TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1183
miRNA Sequence: CACUGUAGGUGAUGGUGAGAGUGGGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52899 838 ------
NM_000038chr551565 1531 1295 1277 318 1239 1608 --
NM_000051chr1113511 23306 2408 --12390
NM_000067chr81566 ------
NM_000084chrX75202 4242 1690 1388 1346 194 41 12302 --16312
NM_000092chr284270 4246 3971 3090 2961 1244 856 390 13737 ----
NM_000109chrX2898 741 12649 1710 --
NM_000115chr1342395 2276 1057 243 11710 12504 --
NM_000125chr673143 2925 1514 1141 1092 661 591 23497 851 ----
NM_000141chr1031475 357 163 1372 ----
NM_000163chr532230 1777 1643 1321 2642 606 --
NM_000167chrX1187 ------
NM_000176chr543907 2636 1539 417 ------
NM_000208chr1944604 1647 473 185 ------
NM_000212chr1731645 280 73 ------
NM_000232chr452558 2425 2333 2175 75 1830 ----
NM_000259chr1565991 4615 4609 1556 933 757 25390 2211 34729 1971 613 15831
NM_000264chr932770 2403 832 --11201 12339
NM_000267chr1752737 2708 663 617 400 23038 855 11335 --
NM_000314chr1032652 1220 442 --1603 11119
NM_000318chr8102892 2693 2622 2233 2050 1838 908 709 577 492 ------
NM_000329chr11141 1706 ----
NM_000332chr696382 6134 2822 2364 1274 1013 872 365 142 16259 11571 --
NM_000337chr566485 6312 6277 5382 4955 4074 15576 21464 728 --
NM_000362chr2253620 3537 2395 1356 1051 --12594 --
NM_000367chr662189 2062 1874 1694 644 508 ------
NM_000390chrX73021 2678 2396 2295 1085 1078 749 23283 2261 ----
NM_000408chr253360 3267 1262 783 716 1881 ----
NM_000428chr1442545 2390 869 349 ------
NM_000430chr1723396 1410 13707 ----
NM_000441chr762225 1863 1543 792 771 616 ------
NM_000461chr3124615 4420 4401 4001 3500 3243 1272 1048 972 837 818 32 13062 ----
NM_000533chrX3657 423 148 --11576 --
NM_000536chr111554 ------
NM_000555chrX137301 7022 6801 5194 5051 4959 2782 1733 1706 1610 1260 661 335 ------
NM_000618chr12116328 6072 5564 5430 5345 4538 4432 2159 1747 459 247 ------
NM_000618chr12116328 6072 5564 5430 5345 4538 4432 2159 1747 459 247 ------
NM_000688chr3------1108
NM_000689chr92387 53 167 ----
NM_000693chr1561802 1775 1719 1648 442 191 ------
NM_000767chr1951294 1168 493 358 273 ------
NM_000780chr83342 48 40 ------
NM_000782chr2021047 83 ------
NM_000786chr731419 1095 960 ------
NM_000807chr45573 556 179 118 67 2549 108 ----
NM_000809chr4128889 8151 8132 7971 7406 6794 6410 6237 6126 5670 2262 423 28230 6180 36383 5832 2798 17860
NM_000813chr524532 926 --35199 4167 3629 --
NM_000814chr1573498 3144 3058 1260 964 748 481 --11553 --
NM_000826chr43441 354 52 12427 1892 --
NM_000831chr1106125 5715 5588 5225 5032 4687 2290 1785 397 329 --15631 --
NM_000866chr341526 1502 1433 534 --11905 --
NM_000868chrX52601 2310 1711 970 668 ----130
NM_000875chr1566196 4635 2295 1616 1230 1160 ----1158
NM_000899chr1274098 2925 887 826 570 517 399 11083 11674 --
NM_000901chr482438 2090 2079 1618 997 932 691 419 ------
NM_000912chr873173 2419 2358 2299 2164 531 27 1772 2666 83 --
NM_000921chr121157 ------
NM_000944chr462329 2148 1540 884 858 419 ------
NM_000950chrX43185 2663 1466 613 23304 2779 ----
NM_000959chr153494 3356 1454 958 797 13966 ----
NM_000961chr2073484 3351 3055 2922 2837 1468 868 ------
NM_001001395chr1222465 331 ------
NM_001001419chr564848 4258 4237 1051 369 104 1346 11086 14450
NM_001001420chr564848 4258 4237 1051 369 104 1346 11086 14450
NM_001001481chr8103052 2659 2504 2169 1301 1281 1231 718 449 105 2675 215 1826 --
NM_001001665chr263260 2899 2783 2500 2468 1239 --22377 795 --
NM_001001928chr22108332 7991 7963 7077 5612 5604 5053 2516 2115 810 --25103 2161 --
NM_001001933chr1----2580 149 --
NM_001001938chr963957 3357 1477 1174 716 458 --11165 --
NM_001001995chrX21280 36 ----170
NM_001002255chr6------1111
NM_001002269chr92449 202 ------
NM_001002814chr863099 2479 1370 1231 862 499 --23234 2697 --
NM_001002838chrX61270 724 636 549 389 184 --11307 11404
NM_001002860chr1484693 4614 4086 3850 1886 1687 732 72 14530 21874 1055 --
NM_001003652chr1868451 6740 5651 1621 1486 1449 57044 2642 1726 843 430 56767 2617 2152 1820 1349 --
NM_001003674chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_001003675chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_001003679chr142074 704 58 22 31806 1637 1435 ----
NM_001003681chr2242095 2028 1510 532 ------
NM_001003712chr1263238 3199 2825 2694 2627 451 13675 13877 22910 332
NM_001003800chr963406 2321 1229 706 451 26 1528 22658 1215 --
NM_001004065chr953973 3463 3005 1601 315 11465 22651 754 --
NM_001004106chr531002 719 62 ------
NM_001004304chr1273214 2676 2296 2019 1190 472 217 1514 ----
NM_001004419chr1273988 3926 3015 2911 2841 1514 82 13054 23494 3267 --
NM_001004720chr22980 868 ------
NM_001005375chrY41505 604 299 162 ------
NM_001005386chr23869 490 279 1663 1817 --
NM_001005404chr1764275 3781 3493 1702 1445 1090 --23627 886 13395
NM_001005473chr575897 5159 4302 4210 4061 1679 1439 --36559 5503 499 --
NM_001005474chr321083 142 ------
NM_001005505chr331827 1303 527 ------
NM_001005609chrX73425 2804 2400 2389 1533 750 582 ------
NM_001005739chr2----2762 201 --
NM_001006600chr521786 57 22325 1893 ----
NM_001006623chr23678 580 95 --12084 --
NM_001006684chrX1628 ------
NM_001007067chr84730 385 308 208 ------
NM_001007068chr84730 385 308 208 ------
NM_001007069chr84730 385 308 208 ------
NM_001007070chr84730 385 308 208 ------
NM_001007097chr951535 1390 969 961 798 24643 276 14723 --
NM_001007278chr13125215 4884 4530 3429 1989 1364 822 651 501 439 416 21 2346 321 ----
NM_001007466chr664566 3871 1724 785 677 60 ------
NM_001007559chr1851891 1671 664 404 298 ------
NM_001008239chr1843614 2540 1101 881 ------
NM_001008495chr862227 1621 578 390 233 98 11679 ----
NM_001008738chr522075 1117 1269 22291 320 --
NM_001008801chr1932144 1732 1513 --11599 --
NM_001008925chr443516 3192 2876 518 --12970 --
NM_001009881chr12474 200 --1234 --
NM_001009882chr12474 200 --1234 --
NM_001009899chr382248 2113 2050 1600 1466 1381 1162 826 16518 36352 5986 5912 --
NM_001009958chr71630 ------
NM_001009960chr762295 2249 2207 1896 935 747 ------
NM_001009993chr284068 3808 3317 1613 812 439 69 35 23208 1787 34562 2874 338 --
NM_001010000chr1871296 1217 1095 879 794 569 101 12794 22386 896 --
NM_001010861chr132734 2281 996 ----1552
NM_001010867chr1175276 5214 5066 4586 2570 2555 2536 2203 2119 1911 1771 1339 1229 1100 1009 750 423 --34943 1381 1278 --
NM_001010888chrX81302 1293 1074 1033 913 685 550 465 33844 1516 75 14170 14335
NM_001010891chr585881 5219 5134 2773 2636 2107 1817 1027 22552 44 35950 5452 2317 --
NM_001010922chr1104169 3020 2747 1483 1419 1215 756 622 537 183 ------
NM_001010935chr13819 679 36 1915 ----
NM_001010986chrX32505 1912 925 32336 2064 1770 --1777
NM_001011513chr453694 3014 1357 842 746 24103 3371 --13574
NM_001011537chr312378 ------
NM_001011666chr786408 5895 4821 4000 2107 1406 1383 134 24561 4529 14160 11974
NM_001011713chr1421589 1291 ------
NM_001011885chr1531639 1212 646 11290 ----
NM_001012393chr11105184 4794 4501 3568 3328 3283 1895 826 637 567 ------
NM_001012419chr941078 1059 885 200 ----1297
NM_001012420chr1542309 858 389 137 --12631 --
NM_001012423chr1542309 784 389 137 --12631 --
NM_001012426chr673172 2817 2679 2594 1147 879 778 13381 2928 892 --
NM_001012427chr673172 2817 2679 2594 1147 879 778 13381 2928 892 --
NM_001012659chr3123245 3053 2919 1201 1139 1116 729 594 508 432 355 347 21382 1351 12518 --
NM_001012751chr1031647 1415 1395 ----11756
NM_001012755chrX94912 4830 4706 4231 3457 2046 2034 1458 1321 --21049 698 --
NM_001012756chr19102735 2608 2474 2143 1146 1137 1033 879 288 160 11169 12384 --
NM_001012761chr572683 2460 2088 1846 676 543 218 1322 ----
NM_001012989chrX198 ------
NM_001013399chr64865 854 397 229 ------
NM_001013406chr731684 1338 401 --21361 1288 --
NM_001013415chr451460 1244 525 354 154 11222 ----
NM_001013438chr34709 673 178 73 1784 ----
NM_001013439chr33555 257 24 1630 ----
NM_001013620chr1297369 7172 6976 6548 3097 2211 1444 1286 103 25787 3240 26505 2599 --
NM_001013699chr123494 456 155 ------
NM_001014434chr13624 579 154 1179 ----
NM_001014797chr1096819 6708 6488 5343 2882 2484 1823 1811 1455 --11856 --
NM_001015045chr492379 2018 1745 1720 1549 704 623 430 336 ----1233
NM_001015877chrX42930 1911 258 217 12215 1210 --
NM_001017368chr1732812 612 32 --12039 --
NM_001017395chr343632 3231 1037 740 12536 --1659
NM_001017396chr252147 1791 1657 802 532 ------
NM_001017523chr1231850 1702 174 21357 1198 --11575
NM_001017926chr831674 1365 722 2445 258 1179 --
NM_001017977chr1173 ------
NM_001018054chr131141 1098 353 ------
NM_001018065chr9104937 4556 4434 3673 1649 1285 876 594 231 38 11995 14427 --
NM_001018066chr9104937 4556 4434 3673 1649 1285 876 594 231 38 11995 14427 --
NM_001018067chr185190 4187 4133 4101 4042 4019 3596 1907 ------
NM_001018068chr185190 4187 4133 4101 4042 4019 3596 1907 ------
NM_001018069chr185190 4187 4133 4101 4042 4019 3596 1907 ------
NM_001018072chr1231850 1702 174 21357 1198 --11575
NM_001018074chr543907 2636 1539 417 ------
NM_001018075chr543907 2636 1539 417 ------
NM_001018076chr543907 2636 1539 417 ------
NM_001018077chr543907 2636 1539 417 ------
NM_001020825chr521382 111 ------
NM_001023567chr154787 682 389 137 12401 ----
NM_001024094chr543907 2636 1539 417 ------
NM_001024647chr1297187 7141 7044 6845 6626 5680 1688 651 234 26865 4728 12946 --
NM_001024934chr62596 185 ------
NM_001024935chr62596 185 ------
NM_001024936chr62596 185 ------
NM_001024948chr183018 2963 2330 2280 2269 1283 1055 1040 --1454 12216
NM_001025076chr1074373 4239 4065 3907 2476 2187 1084 26074 1847 25601 4189 --
NM_001025077chr1085731 5597 5423 5265 5069 2442 1107 720 17432 26959 5547 --
NM_001025079chr364020 3817 3790 2680 2550 1336 --33025 2718 931 12605
NM_001025108chr262794 1642 1629 1326 1108 972 23893 3827 14121 --
NM_001025201chr2135 156 ----
NM_001025252chr832900 598 286 22576 248 ----
NM_001025253chr832900 598 286 22576 248 ----
NM_001025266chr374869 3851 3766 3428 3083 1038 701 --14216 --
NM_001025580chrX83536 3310 1653 1588 1382 814 425 38 --11354 --
NM_001025616chr42580 132 ------
NM_001025780chr931181 1051 196 11332 --11547
NM_001029863chr663180 2546 1292 1098 854 55 2949 277 ----
NM_001029875chr51367 12530 --12296
NM_001030007chr1633559 375 276 11579 ----
NM_001030055chr1453201 3107 1766 858 325 32999 1678 1402 --24291 3119
NM_001030272chr11163 ----133
NM_001030273chr11163 ----133
NM_001031690chr763114 2601 2363 2184 2005 640 ------
NM_001031695chr2264242 4188 4110 1554 1346 87 35248 5229 687 ----
NM_001031804chr1674378 4227 4036 3838 3795 3242 1526 ------
NM_001031812chr562002 1793 1547 882 577 281 21891 331 ----
NM_001032283chr122773 384 ------
NM_001032284chr122773 384 ------
NM_001032380chr1041568 1327 674 407 ------
NM_001032393chrX1211 ------
NM_001033045chr263278 1637 1436 830 708 253 13580 23742 3216 --
NM_001033087chr20112857 2801 2569 2400 2330 1165 1007 983 825 420 165 ------
NM_001033117chr364832 3090 1039 981 638 162 1483 ----
NM_001033503chr52459 419 ------
NM_001033557chr21533 1909 ----
NM_001033561chr171889 1696 ----
NM_001033576chr1762676 2521 2057 1980 1967 890 --1491 --
NM_001033723chr852710 2447 2159 414 62 ------
NM_001033925chr1011621 11912 1810 --
NM_001034954chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_001034955chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_001034956chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_001034957chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_001035003chr441254 930 397 270 11126 ----
NM_001035004chr441254 930 397 270 11126 ----
NM_001037132chr771645 834 734 661 294 286 138 1546 ----
NM_001037133chr771645 834 734 661 294 286 138 1546 ----
NM_001037165chr7168454 8270 8010 7711 7118 7032 6091 5945 5811 5726 2328 2295 1984 1705 1580 877 18738 ----
NM_001037172chr341231 966 504 271 ------
NM_001037174chr232208 2053 1556 ------
NM_001037317chr132734 2281 996 ----1552
NM_001037324chr31722 ------
NM_001037339chr111717 11822 1576 --
NM_001037340chr111717 11822 1576 --
NM_001037341chr111717 11822 1576 --
NM_001037341chr111717 11822 1576 --
NM_001037533chr13212 103 84 ------
NM_001039538chr253680 3413 3207 1414 1122 1765 --13104
NM_001039547chr3107596 7035 5700 5083 5034 3110 2884 2666 2273 2065 11544 16532 --
NM_001039585chr143751 3613 1215 1054 14223 ----
NM_001039590chrX43755 193 146 51 1248 2636 179 --
NM_001039591chrX43755 193 146 51 1248 2636 179 --
NM_001039616chr19156 ------
NM_001039618chr1135457 4260 261 12009 15218 14393
NM_001039693chr244017 3017 1230 98 11378 1293 --
NM_001039937chr1363948 3599 1563 430 155 132 21549 926 ----
NM_001040020chr731565 1535 478 ------
NM_001040142chr232054 1712 43 ------
NM_001040143chr232054 1712 43 ------
NM_001040152chr774806 4306 4258 3492 3467 1681 1528 11140 13773 --
NM_001040157chr462224 2164 1912 1783 269 253 --199 --
NM_001040181chr31785 ------
NM_001040182chr31785 ------
NM_001040183chr31785 ------
NM_001040199chr31785 ------
NM_001040200chr31785 ------
NM_001040214chr642055 1832 1495 350 12003 12199 --
NM_001040402chr452189 2173 2030 215 198 ------
NM_001040429chr1372847 2457 1262 1109 689 334 87 1505 --11280
NM_001040441chr175229 5106 4675 3972 2189 1970 998 --23838 3794 11458
NM_001040665chr784380 4022 3560 1984 1375 1066 687 297 1773 ----
NM_001040712chr963494 3304 2814 967 252 33 --1360 33155 1381 742
NM_001042353chr202510 42 ------
NM_001042357chr1031204 591 294 11086 ----
NM_001042358chr1031204 591 294 11086 ----
NM_001042360chr1031204 591 294 11086 ----
NM_001042363chr1031204 591 294 11086 ----
NM_001042388chr183879 634 391 1185 1805 --
NM_001042389chr1031204 591 294 11086 ----
NM_001042390chr1031204 591 294 11086 ----
NM_001042392chr1031204 591 294 11086 ----
NM_001042395chr1031204 591 294 11086 ----
NM_001042404chr111452 ------
NM_001042413chr993665 2961 2612 1345 1221 779 721 183 117 11655 ----
NM_001042453chrX31537 1339 607 1646 2328 215 --
NM_001042492chr1752737 2708 663 617 400 23038 855 11335 --
NM_001042494chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_001042495chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_001042496chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_001042497chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_001042533chr331249 543 137 23037 847 ----
NM_001042555chr1273600 3422 1924 1371 928 785 389 13656 11252 --
NM_001042599chr256339 5771 2706 776 417 --25308 5047 --
NM_001042601chr332866 2410 99 22971 2131 ----
NM_001042604chr344334 3384 763 202 23843 3677 ----
NM_001042669chr42580 132 ------
NM_001042749chrX31759 654 77 --1212 11902
NM_001042750chrX31759 654 77 --1212 11902
NM_001042751chrX31759 654 77 --1212 11902
NM_001042762chr72735 38 ------
NM_001042784chr4125 ------
NM_001043318chr14114012 3674 3129 3055 2954 2886 2658 1224 1191 363 292 12524 11009 --
NM_001043351chr121532 728 ------
NM_001044722chr562002 1793 1547 882 577 281 21891 331 ----
NM_001044723chr562002 1793 1547 882 577 281 21891 331 ----
NM_001071775chr1341910 1808 349 172 ------
NM_001083620chr43440 353 52 12425 1891 --
NM_001099678chr3136316 4956 4185 2318 2214 1892 1882 1768 1686 1667 687 516 243 15929 16087 11437
NM_001100108chr1106267 5899 5632 3215 3021 1816 933 897 349 152 --37882 2570 2114 --
NM_001106chr3119571 9514 8766 8229 7410 6567 3912 3549 2596 2433 2306 18693 28007 2849 --
NM_001121chr1031486 1285 480 ------
NM_001122679chr52899 838 ------
NM_001128chr1633559 375 276 11579 ----
NM_001149chr102258 203 11001 --1882
NM_001160chr1292607 2146 2076 1009 924 842 711 626 515 1109 ----
NM_001167chrX156486 6385 5877 5742 5614 4735 4640 2300 2273 2127 1990 1905 1708 1327 680 ------
NM_001173chr1453201 3107 1766 858 325 32999 1678 1402 --24291 3119
NM_001174chrX62043 1505 693 572 206 82 --140 --
NM_001178chr11163 ----133
NM_001186chr21122909 2789 2747 2700 2511 1058 1047 968 808 385 355 316 12840 ----
NM_001201chr483878 3837 3656 3102 2943 2858 2756 776 23971 1409 23817 127 --
NM_001204chr287443 7320 6306 5086 5046 3026 1649 1112 --1398 11127
NM_001206chr932897 2256 673 23045 2419 ----
NM_001219chr752089 1572 755 550 46 ------
NM_001238chr19191 ------
NM_001241chr262063 1968 1955 1677 959 789 1264 12228 --
NM_001241chr262063 1968 1955 1677 959 789 1264 12228 --
NM_001259chr764921 1562 1306 841 370 79 15900 11625 --
NM_001270chr51266 ------
NM_001271chr1562933 2838 2382 2125 1318 933 13210 --169
NM_001290chr42398 72 1862 ----
NM_001310chr1243061 2628 2121 2080 ------
NM_001331chr1162727 2687 2643 657 274 128 --11135 --
NM_001332chr521254 517 ------
NM_001338chr2131157 499 178 ------
NM_001356chrX1814 ------
NM_001364chr1174550 4222 4039 1225 749 330 110 24294 204 11880 --
NM_001394chr81604 ------
NM_001396chr2152603 2470 2432 2205 1089 22749 522 ----
NM_001399chrX73425 2804 2400 2389 1533 750 582 ------
NM_001412chrX83660 3596 3410 3174 2281 1480 1071 1040 --1457 --
NM_001415chrX91774 1518 1383 1298 593 558 426 350 280 ------
NM_001419chr1954824 4782 4082 1493 1362 14137 ----
NM_001427chr731985 1511 157 11783 ----
NM_001438chr133451 817 693 1723 11252 --
NM_001498chr631171 877 175 ----147
NM_001527chr6134810 4712 4639 4466 4106 3487 3170 3036 1859 1112 755 545 448 21159 496 --1727
NM_001609chr10103572 3349 3295 2932 1446 1041 532 404 342 319 ------
NM_001650chr1853759 3695 3583 3421 372 1431 ----
NM_001655chr1161698 1620 814 689 625 490 ------
NM_001656chr531488 620 597 11896 ----
NM_001663chr1422543 1739 22714 610 1133 22633 2130
NM_001668chr131866 1719 286 11605 12016 --
NM_001677chr131104 915 347 21025 341 11058 --
NM_001681chr122488 204 ------
NM_001690chr372392 2307 1907 892 758 696 364 1237 ----
NM_001695chr884093 3656 3147 3012 2945 2922 566 189 167 11527 --
NM_001718chr631095 438 252 ------
NM_001730chr1341573 1368 1083 652 31325 1006 455 ----
NM_001730chr1341573 1368 1083 652 31325 1006 455 ----
NM_001745chr551156 1143 1009 873 62 ------
NM_001755chr1671874 1848 799 638 582 544 538 1655 1156 --
NM_001759chr1295193 4708 4687 4392 3678 2068 722 294 282 14756 14004 1619
NM_001777chr364020 3817 3790 2680 2550 1336 --33025 2718 931 12605
NM_001797chr161123 ------
NM_001822chr2135 156 ----
NM_001839chr11209 ----1494
NM_001845chr132883 498 ------
NM_001851chr61136 ------
NM_001858chr653879 1223 1106 463 162 --13353 --
NM_001859chr963784 3274 1517 732 167 36 13138 12567 12630
NM_001918chr1159311 8843 7881 7475 7201 7174 7039 6950 6733 2776 2576 1842 942 897 516 48907 8318 6197 2743 58653 5842 3178 1951 1731 --
NM_001924chr11103 ------
NM_001935chr22686 200 ------
NM_001938chr141501 670 319 292 11251 1660 --
NM_001949chr643183 3011 475 72 12861 --12440
NM_001969chr1463398 3303 2847 2807 973 273 13892 23564 3385 --
NM_001980chr1262137 2020 638 499 414 223 11994 ----
NM_002006chr445638 4025 2134 1925 11620 22158 1179 15290
NM_002009chr152903 426 ------
NM_002015chr1343223 3049 2262 1061 ------
NM_002024chrX31861 1739 1422 11561 ----
NM_002025chrX98374 7889 7790 2579 2408 2073 1917 1865 1042 19161 28650 6090 --
NM_002033chr11103840 3225 2793 2659 1273 1049 1025 929 866 488 13942 12574 --
NM_002040chr2122338 110 23228 2453 1224 --
NM_002063chrX----1498 1915
NM_002077chr932029 315 157 ----1103
NM_002082chr53965 682 25 ------
NM_002092chr4114662 4577 4423 4288 4226 4203 3830 1809 1197 1088 80 34900 4479 1964 24055 3603 --
NM_002095chr8131 ------
NM_002128chr1372257 999 877 577 557 145 128 1225 ----
NM_002130chr521446 410 ------
NM_002137chr731917 1767 135 ----1866
NM_002158chr233503 3232 1070 12925 21159 385 --
NM_002182chr332501 821 404 ------
NM_002196chr201959 ------
NM_002196chr201959 ------
NM_002203chr573407 3261 3184 1281 990 410 142 --121 --
NM_002210chr233547 1158 1052 2921 857 1458 --
NM_002214chr7115074 4117 3988 3812 2205 1986 1794 1435 1300 679 309 1388 ----
NM_002223chr1263570 3487 2607 1414 578 366 --1997 13951
NM_002270chr5115534 4925 3963 2233 1549 1091 991 859 552 398 98 1130 122 --
NM_002285chr262794 1642 1629 1326 1108 972 23893 3827 14121 --
NM_002336chr1274511 4394 3883 3835 3541 3127 115 13529 ----
NM_002349chr231508 1346 654 1245 11515 --
NM_002374chr253680 3413 3207 1414 1122 1765 --13104
NM_002376chr143530 464 388 ------
NM_002387chr5134691 3990 3850 3663 3142 1934 1800 1747 1433 1175 607 494 46 ------
NM_002473chr2221346 934 ----11333
NM_002480chr122554 287 11473 ----
NM_002481chr1127898 7507 7457 5686 5463 5232 2907 2716 2368 2268 2056 1592 11811 ----
NM_002487chr154729 646 128 89 296 75 ----
NM_002500chr241178 950 207 50 21113 239 --11097
NM_002508chr121993 520 --1528 11648
NM_002509chr201261 ------
NM_002519chr1131480 1272 1017 --11518 --
NM_002545chr11105184 4794 4501 3568 3328 3283 1895 826 637 567 ------
NM_002547chrX53693 3510 3302 2787 2627 11690 --23338 562
NM_002581chr995597 5502 4960 4892 3649 2046 561 248 241 ------
NM_002583chr12------1614
NM_002594chr2042369 2245 975 689 ------
NM_002595chr125378 259 241 198 152 --1462 --
NM_002600chr111717 11822 1576 --
NM_002610chr252867 2177 1218 1195 299 ------
NM_002628chr321234 1170 ------
NM_002641chrX11925 ------
NM_002645chr1142753 2368 2274 2163 1106 --11177
NM_002646chr131662 1529 549 ------
NM_002655chr895245 4154 3800 3657 3408 3213 1761 936 26 11330 25263 5141 --
NM_002670chr331164 1008 56 ------
NM_002703chr451879 1737 1377 1308 57 --1425 --
NM_002709chr251371 665 644 483 204 31238 789 758 12559 --
NM_002710chr123871 845 788 ------
NM_002737chr1765325 4949 4816 2402 2394 1954 11009 1981 --
NM_002745chr2293964 3953 2913 1389 1050 868 671 553 311 23154 784 --11088
NM_002748chr151299 ------
NM_002755chr152818 274 ------
NM_002758chr17171 ----1180
NM_002825chr71102 1234 --1177
NM_002828chr184703 176 141 75 1107 ----
NM_002833chr1531609 1600 69 ------
NM_002834chr1263444 3265 2508 1303 916 685 11418 1986 13721
NM_002839chr963494 3304 2814 967 252 33 --1360 33155 1381 742
NM_002841chr32705 508 ------
NM_002857chr142380 1872 1735 485 --1431 --
NM_002869chr1151849 1616 590 544 521 --172 --
NM_002884chr13819 679 36 1915 ----
NM_002886chr364490 3433 1041 855 722 660 53951 3908 1961 1535 990 24364 2074 --
NM_002892chr142670 322 --1591 --
NM_002902chr151606 ------
NM_002912chr62808 24 ------
NM_002942chr341172 1115 900 254 ------
NM_002959chr133900 704 472 33783 1383 1321 --11666
NM_002971chr321125 482 ------
NM_002977chr262883 2749 2689 998 122 28 1940 ----
NM_002998chr852044 1967 1570 1482 780 --1197 11557
NM_003010chr1752441 2169 1651 878 547 ------
NM_003043chr363829 2795 1409 1059 701 76 14162 ----
NM_003092chr20143 ------
NM_003108chr287226 6076 5783 5222 4585 982 703 488 14825 16052 21299 1195
NM_003112chr731284 417 87 32860 2723 609 ----
NM_003128chr242332 2064 532 502 ------
NM_003137chr621888 1462 ------
NM_003139chr114895 642 286 269 --1822 --
NM_003144chr631823 1765 1736 11722 ----
NM_003161chr1753015 2778 2686 1356 1085 23341 800 ----
NM_003185chr202968 382 ------
NM_003199chr1864927 4288 3743 1724 1649 1196 31869 1655 1487 15068 --
NM_003234chr312082 --12327 --
NM_003253chr212747 297 11412 ----
NM_003262chr394682 4546 4460 4227 3422 1868 1157 885 186 21454 230 ----
NM_003286chr201378 ------
NM_003291chr132609 45 ------
NM_003292chr141670 899 737 634 1285 1747 --
NM_003298chr3166150 5993 5720 4902 4776 4090 4081 2232 2149 1798 1754 1740 1435 1096 864 771 1655 15705 --
NM_003337chr541746 1279 681 105 11264 11556 --
NM_003340chr41996 ------
NM_003341chr3------1173
NM_003342chr1792431 2383 2130 2068 2044 1311 1008 904 195 ------
NM_003369chr1132509 1959 260 --22250 782 --
NM_003387chr262809 1887 1009 468 335 222 22535 2491 ----
NM_003390chr113351 277 139 ------
NM_003392chr364287 3694 3016 1500 1324 60 --11552 --
NM_003399chrX2794 332 ------
NM_003403chr141769 ------
NM_003409chr1821223 945 11006 ----
NM_003410chrX23098 461 ------
NM_003412chr331130 913 603 2740 702 ----
NM_003413chrX41718 1517 1459 570 ------
NM_003423chr1962592 2268 2183 2028 1858 534 1715 ----
NM_003430chr1931653 424 106 --11609 --
NM_003453chr131268 ------
NM_003463chr662725 2504 2199 1184 583 176 1273 12613 --
NM_003468chr244067 3941 3358 1373 23758 778 21387 542 --
NM_003474chr1021910 222 12276 11777 12171
NM_003483chr1232962 2620 799 --32765 976 67 --
NM_003489chr2162915 2644 2585 1181 1015 755 --23449 3398 --
NM_003559chr1763514 3316 1359 1323 1147 139 13258 23849 2445 --
NM_003566chr1273158 2848 2730 2586 2490 693 573 12931 ----
NM_003574chr18115635 5436 5257 4528 4274 4054 2189 1414 1198 459 155 1724 ----
NM_003581chr22980 868 ------
NM_003583chr1263163 2941 2737 2411 725 316 --13627 --
NM_003590chr242897 1314 919 222 1111 13670 --
NM_003607chr164098 3970 3421 1669 1480 370 --23651 1650 1524
NM_003622chr1252515 2377 2292 2232 1794 1522 ----
NM_003626chr1161328 976 500 242 140 34 ------
NM_003646chr111570 ------
NM_003671chr933405 1120 1059 11187 13289 --
NM_003677chr1251914 1469 704 571 486 --22272 2210 1262
NM_003692chr91371 ------
NM_003705chr21281 ------
NM_003722chr352392 928 321 278 206 1357 ----
NM_003749chr1342076 1969 1502 95 ------
NM_003758chr1531572 1051 1003 21478 110 ----
NM_003758chr1531572 1051 1003 21478 110 ----
NM_003759chr474214 3472 1607 1599 1476 921 701 11251 ----
NM_003778chr31101 ------
NM_003822chr163028 2967 2905 2637 2251 415 ------
NM_003825chr1541063 501 482 140 ------
NM_003870chr1541808 1767 1524 291 1308 ----
NM_003895chr211415 12152 ----
NM_003909chr863076 2677 2554 2291 1127 483 21941 232 1536 --
NM_003913chr663351 826 798 481 260 238 ------
NM_003930chr782009 1721 1699 926 320 311 250 139 --1864 --
NM_003931chr62596 185 ------
NM_003958chr6103749 3192 2879 2786 2755 2625 1170 1037 694 634 1953 --12730
NM_003966chr5157680 7558 6484 6391 5674 5431 4736 3019 3001 2865 2224 1826 1751 714 637 37767 1593 602 ----
NM_003983chr1684132 2960 559 373 300 277 159 118 --11259 --
NM_003994chr1274098 2925 887 826 570 517 399 11083 11674 --
NM_004006chrX2898 741 12649 1710 --
NM_004007chrX2898 741 12649 1710 --
NM_004009chrX2898 741 12649 1710 --
NM_004010chrX2898 741 12649 1710 --
NM_004011chrX2898 741 12649 1710 --
NM_004012chrX2898 741 12649 1710 --
NM_004013chrX2898 741 12649 1710 --
NM_004014chrX2898 741 12649 1710 --
NM_004015chrX2898 741 12649 1710 --
NM_004016chrX2812 655 12563 1624 --
NM_004017chrX2898 741 12649 1710 --
NM_004018chrX2812 655 12563 1624 --
NM_004020chrX2898 741 12649 1710 --
NM_004021chrX2812 655 12563 1624 --
NM_004022chrX2812 655 12563 1624 --
NM_004023chrX2812 655 12563 1624 --
NM_004028chr1853759 3695 3583 3421 372 1431 ----
NM_004035chr17154577 4442 4358 4079 3835 3766 3647 3480 3250 3176 1962 1934 1653 1351 91 --1995 --
NM_004081chrY41505 604 299 162 ------
NM_004094chr1421021 426 ----11029
NM_004096chr1041959 1380 685 117 ------
NM_004098chr101811 ------
NM_004112chr1721432 1342 ------
NM_004124chr1432632 300 101 13269 --1117
NM_004171chr11189383 9153 9069 8950 8720 7798 7554 7187 6717 6649 6284 3103 3023 2364 2254 2212 2079 1989 38171 7090 1382 29013 8498 --
NM_004225chr81494 1342 --21416 1238
NM_004229chrX41784 1655 896 197 12232 ----
NM_004230chr19101849 1714 943 802 725 717 617 483 398 189 12003 ----
NM_004261chr13689 151 56 ------
NM_004290chr531229 963 235 ----1991
NM_004293chr942921 2831 1491 673 21454 136 --1292
NM_004296chr1474029 3443 3085 2813 471 248 228 ------
NM_004301chr31364 ------
NM_004311chr1082113 2094 1203 1143 1060 913 658 309 ----11935
NM_004331chr832652 2007 1961 12494 --11932
NM_004337chr862187 1995 423 350 175 66 ----1124
NM_004338chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_004346chr451011 281 258 226 104 ------
NM_004370chr662143 2005 1935 1514 1417 32 ------
NM_004380chr1611642 --1498 --
NM_004384chr562002 1793 1547 882 577 281 21891 331 ----
NM_004392chr1351905 1734 412 244 47 2852 810 ----
NM_004397chr1152936 1734 1650 1422 853 --1705 --
NM_004399chr122927 717 ------
NM_004407chr43931 645 406 ------
NM_004426chr1251915 1701 722 598 228 ------
NM_004432chr922259 1795 22318 1952 ----
NM_004438chr271327 1213 1107 402 275 178 136 ----12089
NM_004440chr651943 1821 1751 143 32 ------
NM_004459chr1721605 679 --11583 --
NM_004463chrX3652 635 485 --1199 --
NM_004464chr473451 2967 2879 2612 1718 321 53 ------
NM_004496chr1431348 1203 439 ------
NM_004500chr1461968 1541 1309 733 554 330 ------
NM_004501chr121342 180 --13943 12540
NM_004504chr242921 2688 2105 1089 --22382 594 1280
NM_004505chr1721687 1599 ------
NM_004575chr41365 ------
NM_004588chr11103922 3579 2599 2493 1336 1065 983 822 580 60 ------
NM_004593chr31242 ------
NM_004598chr552623 1022 850 405 385 13049 13073 --
NM_004612chr994603 4521 3945 3511 3147 1683 1597 1586 1477 31726 990 542 2716 474 14304
NM_004631chr131141 1098 353 ------
NM_004637chr33931 498 378 ------
NM_004642chr124270 174 102 54 --1146 --
NM_004663chr1571461 1037 996 642 422 182 36 1980 21300 1274 --
NM_004685chr1352624 2162 1830 760 525 133 12707 --
NM_004687chr1762103 2058 1567 1378 1338 1302 1417 ----
NM_004717chr751494 1143 1128 953 502 1228 ----
NM_004726chrX84900 4806 4035 3707 2102 1967 1803 1202 --13861 25081 2302
NM_004734chr1382438 2331 2207 1270 996 946 716 523 --12263 1409
NM_004745chr8106999 6314 6264 6227 5043 4886 4629 4552 1597 635 22005 1126 14358 17061
NM_004747chr1051538 1512 1409 1035 28 ------
NM_004761chr6124 ------
NM_004768chr131149 1078 286 21106 344 11127 11011
NM_004772chr531491 241 142 ------
NM_004775chr1852251 2136 394 155 137 1545 ----
NM_004790chr11250 22 ------
NM_004801chr22992 326 11299 ----
NM_004808chr1093205 3126 2549 2496 2150 2126 1342 933 338 ------
NM_004827chr431834 1551 1197 ------
NM_004841chr13725 349 85 --1341 --
NM_004857chr1483926 3024 1751 1617 1532 430 221 184 14636 ----
NM_004859chr1762888 2615 2548 2046 551 522 --11132 --
NM_004866chr544321 3787 1496 1185 51250 991 845 793 760 --24918 338
NM_004897chr102249 85 ------
NM_004898chr482885 2852 2000 966 633 416 379 169 1112 ----
NM_004904chr786408 5895 4821 4000 2107 1406 1383 134 24561 4529 14160 11974
NM_004912chr731684 1338 401 --21361 1288 --
NM_004929chr861293 1210 534 497 276 177 ------
NM_004956chr7114549 4312 3936 3848 2947 1688 1185 1176 962 464 385 --13134 11012
NM_004965chr211535 ------
NM_004973chr641636 1538 1248 223 11350 1198 --
NM_004985chr1294545 4341 4283 4133 4077 3639 3367 3102 280 --23196 498 --
NM_004993chr1431022 353 59 ------
NM_005010chr771645 834 734 661 294 286 138 1546 ----
NM_005028chr1032071 580 167 ------
NM_005036chr22108332 7991 7963 7077 5612 5604 5053 2516 2115 810 --25103 2161 --
NM_005045chr71254 ------
NM_005063chr1052994 2478 1245 945 742 23782 127 ----
NM_005065chr1454942 4864 2109 1817 1016 23925 1827 ----
NM_005079chr832900 598 286 22576 248 ----
NM_005087chr33555 257 24 1630 ----
NM_005095chr122219 214 ------
NM_005121chr1762602 823 798 719 663 59 3751 588 407 ----
NM_005134chr183879 634 391 1185 1805 --
NM_005135chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_005154chr153659 200 86 1186 ----
NM_005156chr994160 4038 3637 3545 2008 1823 1796 884 670 --11863 15289
NM_005160chr22106764 5953 5655 5119 5006 2553 2491 1824 1435 702 26466 5210 ----
NM_005168chr211279 ------
NM_005171chr1271257 1189 1099 952 836 350 188 ------
NM_005180chr1051624 1503 1262 1195 68 11563 1304 --
NM_005188chr11108166 7738 7346 5121 3287 2883 2174 839 299 21 --17811 15766
NM_005190chr64865 854 397 229 ------
NM_005203chr102105 63 ------
NM_005207chr2293531 3182 3172 2363 1076 846 711 626 121 --1650 --
NM_005233chr332625 706 65 ------
NM_005235chr256339 5771 2706 776 417 --25308 5047 --
NM_005252chr14164 ------
NM_005254chr1531045 228 112 ------
NM_005256chr113876 755 61 ------
NM_005259chr22368 92 1386 1111 1133
NM_005318chr2231153 1054 153 --11024 --
NM_005339chr473869 3311 3023 985 959 945 24 23133 2650 ----
NM_005359chr18106286 4865 2217 2132 1655 1579 1531 1005 355 328 ------
NM_005415chr2177 --1790 --
NM_005433chr1831911 361 67 22396 631 ----
NM_005436chr1072626 1163 1087 824 573 558 387 11495 ----
NM_005455chr141735 1499 143 21 ------
NM_005475chr1282710 2566 1999 915 904 705 381 218 ------
NM_005487chr2242095 2028 1510 532 ------
NM_005493chr64863 636 144 42 ------
NM_005497chr17166167 6004 5861 5688 5626 5441 5433 4968 4771 4534 4442 1749 1687 1559 1269 216 21195 305 ----
NM_005502chr933310 754 179 32766 2217 2104 12365 --
NM_005506chr452888 2249 2116 2031 963 1260 12359 --
NM_005513chr31388 11501 --1219
NM_005522chr7196 ------
NM_005563chr11813 ------
NM_005578chr343350 1832 1067 725 14467 1627 23992 3608
NM_005596chr9126460 5472 4803 4723 4626 3992 2097 1993 1715 1237 1098 64 25360 4654 26392 4992 15823
NM_005607chr831030 842 105 ------
NM_005625chr84730 385 308 208 ------
NM_005637chr1851891 1671 664 404 298 ------
NM_005644chr11101 ------
NM_005647chrX73262 3009 2826 2297 1375 1226 957 ------
NM_005665chr184729 3392 3053 1451 1024 769 443 152 --14012 12982
NM_005668chr594450 4320 3972 3815 3312 929 795 710 234 24243 3988 ----
NM_005669chr562220 2174 1906 1774 272 200 21468 542 ----
NM_005722chr23869 490 279 1663 1817 --
NM_005739chr1562060 2007 1936 671 651 39 32087 1719 1485 2789 543 --
NM_005746chr752128 837 679 583 89 12058 1929 --
NM_005798chr13125215 4884 4530 3429 1989 1364 822 651 501 439 416 21 2346 321 ----
NM_005807chr12700 187 ------
NM_005840chrX116289 5870 5105 3077 2982 2748 2616 2057 1824 1201 939 12003 21771 129 --
NM_005842chr133732 559 503 2566 26 ----
NM_005853chr163504 455 129 ------
NM_005857chr131052 943 928 ------
NM_005859chr521479 1202 21542 568 ----
NM_005875chr31145 ----187
NM_005885chr511122 21445 654 ----
NM_005896chr23168 147 52 --1526 --
NM_005899chr1721166 1148 11353 --1151
NM_005901chr1868451 6740 5651 1621 1486 1449 57044 2642 1726 843 430 56767 2617 2152 1820 1349 --
NM_005902chr15114494 4308 3499 3474 3328 3228 2985 1698 1329 1154 766 --1380 --
NM_005903chr564848 4258 4237 1051 369 104 1346 11086 14450
NM_005909chr554124 3451 3195 2896 1428 21542 1281 ----
NM_005941chr853674 2776 1618 1390 960 22576 684 ----
NM_005955chr195341 4851 4387 2115 1981 1899 1080 671 603 ------
NM_005964chr1761249 1069 254 90 66 31 ----11145
NM_005966chr262298 2288 2120 1923 486 379 31969 1608 141 1457 --
NM_005986chr1332479 982 275 22744 261 ----
NM_006007chr9114487 4318 4130 3918 3765 3291 3257 1391 1227 1094 166 ----1983
NM_006016chr612210 11495 ----
NM_006030chr331827 1303 527 ------
NM_006047chr201155 1197 --13414
NM_006060chr774324 4106 3659 3539 2856 1415 462 11593 ----
NM_006089chrX41894 1504 1379 300 ------
NM_006095chr464433 4400 4224 3444 3294 1221 34350 4124 877 14235 --
NM_006114chr191474 ------
NM_006136chr721065 989 ------
NM_006154chr1562484 1849 968 950 778 667 1342 11179 --
NM_006166chr122865 848 ----1837
NM_006167chr81648 ------
NM_006190chr211045 ------
NM_006203chr584987 4644 4508 3444 1859 1452 1242 759 11254 ----
NM_006218chr31122 ------
NM_006224chr1732390 1606 259 --1740 --
NM_006246chr1421052 124 2417 97 ----
NM_006258chr1031284 643 464 --1142 --
NM_006264chr41178 ------
NM_006282chr2094494 4134 4085 3983 3306 3172 3087 1109 436 ------
NM_006283chr864262 4231 4172 3811 1559 586 ------
NM_006298chr642861 2679 507 321 --1122 --
NM_006306chrX85806 5656 5306 5137 4969 4648 3614 658 24543 2337 1679 --
NM_006313chr1221234 209 21114 152 --1463
NM_006323chr43590 523 266 ------
NM_006324chr16177 ------
NM_006335chr12911 72 1256 ----
NM_006345chr441165 1058 1007 874 ------
NM_006352chr151813 1432 797 73 62 ------
NM_006375chrX41752 1667 678 174 ------
NM_006380chr1774414 4214 3787 3578 1660 1000 957 1468 23174 1393 --
NM_006390chr1231436 1181 1156 ----11703
NM_006393chr1044383 4328 3398 2994 --11436 13532
NM_006434chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_006457chr453694 3014 1357 842 746 24103 3371 --13574
NM_006459chr1051770 1705 1552 600 88 --1582 --
NM_006464chr264180 3866 3484 528 474 455 14374 23753 930 --
NM_006471chr18184 ------
NM_006482chr1263163 2941 2737 2411 725 316 --13627 --
NM_006504chr1072801 2774 2571 2488 2258 2131 146 ------
NM_006526chr2051937 1731 865 806 636 --1165 --
NM_006538chr2134160 4072 3915 3804 3569 3356 2594 1383 1090 1074 492 403 301 --1436 --
NM_006540chr81551 ------
NM_006544chr14125789 5510 5385 5059 4548 2437 1734 1237 1097 1041 850 41 25741 2447 22019 544 --
NM_006561chr1074373 4239 4065 3907 2476 2187 1084 26074 1847 25601 4189 --
NM_006571chr81225 ------
NM_006577chr221052 849 ------
NM_006587chr431603 272 77 ----1319
NM_006599chr16157781 6514 6505 6418 5853 5600 5222 2612 1898 1464 1354 1251 1201 974 305 27939 172 28277 1165 1780
NM_006603chrX31759 654 77 --1212 11902
NM_006609chr242666 2529 1838 836 ------
NM_006614chr342606 507 420 383 --13432 --
NM_006620chr6114523 4060 3808 3456 3096 3060 1678 1660 350 67 35 34271 4131 3786 21813 1789 --
NM_006624chr1031870 383 284 11580 ----
NM_006628chr1574610 4379 4329 3818 3572 3487 3332 33185 1358 730 ----
NM_006629chr1842604 2072 1086 692 22224 2191 1155 --
NM_006646chr1363037 2505 1213 1201 326 290 12951 ----
NM_006654chr1273600 3422 1924 1371 928 785 389 13656 11252 --
NM_006696chr5196 ------
NM_006699chr132517 2131 56 11662 1405 --
NM_006716chr761376 992 856 181 151 106 ------
NM_006777chrX32562 347 215 11131 11852 --
NM_006790chr52286 119 ------
NM_006805chr53427 234 33 ------
NM_006827chr1443256 2423 2358 763 12088 ----
NM_006912chr152027 1981 1731 1693 920 --136 168
NM_006914chr911334 --1145 --
NM_006920chr231936 1903 42 ------
NM_006922chr252451 2174 316 263 40 --1561 1848
NM_006924chr1734400 3659 43 33491 1360 1160 ----
NM_006956chr772286 1784 1565 905 565 204 42 32067 633 557 12046 --
NM_006999chr561976 1847 1646 1433 278 39 --11694 --
NM_007006chr1663421 3194 2327 1112 1097 62 12829 ----
NM_007007chr1254367 3362 3183 1125 1009 13162 11194 --
NM_007034chr12834 172 ------
NM_007038chr2175827 4980 4632 4317 593 489 56 --14231 --
NM_007039chr1452315 1585 1454 648 45 1261 ----
NM_007042chr362637 2378 2058 542 502 204 12137 ----
NM_007050chr2087989 7808 6816 6040 5356 5249 734 511 11958 ----
NM_007106chr133986 249 31 22776 2690 --1704
NM_007107chr362157 2077 2022 1527 888 103 ------
NM_007111chr132800 770 ------
NM_007114chr343272 2859 927 163 ------
NM_007137chrX74849 4257 4182 1708 1110 641 279 1221 ----
NM_007170chr13954 827 97 ------
NM_007195chr1883607 3571 3369 2906 2692 2361 1437 1218 ------
NM_007203chr953973 3463 3005 1601 315 11465 22651 754 --
NM_007207chr11845 ------
NM_007212chr142152 1529 746 440 ------
NM_007222chr831674 1365 722 2445 258 1179 --
NM_007236chr1561971 1747 1612 1527 881 184 ------
NM_007249chr13129070 8000 7501 7072 5884 3405 2453 1858 1457 1129 821 425 47206 3744 3124 1561 23546 2097 13101
NM_007292chr17154577 4442 4358 4079 3835 3766 3647 3480 3250 3176 1962 1934 1653 1351 91 --1995 --
NM_007347chr1552827 2501 2364 1181 973 1201 ----
NM_007373chr1051838 1242 648 483 310 1407 ----
NM_012072chr2061262 980 832 743 716 172 ------
NM_012081chr533706 2804 2687 --23406 1014 --
NM_012083chr102987 861 ------
NM_012095chr1083246 3218 2706 2582 2514 2368 658 468 --11096 1674
NM_012096chr383770 3567 3189 2970 1468 1357 730 534 ------
NM_012097chr232208 2053 1556 ------
NM_012120chr6102850 2768 2415 2301 1190 1168 901 844 707 134 1641 1415 --
NM_012141chr1363948 3599 1563 430 155 132 21549 926 ----
NM_012158chr1321534 275 11592 11138 --
NM_012164chr9117214 7120 6404 5850 5023 2787 2479 1829 1169 963 437 36441 5903 2670 ----
NM_012193chr1174610 4064 782 496 338 186 85 13823 13856 --
NM_012199chr184604 4237 3109 1569 1470 801 369 136 ------
NM_012218chr1972262 2021 996 781 769 329 262 ------
NM_012234chr362974 2595 1327 1085 875 580 ----12739
NM_012249chr22360 63 ------
NM_012255chr201438 --142 1102
NM_012262chr155244 5043 1432 1236 1172 14014 ----
NM_012294chr762986 2759 686 561 47 32 ------
NM_012300chr542495 1955 938 319 ----1928
NM_012301chr762180 1795 1432 777 620 283 21968 1566 1871 --
NM_012333chr151642 407 367 343 92 164 11211 --
NM_012334chr584293 3608 2912 1843 1731 1552 1529 1034 13641 23021 715 24728 4466
NM_012382chr574216 4173 4114 3531 3483 777 161 21084 713 ----
NM_012388chr1543094 2377 948 519 43022 1203 922 914 22751 1957 --
NM_012413chr22156 112 ------
NM_012419chr61646 --192 --
NM_012431chr753617 3259 2881 814 728 --13641 --
NM_012479chr792772 2611 2548 2448 1068 932 608 586 459 22261 594 22438 45 --
NM_012482chr11443 ------
NM_013229chr1292607 2146 2076 1009 924 842 711 626 515 1109 ----
NM_013231chr1463552 3506 3370 3056 1660 143 14385 13985 --
NM_013255chr7128066 7274 7107 6294 5986 3428 2569 1974 1716 1680 894 521 38732 7085 718 191 --
NM_013261chr463478 2974 2846 2595 1148 1085 13752 ----
NM_013269chr1263915 3853 2942 2838 2768 1441 12981 23421 3194 --
NM_013309chr1562325 1040 613 454 247 227 --22297 42 --
NM_013357chr81642 ----1600
NM_013374chr372777 2643 2601 627 240 139 120 1201 ----
NM_013381chr1252249 2100 1655 975 315 1713 ----
NM_013386chr131798 1180 479 ------
NM_013412chr22970 774 11245 1934 --
NM_013423chrX31005 467 144 ------
NM_013427chrX31005 467 144 ------
NM_013437chr8170 ------
NM_013438chr951635 1446 1205 620 260 3682 394 148 ----
NM_013444chrX3876 760 419 1820 ----
NM_013447chr19113477 3434 3386 3347 2914 2701 2576 1140 467 282 169 11274 ----
NM_013448chr143710 503 237 1226 1181 --
NM_013449chr1222505 2444 ------
NM_013943chr162663 2093 1163 925 581 110 22437 148 ----
NM_013995chrX52395 2013 361 216 95 1848 ----
NM_014011chr261703 1009 771 526 199 66 21800 104 ----
NM_014016chr321238 508 ------
NM_014021chr143455 3144 603 352 2940 561 12478 --
NM_014038chr71351 ------
NM_014043chr321412 456 --11086 --
NM_014048chr1654996 4293 3346 1951 1149 14207 34432 195 85 --
NM_014056chr352359 1781 1696 1455 346 ------
NM_014106chr1561947 840 707 622 521 400 22419 559 ----
NM_014141chr7105141 5008 4597 4472 4105 3960 2095 919 466 409 ------
NM_014155chr11127467 7306 7115 6706 6564 5258 5015 2366 2070 1994 1323 1300 22390 882 47264 5723 2204 1647 16548
NM_014171chr2180 ------
NM_014181chr221008 348 ----22529 964
NM_014243chr451448 733 650 603 96 1343 ----
NM_014250chr2242095 2028 1510 532 ------
NM_014267chr111664 1228 ----
NM_014289chrX51142 921 500 440 317 --11417 --
NM_014294chr841088 1000 125 94 11192 11302 --
NM_014309chr2264232 4178 4100 1544 1336 77 35238 5219 677 ----
NM_014331chr4107521 5603 5558 5297 5289 5207 1752 1565 393 208 56533 5270 3031 2909 2670 14730 16268
NM_014333chr1152706 2485 2288 2061 958 12281 ----
NM_014361chr111137 ------
NM_014363chr1321159 825 --1871 --
NM_014368chr941946 1568 1543 360 --1480 --
NM_014393chr852158 2142 1927 680 552 11587 ----
NM_014408chr13569 389 165 ------
NM_014415chr331070 324 167 ------
NM_014421chr482050 2005 1617 1508 1446 1404 749 189 --11686 --
NM_014423chr583780 2140 1783 1099 738 718 576 221 15428 ----
NM_014445chr352004 1980 1856 1783 1707 2663 247 1375 --
NM_014506chr951670 1455 546 261 177 --1514 --
NM_014573chr1771791 1656 1202 1159 455 311 38 ------
NM_014585chr22986 67 ----11216
NM_014586chr21134852 4683 4366 4246 4012 3344 3182 2983 2960 1393 1316 942 402 --13047 --
NM_014606chr431541 1503 1186 ------
NM_014614chr221315 1046 11407 --11339
NM_014615chr1622843 2776 13329 23069 720 133
NM_014616chr352679 2297 1157 1040 922 1900 22874 770 1598
NM_014647chr1631590 1576 1413 ------
NM_014663chr11745 ------
NM_014667chr362047 1642 1561 954 926 717 --22334 761 --
NM_014670chr22211 202 11467 ----
NM_014673chr8------1103
NM_014674chr373511 3137 2744 2502 2490 721 492 12796 ----
NM_014677chr841344 1306 1294 418 ------
NM_014683chr1741469 799 301 61 ------
NM_014686chr1922513 1659 ------
NM_014690chr763114 2601 2363 2184 2005 640 ------
NM_014693chr31722 ------
NM_014702chr642244 1195 74 28 33420 500 446 23120 1184 --
NM_014711chr1651547 774 530 310 264 1492 ----
NM_014721chr656392 6335 1894 1204 204 36858 1225 588 21296 1016 --
NM_014735chrX62080 1946 1930 392 142 102 1187 ----
NM_014738chr171983 ------
NM_014743chr43939 824 360 22897 898 3750 453 307 --
NM_014747chr174828 4803 3929 1259 611 527 231 15797 13921 --
NM_014748chr2146 ------
NM_014755chr234165 3575 1276 --2755 573 --
NM_014779chr31448 ------
NM_014787chr131135 1046 28 --1608 11834
NM_014803chr1032641 2192 504 31867 691 99 1554 --
NM_014810chr142939 1321 429 169 ------
NM_014812chr111452 ------
NM_014819chr51840 1111 --1869
NM_014826chr164098 3970 3421 1669 1480 370 --23651 1650 1524
NM_014827chr121676 1546 ------
NM_014829chr521793 1511 21584 648 21826 65 --
NM_014836chr1041568 1327 674 407 ------
NM_014839chr151944 1625 439 389 350 42413 1960 470 405 12089 --
NM_014850chr364832 3090 1039 981 638 162 1483 ----
NM_014864chr1104069 3837 2991 2709 1456 1314 1229 1067 464 362 11710 ----
NM_014873chr164581 3134 2979 1339 1254 978 44500 534 511 488 24013 1278 --
NM_014876chr2241845 842 708 413 --169 --
NM_014877chr17127286 7010 6845 6175 6041 5956 5167 4766 1851 1796 567 82 27486 2811 27700 7691 --
NM_014883chr492379 2018 1745 1720 1549 704 623 430 336 ----1233
NM_014887chr131803 --1100 --
NM_014888chr731565 1535 478 ------
NM_014893chrY42351 754 645 450 --11873 --
NM_014897chr1763233 2733 2600 2515 564 462 23026 2786 ----
NM_014898chr1962069 1935 1850 1553 573 227 11777 --1670
NM_014904chr1034060 3832 2993 ----13273
NM_014906chr17133340 3224 3216 2985 2922 2639 1636 1172 866 604 375 356 160 --23497 1253 --
NM_014912chr1032390 158 79 11199 ----
NM_014920chr6102787 2647 2588 2469 1535 1467 1170 363 294 118 3920 395 191 ----
NM_014923chr1331863 1819 114 ------
NM_014939chr183583 420 60 ------
NM_014946chr293089 2983 2923 967 590 451 99 80 24 22511 1157 --1765
NM_014947chr182425 2330 2186 1238 1185 965 464 49 --12999 --
NM_014949chr13865 811 751 --1183 --
NM_014953chr1394201 3804 3572 3545 3293 1427 376 243 90 21676 1033 --11322
NM_014964chr1742092 1930 623 148 ------
NM_014978chr102520 459 11754 11624 --
NM_014982chr1485059 1516 1181 1091 1038 570 484 87 25400 1703 --12008
NM_014988chr452621 1786 1091 403 390 22826 1718 ----
NM_014989chr641659 1541 1336 201 --11328 --
NM_015000chr122160 134 ----1405
NM_015008chr343632 3231 1037 740 12536 --1659
NM_015017chr14825 494 360 298 11142 ----
NM_015020chr16133818 3773 3714 3477 3213 3068 2815 2698 2584 1566 380 243 182 --33621 3059 2611 --
NM_015024chr831454 1204 413 --11070 --
NM_015025chr262216 2118 1958 1844 1676 170 12235 ----
NM_015026chr12103680 3615 3259 1542 1173 675 518 301 161 91 11332 --1250
NM_015039chr1133870 3659 3639 2807 2691 2646 1721 1536 1406 1390 1110 253 146 ------
NM_015051chr943186 1144 990 882 2999 176 ----
NM_015059chr1553683 3060 2908 746 724 --32930 2876 1417 --
NM_015068chr763658 3158 3110 1568 533 380 --12625 --
NM_015071chr5106022 5892 5855 5481 4809 4558 4448 3978 2394 497 --11219 15180
NM_015074chr154869 3596 1399 1292 964 --24207 4062 --
NM_015092chr1664049 2987 1735 1353 956 875 ----1599
NM_015093chr641578 1165 711 252 --11738 --
NM_015097chr351823 1575 611 511 410 --1577 --
NM_015115chr452189 2173 2030 215 198 ------
NM_015130chr431330 1173 231 ------
NM_015144chr1673860 2993 1414 1400 1040 502 265 13015 ----
NM_015147chr252120 1114 987 978 937 11183 1671 --
NM_015156chr1493986 3621 3552 3510 2971 2654 1231 978 593 --1389 --
NM_015184chr31133 ------
NM_015191chr1162283 2230 2128 2111 2076 2039 --1833 --
NM_015199chr332297 676 265 1408 ----
NM_015215chr162327 2288 1130 626 596 165 12157 1145 --
NM_015235chr1011821 ----1299
NM_015250chr931708 623 46 ------
NM_015269chr12474 200 --1234 --
NM_015271chr433956 3334 1057 1465 1230 13376
NM_015272chr1661989 1822 1713 1441 1380 583 ----11859
NM_015275chr1231874 1397 124 1541 21745 356 --
NM_015277chr1861811 1218 708 577 273 104 1347 ----
NM_015291chr153519 3298 3242 2491 1265 ------
NM_015296chr134993 827 434 283 1795 ----
NM_015310chr8217816 7409 7111 7066 6668 5910 5833 5625 5370 5072 3270 2982 2270 1774 1686 1589 1324 1302 813 788 298 --47564 5778 1544 1064 25721 2215
NM_015314chr741999 691 189 64 ----1887
NM_015317chr262571 2353 2168 1925 851 442 2627 357 ----
NM_015323chr61618 129 ----
NM_015335chr1262463 2284 2233 1691 1663 947 22557 672 1162 12541
NM_015344chr831954 1421 661 ----1232
NM_015347chr124906 771 390 214 ----11128
NM_015349chr652974 2802 942 755 194 12886 ----
NM_015355chr1761509 1497 1286 692 505 443 11934 ----
NM_015360chr5154 ------
NM_015361chr22818 267 ------
NM_015365chrX83536 3310 1653 1588 1382 814 425 38 --11354 --
NM_015375chr164890 4753 3404 912 507 89 13956 24275 353 --
NM_015382chr141689 ------
NM_015385chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_015387chr241490 817 498 257 --11549 --
NM_015394chr124676 378 342 216 ------
NM_015396chr361359 1122 510 451 298 108 ------
NM_015397chr921756 1713 --21223 129 --
NM_015419chrX2941 740 --1416 1990
NM_015436chr443335 3011 2695 337 --12789 --
NM_015443chr1721558 1436 --1365 --
NM_015542chr101878 ----1472
NM_015550chr753429 3118 2574 2306 902 --1650 --
NM_015554chr1562805 2755 2284 2057 270 51 ------
NM_015565chr2131934 428 304 ------
NM_015567chr1311281 ------
NM_015570chr721522 673 ------
NM_015575chr253414 2548 1285 1138 199 ------
NM_015602chr141191 470 285 243 1599 --11324
NM_015635chr952159 1641 898 694 554 ------
NM_015640chr185190 4187 4133 4101 4042 4019 3596 1907 ------
NM_015678chr1321281 671 ------
NM_015686chrX51787 919 875 462 364 ------
NM_015723chr72570 177 ------
NM_015850chr852400 1790 1579 1501 429 --12096 --
NM_015886chr885416 4386 4313 4207 2088 1714 1674 957 15659 --13629
NM_015902chr81948 ------
NM_015904chr21306 ------
NM_015906chr164649 3604 2966 1464 1369 785 1722 1110 --
NM_015912chr82221 73 ------
NM_015920chr151545 ------
NM_015995chr1595414 5405 4537 3476 3413 1445 1109 705 583 --15393 --
NM_016009chr173896 3218 1758 1625 1410 1170 172 1798 23576 1617 11221
NM_016037chr141056 917 741 268 21148 748 1832 --
NM_016073chr1511072 ------
NM_016076chr143059 2766 2076 443 1281 22266 724 --
NM_016083chr683822 3117 2442 2428 1472 932 781 199 21123 407 13172 --
NM_016090chr1121007 682 --1141 --
NM_016103chr52459 419 ------
NM_016107chr541079 499 468 153 11030 11290 --
NM_016206chr3107964 7657 7524 7439 7128 7079 6935 6567 5983 2711 27726 650 ----
NM_016224chr632237 1562 540 11672 ----
NM_016234chr1021015 861 1712 1743 --
NM_016260chr2127604 7458 7307 6514 6403 5523 5279 2829 1796 1571 1226 627 26887 5923 ----
NM_016271chr1842303 2159 1537 939 180 ----
NM_016272chr2252765 2537 1036 646 421 --11073 11748
NM_016277chr621434 333 1579 1145 --
NM_016297chr263476 3188 2631 2335 546 294 --12838 12921
NM_016322chr942540 1982 1036 351 1765 21207 828 --
NM_016340chr591135 1081 1024 1015 909 314 271 184 73 ----11100
NM_016356chr662945 2852 1996 1860 1161 1034 ------
NM_016395chr1551495 600 411 350 54 11852 --11387
NM_016396chr1542467 1895 1133 153 1192 1267 --
NM_016441chr23663 580 154 --22348 1647 1593
NM_016451chr11131 ------
NM_016467chr231255 1118 31 ----1964
NM_016472chr1441202 1084 953 288 ------
NM_016507chr1732986 2620 210 ------
NM_016513chr6102787 2647 2588 2469 1535 1467 1170 363 294 118 3920 395 191 ----
NM_016516chr2----2762 201 --
NM_016530chr15113998 3816 3796 3183 2851 2835 2816 1272 681 411 24 --13851 --
NM_016531chr494018 3831 3808 3711 3174 2987 598 509 264 33732 3457 375 ----
NM_016542chrX31537 1339 607 1646 2328 215 --
NM_016578chr113501 468 103 ------
NM_016654chr1531045 228 112 ------
NM_016824chr1031486 1285 480 ------
NM_016936chr1662058 2004 1653 1383 647 306 ----1420
NM_016952chr1183651 3546 2516 1621 1262 1146 700 575 --2766 297 13271
NM_016953chr2114399 4258 2299 1885 1821 1686 1017 924 700 621 36 --1806 14971
NM_017415chr594500 4056 2988 1681 1607 1570 708 597 275 12796 11709 --
NM_017420chr142675 370 13071 11444 --
NM_017488chr221330 498 ------
NM_017522chr131141 1098 353 ------
NM_017628chr474900 4493 2107 1996 1511 1083 111 11174 11241 --
NM_017633chr633913 3813 598 23123 770 12818 --
NM_017634chr861779 1736 1681 1352 1246 694 21946 419 ----
NM_017637chr9128492 5787 3149 2711 2316 1782 1267 763 735 603 461 218 32538 2344 1286 25719 1397 19354
NM_017640chr63888 723 335 ------
NM_017644chr354567 3923 3718 1886 1438 24773 1976 2950 65 --
NM_017658chr1464164 3667 3450 1739 1724 588 14034 ----
NM_017666chrX41974 1822 1580 828 ------
NM_017672chr1541384 1023 838 185 ------
NM_017694chr221979 1777 21716 297 --1167
NM_017709chr143128 2809 228 205 1317 1168 --
NM_017719chr342247 1627 865 837 12254 1594 --
NM_017734chr11114 ------
NM_017736chr1652740 2662 2461 2121 596 11008 23012 278 --
NM_017737chr131727 1672 712 ------
NM_017744chr172172 2120 1620 1500 941 855 267 12242 ----
NM_017752chrX42016 1992 1653 1378 --1598 --
NM_017753chr93822 800 427 ------
NM_017762chr1552217 1645 677 629 216 --11977 12358
NM_017813chr865483 3998 2338 2078 232 24 11829 24227 832 --
NM_017824chr103993 808 693 1824 22205 25 --
NM_017831chr18104353 4161 3620 3530 3027 1799 1714 1456 759 142 11028 23760 3332 --
NM_017848chrX63566 3426 3139 3115 2910 340 13820 ----
NM_017902chr10145559 4247 4083 2260 1876 1851 1800 1691 1442 1435 1122 1035 753 487 --14468 --
NM_017919chr932329 1344 1128 ------
NM_017926chr145857 596 312 292 280 ------
NM_017938chrX21616 784 ------
NM_017972chr145857 596 312 292 280 ------
NM_017987chr1021494 829 --2601 348 --
NM_018003chr1541754 913 603 432 3994 986 480 --1822
NM_018015chrX21147 25 --21064 995 --
NM_018027chr1032539 2127 474 13271 ----
NM_018084chr232694 665 108 ------
NM_018087chr12253 46 ------
NM_018094chrX------1276
NM_018133chr31211 --147 --
NM_018137chr111268 ------
NM_018155chr353028 2837 2617 1071 49 1149 ----
NM_018164chr12289 75 ------
NM_018171chr122934 640 ------
NM_018177chr421098 210 163 1258 1825
NM_018181chr1841837 1570 1213 401 175 ----
NM_018200chr1542408 2309 2245 342 ----12129
NM_018202chr11218 ------
NM_018211chr122024 110 ----21895 42
NM_018222chr111453 ----11800
NM_018254chr142112 1865 1569 685 1957 --126
NM_018285chr15134 ------
NM_018287chr1051260 1106 977 838 487 ------
NM_018293chr352827 964 807 331 238 ------
NM_018299chr8103052 2659 2504 2169 1301 1281 1231 718 449 105 2675 215 1826 --
NM_018313chr352009 679 645 553 425 11693 ----
NM_018315chr451460 1244 525 354 154 11222 ----
NM_018323chr451857 1741 1578 1155 152 ------
NM_018325chr931603 367 118 --2616 138 --
NM_018339chr941232 1140 675 410 11813 21269 107 --
NM_018340chr16114111 4033 3897 3834 3811 3699 3169 1750 1238 1081 598 14395 13652 --
NM_018362chr1193306 3216 2878 2745 1287 580 480 443 239 ------
NM_018364chr133443 1284 58 32926 1213 204 21580 436 --
NM_018373chr1496345 5554 5469 4989 2120 2014 1878 1544 1504 1535 11090 16095
NM_018374chr794652 4368 3514 3423 1168 877 676 253 128 --1150 1280
NM_018403chr383959 3704 3626 3480 3075 2969 630 345 ------
NM_018409chr453097 3050 2430 234 120 165 12298 --
NM_018431chr204582 574 244 215 ------
NM_018433chr24440 190 156 29 ------
NM_018439chr1882352 2240 2197 2065 2027 2004 659 514 --1567 --
NM_018440chr888598 7575 7417 6536 6145 3119 2947 2299 27329 2751 26972 2868 --
NM_018442chr1173 ------
NM_018451chr131785 1261 ----
NM_018477chr143870 410 328 1234 1101 --
NM_018482chr841588 526 495 95 22284 378 ----
NM_018557chr241675 1187 398 379 ----1218
NM_018566chr144681 4082 673 181 34817 3984 3770 24799 196 --
NM_018590chr1031606 383 78 ------
NM_018640chr1222465 331 ------
NM_018682chr71570 1651 ----
NM_018695chr521786 57 22325 1893 ----
NM_018717chr452583 2234 951 612 123 --22659 2173 --
NM_018841chr133616 2763 1107 1430 11177 13447
NM_018847chr941402 1267 86 73 126 ----
NM_018931chr53721 586 274 ------
NM_018945chr621280 716 ----11406
NM_018958chr1574028 3342 2876 2655 1221 1143 800 12998 1230 --
NM_018963chr2121265 403 ------
NM_018976chr1252790 2082 2003 1845 397 12697 --11141
NM_018999chr1074620 4398 4275 4233 1955 1766 227 23601 271 13375 14829
NM_019001chr344334 3384 763 202 23843 3677 ----
NM_019004chr771531 928 846 596 299 177 33 22346 2101 22027 1869 --
NM_019018chr53634 572 127 ------
NM_019106chr2293360 3350 2721 2471 2266 2145 1061 923 418 ------
NM_019117chrX22460 619 13491 1978 --
NM_019555chr331614 1351 1183 150 ----
NM_019556chrX61149 1045 594 346 185 170 ------
NM_019590chr103543 473 251 1237 2209 200 --
NM_019593chr2062788 2322 1270 663 338 207 1978 23174 144 --
NM_019597chrX1211 ------
NM_019605chr11735 ------
NM_019895chr31785 ------
NM_019903chr1031486 1285 480 ------
NM_020116chr451550 729 695 685 305 11598 ----
NM_020122chr2105261 5160 4916 4572 4340 4071 3858 3711 2123 728 35925 5815 4145 1576 --
NM_020123chr1031577 1165 999 1228 --1243
NM_020130chr82270 218 11278 1898 --
NM_020141chr162368 2270 2121 2016 906 192 ------
NM_020154chr152241 231 ------
NM_020177chr553043 2211 1262 678 505 22091 853 1444 --
NM_020178chr171851 ------
NM_020193chr114997 303 238 148 --11375 --
NM_020198chr171164 11446 ----
NM_020204chr13624 579 154 1179 ----
NM_020205chr142132 957 693 217 1100 ----
NM_020245chr654472 3777 1630 691 583 ------
NM_020336chr2073622 3533 2965 2893 1212 1158 425 13473 --21222 927
NM_020337chr413031 32615 1961 614 1270 1124
NM_020342chr242413 2165 1881 624 ----12401
NM_020353chr3166 --11472 --
NM_020357chr31242 11260 ----
NM_020381chr681877 1665 1637 1576 1414 669 592 385 --1235 --
NM_020390chr384710 1583 1193 1056 971 406 83 47 ------
NM_020420chrY41505 604 299 162 ------
NM_020443chr1136807 6449 6199 6007 5872 5787 4674 4523 2018 1936 1644 740 353 15038 ----
NM_020463chr221400 368 ------
NM_020466chr653840 3316 1449 679 519 23725 106 34780 3911 1035 --
NM_020473chrX11925 ------
NM_020474chr1831549 729 112 1572 1748 11697
NM_020482chr61766 ------
NM_020640chr342292 1677 1634 729 ------
NM_020645chr111526 --1167 --
NM_020673chr20107509 7360 6673 6333 6237 6101 5910 5309 5091 162 46712 5483 584 447 17460 --
NM_020704chr752455 2271 1578 841 790 --21875 948 --
NM_020718chr1676573 5998 4971 4767 4581 2195 1318 46567 6355 6078 5528 ----
NM_020742chrX52665 2424 2123 1077 562 22351 1042 11940 --
NM_020747chr51136 --1793 --
NM_020748chr1761937 1452 1325 730 505 142 ------
NM_020752chr1042859 2226 645 618 1690 12324 --
NM_020760chr221641 579 --11866 --
NM_020766chrX64499 4061 3517 1808 894 680 14320 ----
NM_020771chr621464 973 11339 ----
NM_020772chr17118481 8342 6591 5258 3058 2881 2217 1937 1300 165 34 16541 ----
NM_020774chr1886259 6216 5717 5708 5386 4556 4096 1121 25549 1078 24184 2015 --
NM_020791chr17159 --197 11321
NM_020801chr53792 366 167 ------
NM_020805chr183653 589 445 21920 1645 --11487
NM_020809chr1152316 1575 592 561 293 ------
NM_020824chr103536 160 147 ------
NM_020841chr1263238 3199 2825 2694 2627 451 13675 13877 22910 332
NM_020854chr1821118 282 --31454 1149 598 --
NM_020858chr1551975 1855 1585 1576 173 ------
NM_020861chr631341 940 909 ----11291
NM_020917chr1953547 2932 627 475 35 ------
NM_020919chr22182 38 --2463 417 1305
NM_020922chrX61270 724 636 549 389 184 --11307 11404
NM_020925chr121223 44 ------
NM_020935chr274599 3352 3167 3156 1593 727 687 --11622 13494
NM_020940chr1032775 2658 2380 12460 ----
NM_020948chr143503 1352 1002 761 1694 ----
NM_020951chr19132358 1900 1771 1686 1598 932 873 723 670 661 644 438 430 1838 ----
NM_020962chr1522265 308 ------
NM_020964chr1884045 3643 3505 3074 3028 1501 1322 592 --13722 --
NM_020987chr102258 203 11001 --1882
NM_021005chr1521034 191 ------
NM_021007chr232054 1712 43 ------
NM_021033chr1383360 2557 664 519 254 116 106 75 12496 33306 2958 187 --
NM_021038chr312463 1832 13000 13350
NM_021045chr1052273 994 726 614 42 ------
NM_021047chr191508 ------
NM_021083chrX43344 3102 2657 2645 --13601 --
NM_021088chr252147 1791 1657 802 532 ------
NM_021090chr2264444 3915 3526 3286 1818 839 13937 13510 --
NM_021111chr91423 ------
NM_021140chrX2883 268 ------
NM_021148chr752372 1874 1648 971 744 ------
NM_021155chr192844 707 --129 --
NM_021183chrX52125 1575 758 607 129 --12550 12368
NM_021238chr1242038 1764 1683 130 ----11873
NM_021255chr1474097 2897 1128 986 495 400 345 1818 23406 2886 --
NM_021627chr31411 ------
NM_021629chr375069 4574 3780 1936 999 62 55 24659 4423 ----
NM_021645chr1372213 2110 1704 1669 316 229 73 ------
NM_021648chr682370 2086 1759 736 281 274 246 79 12433 ----
NM_021783chrX42194 1840 680 123 ------
NM_021813chr655397 5030 4181 1790 120 54647 4466 2149 1345 838 13623 --
NM_021814chr621456 1087 1250 ----
NM_021911chr524532 926 --35199 4167 3629 --
NM_021912chr1573498 3144 3058 1260 964 748 481 --11553 --
NM_021956chr661087 1039 437 424 305 288 ------
NM_021959chr62947 743 ------
NM_021960chr152632 1927 813 709 67 12270 ----
NM_021961chr11167383 6674 6020 5354 4803 4538 2890 2844 2445 2058 899 885 610 380 317 216 47480 7106 1378 758 ----
NM_021963chrX3683 219 44 ------
NM_021964chr3146416 6256 5971 5811 5703 4931 4386 2433 2173 1647 1315 745 488 423 15036 11656 --
NM_021998chrX51064 372 270 217 206 11009 ----
NM_022048chr1596007 5334 2411 2269 1059 920 413 285 57 11477 1638 --
NM_022051chr11213 ------
NM_022116chr72735 38 ------
NM_022143chr721131 433 ------
NM_022166chr16126293 5845 5265 4970 4396 2504 2452 2291 2062 2033 662 262 ----1486
NM_022343chr94996 533 182 156 ------
NM_022351chr883619 3565 3430 3241 3164 996 766 571 ------
NM_022456chr1297187 7141 7044 6845 6626 5680 1688 651 234 26865 4728 12946 --
NM_022459chr1386216 4495 3924 1969 1502 777 308 147 11393 ----
NM_022475chr41549 ------
NM_022477chr2031715 1367 1232 ------
NM_022483chr551900 1463 1397 482 87 ----1686
NM_022484chr721399 421 ------
NM_022497chr383645 3632 3602 3526 3445 765 536 515 --11181 --
NM_022552chr22787 450 ------
NM_022716chr13713 693 345 --11079 --
NM_022735chr131331 582 380 11867 --11323
NM_022739chr17----21055 991 --
NM_022745chr122818 594 32578 1202 705 --12429
NM_022763chr33429 345 115 ------
NM_022781chr963153 2078 1301 970 350 302 ------
NM_022828chr531412 310 179 --11454 --
NM_022841chr1542555 2186 2045 123 32273 1922 1005 --12706
NM_022843chr1351258 1134 565 215 140 ------
NM_022845chr1671828 1802 753 592 536 498 492 1609 1110 --
NM_022875chr51463 ------
NM_022877chr51463 ------
NM_022893chr252748 2480 2417 566 514 32695 2600 2163 --12286
NM_022894chr21250 ----1244
NM_022970chr1031475 357 163 1372 ----
NM_023000chr142670 322 --1591 --
NM_023001chr142670 322 --1591 --
NM_023009chr11220 ------
NM_023012chr123523 271 215 --1614 --
NM_023071chr1221135 73 --21127 915 --
NM_023074chr1921381 424 195 ----
NM_023076chr1652981 2960 2744 2009 1172 11923 12076 --
NM_023105chr852400 1790 1579 1501 429 --12096 --
NM_023106chr852400 1790 1579 1501 429 --12096 --
NM_023110chr852400 1790 1579 1501 429 --12096 --
NM_023111chr852400 1790 1579 1501 429 --12096 --
NM_023929chr822253 370 42679 2224 1916 277 12058 --
NM_023943chr31186 ------
NM_024061chr71630 ------
NM_024069chr191696 ------
NM_024076chr1972274 1753 1712 1671 1475 672 453 ----11565
NM_024165chr62231 75 ------
NM_024423chr18113734 3714 3537 3289 3164 1271 1135 1077 884 776 767 --1127 --
NM_024519chr162295 285 ------
NM_024524chr342944 2796 2784 2686 22620 120 ----
NM_024539chrX1820 --1141 --
NM_024557chr1141676 1591 373 290 ------
NM_024586chr12615 108 ------
NM_024590chr461906 1228 748 451 415 373 11589 ----
NM_024635chr91255 ------
NM_024639chr62397 203 --1766 12014
NM_024646chr1123969 3808 3610 3153 3075 2664 2608 2585 2451 1555 1378 782 11194 23201 280 --
NM_024658chr141139 ------
NM_024665chr364661 4377 3642 3209 142 112 --182 --
NM_024686chr12546 374 1456 ----
NM_024713chr1521040 1021 ----11320
NM_024721chr841818 660 602 591 22556 107 22006 75 --
NM_024740chr1173627 3200 3064 2920 1166 1064 330 --13642 --
NM_024744chr2102384 2307 2047 2030 1009 835 773 582 278 70 11731 ----
NM_024770chr2126270 6249 6202 6048 5907 5232 4070 2135 1695 1468 1145 864 26162 4295 26483 5719 --
NM_024795chr24569 434 372 349 1342 ----
NM_024884chr1444072 1196 1060 893 --2765 536 --
NM_024900chr482311 2038 1976 1953 937 783 601 340 ------
NM_024900chr482311 2038 1976 1953 937 783 601 340 ------
NM_024930chr572686 1931 1806 957 283 193 74 2861 310 ----
NM_024942chr106566 353 291 235 197 27 --11513 --
NM_024944chr211385 ------
NM_024947chr3179555 9073 8716 7573 7438 7353 7136 6833 3816 3642 3534 2844 1482 1430 245 214 154 37788 6488 3038 29205 6663 --
NM_024949chr464944 1961 1932 1878 1771 1709 --24471 3698 --
NM_024953chr1232699 2410 2197 ------
NM_024963chr7135622 5235 4813 4362 4198 4109 4051 3931 2132 2005 1137 542 48 ------
NM_024989chr2167815 6753 6655 6544 6245 6189 5945 5490 3070 2976 2449 2315 2230 1966 1466 346 17943 27711 419 --
NM_024991chr1073202 3009 2959 2868 2664 2113 96 12131 13025 --
NM_024993chr211104 ------
NM_025054chr843272 3234 2864 1539 ------
NM_025073chr144584 3496 3105 871 13915 21334 644 --
NM_025074chr462952 2876 831 416 196 102 22445 1101 ----
NM_025134chr1682553 2315 2127 780 390 365 358 311 11820 ----
NM_025154chr741345 1306 1097 195 ------
NM_025160chr111128 23744 1092 23757 3261 12616
NM_025191chr123328 1005 23092 2982 ----
NM_025219chr2062439 2334 1814 1533 1510 353 1183 1205 1502
NM_025221chr441254 930 397 270 11126 ----
NM_025222chr3103044 2694 1976 1956 1200 767 598 523 288 31 --1611 --
NM_025238chr1541436 1009 637 443 21087 618 ----
NM_025268chr141392 ------
NM_030621chr14114181 4170 4118 3968 3582 3389 2739 1042 874 806 791 24158 430 --1447
NM_030625chr1042577 2359 224 39 42391 2258 828 660 --1753
NM_030627chr5103893 3434 3254 3232 3093 3007 2885 2859 2613 1301 11057 --1125
NM_030637chr141188 --1641 --
NM_030639chrX3463 325 61 ------
NM_030647chr7106058 5481 5401 5313 5287 4105 4091 1060 1007 981 36077 1421 105 --14689
NM_030648chr475591 5123 4437 4385 2075 1235 1171 15027 12169 --
NM_030653chr122927 717 ------
NM_030660chr1431022 353 59 ------
NM_030674chr1265290 4697 4567 1871 459 92 ------
NM_030755chr1442690 2577 1079 560 32731 2110 2008 ----
NM_030758chr2211394 ----11044
NM_030762chr1231911 1878 623 --11897 --
NM_030780chr841133 1108 631 546 --21681 119 --
NM_030806chr1179112 8974 8559 7689 7630 7039 6676 6132 5733 3117 2830 1703 1515 869 319 147 104 ----16886
NM_030816chr1103566 3260 3221 2885 2755 2675 2332 649 511 141 12660 ----
NM_030885chr372027 1914 1639 1443 542 473 201 ------
NM_030906chr112517 465 --1233 --
NM_030918chr1104364 3934 3857 3326 2101 1961 1589 1513 1384 125 1450 --15296
NM_030920chr12369 91 11570 ----
NM_030940chr92166 65 ----1532
NM_031243chr731917 1767 135 ----1866
NM_031296chr442272 1054 921 836 ----11768
NM_031305chr42580 132 ------
NM_031314chr1461968 1541 1309 733 554 330 ------
NM_031418chr1192586 2389 2148 842 794 725 591 506 388 --1300 --
NM_031419chr321083 142 ------
NM_031424chr202510 42 ------
NM_031427chr1453639 2240 1744 790 674 --14720 --
NM_031431chr13111766 1613 1282 1237 681 354 286 167 141 71 65 21583 707 ----
NM_031483chr2043500 2271 991 346 ------
NM_031844chr121342 180 --13943 12540
NM_031845chr253680 3413 3207 1414 1122 1765 --13104
NM_031847chr253680 3413 3207 1414 1122 1765 --13104
NM_031858chr1721166 1148 11353 --1151
NM_031862chr1721166 1148 11353 --1151
NM_032012chr995018 4885 4659 4606 4349 3819 3571 3269 1231 --21650 1588 11296
NM_032013chr2031715 1367 1232 ------
NM_032047chr331938 1727 1578 1362 22426 1667 --
NM_032105chr1128031 7640 7590 5819 5596 5365 3040 2849 2501 2401 2189 1725 11944 ----
NM_032121chrX62770 2508 779 693 620 418 12237 ----
NM_032124chr1831109 968 301 ------
NM_032144chr241705 1472 1192 370 ------
NM_032208chr243609 2585 2519 2387 13358 1211 --
NM_032211chr1021181 958 ------
NM_032228chr1173515 3327 3089 2787 2586 765 356 12729 --1213
NM_032250chr92885 200 ----1297
NM_032256chr121254 ------
NM_032287chr2294266 3678 3114 2803 1032 1024 818 647 30 ------
NM_032288chr312378 ------
NM_032291chr151725 1599 1420 602 371 ----1183
NM_032354chr176886 856 389 291 222 38 --11046 1335
NM_032373chr1084875 4827 4805 4111 1844 1322 1216 369 25915 1078 14607 --
NM_032439chr1021265 1117 11214 ----
NM_032440chr1031053 915 586 1191 12543 --
NM_032446chr533046 401 314 33080 2861 1331 ----
NM_032449chr192909 2699 2245 2053 1982 1893 1760 589 484 12776 22810 259 --
NM_032457chr463885 1555 1177 971 643 540 33565 3057 2690 13667 --
NM_032458chrX43260 2241 588 547 22545 82 1540 --
NM_032505chr322390 1854 --11099 --
NM_032558chr931496 1149 326 ------
NM_032582chr1731695 1622 640 11190 ----
NM_032682chr332914 394 102 --21460 338 13563
NM_032689chr1951336 1297 485 175 109 ----1559
NM_032778chr331249 543 137 23037 847 ----
NM_032812chr10138 --1243 --
NM_032828chr19144437 4392 4269 4136 3253 3120 1911 1772 1465 696 650 405 194 186 --34876 4829 1685 --
NM_032833chr162636 2598 1917 1732 1647 784 1672 ----
NM_032842chr751454 1316 518 433 116 ----11366
NM_032859chr1383544 2943 2889 2428 1377 1244 755 710 ------
NM_032873chr1184517 4074 3026 1716 1604 1360 647 265 31449 1074 1016 --13441
NM_032875chr171788 ------
NM_032961chr41260 ------
NM_032973chrY53626 2686 1243 136 44 2282 241 ----
NM_032983chr782912 2516 2277 2142 765 382 223 41 --21353 1066 --
NM_032991chr451011 281 258 226 104 ------
NM_033020chr164649 3604 2966 1464 1369 785 1722 1110 --
NM_033055chr131025 874 836 1777 ----
NM_033081chr2071487 1146 1083 442 421 377 242 ------
NM_033132chr1352171 1855 1826 1577 1429 ------
NM_033143chr463782 3298 3210 2943 652 384 ------
NM_033181chr683822 3117 2442 2428 1472 932 781 199 21123 407 13172 --
NM_033208chr161122 ------
NM_033224chr7108055 7903 7303 7208 6867 6431 5295 2944 1016 21 47758 7108 2519 2459 12429 --
NM_033260chr62616 203 ------
NM_033285chr884468 3832 3638 2754 677 589 251 71 33139 780 638 11095 --
NM_033300chr131141 1098 353 ------
NM_033331chr933405 1120 1059 11187 13289 --
NM_033360chr1294666 4462 4404 4254 4198 3760 3488 3223 401 --23317 619 --
NM_033389chr1774873 4807 3882 3708 3701 1700 629 1589 1831 13142
NM_033426chr1452078 2008 1101 991 252 32767 703 356 ----
NM_033427chr71821 ------
NM_033429chr1552542 2317 603 555 126 ------
NM_033430chr483907 3819 3690 3596 1623 1205 84 33 2652 294 ----
NM_033437chr483907 3819 3690 3596 1623 1205 84 33 2652 294 ----
NM_033484chr52718 625 ------
NM_033505chr2106105 5977 5792 5233 4937 4638 4512 2452 1409 733 36697 5662 1945 24191 1994 --
NM_033632chr451460 1244 525 354 154 11222 ----
NM_033644chr542495 1955 938 319 ----1928
NM_033645chr542495 1955 938 319 ----1928
NM_033656chr2195944 5541 5522 4267 4069 3701 3655 426 342 25095 1346 15469 1395
NM_044472chr11647 ------
NM_052811chr13125215 4884 4530 3429 1989 1364 822 651 501 439 416 21 2346 321 ----
NM_052867chr1321213 519 1327 11384 --
NM_052879chr1253434 2764 2529 1258 1206 11081 ----
NM_052885chr1254240 3499 3478 459 208 24701 1463 ----
NM_052905chr251558 1473 1353 640 83 21224 661 1530 --
NM_052923chr62191 103 ------
NM_052932chr1142410 1595 1008 130 --1724 --
NM_052934chr12212 30 ------
NM_052937chr862463 755 582 381 298 110 22352 2053 ----
NM_052978chr1451668 1601 1442 1231 1215 --1213 --
NM_053016chr9136810 6173 6042 5979 5633 5421 5363 5170 5028 2737 1540 936 120 38016 1420 567 ----
NM_053023chr1143013 2257 1212 1154 --1730 --
NM_053056chr1142448 2122 936 281 1676 ----
NM_054016chr161856 1811 1735 1534 817 707 ------
NM_054016chr161856 1811 1735 1534 817 707 ------
NM_054016chr161856 1811 1735 1534 817 707 ------
NM_054111chr63762 653 37 --1353 1962
NM_057158chr81604 ------
NM_057175chr43516 313 183 --1978 --
NM_057178chr1732812 612 32 --12039 --
NM_057182chr19191 ------
NM_057749chr841248 532 523 79 21230 394 ----
NM_058175chr211243 --1687 --
NM_058241chr261963 1868 1855 1577 859 689 1164 12128 --
NM_058241chr261963 1868 1855 1577 859 689 1164 12128 --
NM_078483chr583633 3369 3133 1642 1635 1189 965 22 ------
NM_078485chr61136 ------
NM_080599chr101878 ----1472
NM_080617chr201303 ------
NM_080645chr662143 2005 1935 1514 1417 32 ------
NM_080676chr20112857 2801 2569 2400 2330 1165 1007 983 825 420 165 ------
NM_080683chr41178 ------
NM_080684chr41178 ------
NM_080685chr41178 ------
NM_080759chr1351905 1734 412 244 47 2852 810 ----
NM_080760chr1351905 1734 412 244 47 2852 810 ----
NM_080764chr2283079 2532 2426 2314 1069 691 432 346 13303 ----
NM_080798chr102105 63 ------
NM_080799chr102105 63 ------
NM_080800chr102105 63 ------
NM_080801chr102105 63 ------
NM_080802chr102105 63 ------
NM_080803chr102105 63 ------
NM_080804chr102105 63 ------
NM_080805chr102105 63 ------
NM_080806chr102105 63 ------
NM_080807chr102105 63 ------
NM_080808chr102105 63 ------
NM_080809chr102105 63 ------
NM_080810chr102105 63 ------
NM_080811chr102105 63 ------
NM_080812chr102105 63 ------
NM_080813chr102105 63 ------
NM_080814chr102105 63 ------
NM_080815chr102105 63 ------
NM_080872chr883907 3329 3091 2693 2600 1235 895 633 1708 ----
NM_080874chr41626 ------
NM_130391chr963494 3304 2814 967 252 33 --1360 33155 1381 742
NM_130392chr963494 3304 2814 967 252 33 --1360 33155 1381 742
NM_130393chr963494 3304 2814 967 252 33 --1360 33155 1381 742
NM_130434chr1531117 746 432 1356 1157 --
NM_130435chr1072801 2774 2571 2488 2258 2131 146 ------
NM_130436chr2152603 2470 2432 2205 1089 22749 522 ----
NM_130438chr2143180 3047 3009 2782 23326 1099 ----
NM_130798chr1541063 501 482 140 ------
NM_130808chr32404 21 ------
NM_130809chr542427 1229 254 197 ------
NM_133170chr2087989 7808 6816 6040 5356 5249 734 511 11958 ----
NM_133326chr11339 ------
NM_133334chr495508 5006 4960 4415 4145 1468 696 297 31 44595 3921 596 566 34747 4527 1757 15147
NM_133372chr522075 1117 1269 22291 320 --
NM_133433chr54745 679 227 29 --1924 --
NM_133468chr742438 1776 1615 177 ----178
NM_133496chr194563 3658 3523 3174 3039 1776 946 728 415 ------
NM_133510chr141393 ------
NM_133647chr1573388 2788 2491 2409 1287 570 190 --1182 --
NM_138288chr1452038 1579 1497 1363 546 ------
NM_138292chr1113511 23306 2408 --12390
NM_138423chr1542194 1672 547 219 1854 ----
NM_138444chr1384788 3890 1502 1459 738 173 164 63 11128 ----
NM_138455chr81122 ------
NM_138457chr673172 2817 2679 2594 1147 879 778 13381 2928 892 --
NM_138459chr6------12812
NM_138462chr91160 ------
NM_138468chr2105728 4946 4655 3940 2406 1794 1578 1142 712 254 31874 831 821 ----
NM_138494chr762295 2249 2207 1896 935 747 ------
NM_138621chr2134160 4072 3915 3804 3569 3356 2594 1383 1090 1074 492 403 301 --1436 --
NM_138713chr16157781 6514 6505 6418 5853 5600 5222 2612 1898 1464 1354 1251 1201 974 305 27939 172 28277 1165 1780
NM_138714chr16157781 6514 6505 6418 5853 5600 5222 2612 1898 1464 1354 1251 1201 974 305 27939 172 28277 1165 1780
NM_138727chr172172 2120 1620 1500 941 855 267 12242 ----
NM_138728chr172172 2120 1620 1500 941 855 267 12242 ----
NM_138731chr1484146 3500 3298 2810 1258 1005 243 211 --11511 --
NM_138735chr22992 326 11281 ----
NM_138779chr133248 183 34 ------
NM_138782chr542220 1882 865 315 --1673 --
NM_138811chr741195 1145 787 243 1403 ----
NM_138927chr212982 801 ------
NM_138959chr1125803 5613 2722 2358 1999 1963 1370 1206 873 686 575 261 46029 4124 2525 1602 ----
NM_138966chr181132 --2481 65 --
NM_139072chr23302 190 140 ------
NM_139207chr1251510 600 435 426 71 ----11526
NM_139279chr273488 3038 1357 1261 864 320 102 23430 3277 ----
NM_139321chr2053956 1691 1193 231 62 ----1662
NM_144571chr456678 5816 4698 906 51 35584 5572 402 ----
NM_144583chr231735 91 47 ------
NM_144600chr1631244 492 272 ------
NM_144657chrX2560 29 --1160 --
NM_144721chr442748 2665 1782 133 1627 --1317
NM_144728chr11845 ------
NM_144729chr11845 ------
NM_144778chr1352681 912 570 529 337 ------
NM_144949chr261703 1009 771 526 199 66 21800 104 ----
NM_144973chr1274447 3263 2098 888 378 138 92 25043 1841 ----
NM_145037chr341196 464 185 63 11488 ----
NM_145055chr1843614 2540 1101 881 ------
NM_145176chr643182 2839 2580 410 32616 950 892 ----
NM_145239chr161139 ------
NM_145251chr1431408 500 472 11594 ----
NM_145259chr2106030 5990 5873 5772 5353 5082 2155 1169 613 303 26828 116 ----
NM_145284chrX52429 1886 1711 673 104 11699 ----
NM_145307chr1054465 4390 4271 1817 98 --12983 14184
NM_145320chr753429 3118 2574 2306 902 --1650 --
NM_145321chr753429 3118 2574 2306 902 --1650 --
NM_145322chr753429 3118 2574 2306 902 --1650 --
NM_145349chr1772287 2171 1888 1803 1619 585 308 --12189 --
NM_145350chr1741639 1523 1240 1155 --11541 --
NM_145351chr1772779 2663 2380 2295 2111 1077 800 --22681 512 --
NM_145735chr1362837 2627 2448 2223 1012 741 22762 1920 1996 1787
NM_147150chr953973 3463 3005 1601 315 11465 22651 754 --
NM_147156chr1011480 ------
NM_147175chrX42209 1973 1745 141 ------
NM_147181chr441254 930 397 270 11126 ----
NM_147182chr441254 930 397 270 11126 ----
NM_147183chr441254 930 397 270 11126 ----
NM_147202chr962317 2099 1817 1106 671 112 22713 1827 ----
NM_148904chr12615 108 ------
NM_148905chr12615 108 ------
NM_148906chr12615 108 ------
NM_148907chr12615 108 ------
NM_148908chr12615 108 ------
NM_148909chr12615 108 ------
NM_148921chr1742092 1930 623 148 ------
NM_152265chr141345 327 223 70 ------
NM_152278chrX1617 ------
NM_152282chr341231 966 504 271 ------
NM_152283chr51198 ------
NM_152284chr84914 839 650 40 ------
NM_152373chr11171 1648 ----
NM_152407chr542976 2594 2342 1127 ----22715 2504
NM_152409chr553069 1371 1117 770 716 12386 22686 840 1368
NM_152414chr811060 ------
NM_152424chrX33556 1444 1062 --14305 14517
NM_152437chr12------12459
NM_152455chr1552740 984 854 769 697 12493 --12237
NM_152470chr1863879 3787 3304 3026 745 638 11571 ----
NM_152519chr262191 1970 1781 677 555 194 11708 ----
NM_152527chr272109 1993 1765 1568 585 474 418 22202 105 ----
NM_152529chr263278 1637 1436 830 708 253 13580 23742 3216 --
NM_152554chr61181 ------
NM_152556chr742032 1995 491 124 11966 ----
NM_152594chr1532208 1792 201 ------
NM_152608chr172064 1725 1657 751 617 532 34 --1208 --
NM_152622chr543498 2736 460 441 21296 1035 2984 781 --
NM_152624chr5156932 6380 5585 5165 4555 2835 2583 1977 1738 1323 1014 685 461 357 179 26252 2048 ----
NM_152629chr993665 2961 2612 1345 1221 779 721 183 117 11655 ----
NM_152630chrX3391 123 101 11092 1599 --
NM_152636chr1142821 1115 1033 74 22967 2097 --13072
NM_152641chr1272903 2701 2299 1171 762 656 253 12626 12263 --
NM_152678chr372687 2322 2258 2023 1764 996 127 --1309 --
NM_152699chr3113399 3317 3132 3105 2956 2820 2735 2370 543 279 88 23736 2551 ----
NM_152707chr101859 ----1892
NM_152716chr1141211 416 233 139 ------
NM_152734chr675290 4255 3852 1770 934 918 192 11348 25151 1781 --
NM_152745chr711114 ------
NM_152748chr7158 ------
NM_152756chr554299 3535 1217 1097 681 --23227 715 --
NM_152765chr851749 800 769 590 580 ------
NM_152774chr752469 2254 2211 1910 1880 11046 ----
NM_152780chrX31265 1234 232 ------
NM_152787chrX83341 3218 1263 1117 1009 953 691 202 --1374 --
NM_152793chr744413 3656 3450 412 24511 1828 24167 704 --
NM_152838chr201155 1197 --13414
NM_152914chr17114362 3783 3648 3054 2859 993 806 720 637 631 235 ------
NM_152919chr19113477 3434 3386 3347 2914 2701 2576 1140 467 282 169 11274 ----
NM_152999chr784380 4022 3560 1984 1375 1066 687 297 1773 ----
NM_153013chr551925 1793 1618 979 749 1420 11710 --
NM_153029chr1663858 3825 3487 3156 932 202 --53725 3659 3358 2731 526 --
NM_153035chr151168 902 371 253 173 12251 22966 196 23215 724
NM_153050chr2264444 3915 3526 3286 1818 839 13937 13510 --
NM_153051chr2264444 3915 3526 3286 1818 839 13937 13510 --
NM_153181chr181132 --2481 65 --
NM_153182chr331249 543 137 23037 847 ----
NM_153188chr5115534 4925 3963 2233 1549 1091 991 859 552 398 98 1130 122 --
NM_153207chr1274024 3240 2663 2557 1471 1461 1014 33184 727 677 32608 1510 47 --
NM_153208chr162852 824 ------
NM_153244chr103673 303 169 ------
NM_153260chr1521138 29 ----1103
NM_153333chrX1628 ------
NM_153354chr52395 296 ------
NM_153365chr422790 848 ------
NM_153371chr1352273 1864 738 604 519 11882 --11648
NM_153487chr674024 3779 3710 3603 3544 1701 1621 --24843 1734 --
NM_153616chr1551975 1855 1585 1576 173 ------
NM_153617chr1551975 1855 1585 1576 173 ------
NM_153618chr1551975 1855 1585 1576 173 ------
NM_153619chr1573213 3093 2823 2814 1411 1082 374 1234 ----
NM_153634chr1231621 1150 1133 --11608 --
NM_153649chr121532 728 ------
NM_153690chr31617 ------
NM_153712chr253226 2327 804 362 330 --23764 1391 1974
NM_153759chr22787 450 ------
NM_153831chr831030 842 105 ------
NM_170606chr751643 1603 1348 1342 734 ------
NM_170665chr1264323 4289 4039 3018 1846 268 14198 23315 3247 --
NM_170692chr13725 349 85 --1341 --
NM_170706chr1133870 3659 3639 2807 2691 2646 1721 1536 1406 1390 1110 253 146 ------
NM_171998chrX3983 921 325 12139 ----
NM_172070chr211746 32164 683 506 11774 --
NM_172196chr21166 ------
NM_172373chr1311296 ------
NM_173054chr71254 ------
NM_173074chr21233 ------
NM_173167chr1762676 2521 2057 1980 1967 890 --1491 --
NM_173214chr16157781 6514 6505 6418 5853 5600 5222 2612 1898 1464 1354 1251 1201 974 305 27939 172 28277 1165 1780
NM_173468chr445557 3740 2401 856 25629 2066 24969 1817 --
NM_173469chr153390 162 90 11538 ----
NM_173473chr1052661 2279 1978 1033 525 ------
NM_173495chrX92143 2066 2003 1680 930 830 761 712 351 --1283 --
NM_173511chr253753 2582 1539 1297 1198 --13354 --
NM_173515chr621034 58 ------
NM_173531chr1993591 3448 3363 2829 2795 2631 2535 963 729 21354 837 ----
NM_173602chr1232696 1367 612 --21034 22 13674
NM_173607chr1462088 1795 1627 1574 1548 753 ------
NM_173642chr1108817 8647 8612 8238 6625 6068 3202 1977 1922 1415 17986 12905 1404
NM_173645chr21467 ------
NM_173667chr591956 1670 1608 960 827 765 742 381 50 ------
NM_173672chr682201 2144 1663 1578 663 582 486 327 ------
NM_173694chrX42571 1978 991 62 32402 2130 1836 --1843
NM_173808chr164069 1685 1573 1510 355 71 33530 3101 851 13869 --
NM_173825chr392801 2157 2131 1952 1234 1177 807 735 297 23115 272 12466 --
NM_173829chr5105535 4747 4623 4347 1857 1415 1403 813 732 589 13803 14038 --
NM_173851chr833766 2740 62 ------
NM_174938chr92199 185 ------
NM_175566chr111137 ------
NM_175623chr1297187 7141 7044 6845 6626 5680 1688 651 234 26865 4728 12946 --
NM_175624chr12107282 7236 7139 6940 6721 5775 1783 746 329 42 26960 4823 13041 --
NM_175625chr12107282 7236 7139 6940 6721 5775 1783 746 329 42 26960 4823 13041 --
NM_175629chr22787 450 ------
NM_175736chr1297554 7427 6924 6321 5981 5828 5159 5109 634 17860 24877 686 --
NM_175854chr1342806 1083 1042 64 1500 ----
NM_175861chr1285618 4761 4592 4063 1748 1527 612 253 --15643 13662
NM_175866chr121076 381 --21001 567 --
NM_175876chr192214 2116 1995 1832 819 658 391 368 277 1209 22640 91 --
NM_177401chr192561 465 ------
NM_177424chr111868 --1321 --
NM_177438chr14114181 4170 4118 3968 3582 3389 2739 1042 874 806 791 24158 430 --1447
NM_177553chr113876 755 61 ------
NM_177966chr351400 1389 1375 599 464 11435 ----
NM_177968chr242117 1671 490 323 --1818 1206
NM_177974chr1542194 1672 547 219 1854 ----
NM_177985chr232208 2053 1556 ------
NM_177989chr31364 ------
NM_178011chr1073077 3054 2923 2902 982 905 728 31001 357 208 ----
NM_178033chr1153 ------
NM_178042chr31364 ------
NM_178126chr1791882 1733 1658 1546 898 837 814 569 485 11457 ----
NM_178140chr522029 741 --11856 --
NM_178151chrX137301 7022 6801 5194 5051 4959 2782 1733 1706 1610 1260 661 335 ------
NM_178152chrX137301 7022 6801 5194 5051 4959 2782 1733 1706 1610 1260 661 335 ------
NM_178153chrX137301 7022 6801 5194 5051 4959 2782 1733 1706 1610 1260 661 335 ------
NM_178313chr23382 288 241 ----1401
NM_178426chr131966 1819 386 11705 12116 --
NM_178427chr131866 1719 286 11605 12016 --
NM_178498chr1163937 3847 3749 2461 819 98 33601 2626 711 22947 1571 13157
NM_178505chr10103452 3292 3206 1209 927 760 622 289 226 55 ----13604
NM_178566chr92326 52 1441 ----
NM_180989chr1352062 2055 1991 1550 66 ------
NM_181077chr155787 682 462 389 137 ------
NM_181332chrX52665 2424 2123 1077 562 22351 1042 11940 --
NM_181354chr841304 650 136 85 ------
NM_181358chr142777 1664 563 124 --1281 --
NM_181481chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_181482chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_181483chr18136566 5563 4755 4483 4435 2373 2133 1636 1529 1383 1171 1020 961 --12448 11716
NM_181504chr552686 1467 1351 1017 99 22547 1219 12893 --
NM_181523chr552686 1467 1351 1017 99 22547 1219 12893 --
NM_181524chr552686 1467 1351 1017 99 22547 1219 12893 --
NM_181672chrX42047 1850 1818 1264 196 ----
NM_181673chrX42047 1850 1818 1264 196 ----
NM_181712chr141715 639 454 388 ------
NM_181714chr651936 1852 1628 365 136 156 1723 --
NM_181723chr832188 1968 1701 21546 694 ----
NM_181861chr1292607 2146 2076 1009 924 842 711 626 515 1109 ----
NM_181868chr1292607 2146 2076 1009 924 842 711 626 515 1109 ----
NM_181869chr12102692 2231 2161 1094 1009 927 796 711 600 73 1194 ----
NM_181886chr41996 ------
NM_181887chr41996 ------
NM_181888chr41996 ------
NM_181889chr41996 ------
NM_181890chr41996 ------
NM_181891chr41996 ------
NM_181892chr411043 ------
NM_181893chr41996 ------
NM_182314chrX41752 1667 678 174 ------
NM_182493chr16115270 5042 4909 4823 4415 4171 3520 1336 970 889 860 21420 1106 23808 1768 --
NM_182515chr19135353 5300 5165 5080 4765 4248 1852 1578 1532 1305 1097 1014 63 35926 2248 1352 36336 5534 4391 --
NM_182607chrX41634 1152 603 469 ------
NM_182641chr1721605 679 --11583 --
NM_182648chr143710 503 237 1226 1181 --
NM_182666chr3------1173
NM_182763chr152621 1916 802 698 56 12259 ----
NM_182765chr1072372 2050 484 478 446 339 316 ------
NM_182798chr51307 ----11003
NM_182799chr51307 ----11003
NM_182801chr51307 ----11003
NM_182830chr1451961 1805 911 332 267 ------
NM_182848chr1341537 1445 575 222 ------
NM_182898chr786408 5895 4821 4000 2107 1406 1383 134 24561 4529 14160 11974
NM_182899chr786408 5895 4821 4000 2107 1406 1383 134 24561 4529 14160 11974
NM_182931chr71570 1651 ----
NM_183004chr1463398 3303 2847 2807 973 273 13892 23564 3385 --
NM_183050chr662170 818 684 599 478 343 1181 1254 --
NM_183065chr176886 856 389 291 222 38 --11046 1335
NM_183078chr6103655 3098 2785 2692 2661 2531 1076 943 600 540 1859 --12636
NM_183227chr621434 333 1579 1145 --
NM_183387chr143326 48 21 ------
NM_183398chr531229 963 235 ----1991
NM_183399chr531229 963 235 ----1991
NM_183400chr531229 963 235 ----1991
NM_183401chr531229 963 235 ----1991
NM_194247chr294513 4427 1487 1284 1237 553 443 160 66 --33342 1717 23 13982
NM_194278chr14114012 3674 3129 3055 2954 2886 2658 1224 1191 363 292 12524 11009 --
NM_194282chr473031 2802 1953 1214 1080 933 412 --12772 --
NM_194314chr145372 4154 1593 1188 14534 ----
NM_194328chr963153 2078 1301 970 350 302 ------
NM_194329chr963153 2078 1301 970 350 302 ------
NM_194330chr963153 2078 1301 970 350 302 ------
NM_194332chr963153 2078 1301 970 350 302 ------
NM_194356chr1262260 2143 761 622 537 346 12117 ----
NM_194434chr18115635 5436 5257 4528 4274 4054 2189 1414 1198 459 155 1724 ----
NM_194454chr731684 1338 401 --21361 1288 --
NM_194455chr731684 1338 401 --21361 1288 --
NM_194456chr731684 1338 401 --21361 1288 --
NM_194463chrX1820 --1141 --
NM_197968chr131268 ------
NM_198066chr1472908 2554 2264 1911 718 506 81 1632 ----
NM_198081chr632777 1876 381 ----1645
NM_198128chr1842303 2159 1537 939 180 ----
NM_198181chr1572922 2420 2070 206 176 148 118 12081 --22768 738
NM_198220chr20143 ------
NM_198225chr1041568 1327 674 407 ------
NM_198261chr123523 271 215 --1614 --
NM_198262chr123523 271 215 --1614 --
NM_198268chr142777 1664 563 124 --1281 --
NM_198269chr142777 1664 563 124 --1281 --
NM_198270chrX33198 2666 2633 22396 142 33140 1344 209 --
NM_198279chrX3808 385 33 1185 1214 --
NM_198353chr41420 --151 122
NM_198400chr1562484 1849 968 950 778 667 1342 11179 --
NM_198404chr133800 724 107 ------
NM_198428chr73798 731 273 ------
NM_198581chr2146802 6683 6546 6132 6030 5739 5274 5191 5111 4977 4774 2562 1242 968 11395 21489 82 --
NM_198715chr186166 5712 4496 1920 1874 1244 795 477 --26149 1033 --
NM_198793chr364016 3813 3786 2676 2546 1332 --33021 2714 927 12601
NM_198859chr354169 3898 3421 3137 148 32003 1704 1501 ----
NM_198896chr1151849 1616 590 544 521 --172 --
NM_198900chr1297554 7427 6924 6321 5981 5828 5159 5109 634 17860 24877 686 --
NM_198904chr521692 278 1314 ----
NM_198990chr732292 910 380 13251 1718 --
NM_199000chr71717 ------
NM_199051chr1146 ------
NM_199132chr1932144 1732 1513 --11599 --
NM_199160chr941887 1509 1484 301 --1421 --
NM_199166chr3------1108
NM_199188chr1253434 2764 2529 1258 1206 11081 ----
NM_199190chr1253434 2764 2529 1258 1206 11081 ----
NM_199324chr453436 841 647 421 377 11173 ----
NM_199344chr1191 ------
NM_199436chr293089 2983 2923 967 590 451 99 80 24 22511 1157 --1765
NM_199462chr164890 4753 3404 912 507 89 13956 24275 353 --
NM_199478chrX3657 423 148 --11576 --
NM_199482chr241490 817 498 257 --11549 --
NM_201438chr121339 ------
NM_201532chr111570 ------
NM_201533chr111570 ------
NM_201545chr141199 1182 526 449 1305 ----
NM_201624chr14825 494 360 298 11142 ----
NM_203304chr191150 ------
NM_203307chr1951712 1626 1436 1217 162 ------
NM_203341chr13762 224 129 ------
NM_203350chr141630 1394 702 38 ------
NM_203379chr1021015 861 1712 1743 --
NM_203380chr1021015 861 1712 1743 --
NM_203382chr541498 525 491 436 --1541 --
NM_203391chrX1187 ------
NM_203394chr1252649 2198 2166 1701 1691 --2528 409 --
NM_203399chr11813 ------
NM_203401chr11813 ------
NM_203406chr552838 952 918 891 592 12150 ----
NM_203446chr2142041 802 492 423 12962 ----
NM_203459chr182603 2539 2497 2423 2198 2144 576 65 1550 ----
NM_203463chr284511 4042 1950 998 917 507 480 74 13893 13006 --
NM_205768chr151813 1432 797 73 62 ------
NM_205860chr163028 2967 2905 2637 2251 415 ------
NM_206594chr133451 817 693 1723 11252 --
NM_206595chr133451 817 693 1723 11252 --
NM_206853chr653945 3734 3318 2508 271 33515 3276 210 24080 843 --
NM_206854chr665206 4995 4579 3769 1532 631 34776 4537 1471 25341 2104 1793
NM_206855chr686171 5960 5544 4734 2497 1596 504 475 45741 5502 2436 778 16306 11758
NM_206866chr21122909 2789 2747 2700 2511 1058 1047 968 808 385 355 316 12840 ----
NM_206876chr251371 665 644 483 204 31238 789 758 12559 --
NM_206909chr8217816 7409 7111 7066 6668 5910 5833 5625 5370 5072 3270 2982 2270 1774 1686 1589 1324 1302 813 788 298 --47564 5778 1544 1064 25721 2215
NM_207012chr1083246 3218 2706 2582 2514 2368 658 468 --11096 1674
NM_207043chr121942 569 --1533 --
NM_207044chr121942 569 --1533 --
NM_207047chr121942 569 --1533 --
NM_207121chr202510 42 ------
NM_207292chr312463 1832 13000 13350
NM_207293chr312463 1832 13000 13350
NM_207294chr312463 1832 13000 13350
NM_207295chr312463 1832 13000 13350
NM_207296chr312463 1832 13000 13350
NM_207297chr312488 1857 13025 13375
NM_207299chr93822 800 427 ------
NM_207303chr1083712 2746 1482 1303 1290 806 380 120 11520 33409 2964 2840 12937
NM_207304chr1362568 1023 799 457 416 224 ------
NM_207317chr51305 ------
NM_207396chr171806 1633 1251 668 532 364 228 ------
NM_207406chr475012 4959 2475 1338 1192 582 565 25896 4921 15167 --
NM_207429chr1152200 2085 524 439 125 ------
NM_207517chr152655 231 11783 ----
NM_212467chr1572464 2249 2123 1927 1820 857 43 --2960 25 --
NM_212543chr31101 ------
NM_212559chrX2612 213 ------
NM_213589chr2115537 4970 4746 4166 3720 2048 1619 1364 1272 1100 170 11723 22040 736 1726
NM_213590chr13125215 4884 4530 3429 1989 1364 822 651 501 439 416 21 2346 321 ----