684 --
NM_001025266chr364833 3198 1807 733 67 32 --1384 --
NM_001025366chr61203 --3558 528 169 --
NM_001025366chr61203 --3558 528 169 --
NM_001025367chr61203 --3558 528 169 --
NM_001025367chr61203 --3558 528 169 --
NM_001025368chr61203 --3558 528 169 --
NM_001025368chr61203 --3558 528 169 --
NM_001025369chr61219 --3574 544 185 --
NM_001025369chr61219 --3574 544 185 --
NM_001025370chr61203 --3558 528 169 --
NM_001025370chr61203 --3558 528 169 --
NM_001025580chrX33716 1483 42 --34112 2700 193 159
NM_001025596chr112165 154 ------
NM_001025603chr131306 953 173 1226 21253 60 --
NM_001025780chr911556 ------
NM_001029835chr72309 76 ----1364
NM_001029851chr51131 ------
NM_001029852chr51131 ------
NM_001029853chr51131 ------
NM_001029854chr51131 ------
NM_001029858chr652718 2659 2177 587 380 --22993 2186 --
NM_001029863chr652686 2490 2120 1304 238 ------
NM_001029864chr2072144 952 675 462 304 290 188 --11974 --
NM_001029875chr511971 --32455 1843 1024 --
NM_001030007chr1651532 1446 1393 1090 155 1887 33752 989 650 --
NM_001030055chr1454621 4419 4285 3994 1008 --11074 --
NM_001031679chr1262458 2268 675 579 439 403 --22389 1121 --
NM_001031690chr772937 2458 2203 2036 786 490 209 12310 --1767
NM_001031695chr2264710 4604 3999 1976 1640 910 --11367 --
NM_001031709chr101284 ------
NM_001031740chr171683 1305 1208 158 145 133 78 11322 ----
NM_001031746chr1041282 1019 425 256 --1921 --
NM_001031804chr1633516 3153 3140 ------
NM_001031812chr511708 --121 --
NM_001032221chr941626 1188 581 327 ------
NM_001033026chr19148 ------
NM_001033045chr263996 3517 3328 2874 300 73 11065 11487 23710 622
NM_001033047chr432435 2290 1028 21793 776 22242 2130 1704
NM_001033117chr394850 1649 1579 875 662 598 525 147 91 --34599 4575 805 --
NM_001033602chr1392491 2239 2209 1093 1085 928 905 853 91 11758 ----
NM_001033659chr1721452 1092 --21110 561 1317
NM_001033723chr832202 959 31 11049 22597 1779 --
NM_001033756chr61137 --3492 462 103 --
NM_001033756chr61137 --3492 462 103 --
NM_001035chr11299 --1327 --
NM_001035512chr141531 1445 875 765 --1112 11429
NM_001035513chr141531 1445 875 765 --1112 11429
NM_001035521chr22148 117 1626 121 --
NM_001037317chr121938 1876 12013 ----
NM_001037339chr12510 89 11402 ----
NM_001037340chr12510 89 11402 ----
NM_001037341chr12510 89 11402 ----
NM_001037341chr12510 89 11402 ----
NM_001038702chr562567 1877 1809 943 613 378 ------
NM_001039141chr2272116 2059 1107 1021 572 470 446 --124 --
NM_001039479chr1451895 1864 1631 892 412 182 1347 --
NM_001039538chr243060 2862 1465 1372 --13407 --
NM_001039547chr377646 6279 6080 5442 2842 1852 1090 17734 25751 4880 17800
NM_001039570chr2264251 3751 3693 3488 245 224 --74434 4382 3943 3362 1624 1033 90 --
NM_001039571chr2264251 3751 3693 3488 245 224 --74434 4382 3943 3362 1624 1033 90 --
NM_001039585chr122722 825 --32685 1666 80 --
NM_001039618chr1175075 4666 4640 4591 1637 891 426 14445 ----
NM_001039690chr1682197 2117 691 533 412 376 370 364 ----1738
NM_001039693chr263943 3930 3219 868 572 495 --13068 11151
NM_001039697chr911403 --1458 11108
NM_001039762chr1021835 931 ------
NM_001039802chr13972 332 153 --21231 1218 --
NM_001039840chrX65480 4404 4230 1996 1179 839 --11035 14257
NM_001039937chr1343096 2648 271 162 --23926 137 --
NM_001039960chr124571 536 294 109 --11529 --
NM_001040002chr1721160 124 ----1251
NM_001040057chr71543 1370 ----
NM_001040102chr1042333 1848 564 28 ----1243
NM_001040103chr1042333 1848 564 28 ----1243
NM_001040144chr1682197 2117 691 533 412 376 370 364 ----1738
NM_001040146chr1682197 2117 691 533 412 376 370 364 ----1738
NM_001040152chr754440 3849 1866 1703 614 --11337 --
NM_001040153chr13----1896 11000
NM_001040214chr642300 499 269 35 ----11586
NM_001040429chr1332906 2381 2356 12835 1499 --
NM_001040446chr511758 --2810 354 --
NM_001040624chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040625chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040626chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040627chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040628chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040629chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040630chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_001040633chr7----1212 11067
NM_001040709chr162436 2099 1874 450 245 69 --1946 12405
NM_001042388chr181339 --1104 --
NM_001042404chr111312 --1519 --
NM_001042406chr6--2857 505 1126 --
NM_001042413chr94384 308 113 36 22580 354 13515 11351
NM_001042453chrX2531 35 1324 1588 --
NM_001042479chrX21975 1347 1395 ----
NM_001042480chrX21975 1347 1395 ----
NM_001042486chr2031489 1418 437 --1111 --
NM_001042510chr82193 37 ----156
NM_001042511chr82193 37 ----156
NM_001042543chr421319 1114 --11313 --
NM_001042603chr1275179 5111 4810 4176 3701 3259 159 --14912 154
NM_001042632chr2052434 989 519 441 391 12424 42342 1921 463 431 --
NM_001042633chr2052434 989 519 441 391 12424 42342 1921 463 431 --
NM_001042724chr19--1286 1562 --
NM_001044385chr253981 3918 3647 1117 734 --14010 1961
NM_001044722chr511708 --121 --
NM_001044723chr511708 --121 --
NM_001079874chr121736 492 --31863 1548 1507 --
NM_001092chr1782408 2151 1886 1603 877 628 431 112 11674 21705 561 --
NM_001094chr173149 54 47 --140 --
NM_001099678chr365225 5135 4493 3923 1033 834 --14401 15008
NM_001100108chr186749 6430 6375 5680 2031 366 132 96 23160 578 68301 7861 6650 3224 2886 1360 --
NM_001106chr3178368 8018 7367 6918 6906 3875 3567 3372 2826 2237 1953 1946 1202 1116 841 759 29 --16932 --
NM_001111chr152623 2609 2424 441 201 --11684 --
NM_001113490chrX33042 2787 2393 ------
NM_001116chr1632248 2092 779 ------
NM_001117chr1821838 937 12117 21564 682 --
NM_001121chr1011312 ------
NM_001122631chr111491 ------
NM_001128chr1651532 1446 1393 1090 155 1887 33752 989 650 --
NM_001140chr171462 1187 ----
NM_001167chrX46282 4753 4490 2092 14707 25448 1510 --
NM_001173chr1454621 4419 4285 3994 1008 --11074 --
NM_001218chr1542358 1748 136 38 22521 51 22390 1940 1650
NM_001222chr1031754 1577 565 21648 792 11953 --
NM_001254chr172829 105 --1213 --
NM_001256chr1731049 426 144 --21030 823 --
NM_001265chr135119 111 83 69 60 ------
NM_001271chr1522973 2314 32025 376 64 ----
NM_001273chr12142 --191 --
NM_001304chr171968 12669 22620 88 --
NM_001331chr1182803 2587 2487 1944 1840 868 661 572 11801 ----
NM_001332chr5--2425 215 ----
NM_001343chr531449 1341 575 ----1227
NM_001351chr311351 11682 1135 --
NM_001364chr1143570 3040 1695 838 --34441 3674 3487 23091 3029
NM_001389chr21----1163 --
NM_001396chr211688 --12653 --
NM_001399chrX133720 3629 3547 3297 3243 2654 2506 1500 1444 1054 736 275 186 --43576 3184 709 374 --
NM_001418chr111291 ------
NM_001418chr111291 ------
NM_001419chr1993683 3664 3621 3275 3226 1907 1783 1712 623 13866 34151 1883 950 --
NM_001423chr123705 677 356 --1631 --
NM_001426chr24525 297 222 194 ------
NM_001430chr232036 1296 555 --11435 --
NM_001438chr141300 1258 600 501 --11413 --
NM_001448chrX21569 1355 ------
NM_001497chr972659 2500 1772 1728 1051 580 26 12803 12076 --
NM_001521chr22148 117 1626 121 --
NM_001542chr162882 2531 2457 1927 1810 217 ------
NM_001543chr5104550 4340 4047 3962 1450 1317 1206 901 822 70 11846 44823 4227 1471 291 33622 1656 1194
NM_001560chrX21777 35 1467 2952 786 --
NM_001604chr111179 ------
NM_001609chr1034335 2815 199 --23483 3169 13970
NM_001616chr222517 38 --1133 --
NM_001620chr11----1122 --
NM_001661chr173509 501 274 1264 ----
NM_001663chr141587 --22578 893 --
NM_001665chr111543 ------
NM_001679chr3168 ------
NM_001682chr1211986 12103 11059 --
NM_001683chr342073 1917 1871 40 --2433 160 --
NM_001693chr821292 397 ----2325 180
NM_001699chr1931814 1533 716 11348 11370 1266
NM_001701chr921406 53 ------
NM_001704chr61111 ------
NM_001719chr20147 --2101 22 --
NM_001746chr552648 1811 1036 901 198 ------
NM_001755chr1621843 765 ------
NM_001759chr1234090 3792 3570 ----14627
NM_001768chr241010 1004 482 425 --2863 41 --
NM_001769chr12------1308
NM_001773chr121450 56 21199 514 2578 192 --
NM_001777chr323656 232 --23725 141 --
NM_001788chr71344 ------
NM_001791chr13972 332 153 --21231 1218 --
NM_001802chr16----179 --
NM_001825chr5----1107 --
NM_001842chr96497 244 190 139 105 71 ------
NM_001854chr1--2540 459 ----
NM_001856chr13357 66 31 ------
NM_001859chr923518 2414 --12679 12516
NM_001892chr521330 156 --1575 --
NM_001901chr6--1941 ----
NM_001918chr199228 6519 5771 5660 3190 2063 1586 657 339 --22626 987 --
NM_001923chr11130 --1468 --
NM_001941chr1823920 1083 ------
NM_001957chr42779 94 --22287 672 --
NM_001971chr12125 ------
NM_001977chr431187 682 468 ----11071
NM_001980chr124596 207 120 36 --1739 --
NM_001987chr1294059 3084 2860 1686 1498 1363 1022 354 156 14143 --13025
NM_001999chr51146 --1171 --
NM_002014chr12----1104 --
NM_002025chrX118922 7782 7703 7226 6858 6394 6240 6214 2467 1696 1410 18028 38780 8388 2021 --
NM_002032chr111359 ------
NM_002035chr1872802 1584 1503 1202 747 554 66 --13406 --
NM_002040chr2142068 1008 619 22 ------
NM_002055chr1761255 665 557 470 450 97 ------
NM_002063chrX126 ------
NM_002099chr421897 795 11890 ----
NM_002106chr4--135 ----
NM_002112chr15146 ------
NM_002126chr1753314 2867 611 413 386 --11180 --
NM_002193chr261389 1283 1227 664 637 578 ------
NM_002204chr17101287 1226 1119 1095 1032 931 553 348 170 53 1387 11044 --
NM_002205chr1210777 734 726 720 691 662 626 260 246 203 --1834 --
NM_002211chr102787 251 ------
NM_002213chr31244 --2446 117 --
NM_002214chr734306 3707 3510 --34467 1866 282 --
NM_002223chr1263491 3361 3298 1579 967 186 --23714 1294 --
NM_002232chr121380 428 ----11077
NM_002235chr123690 479 105 --11434 --
NM_002246chr261095 780 335 189 97 46 --21262 319 --
NM_002267chr13--12249 ----
NM_002293chr132654 1076 93 11797 ----
NM_002310chr552442 2123 1867 803 91 --24609 2431 15091
NM_002317chr51270 ------
NM_002334chr1151803 1507 1501 215 82 --21707 1482 --
NM_002356chr632425 904 190 32219 1994 762 ----
NM_002374chr243060 2862 1465 1372 --13407 --
NM_002397chr541823 1691 1636 439 11491 11863 12140
NM_002398chr22451 281 ------
NM_002399chr155967 554 284 222 159 --1540 --
NM_002401chr1761796 1773 1675 637 509 214 ----12068
NM_002429chr121241 11394 21568 1074 --
NM_002444chrX21773 24 --1679 1741
NM_002469chr123479 53 43 --122 --
NM_002470chr17188 ------
NM_002495chr51108 ------
NM_002501chr19144116 3737 3556 3332 3152 1647 1052 861 794 788 561 538 306 201 ------
NM_002507chr1781941 1882 782 727 600 391 382 145 1428 ----
NM_002515chr1421787 1666 ------
NM_002522chr17132907 2892 2572 1544 1186 1163 1044 1011 921 832 820 708 223 --21474 850 --
NM_002527chr121101 ------
NM_002536chrX51549 1389 1210 310 74 ----11019
NM_002545chr1163517 3199 1942 1773 1140 272 24131 3620 11976 --
NM_002547chrX42966 2959 1322 37 --31669 278 137 --
NM_002581chr954534 4435 1261 110 43 12254 14360 --
NM_002589chr4149 ------
NM_002590chr131484 ------
NM_002594chr2021637 604 22345 234 ----
NM_002599chr1181161 1030 1013 956 898 782 401 122 1250 ----
NM_002600chr12510 89 11402 ----
NM_002634chr171367 --1932 --
NM_002645chr1132140 995 825 --21040 982 --
NM_002648chr661000 434 267 193 155 148 --11205 --
NM_002698chr1952655 1865 705 626 251 --11925 --
NM_002715chr511122 ------
NM_002739chr193678 638 256 1242 1103 --
NM_002746chr161102 ------
NM_002775chr105514 432 190 129 67 --142 --
NM_002796chr1----175 --
NM_002822chr121168 ----1357
NM_002828chr181167 ------
NM_002834chr1263700 2968 1624 1394 1049 576 ------
NM_002841chr31589 ----179
NM_002855chr1193372 3248 3041 2973 2834 1494 1432 872 518 --13631 --
NM_002867chr1----2587 251 --
NM_002869chr1111952 --1766 --
NM_002906chr112921 718 11952 ----
NM_002923chr1185 ------
NM_002924chr11158 ------
NM_002941chr311314 ------
NM_002942chr3--171 11442 --
NM_002956chr121287 ------
NM_002957chr9163429 3275 3018 2913 2866 2834 2678 2479 1496 1409 1112 961 876 767 539 417 --31447 1215 1158 --
NM_002959chr164318 2906 557 325 104 21 --13937 --
NM_002998chr8--1358 ----
NM_003001chr141531 1445 875 765 --1112 11429
NM_003010chr173735 320 218 1772 --123
NM_003026chr9----11239 --
NM_003030chr35706 350 170 108 94 ------
NM_003034chr12106770 5875 5579 3248 2806 2795 2701 307 135 104 15399 23188 2373 --
NM_003043chr3133954 3766 3596 3546 3091 3049 2982 1430 1216 1133 831 569 553 1484 24137 3146 1698
NM_003045chr1384258 1446 1278 1252 1022 749 589 190 24062 3214 23691 3306 --
NM_003074chr332013 1831 1759 1524 11732 --
NM_003076chr1281228 1115 1094 1033 407 372 357 51 ------
NM_003081chr2021219 959 ------
NM_003095chr12----2309 277 --
NM_003106chr31315 --1241 --
NM_003108chr2146888 6451 5857 5059 4760 2761 2627 2344 1493 1250 934 891 495 430 ----17314
NM_003112chr7123 1339 --1317
NM_003128chr242299 1925 439 432 12811 ----
NM_003131chr642096 1984 392 261 --21945 1449 --
NM_003137chr641663 174 164 41 1364 --11935
NM_003150chr1721847 240 --22172 868 --
NM_003155chr882185 1890 1775 1728 1076 1016 782 535 --12072 --
NM_003157chr3136 1971 ----
NM_003165chr951725 1287 680 426 21 ------
NM_003170chr172464 21 --1210 --
NM_003178chr312247 --183 --
NM_003188chr6--1765 ----
NM_003189chr173341 3302 3147 2063 1146 342 157 12826 11135 --
NM_003199chr182880 620 --11964 --
NM_003200chr19112365 2342 2099 1848 1783 1493 745 299 280 199 74 --11872 --
NM_003214chr6101382 1373 1210 1117 1060 924 524 495 122 115 --1410 --
NM_003234chr331822 781 386 --1433 --
NM_003236chr223151 3008 12774 2530 104 1492
NM_003247chr6--1117 ----
NM_003253chr2131399 659 376 ------
NM_003262chr325132 4512 11133 24148 3918 --
NM_003269chr6--11127 1995 --
NM_003281chr174618 4266 4094 3297 1566 662 199 11606 ----
NM_003298chr3155258 5021 4979 4973 3943 3771 2355 2267 2202 1827 1665 1553 1252 775 175 24459 1219 ----
NM_003300chr14198 ------
NM_003337chr51649 ------
NM_003342chr1732311 2096 257 ------
NM_003347chr2251993 1685 424 79 41 --11455 --
NM_003360chr4------1280
NM_003368chr1--1701 ----
NM_003376chr61203 --3558 528 169 --
NM_003376chr61203 --3558 528 169 --
NM_003404chr201332 1819 --11544
NM_003412chr342144 1247 144 109 --12012 --
NM_003413chrX1158 --11784 --
NM_003463chr61255 ----1429
NM_003466chr262009 1786 921 204 175 59 --12485 --
NM_003468chr223533 3065 14206 13644 --
NM_003472chr621471 133 ------
NM_003489chr2132996 2214 608 --1684 --
NM_003498chr1682298 2178 2026 657 476 345 246 228 --1450 11751
NM_003557chr141226 386 308 21 ------
NM_003566chr1213437 ------
NM_003607chr144327 3947 164 157 --14249 --
NM_003618chr211001 ------
NM_003626chr1131199 961 229 1124 ----
NM_003629chr183125 2716 2566 2404 2339 1348 1199 1190 --22845 1061 --
NM_003633chr54949 523 324 126 ------
NM_003644chr17176086 5928 5883 5557 5527 5092 4793 4695 4017 2253 1760 833 761 605 231 197 184 14218 22634 1135 --
NM_003671chr952416 2294 959 685 409 --12374 136
NM_003705chr2----2688 257 --
NM_003713chr121237 539 --31302 691 630 --
NM_003716chr31167 1658 ----
NM_003719chr51131 ------
NM_003754chr11--1120 ----
NM_003761chr21246 --1303 --
NM_003766chr171526 ------
NM_003768chr131542 589 34 ------
NM_003791chr161266 --1570 --
NM_003797chr11------1184
NM_003798chr9170 ------
NM_003800chr632097 1824 495 12337 ----
NM_003822chr152928 2603 1203 622 505 ----1822
NM_003825chr1521557 1442 ------
NM_003842chr831714 652 346 --129 --
NM_003864chr4--1131 ----
NM_003908chr2051266 1190 1151 881 507 ------
NM_003939chr10113458 3315 3046 3008 2969 2779 2585 834 428 149 36 11510 14032 --
NM_003948chr432409 1944 205 --1683 --
NM_003958chr643061 2438 993 930 22764 1128 1245 --
NM_003980chr611002 ------
NM_003994chr1223887 718 1243 ----
NM_004004chr131260 21064 115 ----
NM_004006chrX12155 ------
NM_004007chrX12155 ------
NM_004009chrX12155 ------
NM_004010chrX12155 ------
NM_004011chrX12155 ------
NM_004012chrX12155 ------
NM_004013chrX12155 ------
NM_004014chrX12155 ------
NM_004015chrX12155 ------
NM_004017chrX12155 ------
NM_004020chrX12155 ------
NM_004050chr1422309 2078 1953 12284 --
NM_004055chr1192199 1926 1585 1481 909 600 456 406 387 3619 265 132 32069 1389 293 --
NM_004061chr51522 ------
NM_004081chrY21377 93 11709 1223 11415
NM_004093chr1352174 2128 1291 1124 544 ------
NM_004096chr1041843 1650 1384 1359 --21917 236 --
NM_004100chr662479 2076 1907 1696 958 23 ------
NM_004114chrX----1153 --
NM_004132chr1051206 1147 982 914 330 ------
NM_004134chr5----1575 --
NM_004136chr153466 242 61 ----1427
NM_004161chr211261 ----11271
NM_004171chr1178551 6948 6436 6129 6091 3604 3107 23391 1543 ----
NM_004181chr4----1299 --
NM_004187chrX5977 350 180 57 37 1989 126 --
NM_004200chr11163264 2940 2787 2734 2303 1180 1079 978 674 542 490 455 406 319 307 110 --22816 1127 --
NM_004225chr821401 240 --21003 78 --
NM_004227chr792713 2707 2446 2376 2281 1980 1251 240 33 --11236 --
NM_004242chr6--1102 ----
NM_004263chr231837 1479 562 --2666 179 --
NM_004272chr5--11428 ----
NM_004286chr22122728 2528 2470 2464 1133 841 771 765 759 743 373 264 --11815 --
NM_004293chr963473 3107 2719 1435 555 405 11290 13133 --
NM_004296chr14114005 3810 3720 3619 3439 3168 1569 1170 1110 152 40 --33873 1007 281 --
NM_004302chr1282775 2538 2454 2252 2087 2061 1963 152 --21119 219 --
NM_004308chr1151567 1525 1511 154 52 ------
NM_004331chr82862 340 ------
NM_004338chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_004384chr511708 --121 --
NM_004387chr54127 89 58 26 ------
NM_004392chr132309 204 --32189 2098 385 --
NM_004397chr1163851 3479 2764 2668 932 381 ------
NM_004423chr392585 2412 2166 2151 864 714 613 343 255 --11006 --
NM_004430chr81412 11933 1584 --
NM_004432chr91273 ------
NM_004436chr11467 --2194 26 --
NM_004438chr252822 2709 2527 2014 208 12456 11126 --
NM_004440chr631476 1224 481 ------
NM_004449chr212241 143 --1152 --
NM_004485chr1113799 3605 3549 3247 3131 2873 2833 1765 1398 1014 37 ------
NM_004491chr19124056 3202 2811 2783 1633 912 819 755 601 218 202 132 ------
NM_004514chr1782794 2660 2415 2124 1163 983 388 90 --2967 512 --
NM_004520chr5--1499 1259 --
NM_004525chr261340 1190 614 570 442 373 --11038 --
NM_004527chr1721160 124 ----1251
NM_004529chr9--1529 ----
NM_004538chrX----1592 --
NM_004540chr21--285 59 ----
NM_004543chr2----269 43 --
NM_004556chr64915 351 233 23 --1723 --
NM_004569chr142735 48 ----1236
NM_004580chr153429 358 129 --1585 --
NM_004588chr11103970 3397 1536 1522 1392 747 626 221 106 66 --11546 --
NM_004598chr53774 586 77 --22269 354 --
NM_004650chrX41883 1542 739 705 --1463 --
NM_004660chrY21925 1572 --11480 --
NM_004663chr151324 ----1359
NM_004664chr121218 ------
NM_004687chr1731554 381 227 --11964 --
NM_004703chr171970 1564 21949 200 --
NM_004711chr22193653 3523 3223 3203 2817 2802 2718 2647 2632 2456 2359 2305 2255 1432 1289 1103 870 739 410 --12420 --
NM_004717chr731514 566 251 ------
NM_004725chr1021072 275 1357 1557 --
NM_004726chrX55657 5022 1278 138 34 15617 --25144 4517
NM_004734chr1332397 2254 1298 --52607 1033 875 152 116 --
NM_004736chr142085 1569 778 339 1142 ----
NM_004737chr2211048 --1157 --
NM_004745chr896253 6155 2561 2380 2308 2187 1240 480 269 11275 ----
NM_004748chr1544143 3270 2931 1173 ------
NM_004753chr11162 ------
NM_004768chr11918 ------
NM_004772chr51117 ------
NM_004774chr1712669 ----1169
NM_004776chr2052892 2829 2353 828 387 --23069 997 --
NM_004798chr20123530 3470 3119 2930 2865 2526 2406 2307 1052 752 537 281 ------
NM_004808chr1052512 2320 2178 985 438 ----13178
NM_004822chr1783958 3556 2810 2728 2700 1042 242 154 --13353 13453
NM_004841chr1----161 11083
NM_004855chr15----1204 --
NM_004857chr1433402 1717 905 13137 14006 --
NM_004859chr1722731 2022 12509 32515 2033 589 --
NM_004863chr1444966 4372 413 382 25347 298 34930 4232 4076 15172
NM_004865chr6----1106 --
NM_004869chr1811710 ------
NM_004871chr1751769 1520 1032 140 21 11537 24096 1743 --
NM_004872chr11422 ------
NM_004898chr4--12302 ----
NM_004904chr796133 6121 5951 4874 2375 530 396 98 89 15167 15138 --
NM_004925chr92787 168 ------
NM_004952chr16880 755 737 716 688 97 ----1628
NM_004956chr734454 4268 683 --13226 13369
NM_004969chr101430 ------
NM_004976chr11154970 4752 4703 4483 4026 3912 3714 3449 3420 1836 1732 1664 1448 80 39 24140 689 14881 14370
NM_004985chr1241796 1551 724 695 --21007 413 --
NM_004992chrX106150 6098 5549 5328 3170 2869 2564 1763 1687 219 --16413 --
NM_004992chrX106150 6098 5549 5328 3170 2869 2564 1763 1687 219 --16413 --
NM_004995chr1451397 1040 336 328 234 --2568 522 --
NM_004996chr1641712 1580 565 194 ----1363
NM_004998chr15--1196 2939 304 --
NM_004999chr633004 2974 980 ----11262
NM_005028chr1031630 716 298 --21988 331 --
NM_005045chr72925 663 ----1701
NM_005054chr231459 1197 330 --21611 548 --
NM_005056chr1275423 5355 5054 4420 3945 3503 403 --15156 1298
NM_005063chr1043546 3522 3394 225 12724 --13018
NM_005065chr1434702 319 79 --25173 3888 13853
NM_005076chr1144196 4019 3418 3402 3210 1118 1078 860 776 690 524 387 341 288 1352 33363 3229 970 --
NM_005095chr15820 759 612 481 467 ----1346
NM_005096chrX6928 834 329 196 106 74 --1299 --
NM_005097chr10176 ------
NM_005099chr141251 158 122 93 11002 ----
NM_005121chr17--23544 184 --11302
NM_005126chr31915 --1100 --
NM_005134chr181339 --1104 --
NM_005153chr16--1179 ----
NM_005156chr944383 4095 3835 467 ------
NM_005161chr1182231 1905 1584 1390 551 211 205 37 1285 1792 --
NM_005168chr21533 2459 158 ----
NM_005197chr1496164 5855 5838 5070 5029 805 529 418 182 12330 ----
NM_005227chr14472 341 153 52 ------
NM_005229chrX61243 1126 1033 395 128 98 ------
NM_005238chr113719 347 66 --138 --
NM_005241chr3--1134 ----
NM_005245chr42654 130 ------
NM_005249chr14----1359 --
NM_005250chr1651828 747 422 257 225 1735 21768 1445 --
NM_005252chr141105 1118 ----
NM_005259chr2--11332 ----
NM_005261chr82866 210 --1233 --
NM_005263chr151123 971 311 229 112 ----1134
NM_005312chr9142347 1966 1924 1850 1692 1674 582 523 510 465 347 309 198 70 --32200 2160 1024 --
NM_005327chr4--1704 ----
NM_005337chr122344 38 ------
NM_005338chr7104042 3714 3403 3153 2941 2900 2622 1629 188 156 11352 12793 --
NM_005347chr931492 1361 534 --11534 --
NM_005359chr1875315 5213 4504 4470 3968 1544 22 ------
NM_005374chr1752283 2255 2077 886 516 12318 --1140
NM_005375chr611041 --1840 --
NM_005381chr2146 ------
NM_005387chr11172 --1628 --
NM_005399chr194369 3080 1627 1511 882 723 599 366 290 23067 1533 ----
NM_005402chr7----11741 --
NM_005406chr1811468 ------
NM_005407chr1431296 420 285 ------
NM_005417chr2072034 1955 1913 630 621 217 39 --51825 1666 1338 520 133 --
NM_005435chr71214 ------
NM_005436chr10----22687 473 --
NM_005440chr1793189 3036 2787 2748 2678 626 381 287 90 13224 32703 2435 1218 --
NM_005443chr4----2417 393 --
NM_005461chr2061343 446 345 232 188 82 --11223 --
NM_005476chr9125 --1338 --
NM_005486chr17----164 1570
NM_005493chr62714 656 ------
NM_005497chr1756116 5738 1858 1179 141 --13843 --
NM_005504chr1276223 5625 5064 2391 2291 982 590 14538 --14025
NM_005507chr113494 366 149 ------
NM_005523chr751025 382 322 244 157 ----11170
NM_005544chr2132 ----180
NM_005546chr572031 1653 1565 966 670 345 99 --136 --
NM_005578chr323774 3637 --13195 --
NM_005595chr11361 1891 ----
NM_005596chr975045 5032 4701 2483 2349 1374 662 1941 ----
NM_005603chr1811414 --2478 61 --
NM_005604chr642180 222 70 59 --12528 11591
NM_005611chr161262 ------
NM_005613chr11199 ----3598 402 40
NM_005614chr71892 --1696 --
NM_005630chr3101595 1569 1499 1487 1445 799 318 251 47 41 --2733 571 --
NM_005662chr81349 ------
NM_005665chr113047 --24140 3359 --
NM_005668chr52483 267 --1379 --
NM_005707chr1531162 436 247 ------
NM_005730chr1273399 2935 2879 2532 2241 1274 399 --22579 322 --
NM_005736chr1081447 1388 1227 1194 1072 417 154 147 --2580 351 --
NM_005759chr264401 4312 3588 1916 1705 1137 --165 --
NM_005779chr553290 3093 1069 260 235 --1941 11128
NM_005780chr13----1743 --
NM_005786chr183829 210 119 ------
NM_005789chr1762096 1902 1489 677 484 26 --11676 11937
NM_005795chr242074 406 67 59 --12004 --
NM_005819chr152337 2229 1310 777 321 --1386 --
NM_005822chr642408 2195 1841 665 ------
NM_005828chr1774584 3665 3226 1824 1654 1267 183 --24123 4082 11142
NM_005839chr12738 656 ------
NM_005840chrX86038 6019 5217 5151 2654 2560 1917 615 --25852 2320 11927
NM_005842chr13----1525 --
NM_005860chr19101675 1651 1306 1295 1289 1154 275 241 206 37 ------
NM_005866chr97765 716 665 204 167 50 24 --1110 --
NM_005885chr5126 ----1474
NM_005895chr1293699 3651 3625 3214 3097 1216 1198 1151 1104 ------
NM_005896chr2----1544 --
NM_005901chr1877802 6857 6413 5791 3413 3407 1372 1614 38290 5296 1084 --
NM_005902chr15104457 4384 4250 3703 3569 3088 3039 1057 745 440 --42848 834 536 311 --
NM_005906chr621238 62 11397 ----
NM_005909chr523219 3164 --13692 1780
NM_005923chr62216 203 1549 1704 --
NM_005933chr1182663 2620 2407 1162 1043 459 375 208 22453 2258 ----
NM_005937chr1793898 3402 3383 3272 3120 2765 834 491 442 --53957 3453 395 94 48 --
NM_005941chr851673 1430 789 521 126 ------
NM_005955chr144442 3766 2163 2081 11829 33949 1698 470 1679
NM_005962chr101592 ----11449
NM_005962chr101592 ----11449
NM_005964chr1731567 1295 623 1468 2314 291 --
NM_005966chr252364 2009 1718 801 352 ------
NM_006007chr943946 3615 3034 1387 22946 1055 1513 --
NM_006011chr15123917 3723 3621 3416 2761 1683 1625 1084 784 549 441 265 1809 1893 --
NM_006034chr1172301 2019 1731 794 511 288 23 12240 11691 --
NM_006037chr243110 1329 582 164 --11561 --
NM_006047chr2042695 1198 1051 162 ------
NM_006062chr23801 177 25 --31147 215 37 --
NM_006078chr22173 --295 80 --
NM_006094chr81747 --1195 --
NM_006095chr42777 403 ------
NM_006106chr1132618 2371 590 ------
NM_006107chr171542 ------
NM_006113chr121736 492 --31863 1548 1507 --
NM_006133chr11112394 2245 2010 1780 1763 1603 933 780 173 97 48 --22332 1863 --
NM_006141chr162709 220 12601 1195 --
NM_006145chr1951084 823 804 62 35 --21077 395 --
NM_006147chr11404 ------
NM_006154chr1532459 838 530 --12489 --
NM_006166chr12----22304 969 --
NM_006180chr941380 791 131 24 ------
NM_006190chr22917 718 ------
NM_006191chr123736 618 180 --165 --
NM_006194chr141530 ------
NM_006203chr51131 --23626 2227 --
NM_006251chr532385 2209 845 --1398 --
NM_006252chr156820 6127 5918 1110 1026 11092 ----
NM_006258chr101281 ------
NM_006267chr23465 282 169 ------
NM_006275chr2011880 --1186 --
NM_006283chr834383 4070 3111 --14010 1617
NM_006306chrX105661 5469 4566 2237 1524 1044 891 872 400 98 --1763 --
NM_006320chr421117 1029 ------
NM_006334chr9----1311 --
NM_006353chr6--140 ----
NM_006370chr14141 ------
NM_006375chrX128 1153 1318 1180
NM_006380chr1744276 2907 2751 1192 --23052 2940 2785 129
NM_006387chr192447 53 --21269 282 --
NM_006391chr111264 --1258 --
NM_006425chr521234 485 ------
NM_006449chr211979 --22111 428 --
NM_006454chr492914 2907 2880 2717 2662 2585 2095 372 95 12786 11127 --
NM_006457chr433244 1406 115 --22662 797 --
NM_006489chr1421787 1666 ------
NM_006526chr2031589 753 618 ------
NM_006532chr1971605 1506 1473 781 288 178 148 --2736 297 --
NM_006534chr2042397 2281 980 474 ------
NM_006544chr1424421 449 1784 13682 --
NM_006547chr711389 ------
NM_006557chr931776 1311 484 --11388 --
NM_006560chr112165 154 ------
NM_006561chr1056109 5738 1586 194 177 --14831 --
NM_006565chr1611220 ----11149
NM_006579chrX1257 ------
NM_006587chr41290 ------
NM_006595chr11----11300 151
NM_006599chr1657525 5572 3307 1869 926 --16377 --
NM_006608chr1122 ------
NM_006609chr232016 1937 656 ----1536
NM_006618chr11154 --11302 --
NM_006620chr664307 3223 3123 1839 871 793 --13065 --
NM_006624chr10----11314 --
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006644chr131625 2171 63 ----
NM_006650chr5123742 3712 3569 3408 2778 2741 2624 2485 783 649 486 387 --43968 3483 2493 501 --
NM_006690chr2092159 1921 1518 910 783 662 602 559 501 1107 21810 47 --
NM_006699chr132118 529 222 ----12540
NM_006716chr73906 381 110 1934 ----
NM_006738chr1591752 1380 973 778 527 472 229 188 39 1247 64627 3547 3335 3269 1402 195 --
NM_006754chr71806 ----1856
NM_006766chr831835 503 84 --1440 --
NM_006772chr651432 485 276 242 182 1502 31268 343 22 21421 1279
NM_006777chrX21983 189 --22236 1783 --
NM_006783chr131263 ------
NM_006790chr51156 ------
NM_006802chr131150 940 777 --41176 731 222 93 --
NM_006805chr51274 1250 ----
NM_006813chr62655 55 ------
NM_006814chr2061857 1635 1015 772 481 282 1816 ----
NM_006818chr1--1339 1885 --
NM_006838chr1241631 1533 537 103 --11666 --
NM_006843chr124435 300 190 45 ------
NM_006852chr1742677 1964 328 218 11911 12629 --
NM_006868chr1853113 3069 2704 1019 136 21104 70 12987 --
NM_006873chr243314 3253 2439 148 ----1831
NM_006874chr4----1463 --
NM_006875chrX1319 1592 ----
NM_006884chr35706 350 170 108 94 ------
NM_006885chr1623921 1226 ------
NM_006888chr1462964 2558 2352 2286 1008 719 --11036 --
NM_006908chr731393 1247 216 --1381 --
NM_006920chr23535 198 177 ------
NM_006924chr1713676 1534 ----
NM_006931chr1232030 1967 67 --11608 --
NM_006940chr1231582 1182 153 128 ----
NM_006943chr20123231 2863 2656 2394 2223 2130 2070 1051 632 345 296 146 --11175 --
NM_006947chr421230 482 ------
NM_006948chr211182 --1839 1204
NM_006951chr10----121 --
NM_006980chr71203 1882 ----
NM_006997chr101367 ------
NM_007011chr1566691 6170 5653 4593 1718 1445 --16487 1419
NM_007014chr16101438 1367 1337 1248 511 362 290 258 109 93 --21186 167 --
NM_007026chr171494 ------
NM_007030chr5135064 4999 4452 3458 3204 1608 1436 1040 934 887 222 138 51 ------
NM_007032chr2272116 2059 1107 1021 572 470 446 --124 --
NM_007036chr5--1902 ----
NM_007050chr20258104 7531 7308 7263 6882 6852 6709 6502 6377 6371 5938 5272 5209 3238 2763 2754 2534 2464 2316 1914 1800 1776 559 207 135 1530 25990 5230 --
NM_007057chr10------135
NM_007067chr174551 413 384 150 ------
NM_007073chr613755 --151 --
NM_007084chr1341483 1007 626 227 ------
NM_007126chr92144 43 ------
NM_007137chrX95237 4892 3814 2098 1877 1829 1047 991 437 --11699 193
NM_007166chr113592 394 147 --11554 --
NM_007170chr1138 --2599 257 1705
NM_007174chr1292378 1674 1615 1569 1562 972 621 130 82 ----1375
NM_007189chr751373 502 452 357 81 ------
NM_007191chr12--1496 ----
NM_007200chr1591752 1380 973 778 527 472 229 188 39 1247 64627 3547 3335 3269 1402 195 --
NM_007203chr923122 2856 --1187 12976
NM_007222chr831835 640 625 --1522 --
NM_007238chr2054783 3799 954 304 95 13859 2784 53 --
NM_007249chr1378963 7512 6684 3287 3106 1432 1382 --39158 1744 374 --
NM_007257chr882645 2200 2181 893 516 322 108 22 --21144 44 22078 564
NM_007286chr582100 824 649 434 224 197 67 58 11720 21381 209 --
NM_007325chrX51500 435 191 133 68 ------
NM_007349chr7----1330 --
NM_007350chr1284314 4278 4078 3396 3025 3013 1769 956 ------
NM_007353chr751862 1178 1059 524 480 --160 12468
NM_012064chr121994 ------
NM_012081chr523667 2455 --12514 --
NM_012089chr1------11176
NM_012115chr62147 22 ------
NM_012121chr1781579 672 402 156 129 121 101 70 21598 78 ----
NM_012137chr162868 1905 911 517 433 56 --12193 --
NM_012141chr1343096 2648 271 162 --23926 137 --
NM_012156chr2062632 1340 1093 1086 801 479 11195 ----
NM_012193chr11105334 4946 4750 4614 4324 3797 3468 2174 890 881 ----12037
NM_012199chr182863 1547 1044 883 742 514 328 247 ------
NM_012215chr10----21634 257 --
NM_012244chr1471402 1357 1313 474 447 358 216 --21286 1273 1456
NM_012247chr10--1117 ----
NM_012249chr242439 1104 953 814 --178 --
NM_012250chr11----21133 505 --
NM_012257chr7149 ------
NM_012281chr72639 220 --22433 807 --
NM_012296chr11143582 3188 2987 2794 2765 2442 1524 1067 866 829 312 306 146 50 ------
NM_012307chr181139 ------
NM_012308chr1192083 1849 1821 1734 1701 514 411 337 76 ------
NM_012309chr1183794 3788 1853 1236 801 426 385 175 1338 ----
NM_012316chr1125383 4882 4362 4102 3822 3697 3659 2004 1654 743 724 712 --25241 3766 14556
NM_012405chr1123711 2444 2418 1358 1057 739 547 361 171 164 38 23 --11227 --
NM_012416chr911218 --1196 --
NM_012428chr151815 ------
NM_012434chr661238 1034 667 593 423 312 ------
NM_012448chr1732473 1941 1873 1135 ----
NM_012464chr431136 465 329 ----1259
NM_012465chr1032246 927 799 ------
NM_012471chrX21766 1324 ----11401
NM_013230chrY2680 622 ------
NM_013231chr1464334 3544 1396 786 642 539 --23116 42 --
NM_013235chr52826 65 1333 1300 --
NM_013255chr7108750 8536 8414 8111 7807 7471 2917 2890 2759 872 16649 12267 --
NM_013259chr3188 ------
NM_013262chr621459 1180 11191 ----
NM_013269chr1274051 3944 3616 3398 1737 1113 551 ------
NM_013283chr53365 258 107 ------
NM_013302chr1694630 4447 4389 3934 3633 3263 3015 1170 147 12932 23052 1652 1191
NM_013309chr15--1244 12189 12349
NM_013336chr371878 1869 1659 1627 1388 663 459 11346 31471 1272 769 --
NM_013341chr221152 1110 --22421 1059 1230
NM_013354chr8--1452 ----
NM_013363chr31134 ------
NM_013368chr193476 181 25 --1240 --
NM_013372chr153904 408 59 --31123 607 598 --
NM_013377chr121107 ------
NM_013396chr211334 --11303 --
NM_013399chr1651724 1235 730 574 164 --2685 346 --
NM_013402chr1162702 2283 839 681 506 176 --22195 44 --
NM_013411chr162766 2543 2158 1071 725 346 ------
NM_013438chr921403 88 ------
NM_013444chrX--1921 --11015
NM_013449chr1251070 500 439 128 98 --12701 --
NM_013951chr262009 1786 921 204 175 59 --12485 --
NM_013952chr262086 1863 998 281 252 136 --12562 --
NM_013953chr262086 1863 998 281 252 136 --12562 --
NM_013989chr1454789 4636 4487 4330 237 --24157 3774 1506
NM_013992chr262086 1863 998 281 252 136 --12562 --
NM_014010chr94545 391 378 69 1240 2175 35 --
NM_014023chr1031090 804 102 --145 --
NM_014028chr61126 --22579 2346 --
NM_014048chr1664150 3421 2113 1112 945 480 --12016 1380
NM_014117chr1622702 50 1290 ----
NM_014155chr1157164 5208 1830 1488 614 11888 36304 5501 37 --
NM_014157chr1673949 3930 3475 1543 827 602 274 --12931 --
NM_014159chr31260 --1250 148
NM_014178chr14124 ------
NM_014183chr201270 ------
NM_014210chr17----2534 113 --
NM_014213chr21185 ------
NM_014233chr1792019 1673 1604 1403 559 522 440 407 184 --1358 --
NM_014243chr412058 11821 11431 --
NM_014267chr11----2110 84 --
NM_014268chr1831159 931 194 11176 --11023
NM_014278chr41440 ------
NM_014282chr931010 325 282 --1337 185
NM_014283chr1------1531
NM_014299chr1951793 1448 1409 630 367 22059 422 1555 --
NM_014305chr13----1254 --
NM_014309chr2264700 4594 3989 1966 1630 900 --11357 --
NM_014322chr1--21009 423 ----
NM_014323chr2211033 ------
NM_014331chr457201 7181 7109 6085 1615 ----13141
NM_014332chrX------1118
NM_014352chr114422 195 167 33 --1133 --
NM_014368chr941823 848 669 64 ----21386 777
NM_014408chr1191 ------
NM_014423chr534227 4219 173 --11181 11449
NM_014445chr311509 1257 ----
NM_014458chr1156 ------
NM_014488chr111101 ------
NM_014491chr7147 ------
NM_014494chr1642307 2299 2064 691 ------
NM_014517chr331403 590 133 ----11597
NM_014554chr1252187 1775 745 561 117 1826 41920 129 70 24 --
NM_014572chr131214 ------
NM_014574chr141364 ------
NM_014577chr221701 ------
NM_014616chr342945 2790 2691 383 ----22809 766
NM_014634chr22163631 3287 3057 2904 2802 2658 2461 1264 1203 993 410 372 360 270 221 71 --11338 --
NM_014635chr231431 1160 294 --21589 510 --
NM_014636chr964150 1575 1082 552 247 199 --2868 586 --
NM_014660chr7----11070 --
NM_014661chr1073814 3638 2389 1148 624 425 73 1958 --12518
NM_014662chr22----1461 --
NM_014667chr342347 1738 1533 191 ----1723
NM_014674chr353558 3522 3274 1389 458 ----138
NM_014683chr17--1554 1692 --
NM_014690chr772937 2458 2203 2036 786 490 209 12310 --1767
NM_014721chr695322 5122 4878 2846 2080 1487 898 691 210 22585 838 21764 1612 --
NM_014730chr1294809 3800 3619 1630 1538 1268 317 289 272 25215 1051 14180 --
NM_014730chr1294809 3800 3619 1630 1538 1268 317 289 272 25215 1051 14180 --
NM_014743chr42571 69 2817 347 ----
NM_014747chr1134849 4389 3564 2057 1452 1398 1367 1171 922 649 547 482 95 12113 25113 910 --
NM_014752chr112376 342 ------
NM_014754chr83920 633 167 ------
NM_014755chr274133 3761 3200 1399 1219 219 36 ----13690
NM_014762chr151885 692 592 249 83 ----12070
NM_014767chr1093603 3291 3163 2671 1224 1174 390 287 101 --1931 --
NM_014772chr18102988 2924 2790 2538 789 303 263 257 89 44 --53328 2608 1334 1314 359 --
NM_014774chr152754 2338 1312 601 399 ----1304
NM_014787chr182047 1120 1050 681 456 232 198 32 ------
NM_014798chr1751944 1874 1778 591 191 1443 51728 1305 1230 277 124 --
NM_014810chr143118 2307 1325 104 ------
NM_014812chr111312 --1519 --
NM_014819chr542131 1770 801 269 ------
NM_014824chr113299 150 95 1241 ----
NM_014826chr144327 3947 164 157 --14249 --
NM_014828chr1411751 --12164 --
NM_014830chr1263535 3251 2445 1313 605 296 --22431 1203 --
NM_014838chr2282592 2569 2424 2261 2234 2189 2054 1140 ------
NM_014850chr394850 1649 1579 875 662 598 525 147 91 --34599 4575 805 --
NM_014859chr173521 374 232 148 ----
NM_014873chr134663 4224 590 --13761 11680
NM_014876chr2282149 2088 1877 1772 1567 1475 453 353 ------
NM_014877chr1736913 5281 1335 --25561 5427 --
NM_014897chr1733283 2691 144 --195 --
NM_014901chr561991 1783 1418 733 575 195 --1345 --
NM_014902chr2031489 1418 437 --1111 --
NM_014904chr1051499 698 361 293 174 ------
NM_014912chr10----11357 --
NM_014920chr623481 537 --13733 --
NM_014921chr1982681 2510 2281 2251 1995 859 404 262 2158 137 1314 --
NM_014932chr3----11373 --
NM_014945chr561896 1706 1413 414 242 222 --1687 --
NM_014946chr232999 2598 1226 ------
NM_014949chr13106 37 27 --2680 76 --
NM_014950chr1431465 154 68 1221 ----
NM_014952chr1552022 1975 1745 478 361 1312 21795 371 --
NM_014991chr453151 2954 2093 698 40 ------
NM_014997chr732851 2303 50 --12281 1881
NM_014999chr1241346 1319 611 463 --11395 1153
NM_015000chr1221166 714 ----12496
NM_015002chr1212109 ------
NM_015020chr1643810 3383 1324 1014 22434 1305 13310 --
NM_015025chr222423 405 ------
NM_015035chr2095855 4722 4108 4049 1565 1440 1120 243 75 25022 2567 34805 2519 2213 --
NM_015042chr1583891 3687 3354 1688 1511 1010 399 170 1188 53925 3267 2682 1251 145 --
NM_015045chr10----1858 --
NM_015049chr243116 2780 598 22 ------
NM_015055chr1162953 2408 2344 2065 878 364 ------
NM_015064chr1283661 2631 2304 1206 892 369 139 130 13514 11258 --
NM_015068chr753292 2701 1561 718 555 --1189 --
NM_015070chr1331485 1419 209 11320 1377 --
NM_015071chr5105904 5861 5538 5137 4187 4028 2357 557 417 111 11507 26357 5545 --
NM_015074chr141922 1386 805 88 14189 23205 1343 --
NM_015075chrX92138 1619 1607 1535 1443 703 316 137 76 1641 22288 285 --
NM_015076chr623560 3066 11684 13094 --
NM_015079chr15123210 3174 3105 3001 2819 2789 2783 2484 2400 965 421 352 --12960 --
NM_015090chr1116109 5825 4474 4427 3982 2123 1521 1267 805 395 76 --36003 4553 2288 --
NM_015091chr141718 ------
NM_015092chr1634067 1259 366 --11786 --
NM_015094chr22194350 4216 4146 4091 3589 3542 3238 3218 3167 3125 2896 1681 1400 1348 1154 992 786 478 235 --43706 3054 1880 93 --
NM_015097chr311885 ------
NM_015100chr131987 1477 791 ------
NM_015113chr17102144 1845 1785 1767 1691 1668 919 427 409 251 ------
NM_015132chr71495 --21717 1418 21952 1535
NM_015138chr154469 435 163 28 ----1119
NM_015143chr4------11294
NM_015144chr1642542 1163 577 310 --13108 --
NM_015158chr9----1833 --
NM_015170chr84328 315 279 191 --22146 1823 --
NM_015176chr141130 463 397 224 ------
NM_015178chr8122315 1996 1865 1859 1694 1008 826 638 393 217 118 25 ------
NM_015185chrX32948 2616 64 --22311 117 --
NM_015192chr2032839 977 55 ------
NM_015199chr343002 2023 203 106 12114 12743 --
NM_015200chr411980 ------
NM_015208chr1864076 3334 3246 3182 853 183 ------
NM_015213chr11258 39 ------
NM_015233chr1392491 2239 2209 1093 1085 928 905 853 91 11758 ----
NM_015250chr951884 1286 739 517 34 --1246 --
NM_015254chr872500 2440 2324 2261 1199 569 518 --42055 1175 1107 274 23116 3097
NM_015264chr2264507 4298 4281 4202 1483 851 13290 13778 --
NM_015267chr1242072 1965 352 325 --1883 1636
NM_015270chr1242128 1690 852 56 --2839 105 --
NM_015271chr433145 2935 435 --1636 13371
NM_015278chr63441 162 101 --22956 2249 --
NM_015282chr252441 2246 506 104 28 --52304 2033 881 843 60 --
NM_015288chr553824 3654 2350 416 228 --43355 3278 101 27 --
NM_015293chr6186 --1234 --
NM_015296chr131500 ------
NM_015299chr1473736 3488 3355 3149 3042 2892 559 11068 32784 1578 454 --
NM_015305chr1481574 1445 772 741 657 382 237 92 --11396 --
NM_015310chr847261 1406 775 577 --13295 16368
NM_015313chr1121786 1177 21309 1147 1429 --
NM_015315chr572847 2661 2633 2161 1212 743 220 --22990 435 --
NM_015336chr1222708 2001 ------
NM_015338chr202564 167 1785 1714 --
NM_015339chr201692 ------
NM_015346chr1421538 168 1139 ----
NM_015347chr1222626 2181 --1730 --
NM_015349chr662111 595 347 245 49 36 --21095 203 --
NM_015352chr20103732 2830 2760 1239 1205 1131 1005 518 145 31 1445 123 --
NM_015356chr82156 39 ----1200
NM_015358chr211229 ------
NM_015365chrX33716 1483 42 --34112 2700 193 159
NM_015396chr31242 --1200 --
NM_015409chr1242779 2607 2441 875 ----22429 707
NM_015429chr321056 895 ------
NM_015443chr173462 418 27 --21095 248 1133
NM_015447chr9138 --1138 --
NM_015458chr874892 4205 4175 3838 3620 120 31 13484 24379 2063 --
NM_015464chr73958 156 69 ------
NM_015465chr53756 549 190 --1482 --
NM_015472chr3--137 ----
NM_015472chr3--137 ----
NM_015484chr12809 389 ------
NM_015509chr123528 374 50 ------
NM_015520chr331935 1874 440 2811 667 ----
NM_015526chr1991377 1329 1254 940 917 308 189 145 115 --21263 567 --
NM_015542chr1021245 865 ------
NM_015554chr1542524 2138 1849 135 --12646 --
NM_015557chr1173467 3405 3390 3097 2882 2626 1421 1366 1295 1179 1161 984 958 772 719 434 171 --41340 978 765 641 --
NM_015564chr543547 3313 1363 642 ------
NM_015565chr2142042 1790 652 116 ------
NM_015568chr20113981 3837 3457 3296 2834 1531 657 533 470 280 133 13023 ----
NM_015569chr144755 4297 3591 378 ------
NM_015570chr731727 724 141 ----11771
NM_015575chr263380 3130 2514 852 216 146 13716 21104 577 --
NM_015576chr322629 978 --32724 916 290 --
NM_015577chr531598 1368 54 11145 ----
NM_015584chr1741337 1242 532 169 ------
NM_015607chr1----129 --
NM_015609chr142775 1042 280 156 --12487 --
NM_015640chr125026 4494 ------
NM_015680chr21517 --177 --
NM_015686chrX72113 2074 2064 1840 488 360 23 --1434 11977
NM_015695chr641764 1756 669 150 --21941 735 --
NM_015697chr41341 ------
NM_015711chr191847 ------
NM_015713chr821421 298 1732 ----
NM_015726chr131588 446 46 ----178
NM_015840chr152623 2609 2424 441 201 --11684 --
NM_015841chr152623 2609 2424 441 201 --11684 --
NM_015859chr14----1152 --
NM_015879chr18118410 7594 7509 6121 6065 6044 3228 3019 2763 2093 1316 --2974 413 --
NM_015897chr191161 ------
NM_015898chr1982461 2052 1941 1771 843 789 323 235 --1376 1479
NM_015952chr6--1157 ----
NM_015975chrX31547 1392 556 11680 ----
NM_015981chr5133009 2743 2720 2483 2331 2045 2023 1993 981 606 580 417 43 --22984 1980 --
NM_015986chr1711381 ------
NM_016018chr81882 --12154 --
NM_016021chr622256 125 --12048 11064
NM_016048chr5----1318 --
NM_016083chr663635 3128 3093 2725 1313 236 --13153 --
NM_016096chr82193 37 ----156
NM_016097chr18298 25 ------
NM_016104chr6--1157 ----
NM_016129chr4--190 ----
NM_016152chr321066 288 ------
NM_016203chr7----1212 11067
NM_016205chr421096 114 ------
NM_016206chr338128 6734 2472 --57710 7243 6810 2762 1857 23160 2587
NM_016217chr612716 22605 977 ----
NM_016221chr542223 2144 403 24 ------
NM_016226chr121477 ------
NM_016227chr1------1531
NM_016258chr12559 66 --1812 --
NM_016260chr277282 6159 6132 2993 2154 1677 24 12429 26534 5216 --
NM_016300chr3--1501 ----
NM_016339chr1771744 1688 1240 1129 425 148 23 --21443 33 --
NM_016358chr52433 58 ------
NM_016376chr1784194 2895 2669 1715 1158 498 274 150 ------
NM_016433chr1211409 1973 ----
NM_016436chr2042586 2420 1984 546 --1220 --
NM_016441chr2------1132
NM_016470chr20----172 --
NM_016485chr611633 ----1240
NM_016507chr1722624 1278 --1956 --
NM_016513chr623481 537 --13733 --
NM_016526chr11102411 2352 2313 2119 1793 1585 940 542 393 374 12320 1776 --
NM_016530chr1551148 337 183 126 41 --22994 2648 --
NM_016531chr432633 1218 205 --14184 --
NM_016542chrX2531 35 1324 1588 --
NM_016545chr11176 --165 1799
NM_016577chr394509 4227 3540 3005 1403 1397 1074 1011 587 --13501 1527
NM_016605chr572192 1732 1010 925 635 244 40 --21804 229 22014 978
NM_016621chr11114454 4339 4303 3984 3648 3248 3043 3001 1682 801 174 11627 54287 3494 1442 1123 396 165
NM_016734chr981989 1957 1884 662 525 491 164 156 --11843 --
NM_016823chr1711325 --1881 1523
NM_016824chr1011312 ------
NM_016931chr11--127 ----
NM_016936chr1652000 1751 1512 510 179 --31791 820 613 --
NM_016946chr122596 59 --1974 --
NM_016952chr1154003 3744 3721 3219 794 186 13664 --
NM_016953chr2106121 5503 5006 4036 2348 1845 1437 524 219 98 15206 12038 --
NM_017413chrX4832 437 413 259 --12021 1487
NM_017415chr584249 1163 1070 464 436 403 70 55 --34420 2952 291 --
NM_017420chr1433513 2828 2755 23184 285 11458 --
NM_017426chr4----158 --
NM_017437chr1461892 1528 489 265 230 34 ------
NM_017447chr2132748 2698 208 --11326 11071
NM_017455chr151815 ------
NM_017551chr1062107 2017 1633 1055 977 821 --1119 --
NM_017573chr19125 ------
NM_017580chr1032267 2006 456 152 11788 --
NM_017583chr111132 1679 11472 --
NM_017592chr1962070 953 843 722 639 521 --32671 1829 259 --
NM_017596chr1154471 4451 4215 3555 3503 3254 3070 3064 2964 2835 1628 1403 1348 604 215 --24237 1852 --
NM_017610chr151150 1293 1447 --
NM_017623chr271976 924 341 235 187 175 122 --12372 --
NM_017628chr425255 3318 --24570 167 --
NM_017633chr632572 256 197 ------
NM_017634chr821356 546 --21515 557 --
NM_017637chr978908 8865 7870 7826 7352 6057 5779 16512 27837 2530 11317
NM_017643chr1722700 2451 ------
NM_017649chr1061083 1038 474 433 58 28 --1132 --
NM_017658chr1413531 1642 13707 13463
NM_017660chr19103108 2899 2080 795 743 596 300 232 149 67 13305 23425 558 --
NM_017684chr152738 639 --21312 235 --
NM_017693chr132608 594 --11165 --
NM_017709chr162917 2781 2770 698 404 196 --13504 --
NM_017719chr342040 1604 483 376 ------
NM_017742chr181341 ------
NM_017747chr5148 ------
NM_017748chr173332 216 127 ------
NM_017778chr8----1157 --
NM_017784chr3----197 --
NM_017801chr332227 1941 39 --1606 --
NM_017849chr272729 1966 1205 1164 672 462 105 --21223 141 --
NM_017856chrX21975 1347 1395 ----
NM_017860chr11597 --1905 --
NM_017902chr1095605 5011 4258 2156 1534 1324 699 119 77 1582 35326 4526 4367 11160
NM_017915chr12----2803 390 --
NM_017919chr965746 2166 1837 1219 1213 50 --24677 198 1370
NM_017944chr1132424 755 481 ----13055
NM_017969chr2153 ------
NM_017982chr161269 987 858 213 50 25 ------
NM_017983chr171177 --1394 --
NM_018000chr252263 1834 1483 859 159 --12008 --
NM_018017chr1032547 1102 817 12278 ----
NM_018045chr172727 2252 1168 483 338 271 40 1113 12488 --
NM_018060chr11359 ------
NM_018078chr41246 --160 --
NM_018086chr2--1579 ----
NM_018092chr1641432 1206 631 562 11664 21299 112 --
NM_018107chr142193 42 ------
NM_018110chr161274 --21134 927 --
NM_018119chr161224 ------
NM_018121chr1072157 2100 2081 2053 688 649 216 --12066 --
NM_018157chr1262870 2785 2715 319 286 158 12967 12411 --
NM_018159chrX1168 --1206 --
NM_018178chr121590 55 --2435 162 21409 183
NM_018182chr1761719 741 723 690 396 383 ------
NM_018184chr311777 ------
NM_018195chr1151773 1710 480 287 76 ------
NM_018200chr1541827 1726 553 110 12055 1379 --
NM_018201chr972214 2100 2078 1721 822 123 46 --11805 --
NM_018206chr16--1170 ----
NM_018221chr2------1185
NM_018243chr443667 2926 722 218 --43801 2844 1383 1222 --
NM_018246chr832560 558 25 --160 --
NM_018254chr111713 --11898 11496
NM_018266chr3----11085 --
NM_018293chr321097 182 ------
NM_018302chr421704 891 1648 ----
NM_018351chr1244129 3736 1670 1545 13573 44166 3825 3768 119 --
NM_018373chr1454585 4016 3927 2541 1554 --35706 2445 2198 --
NM_018374chr721467 792 14434 --24398 88
NM_018403chr353017 2715 2591 637 124 --1201 13283
NM_018440chr897523 7249 6411 6219 6054 1315 1267 615 272 17583 46036 5692 2593 131 --
NM_018452chr6_random53759 2779 1506 356 259 ----1595
NM_018489chr141668 745 647 345 ----1473
NM_018509chr1731387 137 95 ------
NM_018566chr153827 3540 3141 1907 250 ------
NM_018571chr2----1441 1626
NM_018644chr1191642 1554 1480 860 412 388 352 235 194 --134 --
NM_018650chr121974 473 ------
NM_018667chr16142479 2449 2291 2257 2076 2052 2007 1999 1993 1935 1106 903 443 195 --22462 2356 --
NM_018682chr71660 ------
NM_018689chr1572007 1685 615 399 337 313 50 --2625 159 --
NM_018717chr461873 861 643 224 144 21 --12598 1609
NM_018834chr51890 ------
NM_018841chr173498 3384 3250 3153 2923 772 135 --1818 --
NM_018890chr731393 1247 216 --1381 --
NM_018898chr54335 312 246 113 12192 1829 1643
NM_018899chr54335 312 246 113 12192 1829 1643
NM_018900chr54335 312 246 113 12192 1829 1643
NM_018901chr54335 312 246 113 12192 1829 1643
NM_018902chr54335 312 246 113 12192 1829 1643
NM_018903chr54335 312 246 113 12192 1829 1643
NM_018904chr54335 312 246 113 12192 1829 1643
NM_018905chr54335 312 246 113 12192 1829 1643
NM_018906chr54335 312 246 113 12192 1829 1643
NM_018907chr54335 312 246 113 12192 1829 1643
NM_018908chr54335 312 246 113 12192 1829 1643
NM_018909chr54335 312 246 113 12192 1829 1643
NM_018910chr54335 312 246 113 12192 1829 1643
NM_018911chr54335 312 246 113 12192 1829 1643
NM_018976chr1221973 462 --12755 --
NM_018979chr1241975 1842 1817 952 12014 ----
NM_018991chr74716 311 127 110 ------
NM_018994chr1----1453 --
NM_019006chr151153 ------
NM_019022chr1832889 2708 992 --12527 11951
NM_019036chr6--2857 505 1126 --
NM_019044chr2104449 3704 3494 3100 3070 3037 1762 1117 931 319 --33483 2985 709 --
NM_019074chr154973 787 651 48 ------
NM_019080chr131440 11405 ----
NM_019087chr531424 445 357 --31485 367 129 --
NM_019091chr2197 ------
NM_019096chr61977 ------
NM_019593chr2043015 2344 2180 2080 11943 ----
NM_019596chr2112713 ----1903
NM_019610chr111881 ------
NM_019613chr172534 115 --149 --
NM_019862chr1641712 1580 565 194 ----1363
NM_019885chr282987 2565 2056 1129 738 662 610 355 12462 2714 633 --
NM_019898chr1641712 1580 565 194 ----1363
NM_019899chr1641712 1580 565 194 ----1363
NM_019900chr1641712 1580 565 194 ----1363
NM_019903chr1011312 ------
NM_020122chr255448 4442 4347 2130 409 --34967 3765 1944 --
NM_020130chr81188 ----2894 374
NM_020133chr666077 4979 4463 2201 1652 769 11756 --1541
NM_020184chr252269 2244 1946 804 788 --22134 877 --
NM_020228chr1141758 1608 1570 184 12472 --11995
NM_020240chr562567 1877 1809 943 613 378 ------
NM_020336chr2053816 1444 1186 1108 440 --32961 2804 2696 --
NM_020338chr1053221 2652 2342 457 356 --23155 2641 --
NM_020341chr2021606 616 ------
NM_020364chrY21377 93 11709 1223 11415
NM_020381chr611942 11896 ----
NM_020386chr3----1121 --
NM_020403chr1321119 272 ------
NM_020416chr432600 1688 61 ------
NM_020420chrY21377 93 11709 1223 11415
NM_020433chr20111596 1481 1330 1249 1167 692 682 515 493 93 47 ------
NM_020438chr951046 1004 193 103 93 --31101 475 232 --
NM_020440chr173185 2954 2916 2562 1178 1051 488 1523 32932 2125 300 --
NM_020443chr1136953 6726 6328 5622 5565 4954 2655 2337 2224 1932 1633 1626 1413 --56041 4719 4603 1699 452 11460
NM_020447chr1592215 2137 2095 1892 1001 617 517 155 24 --22230 1020 --
NM_020466chr644129 4096 4080 3477 --14831 14675
NM_020645chr113638 619 153 --1238 --
NM_020661chr1221686 144 --11431 1335
NM_020676chr34772 360 115 83 ------
NM_020699chr124376 4301 11861 25173 3449 --
NM_020711chr222394 120 22127 1939 21695 465 --
NM_020713chr20122843 2739 2576 2564 2553 2437 2185 1184 1008 894 518 164 --2674 351 --
NM_020718chr1675402 5266 5251 4930 4785 1536 752 1472 31769 1502 1121 --
NM_020727chr212974 684 1212 --11451
NM_020728chr773087 2995 2881 2548 1257 1058 261 11176 ----
NM_020739chr1544143 3270 2931 1173 ------
NM_020740chr17----1158 --
NM_020752chr1022267 2160 1782 --21107 315
NM_020755chr6------1327
NM_020766chrX14003 --33463 1434 952 --
NM_020772chr1747891 5598 2441 2026 --27518 994 --
NM_020779chr212730 --1935 12485
NM_020796chr542649 2274 740 260 ----11033
NM_020801chr5----1409 --
NM_020805chr1841533 495 331 156 --1220 --
NM_020808chr11161 --2276 261 --
NM_020821chr152738 639 --21312 235 --
NM_020839chr3139 1319 ----
NM_020850chr1683071 2737 2713 2074 1020 734 726 31 21299 1244 11041 --
NM_020856chr1941551 1325 347 67 --1611 --
NM_020870chr42688 129 --11548 --
NM_020872chr321619 288 ------
NM_020918chr1033534 3175 2913 23452 1081 ----
NM_020921chr1413674 --22427 152 --
NM_020922chrX----1464 11323
NM_020940chr1032897 2117 62 11921 ----
NM_020956chr19124554 4469 3780 3494 3020 1269 1244 1148 1061 266 139 121 ----1401
NM_020964chr1894683 4493 4049 3601 3081 919 793 317 218 1800 33692 3274 207 --
NM_020983chr1242128 1690 852 56 --2839 105 --
NM_020993chr1252505 2108 1123 870 145 1623 22722 2445 --
NM_021012chr17103071 2806 2295 2282 2275 2183 1942 1034 111 49 1416 11245 --
NM_021020chr8123238 2972 2824 2682 2545 2368 2221 1226 745 128 121 87 --52461 791 783 606 213 --
NM_021033chr1322672 2572 ------
NM_021061chr844011 3559 1133 877 --24391 1061 --
NM_021064chr62597 444 ----1137
NM_021072chr541814 695 207 88 ------
NM_021079chr17122612 2587 2473 2252 2207 2165 1036 923 725 678 648 438 --1895 --
NM_021090chr2294978 3971 3785 1480 1399 943 288 80 53 14912 ----
NM_021101chr331625 786 521 180 ----
NM_021115chr22----1123 --
NM_021120chrX1251 --32271 2116 355 --
NM_021132chr103868 165 22 ----1133
NM_021136chr141705 ------
NM_021140chrX21119 183 --130 --
NM_021155chr1992998 2917 2845 2717 2528 2113 914 725 53 ------
NM_021183chrX22545 181 1191 ----
NM_021188chr141360 --2514 117 --
NM_021202chr2072984 2802 2771 2534 2039 486 160 --1869 22461 947
NM_021238chr1251941 1589 301 233 78 ------
NM_021240chr9153 1702 ----
NM_021252chr10188 ------
NM_021629chr323698 1986 --1499 13930
NM_021635chr6--1533 11452 --
NM_021637chrX128 1135 ----
NM_021643chr211781 11526 21588 323 --
NM_021647chr433387 1742 1698 --1100 --
NM_021648chr642602 2266 2110 1700 1318 ----
NM_021728chr142897 109 --1212 --
NM_021814chr6--11053 ----
NM_021912chr1543911 3729 2924 667 --12647 --
NM_021913chr1931814 1533 716 11348 11370 1266
NM_021960chr122039 1705 ------
NM_021962chr1782408 2151 1886 1603 877 628 431 112 11674 21705 561 --
NM_021964chr396556 6475 6452 5065 2231 1970 1631 1493 618 25662 1644 26266 1102 --
NM_021977chr663466 3458 3160 2462 131 47 --22519 650 --
NM_022048chr1596304 5432 4674 4516 4479 2083 470 267 38 --129 --
NM_022138chr621504 226 21470 442 ----
NM_022140chr52456 97 --11543 11537
NM_022166chr16115446 4821 2198 2172 1688 895 885 871 644 610 250 12139 1100 25618 2297
NM_022169chr1141185 1113 509 453 --1554 11011
NM_022373chr72665 284 ----1208
NM_022459chr1376231 5547 5267 4623 1912 1425 460 --74897 4204 2366 2238 1263 473 31 12155
NM_022462chr19123792 3696 3467 3116 2998 2531 2323 1493 1395 598 563 513 ------
NM_022465chr1262876 2152 1175 1020 538 133 1499 12646 --
NM_022469chr182681 2046 929 889 858 447 301 248 ------
NM_022473chr1574140 4086 3137 1541 1257 844 735 1327 21135 789 1304
NM_022476chr161245 --144 --
NM_022491chr1233492 2433 28 --32871 998 908 --
NM_022497chr341324 1300 743 345 --31068 792 106 12664
NM_022574chr752039 1763 785 578 452 --12001 1276
NM_022648chr2104361 3852 3022 1111 1043 1036 837 802 529 58 11521 44420 3837 3735 819 --
NM_022719chr2293740 3533 3210 3113 3104 2543 1335 815 739 --11348 --
NM_022735chr11206 1317 1164 --
NM_022739chr17--129 1764 --
NM_022755chr982399 1911 1782 669 568 363 335 84 --1963 --
NM_022768chr1195 ------
NM_022781chr931319 1214 121 ----1501
NM_022784chr1521063 143 1944 ----
NM_022826chr21892 ------
NM_022841chr151667 ------
NM_022845chr1621797 719 ------
NM_022893chr211154 --11205 --
NM_022898chr1453956 3386 3368 1791 798 ------
NM_022970chr1011272 --11125 11006
NM_023010chrX1698 ------
NM_023067chr331234 374 233 ------
NM_023068chr2031127 518 205 --21536 1233 --
NM_023076chr161597 --22781 2496 --
NM_024007chr562808 2800 1177 1076 362 154 --12660 --
NM_024019chr41884 --1280 --
NM_024052chr1742643 1138 692 119 22577 829 12258 1391
NM_024103chr19111754 719 691 668 594 548 422 366 246 239 101 3575 182 124 3526 174 116 --
NM_024165chr61311 ------
NM_024315chr7132 ------
NM_024345chr9--1147 21812 111 1194
NM_024408chr173421 3016 2589 2396 1224 921 771 12956 22630 530 --
NM_024423chr1824134 1297 ------
NM_024424chr113951 318 70 --1215 --
NM_024425chr113951 318 70 --1215 --
NM_024426chr113951 318 70 --1215 --
NM_024429chr7----1212 11067
NM_024501chr2--1701 ----
NM_024524chr322289 72 --13050 --
NM_024529chr1136 ----1104
NM_024551chr1211852 32379 696 31 1282 --
NM_024551chr1211852 32379 696 31 1282 --
NM_024557chr1161346 615 423 415 322 75 --1518 --
NM_024563chr531182 522 237 --31539 1459 192 --
NM_024607chr852770 1572 1221 136 112 --23026 402 13048
NM_024624chr2167 ------
NM_024626chr111589 --11400 --
NM_024631chr111178 --2595 99 --
NM_024652chr1531167 469 320 --31227 808 400 --
NM_024670chr1021473 81 --11104 --
NM_024674chr133200 3053 558 --22701 764 --
NM_024702chr17--1235 ----
NM_024721chr822600 1018 --2809 575 --
NM_024742chr16111932 1842 1744 1717 1585 1466 1210 766 709 615 144 ------
NM_024759chr81744 --1691 --
NM_024761chr9104919 4466 3901 3702 3614 3390 1795 1459 1362 198 --12020 --
NM_024770chr296695 6258 5469 5444 5298 2372 1781 1653 1037 16323 41815 1124 915 395 --
NM_024780chr161367 --11087 --
NM_024814chr7--1158 ----
NM_024834chr1031969 1829 1815 --11464 --
NM_024899chr181549 ------
NM_024906chr4--1989 ----
NM_024915chr8112834 1944 1086 1005 911 837 723 296 285 153 89 ------
NM_024930chr532232 1897 375 --1436 --
NM_024947chr311931 17183 ----
NM_024949chr464211 4164 4110 3443 1435 880 --34258 4249 1267 --
NM_024953chr1242084 459 200 31 21945 544 12460 22448 1128
NM_024963chr7185445 4863 3968 3831 3773 3751 2368 2115 2079 2037 1997 1667 1493 1187 554 320 269 70 --25731 3595 --
NM_024989chr237758 6742 71 13282 194 13044
NM_025073chr134545 3080 252 --14196 --
NM_025083chr1571770 1699 1615 567 486 84 25 --11400 --
NM_025138chr132504 407 ----11047
NM_025164chr1142231 1750 1743 1565 --11550 --
NM_025179chr1104039 4002 3782 3774 3729 3132 1590 1533 118 93 --11918 --
NM_025182chr91729 --3934 848 89 --
NM_025191chr11181 ------
NM_025195chr851802 762 655 625 536 --2603 70 --
NM_025222chr372580 1049 676 577 273 210 195 ------
NM_025238chr15----11505 --
NM_030576chr17102240 2153 2114 1719 1000 841 790 735 282 270 ----11928
NM_030631chr141529 ------
NM_030647chr734945 807 521 --44251 2031 751 234 --
NM_030648chr464894 4597 4255 1764 1659 28 ------
NM_030761chr162187 2163 1777 714 312 231 --11087 --
NM_030762chr12----11232 1261
NM_030763chrX----1573 --
NM_030767chr992437 2348 2259 2192 2075 1975 714 94 85 --1494 --
NM_030802chr17193 1673 1328 1746
NM_030806chr1168868 8137 8025 7961 7590 7330 7276 5932 3736 3221 2365 2191 1995 1651 817 774 27403 5763 25809 3493 --
NM_030816chr122825 256 1250 22769 1408 153
NM_030945chr531881 508 210 ------
NM_030962chr1141016 478 382 76 --1345 --
NM_030964chr573169 2816 2716 2676 813 772 106 --1476 12311
NM_031411chr54335 312 246 113 12192 1829 1643
NM_031417chr1941927 1125 866 294 21913 944 31860 1821 31 --
NM_031443chr72309 76 ----1364
NM_031444chr2282265 1758 704 460 450 315 242 35 --2639 28 --
NM_031445chr242335 1118 823 588 --23090 290 --
NM_031461chr832225 872 359 1398 11694 --
NM_031468chr7187689 7483 7461 6513 6427 6001 5954 5779 5591 5372 5219 3200 3051 2711 2506 1027 1001 528 12202 32369 423 66 --
NM_031483chr20--12262 33017 845 566 --
NM_031492chr111411 ------
NM_031845chr243060 2862 1465 1372 --13407 --
NM_031847chr243060 2862 1465 1372 --13407 --
NM_031849chr54335 312 246 113 12192 1829 1643
NM_031857chr54335 312 246 113 12192 1829 1643
NM_031860chr54335 312 246 113 12192 1829 1643
NM_031866chr103397 286 207 1845 ----
NM_031890chr2252798 2522 2208 519 336 --33063 2903 550 --
NM_031935chr11995 ----1908
NM_031942chr211158 ------
NM_032012chr954959 4372 3951 3566 71 24301 933 23598 3220 --
NM_032017chr1122091 1922 1414 1329 1314 1307 768 498 455 417 94 79 ------
NM_032041chr872489 2308 2161 1993 1831 698 304 --11838 --
NM_032050chr2211033 ------
NM_032052chr2221418 244 --2957 346 --
NM_032116chr1335120 3950 1308 15509 11947 --
NM_032121chrX22315 1753 --12711 --
NM_032139chr191973 --1252 --
NM_032144chr211808 --1618 --
NM_032146chr32133 127 ------
NM_032153chr361962 1886 1699 963 840 684 --1237 --
NM_032160chr1864351 4335 2687 2650 1599 355 ------
NM_032193chr1161632 1591 1301 738 409 145 11950 21836 1828 --
NM_032208chr23446 422 102 1802 12952 --
NM_032289chr551587 1488 536 219 21 1386 1207 --
NM_032293chr91180 ------
NM_032312chr2----1882 --
NM_032319chr22351 36 ------
NM_032352chr141195 ------
NM_032368chr13547 239 205 ------
NM_032434chr231627 1588 651 ------
NM_032445chr1531769 841 50 ------
NM_032457chr433445 2753 1347 --13092 --
NM_032471chr6------1841
NM_032486chr1642084 2072 1939 1799 1594 ----
NM_032499chr151456 --2562 79 --
NM_032505chr3----1458 12364
NM_032509chr831998 1779 1669 --1650 12347
NM_032550chr1061162 784 408 369 215 43 --125 --
NM_032557chr41638 --1104 --
NM_032569chr1671247 736 730 677 554 545 529 ----11280
NM_032574chr21256 ------
NM_032622chr421152 1068 ----1518
NM_032632chr1411863 ------
NM_032663chr121393 11682 21609 1342 --
NM_032810chr102623 239 ------
NM_032819chr202579 81 ------
NM_032833chr11288 ----12583
NM_032842chr721404 82 --1121 --
NM_032859chr132668 640 32598 2481 1518 13153 --
NM_032873chr1144182 1682 636 208 ----1876
NM_032900chr1032897 1527 1009 23883 3061 23251 211 --
NM_032905chr1031218 1109 38 --1109 --
NM_032918chr12----11059 --
NM_032924chr721093 918 ------
NM_032949chr131484 ------
NM_033030chr23257 68 52 ------
NM_033071chr6186 --1234 --
NM_033083chr332336 2285 224 --12510 --
NM_033128chr71570 ------
NM_033129chr20121887 1815 1693 1618 1437 1405 1261 822 335 240 126 113 --21701 491 --
NM_033132chr1311465 1512 41931 1781 570 434 11954
NM_033181chr663635 3128 3093 2725 1313 236 --13153 --
NM_033207chr1042333 1848 564 28 ----1243
NM_033211chr522063 84 ----11922
NM_033221chr982261 1913 1853 1768 1756 1038 231 31 --22582 551 12009
NM_033224chr735493 5345 1577 --35599 1197 328 --
NM_033225chr822853 546 --22904 2606 --
NM_033274chr571322 1174 870 735 519 292 56 ----12429
NM_033290chrX53749 1038 879 612 303 32991 2823 2606 11170 --
NM_033305chr9--11186 11272 --
NM_033331chr952416 2294 959 685 409 --12374 136
NM_033340chr1021054 69 ------
NM_033360chr1231672 845 816 --21128 534 --
NM_033387chr9112503 2258 2153 1660 978 954 684 410 214 66 29 --12656 --
NM_033389chr1764443 4328 4226 3402 671 441 --24616 1652 --
NM_033397chr10102017 1908 1689 1467 1364 597 426 362 304 25 --21632 580 --
NM_033503chr15183676 3406 3086 2680 2595 2561 1485 1444 1409 998 991 873 729 657 628 451 399 171 --1189 --
NM_033505chr276180 5464 5283 2235 2005 1937 1843 --16257 --
NM_033512chr842430 827 690 277 --22819 105 --
NM_033515chr61127 ------
NM_033542chr2041646 1444 1288 695 11967 165 --
NM_033551chr572847 2661 2633 2161 1212 743 220 --22990 435 --
NM_033624chr1212109 ------
NM_033631chr183652 3349 2809 2757 1404 1283 914 206 23512 363 ----
NM_033637chr10113458 3315 3046 3008 2969 2779 2585 834 428 149 36 11510 14032 --
NM_033642chrX----1153 --
NM_052828chr631111 494 31 --11421 11341
NM_052851chr1322085 855 11856 11976 --
NM_052879chr1211127 1654 ----
NM_052885chr1233388 628 445 --13698 --
NM_052897chr123337 258 29 --1813 --
NM_052906chr22154540 3918 3731 3259 1878 1868 1718 1299 993 638 530 282 128 104 90 --14865 --
NM_052907chr1274088 3836 3648 3056 2974 1563 935 --1369 --
NM_052910chr1352077 1642 1573 553 277 ------
NM_052918chr1062753 2684 2590 1216 844 779 ------
NM_052934chr161880 1855 1781 1486 897 487 --1254 1654
NM_053016chr977326 6245 5861 2721 1182 281 60 1504 37215 7151 6862 --
NM_053024chr3--11011 ----
NM_053025chr341239 1113 648 569 1434 ----
NM_053026chr341239 1113 648 569 1434 ----
NM_053027chr341239 1113 648 569 1434 ----
NM_053028chr341239 1113 648 569 1434 ----
NM_053031chr341239 1113 648 569 1434 ----
NM_053032chr341239 1113 648 569 1434 ----
NM_053064chr1472620 2189 2142 1164 1003 855 368 ----12499
NM_053067chr9188 ------
NM_054025chr1191642 1554 1480 860 412 388 352 235 194 --134 --
NM_057175chr432255 1837 1636 --11694 --
NM_057178chr1752510 2427 1772 879 687 ------
NM_057180chr121477 ------
NM_080491chr11143582 3188 2987 2794 2765 2442 1524 1067 866 829 312 306 146 50 ------
NM_080546chr911568 ------
NM_080599chr1021245 865 ------
NM_080617chr20--1209 ----
NM_080629chr1--2540 459 ----
NM_080630chr1--2540 459 ----
NM_080632chrX1698 ------
NM_080654chr1131241 189 180 ------
NM_080669chr17164686 4676 3828 3800 3617 3443 3379 3100 1825 1310 1114 1018 991 656 553 217 11107 21725 1675 14332
NM_080737chrX11234 ------
NM_080738chr171901 1867 1399 681 557 534 497 ------
NM_080759chr132309 204 --32189 2098 385 --
NM_080760chr132309 204 --32189 2098 385 --
NM_080764chr2211315 32193 528 358 ----
NM_080867chr1454485 3517 3158 1103 281 ------
NM_080927chr332463 2140 759 --22665 672 --
NM_130385chr1152369 2304 2220 450 77 --43044 2894 2702 2450 --
NM_130387chr321134 1006 11246 ----
NM_130436chr211688 --12653 --
NM_130438chr2111265 --23230 2215 --
NM_130439chr101592 ----11449
NM_130439chr101592 ----11449
NM_130798chr1521557 1442 ------
NM_130811chr2021219 959 ------
NM_130838chr1511774 ------
NM_130839chr1511774 ------
NM_133170chr20258104 7531 7308 7263 6882 6852 6709 6502 6377 6371 5938 5272 5209 3238 2763 2754 2534 2464 2316 1914 1800 1776 559 207 135 1530 25990 5230 --
NM_133264chr1753833 963 750 130 41 --11132 23622 194
NM_133265chrX33042 2787 2393 ------
NM_133328chr196604 598 575 303 207 134 --1792 --
NM_133334chr456113 5216 5047 633 325 15066 16244 11419
NM_133367chr653303 2777 1041 816 777 ----23091 2639
NM_133445chr953159 3121 3015 1150 37 --11332 13266
NM_133631chr311314 ------
NM_133642chr2211048 --1157 --
NM_133646chr255587 5084 1893 597 500 1258 23604 670 --
NM_133650chr6186 --1234 --
NM_134325chr161415 1390 1316 735 432 22 ----1189
NM_138286chr1922681 931 ------
NM_138288chr1421918 41 ----1565
NM_138290chr72368 262 --175 --
NM_138300chr151354 1307 316 275 221 11230 11408 --
NM_138338chr22153423 3337 3107 3064 3024 2784 2629 2508 2189 2178 2130 1249 962 258 233 125 52484 1364 1289 248 169 --
NM_138346chr12209 83 ------
NM_138444chr13104220 3009 1958 1645 1364 1172 969 670 579 138 ------
NM_138457chr6182922 2496 2325 2132 1368 1339 1231 1206 851 637 621 432 354 305 242 126 58 36 --31170 1001 255 --
NM_138459chr62256 59 ----13385
NM_138473chr12104160 4011 3714 3638 3561 3229 1932 1779 1637 1607 1809 ----
NM_138492chr521511 507 --2225 151 --
NM_138576chr1453956 3386 3368 1791 798 ------
NM_138694chr633205 2417 119 1214 ----
NM_138713chr1657525 5572 3307 1869 926 --16377 --
NM_138714chr1657525 5572 3307 1869 926 --16377 --
NM_138730chr6--1127 ----
NM_138796chr1----179 --
NM_138807chr3152 ------
NM_138959chr156419 6063 1848 1308 946 ----15431
NM_139071chr1281228 1115 1094 1033 407 372 357 51 ------
NM_139131chr11172 --1628 --
NM_139177chr1751594 1405 309 251 139 ------
NM_139276chr1721847 240 --22172 868 --
NM_139283chr1252537 2509 215 143 66 --1978 --
NM_139286chr9--1204 ----
NM_139323chr201332 1819 --11544
NM_144571chr435186 298 241 11109 ----
NM_144578chr1434951 1430 1424 --13399 --
NM_144579chr2102860 2821 2723 2598 2403 1185 1062 863 712 67 --22382 851 --
NM_144590chr1042691 2078 2071 888 --1369 --
NM_144595chr13----1896 11000
NM_144599chr1555415 3984 696 538 170 ------
NM_144628chr2073025 3015 2889 2648 2388 1951 654 --42710 2444 1093 851 32810 2096 1103
NM_144658chrX136 ------
NM_144660chr10----2268 39 --
NM_144665chr11----141 --
NM_144767chr1591752 1380 973 778 527 472 229 188 39 1247 64627 3547 3335 3269 1402 195 --
NM_144775chr17114455 4344 3733 3608 1570 1487 949 924 596 482 30 --1534 --
NM_145056chr194730 611 116 67 ------
NM_145117chr1132197 1146 131 12230 1460 --
NM_145176chr622848 2760 --13115 --
NM_145203chr131155 ------
NM_145260chr23107 72 42 128 ----
NM_145284chrX22289 1582 1184 ----
NM_145306chr101512 ------
NM_145331chr6--1765 ----
NM_145332chr6--1913 ----
NM_145333chr6--1913 ----
NM_145349chr1771646 1541 1401 814 482 256 114 --11588 --
NM_145351chr1782138 2033 1893 974 748 606 415 45 --12080 1266
NM_145725chr14198 ------
NM_145726chr14198 ------
NM_145799chrX52668 2323 2211 1048 32 --32508 2232 1071 --
NM_145808chr752175 970 918 308 37 ------
NM_145810chr211158 ------
NM_145861chr171901 1867 1399 681 557 534 497 ------
NM_147147chr613755 --151 --
NM_147150chr923122 2856 --1187 12976
NM_147157chr97765 716 665 204 167 50 24 --1110 --
NM_147161chr12936 220 --188 --
NM_147164chr96497 244 190 139 105 71 ------
NM_147188chr1521204 1154 1284 1405 --
NM_148898chr7147 ------
NM_148899chr7147 ------
NM_152237chr22111741 1613 1598 1521 1425 1197 1122 1107 463 291 186 ------
NM_152253chr22114268 3777 3718 3703 3521 2902 2743 1528 1188 800 378 --54166 2968 1723 1557 1265 --
NM_152263chr185663 5456 5345 3751 2165 1229 553 62 12048 24775 4280 --
NM_152272chr821311 21 ------
NM_152275chr222182 551 ------
NM_152284chr8----190 --
NM_152332chr1412402 ----22730 2186
NM_152380chr14480 450 372 42 --2609 65 1237
NM_152388chr253981 3918 3647 1117 734 --14010 1961
NM_152424chrX73633 3351 2984 1874 1323 1265 1253 --23835 595 --
NM_152470chr18123667 3419 2858 1562 1354 1298 1262 1010 968 900 303 182 --33226 2962 1197 --
NM_152493chr181283 648 504 437 114 84 64 48 ------
NM_152495chr12293 116 11042 ----
NM_152522chr2----1154 --
NM_152523chr23175 132 36 ------
NM_152529chr263996 3517 3328 2874 300 73 11065 11487 23710 622
NM_152538chr31511 ------
NM_152542chr421650 1613 --1296 --
NM_152550chr5126 1403 ----
NM_152554chr61272 1224 1613 --
NM_152556chr721973 1004 ------
NM_152608chr121847 68 ------
NM_152624chr567222 6297 5223 5124 743 41 15076 16664 --
NM_152629chr94384 308 113 36 22580 354 13515 11351
NM_152636chr112716 185 12198 22563 2265 --
NM_152678chr311966 --1159 --
NM_152699chr343655 3340 1456 1196 --13450 12681
NM_152748chr7--1488 ----
NM_152749chr7189 11041 2999 957 --
NM_152754chr723178 2668 ------
NM_152758chr842043 1861 807 138 --149 --
NM_152765chr842179 1968 1760 304 12103 31942 1928 950 11676
NM_152787chrX2731 328 175 13383 --
NM_152789chr71543 1370 ----
NM_152835chr121819 797 ----198
NM_152838chr2042695 1198 1051 162 ------
NM_152924chr1566691 6170 5653 4593 1718 1445 --16487 1419
NM_152989chr1231582 1182 153 128 ----
NM_152991chr11------1714
NM_153020chr611660 ------
NM_153029chr1683917 3483 3423 3417 3280 3089 1222 556 13610 ----
NM_153035chr11953 --23265 565 --
NM_153040chr152445 124 ----1173
NM_153050chr2294978 3971 3785 1480 1399 943 288 80 53 14912 ----
NM_153051chr2294978 3971 3785 1480 1399 943 288 80 53 14912 ----
NM_153186chr9----1833 --
NM_153207chr12--1828 1184 12633
NM_153223chr51459 ----131
NM_153256chr1041298 1134 406 283 11775 1663 --
NM_153260chr1521246 1170 --11190 --
NM_153262chr132718 2194 852 ----12352
NM_153273chr3102713 2342 2163 2064 1862 1122 1019 963 539 349 1558 ----
NM_153321chr1731051 921 776 --11059 --
NM_153322chr1731051 921 776 --11059 --
NM_153347chr11122637 2629 2168 2038 2008 1841 1732 1017 916 484 463 457 --22493 53 1723
NM_153354chr5--2734 335 ----
NM_153426chr4133 126 ----
NM_153427chr4133 126 ----
NM_153450chr112601 281 187 ----
NM_153487chr6134661 4603 4560 4449 4356 4227 3801 3669 3146 1443 1297 1276 713 24247 1630 53819 3715 1535 486 182 --
NM_153607chr512858 13198 ----
NM_153619chr1541326 402 145 108 --22645 370 --
NM_153620chr72687 197 --11452 --
NM_153757chr4----21181 163 --
NM_170665chr1264282 4240 3172 3165 2912 1531 --23506 2799 --
NM_170672chr2182 1175 ----
NM_170674chr155967 554 284 222 159 --1540 --
NM_170677chr155967 554 284 222 159 --1540 --
NM_170692chr1----161 11083
NM_170719chr132504 407 ----11047
NM_170750chrX1284 ------
NM_170768chr1161717 1476 500 375 128 64 --11749 --
NM_171825chr5133009 2743 2720 2483 2331 2045 2023 1993 981 606 580 417 43 --22984 1980 --
NM_171827chr241010 1004 482 425 --2863 41 --
NM_171999chr18268 33 1526 ----
NM_172020chr781688 1274 808 593 498 155 79 51 --11823 --
NM_172071chr124883 1683 ----27011 1259
NM_172103chr662479 2076 1907 1696 958 23 ------
NM_172105chr662479 2076 1907 1696 958 23 ------
NM_172169chr1031754 1577 565 21648 792 11953 --
NM_172170chr1031754 1577 565 21648 792 11953 --
NM_172171chr1031754 1577 565 21648 792 11953 --
NM_172173chr1031754 1577 565 21648 792 11953 --
NM_172315chr155967 554 284 222 159 --1540 --
NM_172316chr155967 554 284 222 159 --1540 --
NM_172337chr142897 109 --1212 --
NM_172373chr131411 --1981 --
NM_173054chr72925 663 ----1701
NM_173074chr2165 ------
NM_173163chr163490 230 182 --1537 --
NM_173165chr163371 111 63 --1418 --
NM_173214chr1657525 5572 3307 1869 926 --16377 --
NM_173470chrX32917 138 112 --1774 --
NM_173476chr16142168 2073 2021 1839 1777 1542 901 834 817 465 441 381 304 27 ------
NM_173500chr1511408 ----11332
NM_173508chr1----1167 --
NM_173510chr221142 --164 --
NM_173515chr6--1105 ----
NM_173532chr12221 151 ------
NM_173570chr322138 39 11891 ----
NM_173576chr1032352 92 22 ------
NM_173582chr1155443 4220 3892 1858 1506 15956 16024 11723
NM_173595chr12115200 5185 4123 3578 1744 1618 1422 1362 1149 390 331 --24144 210 13681
NM_173624chr17160 ------
NM_173642chr1148754 8055 7075 6611 6279 5819 3437 3082 2955 2262 1081 1040 834 283 17025 58151 8116 1594 1423 681 --
NM_173670chr53935 280 215 ------
NM_173672chr642555 2311 2180 208 ------
NM_173683chr811582 133 ----
NM_173698chrX21925 544 --1797 --
NM_173808chr11895 ----11654
NM_173832chr882444 2316 752 643 473 460 130 28 --1183 --
NM_173851chr862889 2702 1576 728 454 175 ----11524
NM_174893chr172207 38 ------
NM_174907chr3186 ------
NM_174911chr833279 2601 123 13356 13514 --
NM_175624chr1257840 6524 5312 2829 522 12057 12422 --
NM_175625chr1257840 6524 5312 2829 522 12057 12422 --
NM_175709chr2272630 2113 1966 1017 804 338 132 --1586 --
NM_175736chr12157630 6953 5822 5407 3119 3012 2680 2518 1599 1451 1339 1326 1285 431 381 46097 5273 5236 2947 2853 470 --
NM_175854chr1312662 ----141
NM_175884chr761394 319 254 107 96 39 2341 308 ----
NM_176863chr1762096 1902 1489 677 484 26 --11676 11937
NM_177414chr121237 539 --31302 691 630 --
NM_177454chr21299 ------
NM_177976chr32133 127 ------
NM_177990chr2021606 616 ------
NM_177996chr2062632 1340 1093 1086 801 479 11195 ----
NM_177999chr983564 2987 2572 2545 1267 991 677 372 --1379 --
NM_178006chr1322085 855 11856 11976 --
NM_178007chr1322085 855 11856 11976 --
NM_178010chr1231582 1182 153 128 ----
NM_178011chr101236 2510 85 --12494
NM_178037chr1283661 2631 2304 1206 892 369 139 130 13514 11258 --
NM_178038chr1283661 2631 2304 1206 892 369 139 130 13514 11258 --
NM_178140chr512169 12297 1330 --
NM_178151chrX137593 7321 7172 7046 5808 5802 4850 1974 614 526 471 414 276 --37618 7332 4802 --
NM_178152chrX137593 7321 7172 7046 5808 5802 4850 1974 614 526 471 414 276 --37618 7332 4802 --
NM_178153chrX137593 7321 7172 7046 5808 5802 4850 1974 614 526 471 414 276 --37618 7332 4802 --
NM_178313chr211911 --21730 592 --
NM_178505chr1042783 2318 873 65 ----12993
NM_178565chr821229 372 ------
NM_178566chr91161 --11927 --
NM_178578chr2061857 1635 1015 772 481 282 1816 ----
NM_178582chr2021459 65 --1395 --
NM_178585chr453151 2954 2093 698 40 ------
NM_181077chr1531901 1783 304 ------
NM_181358chr133223 1380 48 11707 21538 80 --
NM_181442chr201692 ------
NM_181453chr231431 1160 294 --21589 510 --
NM_181457chr22393 91 ------
NM_181459chr21292 ------
NM_181460chr22339 37 ------
NM_181481chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_181482chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_181483chr1896956 6521 6375 6361 5842 2714 2354 2253 672 26261 1932 15727 14361
NM_181491chr9103115 2726 2594 2139 1986 1276 707 653 602 182 --32498 1123 287 --
NM_181504chr543082 2658 474 381 --11207 --
NM_181521chr1695523 5454 5289 4962 4453 1696 587 281 184 12609 25347 2212 --
NM_181523chr543082 2658 474 381 --11207 --
NM_181524chr543082 2658 474 381 --11207 --
NM_181552chr78946 281 263 232 209 190 184 148 1728 ----
NM_181659chr2042397 2281 980 474 ------
NM_181659chr2042397 2281 980 474 ------
NM_181672chrX12073 11815 ----
NM_181673chrX12073 11815 ----
NM_181702chr82866 210 --1233 --
NM_181705chr544247 1437 673 288 --11707 13655
NM_181715chr1----1104 185
NM_181782chr622264 1994 --11578 --
NM_181784chr222013 265 --2426 175 --
NM_181794chr6------1841
NM_181795chr6------1841
NM_181809chr173646 3557 3368 2636 1192 110 52 23985 2742 11613 --
NM_181874chr33468 311 145 --2110 26 --
NM_181876chr432600 1688 61 ------
NM_182314chrX128 1153 1318 1180
NM_182507chr12122240 2151 1550 929 621 594 560 477 377 359 349 63 --32316 1513 522 --
NM_182527chr22111673 1496 774 760 737 588 576 566 532 325 73 ------
NM_182643chr81747 --1195 --
NM_182689chr11288 ------
NM_182690chr12350 31 ------
NM_182691chr731188 172 69 --1116 --
NM_182692chr731188 172 69 --1116 --
NM_182706chr82156 39 ----1200
NM_182715chr71806 ----1856
NM_182728chr1471402 1357 1313 474 447 358 216 --21286 1273 1456
NM_182760chr34876 344 324 288 1719 ----
NM_182763chr122028 1694 ------
NM_182796chr53365 258 107 ------
NM_182797chr2021159 51 ------
NM_182854chr16--1320 ----
NM_182898chr796133 6121 5951 4874 2375 530 396 98 89 15167 15138 --
NM_182899chr796133 6121 5951 4874 2375 530 396 98 89 15167 15138 --
NM_182918chr212241 143 --1152 --
NM_182920chr32964 327 ------
NM_182931chr71660 ------
NM_182961chr6186 --1234 --
NM_182964chr1132197 1146 131 12230 1460 --
NM_182970chr20154247 3868 3511 3442 3296 3216 3014 2985 2762 1636 688 187 134 70 63 --23916 3275 --
NM_182976chr11217 1749 ----
NM_183006chr2031489 1418 437 --1111 --
NM_183057chr81269 ------
NM_183078chr642967 2344 899 836 22670 1034 1151 --
NM_183234chr153429 358 129 --1585 --
NM_183235chr153429 358 129 --1585 --
NM_183236chr153429 358 129 --1585 --
NM_183377chr173149 54 47 --140 --
NM_183393chr31167 1658 ----
NM_183394chr31167 1658 ----
NM_183397chr2065007 4023 1178 528 319 49 14083 21008 277 --
NM_194071chr795177 4875 4730 4069 3852 3467 1716 1008 380 --45202 3647 1976 388 14009
NM_194281chr18----148 --
NM_194285chr1142976 2810 443 260 ------
NM_194286chr12176106 6010 5488 4973 4745 4248 3965 3799 1771 1230 1139 941 785 722 535 447 379 --11370 --
NM_194292chr11302 --180 --
NM_194314chr1--24311 3692 ----
NM_194328chr931319 1214 121 ----1501
NM_194329chr931319 1214 121 ----1501
NM_194330chr931319 1214 121 ----1501
NM_194332chr931319 1214 121 ----1501
NM_194356chr125719 330 243 159 92 --1862 --
NM_197939chr174924 817 323 242 11147 21110 127 --
NM_197941chr52830 239 --32604 1037 862 --
NM_197970chr23257 68 52 ------
NM_198053chr16838 694 257 229 216 35 ------
NM_198081chr672836 2615 1899 630 361 180 42 --195 --
NM_198181chr1531821 1180 390 --12785 --
NM_198186chr94545 391 378 69 1240 2175 35 --
NM_198187chr94545 391 378 69 1240 2175 35 --
NM_198240chr121287 ------
NM_198268chr133223 1380 48 11707 21538 80 --
NM_198269chr133223 1380 48 11707 21538 80 --
NM_198273chr532640 649 593 12700 1694 --
NM_198281chr441294 1288 1006 729 --22799 149 --
NM_198291chr2072034 1955 1913 630 621 217 39 --51825 1666 1338 520 133 --
NM_198400chr1532459 838 530 --12489 --
NM_198446chr1----1237 --
NM_198503chr11969 --31696 867 39 --
NM_198510chrX5650 119 83 45 30 ------
NM_198560chr3163558 2935 2860 2532 2515 1357 928 897 863 855 799 640 615 452 349 310 --53362 2926 261 187 94 --
NM_198581chr297162 7005 6907 6144 6050 4957 2733 2650 868 15883 ----
NM_198679chr9142347 1966 1924 1850 1692 1674 582 523 510 465 347 309 198 70 --32200 2160 1024 --
NM_198686chr1472524 2456 2082 658 290 192 21 1252 11621 12343
NM_198700chr112165 154 ------
NM_198793chr323652 228 --23721 137 --
NM_198829chr731393 1247 216 --1381 --
NM_198859chr395103 4445 4193 4056 3773 1761 672 384 347 --24808 612 1228
NM_198896chr1111952 --1766 --
NM_198900chr12157630 6953 5822 5407 3119 3012 2680 2518 1599 1451 1339 1326 1285 431 381 46097 5273 5236 2947 2853 470 --
NM_198947chr1121072 109 ------
NM_198993chr17111728 1637 1570 1408 1214 1112 518 494 202 76 48 --21555 1466 --
NM_199076chr1061083 1038 474 433 58 28 --1132 --
NM_199078chr271976 924 341 235 187 175 122 --12372 --
NM_199132chr1912126 --126 --
NM_199160chr941764 823 789 610 ----21327 718
NM_199188chr1211127 1654 ----
NM_199189chr51890 ------
NM_199190chr1211127 1654 ----
NM_199262chr1751926 1833 1809 1657 631 --11684 --
NM_199320chr42783 476 --1907 --
NM_199320chr42783 476 --1907 --
NM_199355chr162397 314 --11141 --
NM_199421chr1454485 3517 3158 1103 281 ------
NM_199424chr16101438 1367 1337 1248 511 362 290 258 109 93 --21186 167 --
NM_199436chr232999 2598 1226 ------
NM_199437chr1141758 1608 1570 184 12472 --11995
NM_199438chr1141758 1608 1570 184 12472 --11995
NM_199439chr1141758 1608 1570 184 12472 --11995
NM_201263chr121735 35 --162 11371
NM_201432chr17176086 5928 5883 5557 5527 5092 4793 4695 4017 2253 1760 833 761 605 231 197 184 14218 22634 1135 --
NM_201433chr17176086 5928 5883 5557 5527 5092 4793 4695 4017 2253 1760 833 761 605 231 197 184 14218 22634 1135 --
NM_201595chr14----1152 --
NM_201599chrX6928 834 329 196 106 74 --1299 --
NM_201999chr4----1463 --
NM_203301chr1421502 1376 ------
NM_203329chr11126559 6324 5681 5456 4876 4661 4552 2406 2171 1971 1140 100 --36194 2040 506 --
NM_203330chr11126559 6324 5681 5456 4876 4661 4552 2406 2171 1971 1140 100 --36194 2040 506 --
NM_203331chr11126559 6324 5681 5456 4876 4661 4552 2406 2171 1971 1140 100 --36194 2040 506 --
NM_203344chr193476 181 25 --1240 --
NM_203351chr1761796 1773 1675 637 509 214 ----12068
NM_203391chrX3320 145 133 11132 ----
NM_203394chr1221756 203 --1977 --
NM_203403chr91102 ------
NM_203413chr176875 738 312 179 114 63 1417 1402 --
NM_203446chr213767 702 143 --1756 --
NM_203487chr1321119 272 ------
NM_205846chr521511 507 --2225 151 --
NM_205860chr152928 2603 1203 622 505 ----1822
NM_206594chr141300 1258 600 501 --11413 --
NM_206595chr141300 1258 600 501 --11413 --
NM_206852chr141705 ------
NM_206853chr652876 1646 1541 1462 542 ------
NM_206854chr654137 3347 1803 618 136 ------
NM_206855chr665102 4312 3872 1583 1101 174 ------
NM_206857chr141705 ------
NM_206860chr101367 ------
NM_206861chr101367 ------
NM_206862chr101367 ------
NM_206907chr532385 2209 845 --1398 --
NM_206909chr847261 1406 775 577 --13295 16368
NM_206914chr1282159 1927 882 364 205 185 68 26 11952 ----
NM_206925chr1542358 1748 136 38 22521 51 22390 1940 1650
NM_207042chr11467 --2194 26 --
NM_207045chr11467 --2194 26 --
NM_207046chr11467 --2194 26 --
NM_207113chr72271 246 ------
NM_207170chr12809 389 ------
NM_207171chr131987 1477 791 ------
NM_207303chr1063307 3168 3027 2896 2548 868 11536 13786 --
NM_207371chr101248 11343 ----
NM_207405chr442217 1788 744 37 --21801 1458 --
NM_207406chr456196 6060 5039 2419 701 --15002 15572
NM_207429chr1171872 615 227 204 165 147 108 22332 1965 ----
NM_207435chr122226 83 ------
NM_212551chr14718 324 244 201 --1891 --
NM_212552chr2----139 --
NM_213609chr3----1802 --
NM_213662chr1721941 334 --22266 962 --