TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1185-2-3p
miRNA Sequence: AUAUACAGGGGGAGACUCUCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52352 101 ------
NM_000038chr541965 1858 1744 746 --11368 1658
NM_000044chrX1277 ------
NM_000052chrX103233 3142 3001 2831 2674 2570 2371 2343 1311 427 --33210 2684 469 --
NM_000067chr81669 ------
NM_000084chrX116924 5253 4877 4275 2558 2156 2060 1441 1298 575 59 11112 12149 --
NM_000089chr73770 566 556 ------
NM_000092chr294557 4064 3783 3645 3591 3397 3216 2949 1756 ------
NM_000112chr585342 4824 3930 1968 1680 1374 1310 151 15148 25526 4035 --
NM_000129chr611105 ------
NM_000138chr1551886 707 592 210 141 21045 121 ----
NM_000168chr7103376 3058 2992 2940 2866 2752 2224 1216 1044 946 13136 2736 93 --
NM_000173chr172431 124 ----1444
NM_000176chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_000212chr1762417 2081 1784 179 164 157 1214 ----
NM_000214chr2071418 690 587 494 419 384 108 11517 1625 --
NM_000216chrX113968 3941 3436 3379 3006 2970 2835 1303 1269 1144 271 2527 40 13039 --
NM_000242chr1072598 2275 2199 2102 809 759 728 21073 751 11757 --
NM_000245chr752043 811 670 449 122 --11438 --
NM_000248chr32967 176 --33007 2990 2046 --
NM_000259chr15106365 5936 5918 5354 5135 4801 2131 2064 2012 194 --12443 --
NM_000264chr932439 2314 150 43149 385 372 200 11027 --
NM_000278chr1012318 ------
NM_000280chr116991 831 328 277 184 139 ------
NM_000284chrX31654 271 126 11748 --11805
NM_000314chr1063188 714 325 218 210 203 13144 --1927
NM_000321chr1331725 594 402 1218 130 171
NM_000332chr686027 5316 5279 4556 2388 1182 646 47 --17158 15958
NM_000337chr556148 1828 1227 478 114 --36628 2107 1262 1212
NM_000346chr1731993 1331 641 21431 1353 1462 11799
NM_000362chr2293582 2758 2531 2515 2465 1003 569 559 269 ----12429
NM_000378chr111407 1836 --21173 1120
NM_000405chr511284 ------
NM_000408chr263440 3401 3329 1390 1239 186 12261 ----
NM_000415chr124936 884 225 100 ----154
NM_000430chr17133681 3439 3086 2908 2722 2517 1390 1151 1014 940 782 430 181 --33266 1145 805 13733
NM_000451chrX31997 1437 794 ------
NM_000459chr92878 745 --1193 --
NM_000461chr364584 4548 3820 3010 2949 909 ----13967
NM_000462chr1541169 501 478 286 11830 11306 --
NM_000474chr71668 ------
NM_000484chr214839 330 266 245 11079 ----
NM_000489chrX62706 2656 2562 2437 2340 2320 22894 651 --192
NM_000492chr741169 1005 970 461 11203 --11378
NM_000555chrX87210 6631 6581 5506 2818 1646 1499 972 27874 7733 37854 1790 826 --
NM_000590chr51125 ------
NM_000598chr731538 1127 362 ------
NM_000609chr1073121 2973 2966 2438 2394 792 314 ------
NM_000618chr1276563 6440 6120 4556 1235 1216 324 25610 4988 26127 1939 --
NM_000618chr1276563 6440 6120 4556 1235 1216 324 25610 4988 26127 1939 --
NM_000627chr23865 787 286 1858 --145
NM_000633chr1885001 4120 3402 1849 1743 1352 992 797 ------
NM_000719chr12126648 6633 6370 2547 2533 1723 1690 1462 1226 1204 970 890 --14792 --
NM_000724chr1031716 766 125 149 31804 556 549 --
NM_000793chr14105131 4667 4294 3551 3287 3222 1689 1209 998 987 11911 ----
NM_000809chr488204 8068 6841 3620 2968 2939 1920 727 1658 47430 6677 6616 1912 26732 108
NM_000813chr584518 4004 3432 3424 1832 1387 1284 844 25611 3959 15005 --
NM_000814chr15102768 1205 1034 991 753 409 228 188 176 131 ------
NM_000831chr186171 4601 4579 4181 2365 2084 1967 1953 --14554 16277
NM_000839chr31468 ------
NM_000859chr551696 1383 1070 670 250 11357 ----
NM_000861chr352356 2334 1719 1683 74 12653 --1463
NM_000868chrX72469 1978 1954 1945 1692 1628 1009 --12588 12478
NM_000905chr71139 ------
NM_000912chr873522 3477 2621 2197 798 517 492 13189 22445 486 --
NM_000926chr1159466 7437 7263 6101 2103 1128 49161 7756 6245 5985 --
NM_000943chr52374 117 ------
NM_000944chr451959 1942 1860 971 961 ------
NM_000950chrX73634 1314 1173 747 296 276 266 1415 --13518
NM_000959chr173383 3233 2963 2939 2910 466 24 11203 12719 33946 1393 1305
NM_001001331chr362370 1888 1706 838 621 507 --1654 --
NM_001001395chr1252748 2572 428 372 291 21009 944 2412 157 --
NM_001001419chr5145068 4975 4913 4645 4539 4322 3506 3224 2043 1160 950 485 172 144 ------
NM_001001420chr5145068 4975 4913 4645 4539 4322 3506 3224 2043 1160 950 485 172 144 ------
NM_001001483chr111380 ------
NM_001001549chr782371 2309 2144 2116 2038 1068 426 384 22696 1998 11972 --
NM_001001550chr782371 2309 2144 2116 2038 1068 426 384 22696 1998 11972 --
NM_001001555chr782371 2309 2144 2116 2038 1068 426 384 22696 1998 11972 --
NM_001001664chr283865 2974 2963 2954 2935 864 624 446 24008 1595 --1855
NM_001001668chr1954037 3274 3056 3005 2819 13788 11196 14179
NM_001001870chr175840 770 708 701 550 ------
NM_001001933chr13445 407 235 158 ----
NM_001002026chr312446 ------
NM_001002838chrX21165 757 1568 ----
NM_001002860chr14104719 4569 4210 4130 1716 1613 465 372 321 134 23925 1356 14297 --
NM_001003407chr10124988 4925 4448 4014 3990 3947 3738 3287 3108 1784 1250 266 11557 13839 --
NM_001003408chr10124988 4925 4448 4014 3990 3947 3738 3287 3108 1784 1250 266 11557 13839 --
NM_001003652chr18118654 7892 7433 6914 6669 2772 2563 1702 1694 1237 306 22297 911 28617 5324 --
NM_001003674chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_001003675chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_001003679chr151929 1779 1540 574 471 42166 2047 1690 178 ----
NM_001003681chr2251937 1931 1767 599 54 22103 1962 1588 --
NM_001003694chr31610 ------
NM_001003712chr1273535 2882 2648 1613 688 323 278 23398 3138 ----
NM_001003800chr963491 3060 2386 1383 703 609 --13456 13011
NM_001004317chr6113918 3735 3574 3164 2982 2748 1671 1554 760 330 258 23911 725 24340 4266 --
NM_001004342chr196045 6009 5986 5964 5689 4908 4358 1969 1808 --24003 3782 --
NM_001004419chr1243659 3364 3182 1647 --24556 3083 13328
NM_001005266chr151666 ------
NM_001005267chr151666 ------
NM_001005268chr151666 ------
NM_001005269chr151666 ------
NM_001005335chr19194 ------
NM_001005375chrY51325 724 602 287 212 ----21255 205
NM_001005463chr1041783 1600 878 440 1290 1783 12593
NM_001005473chr5126629 4484 4292 2576 2401 2362 2004 1985 1934 735 441 49 34501 4463 4403 26566 405 --
NM_001005502chr1254985 4530 2018 1808 331 1276 11250 --
NM_001005861chr3177 ------
NM_001006600chr561934 1910 826 321 274 263 --11784 --
NM_001006610chr164907 309 249 222 ------
NM_001006612chrX3397 301 156 ------
NM_001006613chrX3397 301 156 ------
NM_001006614chrX3397 301 156 ------
NM_001006657chr233219 2630 507 2214 100 166 12744
NM_001007023chr14105131 4667 4294 3551 3287 3222 1689 1209 998 987 11911 ----
NM_001007278chr1375274 5147 4269 1249 535 296 247 --15135 --
NM_001007466chr6105046 4680 4327 4319 3978 3955 3556 3534 650 472 24535 1448 --13429
NM_001007468chr221268 ------
NM_001008220chr593801 2824 2537 1521 1433 1308 1293 1221 1147 33916 3359 1406 11391 --
NM_001008239chr1853542 3353 2551 991 357 13246 --2935 373
NM_001008405chr741842 1787 673 244 1466 11432 --
NM_001008408chr7126399 6302 6120 5735 5009 4741 4588 2050 1761 1554 1048 635 --25154 5139 15131
NM_001008495chr842080 350 223 93 --1274 1664
NM_001008539chr895137 4771 4533 4158 1825 1327 272 254 242 ------
NM_001008540chr21488 ------
NM_001008660chr1161316 585 544 380 368 336 11176 ----
NM_001008707chr1441377 580 515 343 ------
NM_001008738chr532913 2631 145 --32889 2133 155 --
NM_001009554chr484777 4738 4554 4482 4086 3316 3176 3019 ------
NM_001009554chr484777 4738 4554 4482 4086 3316 3176 3019 ------
NM_001009571chr741153 450 243 117 1519 --1357
NM_001009881chr14611 568 216 207 ------
NM_001009882chr14611 568 216 207 ------
NM_001009899chr3146502 6407 6247 6210 5749 5482 4612 4533 2498 1207 1182 1063 802 645 26329 1188 34868 1453 1173 25335 111
NM_001009909chr1163856 3398 3295 3244 2737 692 ----13471
NM_001009994chr6194 ------
NM_001010888chrX84671 4616 4319 4269 2861 1826 1009 583 33061 2983 978 11081 11020
NM_001010891chr5146650 6156 6120 5756 5252 4804 4251 1846 1695 1383 1352 1117 772 167 26089 2412 1257 --
NM_001010922chr174219 3741 3188 3012 2701 1710 656 11702 14167 --
NM_001010942chr1221075 343 41303 1218 933 301 1318 --
NM_001010984chr172291 2246 2068 1788 952 877 433 12000 ----
NM_001011513chr484035 3443 3403 3043 1017 824 422 214 13988 ----
NM_001011537chr352275 2097 1907 1747 1473 ------
NM_001011553chr73976 963 942 ------
NM_001011645chrX1277 ------
NM_001011658chrX82100 1909 1600 753 421 103 59 45 ------
NM_001011666chr796302 5632 4878 4704 4326 4168 3994 3984 2102 --1283 16231
NM_001011705chr131281 ------
NM_001012393chr1175087 4896 4808 1240 1130 1022 1008 14245 ----
NM_001012418chr6104252 4179 4064 4037 3602 3263 2820 1370 1132 629 24240 3946 ----
NM_001012478chr191639 ------
NM_001012506chr31130 ------
NM_001012755chrX84984 4945 4333 3646 1785 1621 1566 1353 34994 4936 4844 ----
NM_001012756chr1953218 2962 2640 2506 2069 1319 11144 --
NM_001012761chr572109 835 319 201 156 108 97 12689 --12666
NM_001012989chrX1633 ------
NM_001013398chr731538 1127 362 ------
NM_001013406chr751454 1169 1137 662 422 1464 --1552
NM_001013438chr32986 341 --1656 1897
NM_001013439chr32832 187 ----1743
NM_001013620chr12147653 6731 6124 5893 5883 5869 2695 1764 1531 1463 1291 1145 744 294 67453 5555 2644 1479 673 300 ----
NM_001014380chr13175861 5795 5612 5334 5004 4955 4695 4403 4374 3939 3891 2170 1962 1384 924 792 389 14342 23737 807 14277
NM_001015508chr82522 485 ----1497
NM_001017369chr431083 1053 1022 ------
NM_001017415chr16787 761 639 503 232 23 --1671 --
NM_001017416chr16787 761 639 503 232 23 --1671 --
NM_001017440chr787828 7821 6788 5237 3067 1386 1151 25 18154 --18223
NM_001017523chr1241753 1181 600 371 11160 --1663
NM_001017920chr21121 ------
NM_001017973chr5278 66 ------
NM_001017974chr5278 66 ------
NM_001017992chr541560 1246 1120 464 ----1379
NM_001018009chr321023 375 --11107 --
NM_001018037chr931367 1228 110 11152 11277 --
NM_001018038chr91112 ------
NM_001018065chr995310 5018 2288 2112 1471 899 889 409 30 15949 25670 4230 --
NM_001018066chr995310 5018 2288 2112 1471 899 889 409 30 15949 25670 4230 --
NM_001018067chr1125161 4946 4901 4798 3858 3327 2039 966 506 334 279 205 44877 4504 4444 912 23738 1456 --
NM_001018068chr1125161 4946 4901 4798 3858 3327 2039 966 506 334 279 205 44877 4504 4444 912 23738 1456 --
NM_001018069chr1125161 4946 4901 4798 3858 3327 2039 966 506 334 279 205 44877 4504 4444 912 23738 1456 --
NM_001018072chr1241753 1181 600 371 11160 --1663
NM_001018074chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_001018075chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_001018076chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_001018077chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_001018676chr82496 347 ------
NM_001018677chr82496 347 ------
NM_001020658chr171647 1541 1436 1104 1067 309 247 11591 11607 --
NM_001020658chr171647 1541 1436 1104 1067 309 247 11591 11607 --
NM_001024094chr573573 2778 1377 784 667 474 330 43675 1473 1022 59 33617 1247 415 13505
NM_001024647chr12157690 7674 7552 7315 7307 7203 6950 5764 4739 2420 2246 1460 1315 287 168 ------
NM_001024649chr552913 2273 1011 865 610 22934 2519 --21130 150
NM_001024947chr51755 ------
NM_001024956chr1195894 5758 5016 3620 1902 1782 1127 273 244 --14030 --
NM_001025068chr351801 1628 1545 1528 1185 ------
NM_001025069chr351801 1628 1545 1528 1185 ------
NM_001025076chr1075912 5062 4504 3973 3890 2405 777 46120 4054 1316 1180 11786 --
NM_001025077chr1097270 6420 5862 5331 5248 5061 2135 1063 241 47478 5412 2674 2538 --11373
NM_001025079chr373823 3269 3186 2775 1275 1073 853 21522 561 22567 1314 --
NM_001025108chr283657 3637 3555 3175 1233 1226 805 161 23698 199 1190 --
NM_001025266chr373885 3234 3076 1964 1752 1266 208 21970 1108 13188 --
NM_001025366chr651900 1609 1583 1574 1386 ------
NM_001025366chr651900 1609 1583 1574 1386 ------
NM_001025367chr651900 1609 1583 1574 1386 ------
NM_001025367chr651900 1609 1583 1574 1386 ------
NM_001025368chr651900 1609 1583 1574 1386 ------
NM_001025368chr651900 1609 1583 1574 1386 ------
NM_001025369chr651916 1625 1599 1590 1402 ------
NM_001025369chr651916 1625 1599 1590 1402 ------
NM_001025370chr651900 1609 1583 1574 1386 ------
NM_001025370chr651900 1609 1583 1574 1386 ------
NM_001025579chr1711055 --11143 --
NM_001025595chr441665 1390 382 242 11025 11565 --
NM_001025780chr911084 --1555 2260 208
NM_001029858chr632488 300 65 ----23384 2704
NM_001029860chr83254 147 123 ------
NM_001029882chr13656 471 440 ------
NM_001029882chr13656 471 440 ------
NM_001029884chr672553 2483 2457 2407 2157 645 82 12145 12710 12369
NM_001030007chr1673986 3737 1568 1478 1135 993 623 --23327 601 --
NM_001030055chr1494584 4493 3737 3371 1570 1394 1325 1102 740 13151 --13187
NM_001031623chr631357 698 159 ----11779
NM_001031692chr7284 35 ----1291
NM_001031695chr2275340 5225 4684 4627 4397 2094 1854 25358 5056 1297 --
NM_001031722chr61138 ------
NM_001031732chr493645 2967 2324 1154 1143 790 671 117 48 22480 754 21358 462 --
NM_001031804chr1694440 3844 3065 1738 1713 1520 1002 542 480 13498 13119 --
NM_001031812chr572116 2043 1945 1503 825 785 702 1888 11769 11739
NM_001032279chr111401 ------
NM_001032282chr831203 448 303 ------
NM_001032296chr13102939 2867 2622 1939 1855 1101 1088 626 437 321 --42782 2270 1068 490 --
NM_001033002chr171100 ------
NM_001033081chr131868 1753 1745 --1220 --
NM_001033082chr131868 1753 1745 --1220 --
NM_001033557chr241401 1364 1304 949 --11374 --
NM_001033756chr651834 1543 1517 1508 1320 ------
NM_001033756chr651834 1543 1517 1508 1320 ------
NM_001033925chr1041470 1391 734 358 --12151 --
NM_001034954chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_001034955chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_001034956chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_001034957chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_001035chr12962 175 ------
NM_001037165chr7118901 8804 8714 8439 8155 7439 7151 6528 5845 2868 2144 1220 17690 --
NM_001037174chr282182 1838 699 618 609 470 463 262 22103 34 ----
NM_001037494chr121202 ------
NM_001037495chr121202 ------
NM_001037553chr2185090 4663 4572 4413 4168 4112 3178 1075 1671 14618 14006
NM_001037738chr51286 ------
NM_001039091chrX31349 944 126 --1445 1399
NM_001039395chr942474 1898 1728 98 22417 1695 --11720
NM_001039465chr141190 ------
NM_001039538chr233389 2471 860 1497 23678 3517 22983 2744
NM_001039547chr3107911 6952 6662 6232 6062 4941 2944 2784 2060 1812 36870 6369 858 --16754
NM_001039577chr1113915 3813 3656 3613 1730 1721 1077 766 611 464 336 13573 --1260
NM_001039580chr4134936 4560 4541 4152 3966 3642 3434 3137 2002 1897 1841 1690 1012 13984 2884 307 13891
NM_001039585chr173640 3490 3220 3196 3167 723 281 11460 12976 34203 1650 1562
NM_001039590chrX93793 3248 3068 1299 968 736 243 191 69 32751 1332 227 ----
NM_001039591chrX93793 3248 3068 1299 968 736 243 191 69 32751 1332 227 ----
NM_001039618chr11114968 4952 4540 4272 3868 3794 3667 1993 1979 1112 1005 34000 1241 1037 25049 4821 --
NM_001039690chr1612376 ------
NM_001039693chr244112 3789 3386 2778 12642 ----
NM_001039802chr121384 210 ------
NM_001039840chrX115382 4861 4319 1861 1819 1736 1381 818 630 91 26 32351 2227 2072 35497 4333 3828 --
NM_001039937chr1333864 772 423 ------
NM_001040001chr651967 1933 1789 597 26 21863 1466 ----
NM_001040092chr8263 42 --1323 --
NM_001040110chr771839 1573 1219 321 315 291 275 1389 --1414
NM_001040142chr292225 1979 826 810 798 790 782 529 122 1536 ----
NM_001040143chr292225 1979 826 810 798 790 782 529 122 1536 ----
NM_001040144chr1612376 ------
NM_001040146chr1612376 ------
NM_001040157chr461935 855 385 285 277 52 1683 --12819
NM_001040202chr452264 2172 1931 1873 59 --12141 12020
NM_001040214chr652212 2011 1757 1625 666 21854 1781 --1722
NM_001040402chr482946 2667 1231 277 255 204 166 76 42936 2255 641 287 ----
NM_001040429chr1342781 1260 1087 214 11072 --1558
NM_001040441chr155483 5416 3427 158 56 --22096 1288 --
NM_001040446chr542721 2408 2368 451 --22673 2559 1407
NM_001040450chr15102594 2422 2271 1994 1831 996 802 637 521 223 --11767 --
NM_001040453chr15102594 2422 2271 1994 1831 996 802 637 521 223 --11767 --
NM_001040624chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040625chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040626chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040627chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040628chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040629chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040630chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_001040665chr755015 4832 3694 3047 958 54215 3443 1257 1208 549 1793 14869
NM_001040666chr72717 534 ----1571
NM_001040712chr943108 2359 2189 931 12850 --23557 555
NM_001042355chr1695402 4860 3927 3875 3683 3412 1999 1242 553 13947 13969 --
NM_001042412chr1695402 4860 3927 3875 3683 3412 1999 1242 553 13947 13969 --
NM_001042453chrX71684 1478 1418 1184 643 592 226 ----11520
NM_001042493chr6----11594 21513 286
NM_001042494chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_001042495chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_001042496chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_001042497chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_001042510chr882056 2049 1911 1766 1664 1510 730 593 1277 --1177
NM_001042511chr882056 2049 1911 1766 1664 1510 730 593 1277 --1177
NM_001042555chr1284111 4014 3912 3770 3245 1398 923 585 33835 3751 3259 ----
NM_001042599chr287403 7330 7005 6685 5759 4814 4796 1970 26800 3009 47192 6470 6375 4756 --
NM_001042601chr342956 2807 484 380 ----1744
NM_001042603chr1255344 4356 4106 3860 1537 24952 2082 24961 1593 11994
NM_001042604chr374426 3529 1799 1431 848 838 211 33954 1618 111 1173 --
NM_001042635chr14261 22 ------
NM_001042749chrX41910 1855 1347 774 --11684 --
NM_001042750chrX41910 1855 1347 774 --11684 --
NM_001042751chrX41910 1855 1347 774 --11684 --
NM_001044385chr2103885 3750 2906 2723 1578 950 546 278 87 79 --23722 3156 --
NM_001044722chr572116 2043 1945 1503 825 785 702 1888 11769 11739
NM_001044723chr572116 2043 1945 1503 825 785 702 1888 11769 11739
NM_001071775chr1351699 648 520 455 373 11766 ----
NM_001099678chr3136280 6121 5541 5260 5052 4658 4609 4434 2316 2275 1630 1257 1245 11540 3810 504 412 14700
NM_001100108chr1118095 8052 7832 7252 7166 6969 5245 3100 2532 267 70 13086 47668 2929 1042 979 --
NM_001106chr3119784 9715 9550 9182 9004 8990 7565 6378 6194 3544 221 ------
NM_001115chr8132 ------
NM_001121chr1061855 1681 1670 1207 751 737 11874 ----
NM_001124chr112666 527 ----1696
NM_001128chr1673986 3737 1568 1478 1135 993 623 --23327 601 --
NM_001148chr442221 2062 554 386 --11529 12015
NM_001149chr1041269 1181 1175 263 11376 --1508
NM_001151chr41185 ------
NM_001152chrX2199 44 ------
NM_001160chr1272763 2745 2686 2676 742 502 355 ------
NM_001167chrX166681 6586 6418 5989 5775 5650 5541 5214 2690 2503 1414 1366 704 678 274 192 --22298 372 16714
NM_001173chr1494584 4493 3737 3371 1570 1394 1325 1102 740 13151 --13187
NM_001179chr41193 --1232 --
NM_001198chr651543 1506 898 722 250 --2271 220 1503
NM_001201chr483931 3699 3554 1522 1513 667 558 181 33913 3476 3340 23530 3198 23084 2602
NM_001204chr2127694 7585 7148 7111 6811 6190 5635 5181 2583 2295 1833 272 27498 5722 25969 2794 17527
NM_001237chr441162 865 173 162 ------
NM_001237chr441162 865 173 162 ------
NM_001241chr262339 1928 1624 595 501 488 1507 11914 12108
NM_001241chr262339 1928 1624 595 501 488 1507 11914 12108
NM_001256chr1712606 --2154 69 11853
NM_001257chr1631481 1132 943 21114 364 1375 --
NM_001260chr131346 ------
NM_001304chr1762752 2567 1470 991 311 135 13463 12554 23851 3024
NM_001310chr1282519 1903 869 854 837 378 370 299 12151 12569 --
NM_001315chr652228 1753 1738 1583 1511 11701 1901 --
NM_001316chr201359 ------
NM_001329chr1021118 1007 ------
NM_001351chr331299 192 124 1117 --11224
NM_001364chr1184653 4094 3355 807 732 591 536 342 14615 14070 1150
NM_001390chr1823514 3502 ------
NM_001412chrX103449 3387 3380 2811 2701 2451 1161 782 391 377 22337 735 ----
NM_001416chr171460 ------
NM_001418chr112736 476 ------
NM_001418chr112736 476 ------
NM_001419chr1984157 3524 1822 1773 1606 916 884 462 1996 24852 4699 --
NM_001426chr21301 ------
NM_001431chr631198 1156 920 ------
NM_001432chr4123819 3779 3720 3540 3381 2660 2461 1543 1087 767 522 113 1179 ----
NM_001438chr193566 3518 3507 3491 3282 3181 3060 2766 2307 23626 3544 22421 2255 --
NM_001448chrX41280 654 620 300 ------
NM_001451chr1631348 1282 1180 11320 --21248 1107
NM_001497chr982758 2728 2717 2703 2504 2136 1906 53 --32689 2672 2481 --
NM_001533chr19194 ------
NM_001604chr116991 831 328 277 184 139 ------
NM_001609chr1084463 4257 3925 3518 2822 1373 1088 230 13107 1261 1928
NM_001616chr293504 3358 2735 2570 2543 2276 2243 911 683 --1518 190
NM_001621chr753051 2724 2645 2306 586 11071 12346 --
NM_001621chr753051 2724 2645 2306 586 11071 12346 --
NM_001656chr551981 1930 1820 1581 389 21746 632 11952 --
NM_001660chr3175 ------
NM_001682chr1262563 2471 2357 2241 1033 547 ------
NM_001683chr362370 1888 1706 838 621 507 --1654 --
NM_001695chr894257 3174 2626 1563 1555 852 386 221 147 1553 ----
NM_001701chr931324 1144 108 ----11551
NM_001706chr361009 805 730 691 374 343 2780 241 ----
NM_001709chr1142757 1153 668 55 1118 12331 --
NM_001717chr1551498 1232 1068 953 507 --11208 --
NM_001726chr11108 ------
NM_001730chr1361528 390 217 162 134 126 --11571 171
NM_001730chr1361528 390 217 162 134 126 --11571 171
NM_001745chr521153 183 ------
NM_001746chr552913 2273 1011 865 610 22934 2519 --21130 150
NM_001748chr1181 ------
NM_001759chr1275167 5129 4667 1390 854 315 230 --1411 --
NM_001777chr373823 3269 3186 2775 1275 1073 853 21522 561 22567 1314 --
NM_001788chr73976 963 942 ------
NM_001791chr121384 210 ------
NM_001826chr11363 ------
NM_001830chrX53743 1421 1219 222 41 23534 1134 13810 23992 1318
NM_001858chr6114936 4865 4797 4290 4283 4112 1911 1810 1089 1031 918 23893 755 11695 1675
NM_001874chr1254985 4530 2018 1808 331 1276 11250 --
NM_001881chr102115 74 ------
NM_001903chr52219 210 ------
NM_001920chr121541 ------
NM_001933chr1421247 1179 ----1142
NM_001949chr663248 3094 2371 1301 955 580 32930 2579 2144 12062 --
NM_001964chr531190 1060 476 ------
NM_001967chr32616 468 ------
NM_002006chr495755 5716 4946 4318 885 826 607 191 90 24340 2301 --25547 507
NM_002015chr1372625 2157 1114 1059 905 358 334 13255 ----
NM_002024chrX52164 2040 1755 1558 442 2799 540 1811 --
NM_002025chrX149098 8095 7909 7119 6909 6182 6107 5825 5654 2958 1145 980 781 470 39080 7201 1796 29171 7977 --
NM_002027chr82496 347 ------
NM_002035chr1874003 3708 3284 2940 1323 592 530 --12875 --
NM_002056chr24817 754 234 61 ----134
NM_002061chr161810 1525 1219 604 341 195 163 ----
NM_002068chr191669 ------
NM_002069chr74659 522 515 279 11569 11751 11868
NM_002074chr111673 ------
NM_002092chr474938 4747 4557 4321 3917 3096 531 24997 967 21142 1121 --
NM_002128chr1342526 2388 2227 142 12370 22580 1893 1105
NM_002137chr732230 1497 463 2607 524 --135
NM_002140chr951182 1164 1114 1086 1046 ------
NM_002158chr293750 3246 3059 2919 2495 1432 1329 899 893 53519 3509 3276 1279 1014 ----
NM_002163chr1611263 ------
NM_002165chr201324 ------
NM_002166chr21514 ----1748
NM_002182chr352741 2643 2592 1051 142 ----1502
NM_002210chr273329 3259 2919 2744 2579 424 261 31193 753 679 23406 889 --
NM_002214chr775221 4563 1975 1333 867 695 577 45042 4005 2292 1680 --11824
NM_002222chr32315 24 --1135 --
NM_002223chr12134042 3654 3400 2872 2837 2598 2539 1133 1073 984 815 734 166 ------
NM_002247chr1051901 1780 573 34 24 21986 135 ----
NM_002264chr364360 1353 932 749 455 29 --13597 14598
NM_002265chr1711062 ------
NM_002267chr1352427 2220 1937 1663 753 ------
NM_002270chr5145637 5111 4799 4750 4522 4495 4447 3800 3700 2048 1675 1481 1146 182 35651 5370 1155 --15192
NM_002285chr283657 3637 3555 3175 1233 1226 805 161 23698 199 1190 --
NM_002290chr61234 ------
NM_002291chr72149 119 ------
NM_002310chr5116441 5484 5256 2475 2437 2350 1822 1553 1354 1204 366 26419 4826 23991 1624 22227 606
NM_002313chr10124988 4925 4448 4014 3990 3947 3738 3287 3108 1784 1250 266 11557 13839 --
NM_002336chr1264425 3336 3243 1681 1572 655 25016 229 --15001
NM_002349chr21302 21426 1209 21639 1572 1275
NM_002351chrX51328 1211 677 493 397 --1487 --
NM_002374chr233389 2471 860 1497 23678 3517 22983 2744
NM_002387chr595034 4172 3385 1835 1526 669 451 367 189 --14311 11030
NM_002449chr531037 1022 408 1261 --1393
NM_002480chr1231496 1484 491 ------
NM_002500chr22829 278 --11259 --
NM_002518chr241146 1121 1004 404 11134 ----
NM_002519chr1151436 1279 1108 1030 331 --1249 1283
NM_002522chr1773722 3352 3122 2631 1399 785 302 13530 --13732
NM_002538chr51231 ------
NM_002542chr31251 ------
NM_002545chr1175087 4896 4808 1240 1130 1022 1008 14245 ----
NM_002552chr241081 1053 145 108 1889 1875 1922
NM_002577chr364025 3568 3264 3255 2658 701 1544 1934 --
NM_002590chr132473 78 ------
NM_002594chr2051930 1905 1877 1867 771 21898 1819 --12089
NM_002613chr16125190 5127 5069 4657 3439 1984 1895 1728 1565 1509 631 385 ----14756
NM_002620chr4162 ------
NM_002645chr1133142 2257 102 63073 2817 2779 2550 1090 782 11050 1398
NM_002647chr183234 215 66 ------
NM_002655chr8105059 5021 4957 4846 4088 3758 3310 1045 786 35 55104 5067 4346 408 112 24751 3352 --
NM_002663chr171526 ------
NM_002670chr341564 1145 99 40 --11649 --
NM_002699chr111467 ------
NM_002709chr232427 1137 179 --11212 1344
NM_002719chr1432374 2171 626 21981 1793 --11967
NM_002721chr93467 365 61 ------
NM_002731chr153140 3006 2029 1953 1219 22493 1202 1709 --
NM_002736chr771738 1532 1494 851 756 294 76 12199 12074 --
NM_002737chr1766139 4351 1849 1544 1452 781 36687 6616 6582 --16504
NM_002738chr1641123 1071 423 412 ------
NM_002745chr2264509 3951 3920 3575 2901 212 --11268 13763
NM_002748chr1531210 887 28 --21082 874 --
NM_002760chrY125626 5425 5398 4900 4489 4266 1207 897 882 711 529 317 --35605 1841 1038 --
NM_002765chrX31349 944 126 --1445 1399
NM_002788chr14124 ------
NM_002790chr11100 ------
NM_002814chrX4735 676 627 28 ------
NM_002821chr61637 ------
NM_002833chr1581616 1535 1501 1246 577 560 538 513 ------
NM_002834chr1254049 3453 3382 311 178 13544 34082 3556 3305 --
NM_002837chr1264549 4174 3812 1718 184 43 21769 112 --1308
NM_002839chr943108 2359 2189 931 12850 --23557 555
NM_002843chr1183242 1387 1281 1048 1031 926 903 418 22633 2395 33232 1174 1038 --
NM_002851chr72646 263 ----1583
NM_002865chr82285 193 ------
NM_002868chr121274 ------
NM_002890chr54926 749 674 290 --2973 953 --
NM_002893chrX181 ------
NM_002941chr311090 ------
NM_002956chr1241416 1291 1248 388 ------
NM_002958chr3177 ------
NM_002968chr162860 243 --1426 --
NM_002971chr341224 911 464 269 ----21070 1057
NM_002993chr441083 1057 703 330 ------
NM_002995chr13707 145 120 ------
NM_002996chr1611982 ------
NM_002998chr862233 2031 1600 799 511 138 2646 554 ----
NM_003003chr171219 ------
NM_003031chr164907 309 249 222 ------
NM_003034chr12107095 6905 6861 6068 5638 5450 3030 1121 986 686 ------
NM_003043chr3104253 4207 4146 4123 3958 3644 3383 1299 310 171 14181 1430 --
NM_003046chr895137 4771 4533 4158 1825 1327 272 254 242 ------
NM_003068chr831051 861 113 ----1921
NM_003073chr221268 ------
NM_003076chr1211192 ------
NM_003093chr62182 25 ------
NM_003094chr11145 ------
NM_003095chr12187 ------
NM_003099chr15126559 6543 6159 6001 4907 4466 1567 1297 1148 879 292 30 ----11657
NM_003106chr351016 983 961 873 319 ------
NM_003108chr2107087 6858 6779 5320 5094 4991 4567 1554 1281 1006 27076 5945 ----
NM_003113chr23286 139 129 ----1102
NM_003199chr18125670 5447 5349 5085 5033 3511 2159 1992 1933 1647 965 61 14867 24185 1178 --
NM_003202chr521847 1505 ------
NM_003211chr125703 621 433 207 193 ----21484 1357
NM_003215chr451574 1315 1186 559 275 --1567 --
NM_003257chr1511055 ------
NM_003274chr2192966 2710 2635 2502 2432 2269 2199 1890 1175 11093 --1840
NM_003290chr191147 ------
NM_003292chr131882 1701 1550 ----11540
NM_003298chr396135 4569 4124 4115 4097 4086 1245 354 252 1443 1490 --
NM_003319chr21111 --1213 --
NM_003338chr105537 463 421 381 206 1715 3757 435 347 --
NM_003342chr1793296 3230 3194 2841 2137 1150 1047 694 535 --13067 --
NM_003348chr121623 ------
NM_003368chr16787 761 639 503 232 23 --1671 --
NM_003372chrX1943 ------
NM_003373chr1061985 1625 1537 1512 789 210 ----1201
NM_003374chr53720 666 83 ------
NM_003376chr651900 1609 1583 1574 1386 ------
NM_003376chr651900 1609 1583 1574 1386 ------
NM_003403chr145821 631 618 585 82 1612 ----
NM_003407chr191568 ------
NM_003410chrX72983 2896 2097 2049 891 841 709 --2111 94 12703
NM_003413chrX11262 --11455 --
NM_003463chr693294 3154 2306 2212 1131 626 375 244 165 ----11070
NM_003467chr21488 ------
NM_003468chr294225 4165 3939 3779 3764 3755 3301 2784 377 13084 11416 --
NM_003472chr64606 583 533 246 ------
NM_003477chr111534 ----1264
NM_003489chr2152937 2907 2805 2709 716 12865 22853 231 166
NM_003490chr2221077 1052 ------
NM_003503chr131298 950 834 ------
NM_003505chr731675 1560 302 ----1279
NM_003506chr83934 859 386 11354 11249 --
NM_003557chr111592 ------
NM_003566chr1243268 3164 1389 708 33091 2592 844 13126 13418
NM_003574chr1885698 5685 5577 3969 1504 882 203 115 14204 21663 1441 --
NM_003576chr13102939 2867 2622 1939 1855 1101 1088 626 437 321 --42782 2270 1068 490 --
NM_003583chr1283752 3701 3126 3059 1545 757 248 116 11395 33845 3742 864 --
NM_003590chr253223 1409 1084 780 546 2728 406 12655 1272
NM_003591chr101390 ------
NM_003622chr1252415 2126 1969 1812 513 ------
NM_003630chr61732 ------
NM_003645chr151213 ------
NM_003659chr21304 ------
NM_003663chr3133386 3353 3326 3312 2453 2365 2219 1345 1060 612 539 127 80 32704 2642 330 ----
NM_003677chr12131858 1850 1820 1707 604 240 220 198 172 158 144 122 104 11986 ----
NM_003686chr11263 ------
NM_003713chr141751 1731 1515 1503 11428 --21638 1082
NM_003714chr562774 2428 2395 2362 2347 2076 1620 ----
NM_003722chr362219 1970 1856 1777 1746 501 22301 347 ----
NM_003737chr111450 ------
NM_003741chr31382 ------
NM_003746chr121202 ------
NM_003749chr1372402 2391 2128 1630 751 530 124 32096 1779 1757 12330 --
NM_003759chr4104307 3467 3399 3080 1705 1690 1322 1295 1226 989 13743 13340 --
NM_003769chr121219 ------
NM_003778chr31134 ------
NM_003783chr131199 836 56 --1232 1218
NM_003822chr183100 3015 2072 2043 613 552 332 202 12363 ----
NM_003845chr12146 ------
NM_003872chr263013 2006 1933 695 306 237 13030 12016 --
NM_003887chr252112 1704 1492 860 95 32229 2172 601 12219 --
NM_003907chr31339 ------
NM_003913chr674263 4106 3759 1705 947 250 75 --34181 3225 1244 --
NM_003916chrX2518 343 ------
NM_003948chr472241 2056 2019 630 437 325 304 1356 12160 1430
NM_003966chr567830 7777 7762 7612 7321 5535 --12444 --
NM_003972chr1071160 1146 1131 1086 1077 357 183 1101 ----
NM_003987chr1012318 ------
NM_003988chr1012395 ------
NM_003989chr1012254 ------
NM_003990chr1012254 ------
NM_004075chr121188 ------
NM_004081chrY51325 724 602 287 212 ----21255 205
NM_004085chrX1190 --1672 --
NM_004094chr1421114 696 ----13043
NM_004100chr652721 2399 1852 1672 980 31083 900 487 12200 1454
NM_004113chr382010 1852 1541 1276 661 454 287 158 ------
NM_004114chrX51233 1147 959 938 811 2920 845 1913 --
NM_004124chr1483290 3148 2774 2697 908 533 514 488 ------
NM_004128chr132379 215 ------
NM_004133chr872363 2345 2115 853 642 485 202 22594 284 ----
NM_004136chr1573303 3258 3215 2356 2284 2270 2166 --1368 --
NM_004171chr11219654 9327 9297 8902 8327 8139 8115 8069 8015 7969 7669 6802 6691 6659 3452 2933 2623 2113 1586 225 179 ----28979 661
NM_004180chr22614 249 ----1231
NM_004199chr5278 66 ------
NM_004232chr1883746 3555 3255 2736 2468 730 455 351 33901 3866 121 13728 --
NM_004235chr92842 797 ------
NM_004272chr581575 1410 665 577 544 413 239 153 ------
NM_004274chr1442200 753 641 471 2885 861 22070 852 --
NM_004279chr782296 1901 1555 1474 682 157 108 77 11815 1825 --
NM_004293chr973843 3770 3275 3073 778 769 124 13806 11074 --
NM_004295chr171496 ------
NM_004304chr22279 145 ------
NM_004331chr822639 344 12669 --1650
NM_004338chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_004384chr572116 2043 1945 1503 825 785 702 1888 11769 11739
NM_004389chr22871 74 ------
NM_004392chr1382637 1674 1040 1021 847 364 278 117 --12175 --
NM_004397chr1174235 3961 3701 1201 977 911 211 32943 1569 988 ----
NM_004411chr73576 284 76 ------
NM_004434chr1441377 580 515 343 ------
NM_004438chr283009 2852 2829 2700 2188 1169 379 310 23063 2509 ----
NM_004457chr251611 1598 525 419 361 --11518 31482 511 324
NM_004459chr1761820 1359 829 806 495 390 ------
NM_004491chr1964355 4092 4020 3909 3843 3554 --24061 3800 --
NM_004500chr1441679 699 462 279 11812 12034 --
NM_004501chr143178 2994 1206 637 --1838 1864
NM_004503chr125637 622 604 549 78 ----1800
NM_004504chr283065 3046 2081 2057 907 885 225 134 ------
NM_004505chr1731949 1928 167 ----11833
NM_004519chr8148 ------
NM_004540chr211662 ------
NM_004586chrX95414 4251 4244 4207 3311 1378 509 453 427 15361 --24763 1087
NM_004598chr563139 2911 2620 806 182 68 --1676 --
NM_004612chr9134377 4229 4222 4195 4053 4001 3902 3053 1244 661 577 570 233 ------
NM_004627chr212656 551 ------
NM_004634chr31610 ------
NM_004690chr61316 --1118 1526
NM_004703chr1731997 949 516 ----1460
NM_004704chr3156 ------
NM_004726chrX145608 5450 4803 4725 4408 4265 3927 3635 2000 1390 1022 413 160 99 15784 ----
NM_004730chr542040 1981 743 301 11651 ----
NM_004737chr2211286 ------
NM_004744chr483706 3640 3469 3328 2962 618 110 27 13890 136 1158
NM_004745chr887013 6766 5693 2667 1160 1096 903 815 --11295 12094
NM_004748chr1553892 2735 1394 1122 523 13334 ----
NM_004772chr541497 478 36 21 --1442 21438 84
NM_004787chr4139 ------
NM_004788chr11112745 2678 2224 2128 2003 1867 1857 994 929 546 501 --1459 --
NM_004794chrX1124 ------
NM_004800chr131196 ------
NM_004815chr1124865 4031 3373 3234 1667 1574 1557 1225 595 223 137 97 21219 894 ----
NM_004844chr321023 375 --11107 --
NM_004849chr621601 326 ------
NM_004865chr61373 ------
NM_004866chr594777 4085 3484 3419 3357 3267 3058 1331 59 ------
NM_004869chr1831777 1680 1206 11088 31688 1194 568 11718
NM_004879chr111387 ------
NM_004904chr796302 5632 4878 4704 4326 4168 3994 3984 2102 --1283 16231
NM_004912chr751454 1169 1137 662 422 1464 --1552
NM_004956chr744531 4394 1064 97 23759 403 13357 21396 220
NM_004985chr12114280 3994 3867 3804 3665 3472 2918 1055 1011 856 364 12948 ----
NM_004992chrX98380 8260 7184 7166 6963 3258 2210 2055 1107 17120 28480 5494 --
NM_004992chrX98380 8260 7184 7166 6963 3258 2210 2055 1107 17120 28480 5494 --
NM_004999chr6104456 3687 3516 1750 1635 1504 1194 1015 863 200 13458 24518 467 --
NM_005011chr771839 1573 1219 321 315 291 275 1389 --1414
NM_005023chr54547 315 278 237 170 31509 1444 272 --
NM_005034chr82541 71 2498 221 ----
NM_005044chrX94589 3980 3616 3419 2785 747 400 391 134 --14161 --
NM_005054chr221206 130 11476 11784 21626 169
NM_005056chr1255588 4600 4350 4104 1781 15196 25205 1837 22238 140
NM_005065chr1485305 4005 3909 3629 1593 1363 1323 297 23958 1701 14051 15095
NM_005066chr11818 ----1232
NM_005086chr1231327 703 175 ------
NM_005087chr32832 187 ----1743
NM_005095chr152263 1956 1915 1670 1563 52112 1851 1818 318 83 --21654 1624
NM_005113chr141349 ------
NM_005120chrX1174 ------
NM_005121chr1783416 2980 2943 1230 1210 767 647 396 1468 --12782
NM_005133chr111401 ------
NM_005135chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_005156chr975314 5110 4878 4457 3730 1971 162 11578 11030 --
NM_005160chr22166797 6729 6615 6015 5652 5407 5355 5348 5206 5053 2332 1403 1390 1291 966 648 --11013 --
NM_005188chr11168012 7210 6772 6498 6433 6254 5924 5748 2810 2632 2369 2325 1421 526 426 392 21634 1497 12283 --
NM_005194chr201486 --1530 --
NM_005197chr1475915 5624 5573 5460 5346 4525 899 24824 1802 14904 15926
NM_005207chr2253572 2991 2943 743 179 ----13670
NM_005222chr72947 67 --1912 --
NM_005227chr11503 ------
NM_005231chr1111338 ------
NM_005233chr342380 2145 1829 936 12464 1904 --
NM_005235chr287403 7330 7005 6685 5759 4814 4796 1970 26800 3009 47192 6470 6375 4756 --
NM_005239chr2161867 1531 552 521 505 456 ------
NM_005254chr1541152 1040 1018 568 1383 --21304 438
NM_005259chr22962 455 ----11223
NM_005296chrX1240 ------
NM_005302chr72391 324 ------
NM_005308chr103410 379 371 ------
NM_005311chr782371 2309 2144 2116 2038 1068 426 384 22696 1998 11972 --
NM_005333chrX11237 --1272 --
NM_005339chr473348 3141 3103 3040 1190 1054 668 --22647 1396 1190
NM_005342chrX102771 2762 2613 1813 1767 1722 1023 920 800 209 --2576 391 --
NM_005359chr18174512 4219 4131 2112 1491 1482 1265 1205 1114 1082 853 775 765 650 509 426 344 1265 16476 --
NM_005382chr81108 ------
NM_005385chr352690 2563 1846 978 599 1275 --12653
NM_005387chr112566 461 ------
NM_005393chrX1242 ------
NM_005398chr1041199 968 344 63 ------
NM_005400chr283069 3048 2940 2756 1904 1220 1054 62 12233 1248 1851
NM_005407chr1411269 ------
NM_005410chr53607 585 533 ------
NM_005413chr22413 335 ------
NM_005418chr111233 ------
NM_005436chr1083722 3630 3608 3201 1340 1320 1269 998 --13962 13233
NM_005487chr2251937 1931 1767 599 54 22103 1962 1588 --
NM_005488chr221741 ------
NM_005493chr61675 ------
NM_005497chr1786120 5824 4865 4668 1043 755 348 297 24567 532 ----
NM_005502chr983215 2813 2794 2694 2389 1300 1015 210 --32763 2489 332 12429
NM_005504chr12116548 6522 6185 4129 2239 1652 1573 1052 936 837 691 --36258 1992 47 --
NM_005506chr452149 898 423 256 31 ------
NM_005509chr541506 642 611 576 1209 ----
NM_005513chr361530 1445 1081 515 421 236 ------
NM_005524chr31233 ------
NM_005526chr81275 ------
NM_005544chr22780 696 --1392 --
NM_005595chr11972 ------
NM_005596chr9136078 5943 5438 5430 5276 5257 5089 4607 4286 2014 1935 1888 1364 1687 23990 1711 --
NM_005613chr1102060 1955 1767 1748 623 539 527 456 444 77 11907 2515 501 --
NM_005618chr61556 ------
NM_005631chr711091 ------
NM_005639chr1271578 1338 320 313 276 263 232 --1346 11455
NM_005655chr831203 448 303 ------
NM_005668chr5104579 4395 4069 4033 3907 3811 3557 3541 3018 829 21661 246 14045 --
NM_005688chr331165 264 179 ------
NM_005725chr172304 2284 2261 1696 963 952 500 --12190 --
NM_005746chr782707 2459 2307 2077 1041 703 365 29 1389 ----
NM_005748chr1252870 2814 1194 758 415 1541 ----
NM_005751chr75324 184 168 125 79 1440 ----
NM_005756chrX31496 455 397 182 --1473
NM_005759chr254761 3990 1811 1077 248 34084 1128 462 44390 2924 341 275 --
NM_005783chr23561 161 128 ------
NM_005798chr1375274 5147 4269 1249 535 296 247 --15135 --
NM_005813chr262196 1680 773 692 450 252 --1969 22288 61
NM_005826chr16612 508 476 454 146 120 ------
NM_005828chr1785096 4696 3977 481 329 278 193 40 14629 24556 654 15042
NM_005840chrX137124 6151 5665 5098 4870 2946 2184 2000 1570 1001 813 629 521 47009 6938 4855 1693 --13031
NM_005853chr161224 --1242 --
NM_005871chr1051071 1054 851 755 313 --2888 765 --
NM_005875chr31303 ------
NM_005898chr1162540 2286 2206 1987 1144 876 12174 12026 22400 646
NM_005901chr18118654 7892 7433 6914 6669 2772 2563 1702 1694 1237 306 22297 911 28617 5324 --
NM_005902chr1594484 4424 3989 3584 3154 1611 1338 764 192 21509 1345 ----
NM_005903chr5145068 4975 4913 4645 4539 4322 3506 3224 2043 1160 950 485 172 144 ------
NM_005911chr211108 ------
NM_005955chr195402 4985 4730 4602 4257 3877 3737 3633 2013 25453 3506 1253 --
NM_005966chr262197 1875 1772 1760 730 240 2809 320 ----
NM_005977chr131286 ------
NM_005985chr204774 756 288 174 ------
NM_005996chr1241529 1337 576 383 ----11008
NM_006007chr9114461 3818 3427 3254 3167 1461 1398 1165 727 385 201 11194 ----
NM_006033chr1882293 2284 2229 2196 1984 1660 1644 735 21512 268 1377 --
NM_006036chr262103 1978 1950 1594 1031 874 12265 ----
NM_006037chr244242 4211 3985 3705 21540 1145 12968 21852 454
NM_006047chr2083229 2903 2819 2587 2393 2298 708 511 12668 43117 547 497 189 --
NM_006064chrX3322 103 56 ------
NM_006095chr4114392 3686 3220 2977 2939 1663 1049 1041 1014 811 150 23550 3338 --13674
NM_006136chr711296 ------
NM_006154chr1572709 2394 2186 1079 943 887 338 --12196 1297
NM_006160chr1711097 ------
NM_006178chr1731581 1433 1343 ------
NM_006195chr921277 169 --11230 11245
NM_006197chr852223 1870 1827 1601 201 --32283 1536 859 187
NM_006206chr462698 2641 2371 1045 393 382 1694 --11800
NM_006209chr8263 42 --1323 --
NM_006211chr82283 103 ------
NM_006212chr1175409 5379 5051 4864 4833 4520 4505 4410 4353 4289 3990 3549 1969 1690 1463 1321 39 ------
NM_006216chr21670 ------
NM_006218chr31282 ------
NM_006223chrX1130 ------
NM_006243chr141084 937 167 43 --1354 --
NM_006246chr1431337 1174 80 1460 1136 --
NM_006247chr191129 ------
NM_006251chr5113308 3116 2454 2307 2285 2190 1349 1301 1234 820 215 12759 12786 --
NM_006252chr1147052 6851 5599 5262 3011 2965 2239 1827 1804 1545 1498 1369 918 411 ----11353
NM_006256chr172721 2558 2427 1866 970 950 516 --32622 2183 778 --
NM_006283chr864760 4495 4376 4327 1964 528 11734 23493 1703 14312
NM_006287chr272617 2559 1858 1026 472 247 149 12350 ----
NM_006298chr6112464 2306 2154 2140 2090 958 714 580 482 465 415 ----12626
NM_006306chrX84446 4439 2180 1854 539 337 331 316 35345 5168 1870 55898 3927 3663 1736 1406 --
NM_006315chr454162 3953 2774 1147 565 34058 3866 134 11760 11739
NM_006325chr121342 ------
NM_006328chr111635 ------
NM_006333chr22683 623 --1457 --
NM_006363chr203469 238 152 ------
NM_006364chr143472 311 113 ------
NM_006372chr64495 387 371 115 ------
NM_006375chrX21380 365 ----1448
NM_006379chr762159 2087 1991 1830 831 388 31701 500 167 --12264
NM_006393chr1044027 3614 1477 978 --12821 14122
NM_006420chr2043234 2813 2739 1066 43435 3359 3226 1246 1370 --
NM_006425chr531599 623 429 ------
NM_006427chr141132 ------
NM_006434chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_006457chr484035 3443 3403 3043 1017 824 422 214 13988 ----
NM_006467chr552224 1589 1472 303 68 1253 1680 --
NM_006471chr181105 ------
NM_006482chr1283752 3701 3126 3059 1545 757 248 116 11395 33845 3742 864 --
NM_006496chr131899 1755 151 11465 ----
NM_006497chr171767 ------
NM_006504chr1092957 2889 2788 2672 2538 2027 640 620 108 12717 ----
NM_006526chr2071854 1806 1564 1506 558 524 450 31914 845 172 1859 --
NM_006534chr2073064 2553 2273 1096 1010 993 467 --1215 --
NM_006538chr294066 3965 3760 2864 2816 2696 2633 842 382 23851 281 14014 --
NM_006544chr1464846 4317 3820 2319 2259 761 25841 2402 15597 --
NM_006546chr1756510 6465 4600 1621 1200 ------
NM_006561chr1075912 5062 4504 3973 3890 2405 777 46120 4054 1316 1180 11786 --
NM_006572chr17103193 3178 2674 2585 2380 2345 1130 943 584 550 11141 23431 1379 --
NM_006585chr212108 36 ------
NM_006599chr16148244 8092 7732 7256 7079 6850 6838 6125 2439 2277 1971 1406 1259 108 37149 6948 5348 25851 560 --
NM_006601chr123711 184 108 ------
NM_006603chrX41910 1855 1347 774 --11684 --
NM_006614chr353634 3614 3596 2601 1096 11072 ----
NM_006626chr931879 847 34 1530 ----
NM_006628chr15114665 4419 4068 1217 761 492 392 377 345 239 157 1854 ----
NM_006629chr1842601 2595 2220 706 1987 --12236
NM_006633chr5131 ----1552
NM_006646chr1353025 2255 1984 926 337 1108 --1170
NM_006650chr593801 2824 2537 1521 1433 1308 1293 1221 1147 33916 3359 1406 11391 --
NM_006654chr1284111 4014 3912 3770 3245 1398 923 585 33835 3751 3259 ----
NM_006660chr15123 ------
NM_006717chr993287 3184 2870 2560 2362 915 418 395 386 32516 1109 184 12750 --
NM_006720chr10124988 4925 4448 4014 3990 3947 3738 3287 3108 1784 1250 266 11557 13839 --
NM_006722chr32967 176 --33007 2990 2046 --
NM_006726chr451055 1033 996 863 423 1969 ----
NM_006729chrX51826 1415 1117 1099 241 31568 1108 351 14905 --
NM_006735chr72311 286 ------
NM_006738chr1594322 4107 3734 3164 3005 1729 1619 1096 926 24511 690 24490 419 --
NM_006745chr431083 1053 1022 ------
NM_006750chr16137965 7837 7261 6659 6181 5757 5692 5093 2608 2444 2118 1625 543 18051 ----
NM_006772chr611297 ------
NM_006775chr652807 2704 2640 2138 447 12398 2868 818 --
NM_006777chrX42744 2219 1821 431 2903 505 ----
NM_006785chr1892246 1703 1405 1395 652 335 258 244 95 --1576 --
NM_006790chr52430 86 ------
NM_006804chr171537 ------
NM_006823chr861289 1270 498 479 466 242 ----21335 1007
NM_006827chr1442655 1259 691 656 43386 1361 954 863 --13235
NM_006838chr1241809 1309 1262 1209 --11746 11407
NM_006857chr24826 722 70 63 ------
NM_006868chr1883170 2930 2479 2458 2212 2094 331 303 1229 --12467
NM_006873chr263108 2969 774 609 167 130 --12479 12814
NM_006885chr1672654 2642 1290 950 933 825 332 11432 21443 396 --
NM_006888chr1483518 3248 3110 2977 2340 1315 610 354 ------
NM_006918chr1195894 5758 5016 3620 1902 1782 1127 273 244 --14030 --
NM_006920chr231987 807 347 ----1183
NM_006924chr1764244 3286 2889 874 183 38 23068 256 ----
NM_006925chr141190 ------
NM_006939chr1431165 769 747 ------
NM_006956chr782294 2283 1905 938 786 609 574 238 2821 440 ----
NM_006996chr151594 556 482 352 302 --21878 1823 --
NM_006997chr102149 117 ------
NM_007005chr931521 516 371 21310 487 1469 --
NM_007006chr1683274 3188 2962 2657 2246 1086 839 420 13468 ----
NM_007007chr12134823 4441 3891 3827 3390 3289 3259 3079 1760 1498 1164 1096 225 3847 786 442 11784 --
NM_007015chr131281 ------
NM_007017chr51567 ------
NM_007019chr201155 ------
NM_007034chr121015 204 1100 --190
NM_007038chr2185931 5229 4190 4110 2374 1091 877 731 55530 4397 4371 3994 945 25762 5384 --
NM_007045chr61536 ------
NM_007054chr5103957 3942 3927 3909 3709 3040 2811 1139 797 374 23920 300 23847 331 --
NM_007068chr224241 213 207 186 11022 1296 --
NM_007073chr693340 3103 2956 2658 1269 1033 979 767 739 23070 2893 ----
NM_007106chr1342668 2144 1017 205 ------
NM_007111chr131325 ------
NM_007124chr652004 1820 1814 299 129 1293 1640 --
NM_007125chrY71409 1126 963 913 432 324 225 1932 ----
NM_007146chr17102863 2778 2698 2536 2388 1817 1054 1017 456 175 22363 2335 ----
NM_007166chr1161316 585 544 380 368 336 11176 ----
NM_007175chr873554 3323 3292 3155 1121 1052 603 --11318 12573
NM_007200chr1594322 4107 3734 3164 3005 1729 1619 1096 926 24511 690 24490 419 --
NM_007212chr172269 1827 1644 811 782 431 318 22212 1891 ----
NM_007249chr13159392 9279 9075 9068 9059 8309 8166 8005 6971 6621 6438 3673 2382 1424 262 19349 29338 7284 17447
NM_007279chr191639 ------
NM_007308chr41529 ------
NM_007345chr1892320 1979 1954 1789 1597 1591 1490 726 333 22292 1695 ----
NM_007357chr13490 408 210 ------
NM_007372chr172738 317 ------
NM_012073chr531445 209 200 ----1168
NM_012081chr5113449 2801 2498 1502 1356 1343 1045 659 569 541 362 --1763 --
NM_012082chr86969 661 650 390 298 286 --2619 321 --
NM_012089chr131109 561 242 1135 --1401
NM_012095chr1063466 2992 1271 736 611 210 13446 ----
NM_012096chr353503 3268 3089 841 328 23746 1069 ----
NM_012097chr282182 1838 699 618 609 470 463 262 22103 34 ----
NM_012104chr11------23825 499
NM_012104chr11------23825 499
NM_012110chr41272 ------
NM_012115chr62489 481 3602 573 457 1507 1559
NM_012120chr682960 2859 2348 2299 774 496 457 311 32574 2458 1066 ----
NM_012124chr114739 348 296 53 ------
NM_012130chr212232 110 ------
NM_012141chr1333864 772 423 ------
NM_012177chr65596 564 544 469 77 ------
NM_012193chr1175436 4383 4255 4124 4096 3728 1939 ----11017
NM_012207chr103932 815 80 ----1855
NM_012214chr2116389 6202 5782 5426 5082 3881 2541 1790 1140 768 166 55265 4729 3944 1006 806 34959 4885 759 --
NM_012219chr333232 2341 775 1847 --13211
NM_012223chr241230 1222 1154 82 21047 993 1273 21315 930
NM_012233chr271047 977 947 812 473 242 169 ----11150
NM_012234chr333199 2731 1028 23465 3291 12335 13316
NM_012252chr774853 4671 4530 4126 1974 753 70 34422 4084 516 ----
NM_012257chr751057 767 745 412 321 ------
NM_012262chr1105150 4200 4078 3435 2047 1242 1069 455 111 98 ----23824 3590
NM_012281chr762294 2279 964 931 766 453 --12323 --
NM_012287chr3124538 4425 3729 3505 3364 3178 1267 1090 1049 739 621 50 34381 3307 630 13044 --
NM_012294chr744047 3938 3631 26 --33953 3917 3577 23563 2968
NM_012301chr742080 2046 1866 739 ----12200
NM_012309chr1164787 4774 4535 4361 3391 1899 13268 ----
NM_012316chr163528 1482 1162 1123 936 589 ----1426
NM_012319chr182121 73 1647 2269 204 1814
NM_012328chr731371 1282 1019 ----1452
NM_012330chr1051806 1739 1302 1146 424 11120 21538 152 --
NM_012333chr151135 531 427 300 60 144 21628 397 --
NM_012388chr1583009 2976 2887 2638 2514 2288 894 132 ------
NM_012399chr2261663 1592 769 263 194 184 11972 1218 --
NM_012434chr661172 1157 632 177 113 73 180 --1464
NM_012449chr7167 ------
NM_012464chr452840 2740 927 523 440 11944 ----
NM_013229chr1272763 2745 2686 2676 742 502 355 ------
NM_013232chr51413 ------
NM_013233chr21467 --11162 --
NM_013243chr1531094 213 194 ------
NM_013246chr112942 875 --169 --
NM_013255chr7158836 8352 7104 6210 6188 3468 3053 2583 2475 1673 1450 567 561 543 519 26369 1285 18701 --
NM_013263chr161150 ------
NM_013269chr1243586 3291 3109 1574 --24483 3010 13255
NM_013281chr2041313 521 350 256 ------
NM_013322chr731278 402 368 ----1189
NM_013374chr373151 3095 2478 2079 955 775 556 2989 126 --11145
NM_013381chr1272105 960 708 681 671 606 373 22200 936 1640 --
NM_013390chr931581 1426 208 1307 ----
NM_013396chr2131435 1243 462 1218 1372 131
NM_013436chr23811 326 128 1608 --2685 518
NM_013438chr93608 475 170 --11536 --
NM_013448chr143718 628 573 1737 --176
NM_013943chr173303 2587 2360 1178 1127 491 92 --22777 324 --
NM_013958chr81136 ------
NM_013959chr81136 ------
NM_013961chr81136 ------
NM_013962chr81136 ------
NM_013989chr14105131 4667 4294 3551 3287 3222 1689 1209 998 987 11911 ----
NM_014000chr1061985 1625 1537 1512 789 210 ----1201
NM_014021chr162809 969 763 486 387 240 --23009 951 --
NM_014023chr1092739 2701 2267 1817 426 341 207 200 120 --22524 2461 --
NM_014034chr611320 ------
NM_014048chr1675201 5110 3986 907 786 770 574 11430 ----
NM_014051chr62435 70 ------
NM_014059chr132365 249 ------
NM_014154chr331548 488 343 21563 649 --11274
NM_014155chr11157292 7286 7060 6930 6330 5961 5697 5242 4935 2741 2500 2399 2186 2054 1051 21826 708 27304 1937 15843
NM_014241chr101104 ------
NM_014250chr2251937 1931 1767 599 54 22103 1962 1588 --
NM_014253chrX62430 2009 765 679 592 68 --32165 658 95 --
NM_014267chr113623 89 24 1208 ----
NM_014278chr41456 ------
NM_014294chr811080 ----11041
NM_014305chr132627 589 1547 --1130
NM_014309chr2275330 5215 4674 4617 4387 2084 1844 25348 5046 1287 --
NM_014319chr12141646 1500 1392 1359 723 709 699 693 683 575 553 391 290 89 31906 585 542 ----
NM_014333chr1142763 2750 2452 784 12610 --1149
NM_014335chr1521124 575 --21108 1065 --
NM_014345chr65991 829 806 405 334 ------
NM_014393chr872369 2351 2221 928 846 700 575 12290 21806 59 --
NM_014395chr431814 1398 1358 ------
NM_014399chr74999 313 300 236 1660 2958 378 --
NM_014417chr191944 --1871 --
NM_014423chr5125660 5583 5496 5000 3683 3534 2240 1321 1196 951 648 46 13543 25425 3987 --
NM_014426chr201702 ------
NM_014445chr342352 2338 1903 1826 21837 368 ----
NM_014447chr441664 1389 382 242 11024 11564 --
NM_014455chr13445 181 62 ------
NM_014458chr131187 37 23 11408 ----
NM_014498chr32303 132 ------
NM_014552chr231515 1470 1197 ------
NM_014563chrX82100 1909 1600 753 421 103 59 45 ------
NM_014574chr1461522 1490 1245 638 368 188 11321 21530 1027 --
NM_014607chr222113 1966 ------
NM_014608chr151173 ------
NM_014615chr1653567 3426 3261 2688 820 --2789 684 --
NM_014620chr121535 ------
NM_014633chr111134 1544 --1465
NM_014637chr821434 275 ----1352
NM_014671chr721572 1463 11323 ----
NM_014676chr171647 1541 1436 1104 1067 309 247 11591 11607 --
NM_014682chr862336 2260 2227 2104 1869 561 ----11478
NM_014683chr1762024 1855 1574 1449 746 681 11541 1619 11404
NM_014686chr19132549 2509 2351 2315 2130 2023 1968 1904 1882 1837 1753 458 351 ------
NM_014701chr1563368 2545 2102 1225 483 198 23067 814 13140 --
NM_014702chr653082 1171 463 399 252 12780 ----
NM_014705chr752052 1723 1455 672 349 11495 --11924
NM_014707chr752253 2190 1846 544 112 21975 668 11541 --
NM_014713chr21504 ------
NM_014721chr6107276 6903 6851 5027 4841 4738 2495 1302 1189 165 37097 7008 2275 12679 26617 5771
NM_014729chr83896 890 731 31816 782 745 --11986
NM_014733chr571609 826 776 606 435 391 275 1511 ----
NM_014739chr654168 3606 3095 3015 713 13127 44124 3879 436 173 --
NM_014746chr254136 3565 3283 1672 854 34239 4104 3757 33706 2891 678 --
NM_014755chr264194 3219 3176 3138 1304 718 --1450 13079
NM_014764chr1211221 ------
NM_014803chr1072654 2536 2035 981 677 157 132 21805 163 ----
NM_014813chr11550 ------
NM_014824chr1152004 1815 1735 1372 796 12017 ----
NM_014827chr171628 1566 1417 1154 490 480 358 11463 1143 --
NM_014829chr532227 802 45 --11745 --
NM_014830chr1273821 3482 2837 2598 1518 1037 122 11547 12374 --
NM_014838chr2252330 1903 1808 1793 389 32777 2368 874 193 --
NM_014840chr1223374 424 ------
NM_014841chr681341 1261 1238 1063 1042 425 349 232 1142 ----
NM_014844chr1434152 3442 1075 ------
NM_014847chr14532 500 199 181 ------
NM_014859chr1711168 ------
NM_014862chr1584169 4123 953 657 249 238 229 134 14178 ----
NM_014873chr164598 3464 1372 829 688 643 14433 ----
NM_014877chr17167161 7087 7071 6903 6074 5671 4968 2959 2819 2808 2285 1691 651 444 247 48 46491 2648 880 583 --21872 1767
NM_014892chr61163 ------
NM_014897chr1753171 2633 587 532 414 --1423 --
NM_014903chr1232445 1552 1529 12080 12228 --
NM_014904chr1063938 3412 3077 2878 1627 500 33999 3983 3419 ----
NM_014912chr1033321 2680 2615 12977 ----
NM_014917chr12751 700 --1612 --
NM_014920chr653536 3141 3113 782 263 33319 2569 206 ----
NM_014923chr1372336 2214 2186 1853 1698 818 66 22088 825 11663 --
NM_014932chr341659 1388 428 162 ------
NM_014935chr123885 2538 13902 ----
NM_014936chr682848 2616 2363 2263 1083 493 439 310 22878 2531 ----
NM_014949chr12890 366 11002 ----
NM_014953chr1394113 3754 3429 1642 1390 1309 775 525 156 11349 24173 1584 1796
NM_014962chr2032849 2333 1088 22896 915 22233 928 --
NM_014969chr131148 1087 473 1955 11122 --
NM_014982chr1473934 3468 3399 1596 1186 859 724 14552 23431 2087 13984
NM_014991chr493202 2990 2837 2519 2227 1171 829 621 419 12807 12875 --
NM_014992chr147652 258 235 172 154 148 136 ------
NM_014996chr35704 324 231 164 115 ------
NM_015000chr1262631 2312 1158 1055 755 309 22961 2568 1733 --
NM_015009chr3187 ------
NM_015018chr6293 74 ------
NM_015026chr1284073 3996 3846 3177 2982 1302 1117 313 33806 1566 505 --1527
NM_015032chr1392319 2027 1067 884 829 525 421 415 304 12458 12696 12531
NM_015033chr973301 3207 2634 2407 1329 1127 766 ------
NM_015040chr233313 3175 2199 12605 1106 12926
NM_015046chr972501 2457 2161 955 316 309 203 ------
NM_015049chr282616 2386 2229 2213 2168 935 702 666 12397 12873 11251
NM_015057chr13----1523 1551
NM_015074chr184944 4877 4602 3725 3626 3219 3213 93 1365 24907 4261 --
NM_015076chr694244 4036 3471 2907 1531 1167 1091 935 405 13892 14130 --
NM_015092chr1654553 3975 3002 1790 370 24668 4490 --11411
NM_015097chr361815 1715 1649 1567 819 143 1324 --11674
NM_015100chr131250 380 287 ------
NM_015115chr482946 2667 1231 277 255 204 166 76 42936 2255 641 287 ----
NM_015137chr8102597 2250 1842 1832 1719 1689 1035 993 917 84 --12313 1351
NM_015138chr1552222 1776 871 657 594 22043 609 1158 22272 786
NM_015158chr95757 723 666 619 82 --1206 --
NM_015176chr131356 1318 1293 ----11497
NM_015192chr2072803 2566 2277 2162 1010 646 225 12349 12550 12452
NM_015208chr1883138 2549 1259 1245 867 769 681 660 ----1573
NM_015215chr152900 1182 1173 1127 349 --11016 --
NM_015230chr471461 407 349 332 226 161 45 3339 238 62 ----
NM_015231chr113900 234 110 --2886 852 --
NM_015238chr52256 247 ------
NM_015247chr1695402 4860 3927 3875 3683 3412 1999 1242 553 13947 13969 --
NM_015250chr941793 1362 688 491 --21758 233 11313
NM_015265chr241859 418 412 404 ------
NM_015269chr14611 568 216 207 ------
NM_015271chr484297 4193 4066 2802 2622 1124 679 177 33976 3765 1690 ----
NM_015272chr1662091 1943 720 681 155 90 --12082 --
NM_015278chr653103 3097 2139 928 880 32845 2293 1074 33341 3220 314 --
NM_015285chr1872581 2368 2350 1947 1913 1667 509 --22552 2464 12437
NM_015291chr183478 2671 1158 1039 1008 799 560 321 ------
NM_015308chr115871 840 775 134 28 ------
NM_015310chr8108384 8272 8209 8134 7672 6307 5356 5242 2155 135 48244 6268 3219 2933 12170 --
NM_015313chr1174850 4701 4508 3979 1911 1754 277 24228 926 13855 --
NM_015314chr772601 2560 2481 2467 2243 1662 46 ------
NM_015317chr292794 1796 1026 827 689 535 430 274 165 32842 2805 1822 21759 260 --
NM_015323chr661706 1671 657 457 391 149 ------
NM_015326chr152903 2843 845 734 533 12858 --1913
NM_015328chr773089 2393 2203 1976 1239 1081 125 ------
NM_015335chr1292367 2134 1659 1649 1615 561 416 346 253 11772 1362 12150
NM_015338chr2041589 1549 42 28 11651 21941 73 --
NM_015339chr2041047 1016 699 394 1988 --1855
NM_015342chr51123 ------
NM_015344chr822058 1522 --1526 --
NM_015349chr672911 2882 2690 2391 1965 958 874 ------
NM_015358chr2131130 1019 124 1522 11180 --
NM_015361chr22365 298 ----1906
NM_015375chr1104786 4511 3194 3080 1805 1524 1505 1021 1013 995 21849 247 24996 321 15033
NM_015385chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_015387chr261999 1495 1482 804 526 121 --31936 177 54 --
NM_015429chr341110 458 380 274 199 1791 --
NM_015443chr1711362 ----21401 1058
NM_015455chr543793 2629 520 458 11063 --13979
NM_015458chr8104967 4835 4660 2067 1841 1390 1109 920 318 44 15244 35026 4945 1338 25092 153
NM_015461chr184190 130 111 92 --1699 --
NM_015507chrX3443 187 30 1148 ----
NM_015514chr142519 480 ------
NM_015525chr61898 1159 1927 1870
NM_015530chr22213 156 ------
NM_015534chr141036 923 813 717 --11055 1757
NM_015548chr64954 713 694 135 ----1161
NM_015554chr154833 801 561 474 11144 ----
NM_015555chr631357 698 159 ----11779
NM_015560chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_015569chr1154841 4794 4244 4225 3960 3508 3291 3271 3265 3242 3231 3155 1589 1470 243 23937 1700 54148 3113 3080 1497 997 --
NM_015571chr682433 2294 2219 2068 2043 1878 986 797 2501 121 --1834
NM_015575chr263552 3513 3318 3076 3019 221 43671 1031 918 908 ----
NM_015576chr392671 2544 2527 2116 2096 1171 1141 872 552 12944 11150 --
NM_015578chr1992003 1676 1475 718 653 442 385 341 256 12107 --1663
NM_015630chr23374 201 152 ------
NM_015640chr1125161 4946 4901 4798 3858 3327 2039 966 506 334 279 205 44877 4504 4444 912 23738 1456 --
NM_015641chr761271 1173 1016 949 803 224 1384 11217 --
NM_015646chr1221075 343 41303 1218 933 301 1318 --
NM_015678chr1341473 1361 1232 1217 2616 487 ----
NM_015702chr22215 35 ------
NM_015850chr842166 1755 1736 139 1655 1626 1918
NM_015886chr895744 5672 4887 4015 1405 364 342 232 54 44915 1616 1308 136 13605 15692
NM_015888chr1123406 3104 3068 3049 2770 2588 2442 902 878 528 321 294 ------
NM_015891chr641962 1616 732 535 12036 ----
NM_015902chr83893 694 359 ----128
NM_015906chr1114785 4672 4072 4008 3800 3752 3044 1812 1508 1045 958 24688 946 13292 --
NM_015934chr21220 ------
NM_015949chr71738 ------
NM_016009chr184828 4527 4311 3926 1260 872 834 41 21975 1337 ----
NM_016019chr71397 ------
NM_016075chr1372565 2288 2256 1994 1983 1171 618 159 1670 --
NM_016076chr192957 2898 2842 2060 2041 1144 377 289 93 22738 2602 ----
NM_016081chr442142 1708 840 519 --21814 561 --
NM_016083chr693767 3688 3588 3414 1507 1092 1067 914 451 23276 2970 13267 13757
NM_016096chr882056 2049 1911 1766 1664 1510 730 593 1277 --1177
NM_016125chr175564 500 472 204 170 ------
NM_016127chr83224 200 147 ------
NM_016132chr1573272 2949 2227 1028 926 328 82 ------
NM_016156chr1111938 --12291 1888
NM_016195chr104210 167 82 64 --1831 --
NM_016206chr3108776 8675 7558 6814 6401 5884 2349 2117 1286 721 38325 5787 5512 --17328
NM_016226chr123399 338 88 ------
NM_016248chr1373489 2782 1377 1351 314 226 163 33086 1390 724 23571 1359 13818
NM_016255chr633346 3331 2337 --11214 12094
NM_016260chr2157440 7407 7374 7328 7246 7143 6781 5986 5122 5094 4752 2869 2795 2547 2315 37398 5766 1448 37619 7434 7387 25569 5107
NM_016262chr61567 ------
NM_016270chr192390 367 ------
NM_016271chr1872242 933 913 891 821 527 92 11437 ----
NM_016275chr362067 1792 1018 657 595 587 12437 22273 226 --
NM_016277chr631216 1165 636 ----1516
NM_016287chr131727 1293 251 ------
NM_016303chrX3397 301 156 ------
NM_016315chr241857 1619 319 44 21565 482 ----
NM_016319chr121747 ------
NM_016322chr922090 1232 32399 2208 658 33151 1060 695 --
NM_016351chr71618 ------
NM_016357chr1241116 912 445 302 ------
NM_016374chr141164 1133 1084 360 31102 1048 484 21265 345 --
NM_016374chr141164 1133 1084 360 31102 1048 484 21265 345 --
NM_016376chr1784245 4067 3639 2978 2946 1648 1547 539 21589 1479 11118 13797
NM_016396chr1552950 2799 2586 629 499 13019 12710 11063
NM_016422chr1152931 2861 2695 2190 243 ----1638
NM_016436chr2062712 2706 2573 1748 1009 603 --12656 --
NM_016441chr222239 97 --11640 --
NM_016442chr552198 2036 1950 1442 615 2471 202 --12222
NM_016447chr71220 ------
NM_016485chr652084 2078 316 297 130 --1899 --
NM_016513chr653536 3141 3113 782 263 33319 2569 206 ----
NM_016525chr91872 ------
NM_016526chr1172477 2239 2130 1893 884 747 304 --1863 --
NM_016531chr4114129 4075 3011 3005 2570 1158 1122 1072 801 691 666 24149 3474 13088 --
NM_016542chrX71684 1478 1418 1184 643 592 226 ----11520
NM_016561chr161126 ------
NM_016569chr1241529 1337 576 383 ----11008
NM_016584chr121257 ------
NM_016603chr562214 1688 1606 478 65 41 --22156 1826 --
NM_016621chr1154602 4508 4022 1232 187 ------
NM_016654chr1541152 1040 1018 568 1383 --21304 438
NM_016656chrX3322 103 56 ------
NM_016819chr31558 ------
NM_016820chr3173 ------
NM_016824chr1061855 1681 1670 1207 751 737 11874 ----
NM_016946chr193277 2838 2422 1134 1118 1052 1011 595 408 13063 11066 --
NM_016952chr1194010 3354 3311 3052 3015 857 727 610 75 --12557 --
NM_016953chr2116016 5757 5742 5729 5641 4791 4495 2071 1053 473 373 --14898 15613
NM_017415chr5144595 4337 4328 3974 3713 3627 3313 2934 1752 1458 1092 639 413 321 24287 2925 24459 1763 --
NM_017420chr14103754 3640 3500 3442 3209 3062 3037 2676 697 338 --23563 3198 --
NM_017423chr442241 1662 754 689 12146 32126 622 102 --
NM_017426chr43455 259 222 ------
NM_017440chr122550 64 1583 1505 1637
NM_017447chr2174367 4025 3486 3356 3248 1003 466 13480 24389 484 --
NM_017489chr82534 179 ------
NM_017519chr631219 320 197 1203 11022 --
NM_017548chr321456 669 --1637 12106
NM_017599chr1281978 1862 1668 1620 761 586 436 386 ------
NM_017610chr155470 256 236 223 164 1440 31965 1424 510 --
NM_017615chr10170 ------
NM_017628chr474037 3815 3621 1525 903 860 221 --1638 --
NM_017632chr4295 62 ------
NM_017633chr672917 2811 1142 1077 1043 1014 327 33260 1025 971 ----
NM_017637chr9149440 9328 8634 8196 8104 7411 6990 6336 3048 2963 2612 1367 567 127 2928 849 19222 --
NM_017641chr124955 177 166 50 11029 --1986
NM_017643chr1773090 2981 2672 2041 1110 905 218 12546 12879 1625
NM_017644chr395213 5166 5070 3950 3835 3643 2051 1558 340 24600 1292 1352 --
NM_017650chr7175728 5558 5381 5342 5161 5140 4932 4861 4770 4722 2288 2184 2110 1603 814 249 135 ------
NM_017658chr1464625 4594 4496 1506 1106 682 24250 3380 14366 --
NM_017660chr1933404 3291 2424 ------
NM_017666chrX42221 2130 1480 856 ------
NM_017669chrX3309 237 22 ------
NM_017672chr1551339 1211 261 104 56 ------
NM_017693chr131156 ----161
NM_017719chr392349 2309 2292 2115 2010 1955 1884 1785 777 22511 2262 12303 1811
NM_017769chr1473059 2781 2413 2373 1005 891 274 11086 32207 1160 913 --
NM_017778chr831124 932 496 --21052 360 --
NM_017798chr2021168 1154 ------
NM_017813chr8165517 5103 4800 4751 4704 4102 3902 2231 2113 1503 1344 1265 998 643 508 385 25637 3834 25461 4302 --
NM_017831chr1874062 3000 2926 1832 1475 1361 485 --1316 1380
NM_017848chrX94387 3111 1731 1038 1026 1018 938 924 836 ------
NM_017896chr2063484 3448 3372 3148 2638 634 ----13404
NM_017902chr10135224 5144 4706 3992 3879 3714 3698 1997 1538 873 851 357 298 13915 ----
NM_017907chr111449 ------
NM_017913chr91421 ------
NM_017919chr965628 5387 2181 2014 314 221 23597 796 23814 2247 --
NM_017922chr142597 93 ----1124
NM_017925chr971380 1343 1329 1222 763 743 736 1728 1753 --
NM_017938chrX52150 2011 289 67 44 ----12125
NM_017943chr141678 1797 --1841
NM_017954chr741153 450 243 117 1519 --1357
NM_017958chr252896 2592 646 359 44 11991 12092 22869 2047
NM_017964chr21622 ------
NM_017988chr123932 738 157 ------
NM_018009chr121108 ------
NM_018017chr1062669 2377 2163 726 262 210 32103 823 497 22657 169 --
NM_018036chr14124320 4129 4121 3569 3471 3234 3048 1565 1219 615 606 336 34184 3224 661 ----
NM_018048chr1241544 643 111 26 21994 720 ----
NM_018056chr11122 ------
NM_018078chr42695 403 ------
NM_018084chr262796 2779 2601 2435 1047 844 1449 ----
NM_018092chr1681482 1370 1342 1264 1249 570 135 38 ------
NM_018155chr393419 3278 2389 2310 2221 2156 1248 551 342 32347 1314 1080 ----
NM_018157chr12113239 3225 3172 3026 2370 1284 1165 927 729 587 162 1525 11155 --
NM_018181chr1891800 1746 1731 1342 1277 1270 369 246 200 ----11442
NM_018202chr13773 112 97 ------
NM_018241chr41160 ------
NM_018243chr473938 3685 3537 1351 1285 988 292 ------
NM_018247chr652651 1181 1044 368 329 32924 494 404 22339 362 --
NM_018257chr2082547 2306 2200 2136 1943 1817 397 67 3808 437 184 12450 --
NM_018298chr14879 830 731 42 --1279 1336
NM_018312chr1162175 2121 764 591 355 231 ------
NM_018313chr332632 2586 262 --22139 2110 21780 1032
NM_018323chr451787 1296 233 214 127 ------
NM_018330chr1051622 1422 571 460 317 ------
NM_018332chr1611356 ------
NM_018339chr95705 358 351 341 49 1268 --11415
NM_018351chr1274680 3055 2941 2904 879 504 302 183 1296 --
NM_018361chr893981 3705 2746 1570 1314 1184 563 479 296 23626 3141 ----
NM_018362chr1153912 3743 3725 3341 1427 14069 ----
NM_018364chr1113892 3526 3414 3365 1626 1620 1599 1504 1019 610 184 ----11544
NM_018370chr1232353 1583 155 ----1445
NM_018374chr785279 4225 4154 3419 1898 1788 666 173 25230 1996 --12022
NM_018403chr373992 3869 3811 3723 3561 3296 2646 --14034 --
NM_018429chr562812 2464 1988 1926 737 366 12359 11865 1331
NM_018434chr51147 ------
NM_018440chr8107995 7637 5977 5623 3219 3092 2912 1916 1126 957 27721 2885 1320 --
NM_018464chr101305 ------
NM_018553chr1721527 1247 ------
NM_018557chr241266 671 185 58 136 --128
NM_018566chr165131 4807 3753 3249 1937 1302 25108 765 ----
NM_018638chr12115219 4957 4614 4544 4445 4439 1652 1279 1237 734 281 11888 22258 1342 --
NM_018640chr1252748 2572 428 372 291 21009 944 2412 157 --
NM_018650chr162040 1826 1640 326 295 233 1267 --11812
NM_018682chr73627 502 132 1106 150 1265
NM_018685chr71155 ------
NM_018695chr561934 1910 826 321 274 263 --11784 --
NM_018698chrX41944 1872 1618 1578 ----11901
NM_018704chr11146 22095 777 11839 2836 117
NM_018712chr1151305 338 331 317 105 21499 1043 1991 --
NM_018841chr173935 3378 2404 1032 642 477 457 --33300 573 427 --
NM_018844chr762084 2029 486 190 133 32 1708 11674 --
NM_018945chr663599 3589 3547 3537 3199 2316 --11054 1861
NM_018951chr721232 477 ----11110
NM_018975chr162817 537 ------
NM_018976chr12112881 2784 2599 2567 2452 2416 2025 1964 1110 949 309 --1190 --
NM_018979chr1232114 817 806 1850 12335 --
NM_018993chr2031425 1286 299 11131 --21488 1332
NM_018999chr1063911 3501 1890 1462 1209 1078 --14876 --
NM_019001chr374426 3529 1799 1431 848 838 211 33954 1618 111 1173 --
NM_019004chr752161 2052 1706 870 276 --11882 --
NM_019024chr25448 299 102 65 23 ------
NM_019027chr462597 2126 2046 550 278 260 11830 ----
NM_019028chr111380 ------
NM_019035chr441653 188 145 35 2384 224 1123 --
NM_019042chr741179 1166 817 124 ------
NM_019044chr294594 4554 4546 4460 4453 4319 1431 312 306 --24304 23 --
NM_019046chr101167 ------
NM_019071chr72782 167 ------
NM_019072chr563879 3062 1663 654 296 143 13965 --23821 2629
NM_019074chr1511000 ------
NM_019114chr992516 1989 1750 1633 1615 1604 945 493 284 1361 ----
NM_019593chr2062690 2426 1087 1040 959 485 1680 ----
NM_019610chr122188 1526 ------
NM_019852chr141109 ------
NM_019903chr1061855 1681 1670 1207 751 737 11874 ----
NM_020122chr295950 5614 5528 5108 656 619 314 122 39 11143 35551 2221 2170 --
NM_020132chr2185090 4663 4572 4413 4168 4112 3178 1075 1671 14618 14006
NM_020190chr12449 297 ------
NM_020193chr113428 386 66 1982 ----
NM_020194chr22191 88 ------
NM_020229chr111149 ------
NM_020242chr31454 ------
NM_020245chr6104952 4586 4233 4225 3884 3861 3462 3440 556 378 24441 1354 --13335
NM_020317chr13311 298 232 ------
NM_020337chr472562 2077 1136 465 450 378 220 12972 12996 --
NM_020338chr1063659 3080 3019 1457 674 199 13383 33632 3566 3304 --
NM_020340chr641759 660 641 188 ------
NM_020341chr2021796 504 ------
NM_020342chr272607 2299 2163 1042 701 652 597 --21607 72 --
NM_020345chr34754 733 97 25 1316 --1368
NM_020357chr351452 1185 1177 1155 433 --11383 --
NM_020381chr631593 1282 701 ----11938
NM_020390chr354916 4326 1553 1091 307 1185 24144 463 --
NM_020395chr4123 ------
NM_020420chrY51325 724 602 287 212 ----21255 205
NM_020425chr6----11594 21513 286
NM_020432chr742302 1902 1548 659 ------
NM_020443chr176802 6703 6694 5905 5424 5358 2276 --25525 4708 26167 2175
NM_020456chr1362262 1801 748 627 499 25 1546 ----
NM_020648chr1862837 2805 2553 2500 84 77 ------
NM_020673chr20107559 7538 6744 6137 5825 5207 1690 1545 431 269 11052 46282 4907 2826 1910 --
NM_020697chr831163 1009 911 ------
NM_020718chr16146493 6471 6330 5770 5174 4522 4379 2053 2029 1568 999 649 140 121 --12421 --
NM_020727chr2144054 3983 3287 3187 21304 574 13859 13280
NM_020732chr631219 320 197 1203 11022 --
NM_020734chr12102779 2750 2703 2285 1306 1120 1096 740 448 273 22719 2672 12969 --
NM_020739chr1553892 2735 1394 1122 523 13334 ----
NM_020748chr1741984 1350 1342 299 12045 ----
NM_020766chrX84373 3983 3580 3512 1212 1165 589 453 --14388 --
NM_020768chr583195 2885 1235 1104 1029 1021 753 561 ------
NM_020772chr17187818 7799 7389 7064 6877 6651 6457 6103 3410 3225 3134 2237 2123 1891 1825 1452 1308 417 53195 2938 2256 1926 872 17775 --
NM_020774chr18106191 6074 5979 5330 5202 2159 2153 1637 1213 1004 --36214 4554 1112 14748
NM_020779chr233219 2630 507 2214 100 166 12744
NM_020783chr1852211 1776 1743 469 167 --11574 22397 2294
NM_020792chr342412 2229 1827 1816 21835 1766 12568 --
NM_020800chr331492 922 351 21209 450 31410 246 125 --
NM_020801chr552674 2408 1645 745 45 12294 1653 --
NM_020805chr1851846 1576 1523 1513 686 11933 ----
NM_020808chr151076 889 810 750 79 --2343 123 --
NM_020810chr1433568 923 59 22343 589 --12314
NM_020841chr1273535 2882 2648 1613 688 323 278 23398 3138 ----
NM_020844chr8126986 6941 6707 5961 5246 5132 5109 2776 2176 1455 1308 306 12633 ----
NM_020858chr1562360 2259 854 397 255 96 22373 2076 1188 --
NM_020859chr423340 577 ------
NM_020871chrX42562 2495 890 28 --12349 1592
NM_020922chrX21165 757 1568 ----
NM_020935chr2124589 4565 4543 4275 4053 3995 3927 3756 3620 3315 3307 285 14656 1277 --
NM_020940chr10112586 2578 2568 2338 1982 1974 1079 776 719 549 395 1176 142 --
NM_020948chr173386 2787 2287 1344 857 653 584 33693 3224 742 ----
NM_020951chr19122447 1801 878 831 750 735 717 686 675 666 649 283 1455 1135 --
NM_020973chr42243 182 ------
NM_020977chr442221 2062 554 386 --11529 12015
NM_020987chr1041269 1181 1175 263 11376 --1508
NM_021005chr154920 901 398 223 1260 11088 --
NM_021007chr292225 1979 826 810 798 790 782 529 122 1536 ----
NM_021021chr82956 729 ------
NM_021032chr382010 1852 1541 1276 661 454 287 158 ------
NM_021038chr332221 467 87 --33367 2459 609 22485 965
NM_021061chr853493 1402 809 640 472 21804 580 34522 4115 3653 --
NM_021072chr582478 2369 945 920 752 512 437 322 22362 759 --12573
NM_021097chr262891 2702 2331 2308 1978 1935 22870 62 11129 13030
NM_021116chr7138472 8456 8236 7602 6845 6591 5691 5522 3428 3362 1655 1543 847 28877 8678 ----
NM_021148chr731834 330 52 1141 11749 --
NM_021159chr42464 228 ------
NM_021180chr13779 727 614 --1669 1585
NM_021183chrX42591 870 850 345 --2577 446 --
NM_021239chr142901 513 1547 2363 161 1523
NM_021619chr931285 1248 1138 ------
NM_021629chr395009 4496 4373 1676 1462 441 357 283 259 23881 1482 1433 --
NM_021643chr241879 1768 1578 1169 --11478 11408
NM_021644chr103932 815 80 ----1855
NM_021647chr484777 4738 4554 4482 4086 3316 3176 3019 ------
NM_021722chr71577 ------
NM_021723chr71618 ------
NM_021803chr4168 ------
NM_021804chrX4804 264 239 40 --1760 --
NM_021813chr6105384 4808 4457 4427 4397 4349 4311 3642 2322 1044 12120 1930 15462
NM_021911chr584518 4004 3432 3424 1832 1387 1284 844 25611 3959 15005 --
NM_021912chr15102768 1205 1034 991 753 409 228 188 176 131 ------
NM_021914chr1452082 1525 567 287 93 11958 --1765
NM_021935chr321006 979 --11029 1995
NM_021960chr141944 1901 857 697 1877 1884 1425
NM_021961chr11107470 7131 7115 6868 6263 5866 4873 1208 1198 782 26887 5575 22697 33 16572
NM_021964chr386088 5142 4967 4603 4478 1403 887 861 --34800 4707 1845 172
NM_021977chr673733 3564 3498 3320 2775 2613 1469 ----1125
NM_022048chr1586167 5362 4954 4819 4624 4182 1839 653 25858 5768 22362 2332 --
NM_022114chr164800 4663 4113 3805 2991 1719 1677 34734 4253 1412 --
NM_022130chr551444 1245 567 475 433 11405 ----
NM_022133chr861770 1667 1535 1366 332 193 1124 1322 --
NM_022143chr721582 91 ------
NM_022169chr1111500 ------
NM_022351chr863842 3732 2716 1474 1335 1125 23791 2636 1100 11519
NM_022456chr12157690 7674 7552 7315 7307 7203 6950 5764 4739 2420 2246 1460 1315 287 168 ------
NM_022459chr13106383 5254 4789 2461 1953 1946 1786 1575 844 138 21567 788 ----
NM_022473chr1594093 3304 3130 3001 2822 2796 2768 2750 339 --1913 --
NM_022474chr1482819 2780 2121 899 854 813 336 317 1946 11028 --
NM_022484chr741415 1371 78 71 ------
NM_022566chr151425 ------
NM_022648chr2114636 4551 4505 4332 4284 4278 3913 2908 1858 1198 929 24538 1775 14470 --
NM_022650chr54926 749 674 290 --2973 953 --
NM_022659chr81513 ------
NM_022725chr1151908 1747 851 514 286 11423 ----
NM_022735chr151771 1636 1371 1243 709 ------
NM_022739chr171979 ------
NM_022763chr3143180 3168 3127 3098 3065 2584 2057 2019 802 606 575 549 422 395 --12726 1642
NM_022776chr351618 1535 1396 1136 578 21358 1020 1571 --
NM_022781chr993165 3138 2503 1140 532 444 135 80 50 33339 557 494 ----
NM_022802chr1021118 1007 ------
NM_022832chr462546 2199 819 808 295 132 ------
NM_022893chr293129 3081 2432 2305 2234 1209 844 372 341 11042 22595 273 --
NM_022894chr251382 1263 542 445 402 ------
NM_022900chr75953 419 230 157 91 ------
NM_023074chr193352 315 92 ----11365
NM_023105chr842166 1755 1736 139 1655 1626 1918
NM_023106chr842166 1755 1736 139 1655 1626 1918
NM_023110chr842166 1755 1736 139 1655 1626 1918
NM_023111chr842166 1755 1736 139 1655 1626 1918
NM_023927chr541213 1127 906 860 ------
NM_024007chr562053 851 638 477 247 24 12745 --2661 398
NM_024052chr1772931 2755 2499 2138 934 928 70 11246 ----
NM_024095chr1211412 ------
NM_024320chr171151 ------
NM_024324chr221177 ------
NM_024345chr9136094 5932 5722 5346 4851 4672 4364 4266 2137 2084 1442 1245 894 1713 ----
NM_024408chr163649 3263 3053 2624 808 688 33691 3091 2977 21055 868 --
NM_024423chr1894128 3955 3432 3343 2918 2751 2706 798 299 43564 3018 1672 987 ----
NM_024424chr111407 1836 --21173 1120
NM_024425chr111407 1836 --21173 1120
NM_024426chr111407 1836 --21173 1120
NM_024491chr3252 36 ----2151 29
NM_024511chr483255 3197 2621 2260 1022 736 633 488 1980 160 --
NM_024519chr161274 ------
NM_024524chr373113 2995 2884 2530 981 399 76 ----1524
NM_024529chr141001 477 306 215 ------
NM_024582chr43981 370 355 --11114 1955
NM_024586chr11598 ------
NM_024604chr121168 ------
NM_024613chr821179 1166 11172 ----
NM_024631chr111521 ------
NM_024665chr374678 4196 3149 1724 418 147 40 24516 2884 11084 --
NM_024674chr1102862 2743 2255 2122 2006 781 746 738 675 461 12989 ----
NM_024713chr1521440 1058 --1539 21127 56
NM_024721chr832709 958 666 --31057 653 343 --
NM_024740chr1193100 2597 1463 1437 1404 1040 930 700 188 --1788 14030
NM_024744chr262693 2342 1994 395 388 381 21844 204 ----
NM_024745chr1641058 441 94 85 --11126 --
NM_024749chr11514 ------
NM_024770chr296724 6627 5843 5169 4487 1595 1318 972 108 --11754 11021
NM_024828chr93385 262 63 ----21551 1132
NM_024844chr17128 ------
NM_024857chr173244 123 26 ------
NM_024930chr592835 2472 2443 1839 827 782 460 110 85 --12805 --
NM_024944chr2131001 373 367 ----148
NM_024947chr3159370 9124 8594 8222 7471 6984 6435 3711 2991 2312 2275 1846 1825 1742 1372 49339 9219 3675 3002 --16577
NM_024989chr2178151 8082 7976 7940 7494 6649 6458 6436 5481 5360 5130 5052 5009 2687 2665 2348 1290 27965 975 27478 6574 --
NM_024991chr1062765 2743 2730 2370 2188 226 12462 1173 --
NM_024993chr231544 582 269 ----21602 576
NM_025054chr873822 3611 2833 1341 1318 1159 462 13095 1890 --
NM_025074chr473120 3049 2490 2422 2046 1239 1063 ----12186
NM_025090chr177605 378 298 273 120 82 76 41456 260 231 114 1131 --
NM_025134chr1662469 2379 1676 1665 957 293 12257 11592 --
NM_025138chr1351262 1225 349 272 207 --21170 478 --
NM_025160chr144168 3860 2965 720 23524 2674 --1350
NM_025191chr173486 3430 3285 1198 1187 168 51 --13498 --
NM_025211chr9161 ------
NM_025222chr372204 2190 1109 1084 1068 1014 948 --42989 1974 471 29 --
NM_025268chr141400 ------
NM_030579chr1663616 3509 2370 1335 1213 561 11016 ----
NM_030625chr1052591 2253 1860 795 772 --1728 1556
NM_030627chr523997 3669 22780 907 13905 11241
NM_030647chr7126225 6198 6173 5961 5907 4844 2278 1713 1217 1181 592 100 36306 1385 789 ----
NM_030648chr455463 4071 638 492 163 24091 1223 25022 1169 --
NM_030650chr283964 3789 2664 2581 1167 814 687 109 --23319 307 11322
NM_030674chr1264958 2334 2302 2205 992 439 --24993 4884 --
NM_030751chr1041829 1820 1674 1437 11422 21299 91 1118
NM_030751chr1041829 1820 1674 1437 11422 21299 91 1118
NM_030755chr1493074 2241 1153 1023 659 511 456 396 256 22997 2130 ----
NM_030789chr201280 ------
NM_030791chr1421711 257 --2663 414 11470
NM_030799chr552227 2152 1370 1363 755 ------
NM_030806chr189405 8708 7542 7030 6076 5786 3298 1325 --11453 141
NM_030808chr171969 --11057 --
NM_030809chr1222495 1632 ------
NM_030885chr352310 2278 2066 1804 827 ------
NM_030918chr155304 5283 2117 1457 1193 13499 1329 1516
NM_030945chr542532 1925 624 100 ------
NM_030949chr621480 431 ------
NM_031243chr732230 1497 463 2607 524 --135
NM_031262chr951125 1107 1057 1029 989 ------
NM_031263chr951182 1164 1114 1086 1046 ------
NM_031268chr16125190 5127 5069 4657 3439 1984 1895 1728 1565 1509 631 385 ----14756
NM_031296chr452330 2024 954 146 139 ------
NM_031314chr1441679 699 462 279 11812 12034 --
NM_031371chr141164 1133 1084 360 31102 1048 484 21265 345 --
NM_031371chr141164 1133 1084 360 31102 1048 484 21265 345 --
NM_031435chr1293467 3102 3020 2184 1262 1067 972 741 425 12925 ----
NM_031453chr1062525 2467 2168 1913 1000 238 12539 --1658
NM_031461chr861836 1595 876 758 314 221 165 ----
NM_031468chr787828 7821 6788 5237 3067 1386 1151 25 18154 --18223
NM_031483chr2053435 3425 2417 2400 2335 13379 ----
NM_031844chr143178 2994 1206 637 --1838 1864
NM_031845chr233389 2471 860 1497 23678 3517 22983 2744
NM_031847chr233389 2471 860 1497 23678 3517 22983 2744
NM_031904chr1122133 1804 ------
NM_031922chr61144 ------
NM_032012chr974646 3224 1226 1202 883 470 183 34546 4459 1616 ----
NM_032041chr862478 2366 2316 2274 1938 1785 11091 32726 2651 740 --
NM_032047chr362389 2367 1993 843 533 208 --11859 --
NM_032102chr1143060 3017 2592 2386 33000 874 507 13097 11073
NM_032116chr13175861 5795 5612 5334 5004 4955 4695 4403 4374 3939 3891 2170 1962 1384 924 792 389 14342 23737 807 14277
NM_032121chrX72624 2555 673 471 154 97 88 12448 22506 1844 --
NM_032128chr441033 851 704 281 1782 ----
NM_032144chr211178 --11190 11416
NM_032195chr215507 490 478 470 342 --1441 --
NM_032199chr10103817 3777 3655 3599 3585 3233 3223 1442 560 457 --1534 --
NM_032208chr242908 2761 1112 592 22444 685 --23314 2552
NM_032228chr1173308 2739 2332 1372 1244 1092 190 21020 70 --12528
NM_032256chr123393 171 77 --1195 --
NM_032272chr81307 ------
NM_032288chr352275 2097 1907 1747 1473 ------
NM_032300chr1211110 ------
NM_032312chr23573 158 47 ------
NM_032321chr253130 3009 2184 936 811 --11313 --
NM_032364chr124999 937 908 287 1985 ----
NM_032373chr1085320 3782 3715 1440 1208 828 676 452 1761 15004 15838
NM_032410chr851216 1028 436 371 156 2277 252 ----
NM_032424chr1131499 1134 245 --4611 506 255 146 --
NM_032429chr101596 ------
NM_032435chr192352 2255 2216 2123 2030 1962 1620 154 90 --11948 --
NM_032439chr1041586 1178 568 527 1578 1632 --
NM_032446chr563223 2928 2799 2379 1213 1129 1877 ----
NM_032505chr362732 2537 2459 2133 1970 493 22217 747 22038 1832 11744
NM_032521chr2053213 2987 2079 657 373 13247 ----
NM_032536chr92625 237 ------
NM_032539chrX1617 ------
NM_032582chr1731746 677 595 ----11845
NM_032679chr1911084 ------
NM_032682chr363031 2956 2664 2259 2221 546 --13202 12445
NM_032826chr7105131 4367 4238 3976 3432 1686 1673 1531 1523 1512 11301 --15406
NM_032828chr19104940 4432 4325 4169 3314 3280 3153 1729 1366 1067 ------
NM_032837chr174676 657 625 279 --12037 1541
NM_032859chr1353610 3527 1269 523 29 23645 1411 ----
NM_032864chr131403 216 164 --158 --
NM_032873chr11104423 4360 4348 4056 3372 1749 1381 1071 922 52 14203 --1157
NM_032884chr11341 ------
NM_032895chr175840 770 708 701 550 ------
NM_032949chr132473 78 ------
NM_032968chrX174242 4216 4175 4070 4006 3934 3501 3179 3092 2804 1414 1388 871 812 626 195 40 53260 2798 1637 1603 654 ----
NM_032969chrX174242 4216 4175 4070 4006 3934 3501 3179 3092 2804 1414 1388 871 812 626 195 40 53260 2798 1637 1603 654 ----
NM_032973chrY164234 4208 4167 4062 3998 3926 3497 3174 3087 2799 1414 871 812 626 195 40 43255 2793 1602 654 ----
NM_032975chr1823514 3502 ------
NM_032980chr1823514 3502 ------
NM_033020chr1114785 4672 4072 4008 3800 3752 3044 1812 1508 1045 958 24688 946 13292 --
NM_033114chr123840 759 617 ------
NM_033125chr6157 ------
NM_033161chr921955 523 ------
NM_033181chr693767 3688 3588 3414 1507 1092 1067 914 451 23276 2970 13267 13757
NM_033211chr561794 1648 1611 421 403 244 ------
NM_033224chr7118078 7472 6765 2378 2176 2132 2079 1873 1800 1259 981 --27482 6570 17435
NM_033281chr53756 309 149 --184 --
NM_033285chr8104007 3827 3056 2842 1775 1073 558 360 61 51 23991 3866 33136 445 168 --
NM_033290chrX83645 2382 2294 548 386 213 174 167 11121 --13612
NM_033305chr931367 1228 110 11152 11277 --
NM_033326chr1132410 2396 2048 ------
NM_033360chr12114401 4115 3988 3925 3786 3593 3039 1176 1132 977 485 23069 113 ----
NM_033389chr17104787 4363 3813 3291 3010 2967 2957 914 165 155 --14397 --
NM_033420chr1911207 ------
NM_033427chr73612 339 331 --3323 315 308 --
NM_033430chr4163951 3871 3591 3583 3259 3098 2581 1678 1600 1104 572 502 289 189 119 92 12563 182 24094 3755
NM_033437chr4163951 3871 3591 3583 3259 3098 2581 1678 1600 1104 572 502 289 189 119 92 12563 182 24094 3755
NM_033505chr2116567 6036 5997 4656 2339 2295 2045 1870 1730 1348 962 16083 ----
NM_033512chr863095 3035 2945 2511 2491 2379 --194 12851
NM_033642chrX51233 1147 959 938 811 2920 845 1913 --
NM_052811chr1375274 5147 4269 1249 535 296 247 --15135 --
NM_052832chr812796 22649 1861 42711 2280 1068 462 --
NM_052834chr1872581 2368 2350 1947 1913 1667 509 --22552 2464 12437
NM_052851chr1362357 2117 1903 913 360 335 --1381 --
NM_052854chr111441 ------
NM_052879chr1254068 4062 2547 538 489 --13815 --
NM_052885chr1274842 4828 4611 4073 1597 1256 423 31294 377 246 24671 859 --
NM_052898chr811299 ------
NM_052900chr821424 1269 ------
NM_052907chr1243960 1474 949 21 1747 ----
NM_052913chr61154 ------
NM_052917chr243249 3233 448 179 ------
NM_052927chr552132 1880 847 788 630 22235 1839 --11397
NM_052937chr831744 1061 270 --1490 1804
NM_052948chr19178 ------
NM_052953chr31105 ------
NM_052971chr52305 112 ------
NM_053016chr956930 5735 5570 5557 2467 --27563 5405 --
NM_053043chr7126399 6302 6120 5735 5009 4741 4588 2050 1761 1554 1048 635 --25154 5139 15131
NM_053053chr18983 972 938 393 367 203 100 93 --11010 --
NM_054016chr141959 1895 1809 1692 --1229 --
NM_054016chr141959 1895 1809 1692 --1229 --
NM_054016chr141959 1895 1809 1692 --1229 --
NM_057180chr123399 338 88 ------
NM_058241chr262239 1828 1524 495 401 388 1407 11814 12008
NM_058241chr262239 1828 1524 495 401 388 1407 11814 12008
NM_080546chr982274 1595 123 117 107 101 95 85 12284 1836 1420
NM_080617chr2041056 981 939 425 --1419 --
NM_080686chr6137 ------
NM_080737chrX71505 1285 977 133 107 99 91 --21379 249 --
NM_080759chr1382637 1674 1040 1021 847 364 278 117 --12175 --
NM_080760chr1382637 1674 1040 1021 847 364 278 117 --12175 --
NM_080764chr2232490 2214 212 --12411 --
NM_080867chr1453732 3077 880 356 243 14976 --34900 4721 4043
NM_080874chr431882 1825 1407 ------
NM_130391chr943108 2359 2189 931 12850 --23557 555
NM_130392chr943108 2359 2189 931 12850 --23557 555
NM_130393chr943108 2359 2189 931 12850 --23557 555
NM_130398chr11136 ------
NM_130435chr1092957 2889 2788 2672 2538 2027 640 620 108 12717 ----
NM_130438chr2143174 3100 2999 2176 23349 3199 13135 11152
NM_130446chr334282 4218 4116 --13086 --
NM_130831chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130832chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130833chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130834chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130835chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130836chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130837chr3102897 2814 2597 2577 2380 2038 732 466 433 141 --12184 --
NM_130838chr1541169 501 478 286 11830 11306 --
NM_130839chr1541169 501 478 286 11830 11306 --
NM_130847chr1185690 5583 5281 5150 4142 1283 1147 807 45505 4591 3692 1703 25734 314 --
NM_133334chr486192 5855 5401 4351 4045 2503 1279 885 25474 5104 26229 1187 --
NM_133370chr493645 2967 2324 1154 1143 790 671 117 48 22480 754 21358 462 --
NM_133372chr532913 2631 145 --32889 2133 155 --
NM_133378chr21111 --1213 --
NM_133432chr21111 --1213 --
NM_133433chr53834 751 221 ------
NM_133437chr21111 --1213 --
NM_133478chr212462 ------
NM_133496chr1103396 2913 2813 1672 1295 1206 1076 1057 659 609 ------
NM_133503chr121541 ------
NM_133504chr121541 ------
NM_133505chr121541 ------
NM_133506chr121541 ------
NM_133507chr121719 ------
NM_133631chr311090 ------
NM_133633chr2221193 1168 ------
NM_133642chr2211286 ------
NM_133647chr1563680 3123 2676 639 630 104 13607 13559 1158
NM_138270chrX62706 2656 2562 2437 2340 2320 22894 651 --192
NM_138285chr21455 ------
NM_138286chr1983940 3251 3036 1278 1060 846 714 363 11751 13264 12875
NM_138288chr1441425 1397 392 203 11977 ----
NM_138316chr1041242 1014 270 225 --1219 --
NM_138340chr18182 ------
NM_138360chr141303 ------
NM_138423chr1592201 2136 2039 861 606 580 266 184 94 11473 11638 --
NM_138426chr7102509 2484 2385 1734 1698 810 549 355 278 271 ------
NM_138444chr1364917 4121 3799 3353 1907 942 14884 23591 1977 --
NM_138459chr693652 3104 2666 2619 2591 2258 723 512 201 32768 2696 1117 ----
NM_138471chr111537 ------
NM_138473chr12105059 4945 4907 3454 3387 3359 1827 1695 1376 176 35014 1729 1031 ----
NM_138554chr942454 2192 2030 347 --22495 2000 --
NM_138565chr1111338 ------
NM_138621chr294066 3965 3760 2864 2816 2696 2633 842 382 23851 281 14014 --
NM_138638chr1452082 1525 567 287 93 11958 --1765
NM_138713chr16148244 8092 7732 7256 7079 6850 6838 6125 2439 2277 1971 1406 1259 108 37149 6948 5348 25851 560 --
NM_138714chr16148244 8092 7732 7256 7079 6850 6838 6125 2439 2277 1971 1406 1259 108 37149 6948 5348 25851 560 --
NM_138729chr1190 ------
NM_138731chr1494157 4079 4054 3180 1424 684 515 493 410 22770 571 --171
NM_138771chr721328 595 21039 278 11142 --
NM_138931chr361009 805 730 691 374 343 2780 241 ----
NM_138959chr1125628 4277 4185 2511 2263 1989 1936 1546 1442 1084 767 441 26513 6400 ----
NM_138971chr11------23825 499
NM_138971chr11------23825 499
NM_138972chr11------23825 499
NM_138972chr11------23825 499
NM_138973chr11------23825 499
NM_138973chr11------23825 499
NM_139012chr652228 1753 1738 1583 1511 11701 1901 --
NM_139014chr652308 1833 1818 1663 1591 11781 ----
NM_139048chr311180 ------
NM_139071chr1211192 ------
NM_139131chr112566 461 ------
NM_139136chr1221020 823 ----1927
NM_139157chr111233 ------
NM_139168chr521430 391 --11766 --
NM_139182chr471461 407 349 332 226 161 45 3339 238 62 ----
NM_139207chr1231496 664 87 ------
NM_139266chr22201 79 ------
NM_144492chr212232 110 ------
NM_144571chr4126946 6397 6006 5720 5597 5311 4387 4333 2317 1360 766 254 45094 2466 2435 2286 36982 2520 2128 --
NM_144578chr1494873 4768 4713 4646 1321 1197 699 179 50 13488 ----
NM_144583chr22271 143 --1522 1332
NM_144590chr1052993 2351 1185 613 480 ------
NM_144599chr1564974 4243 4136 1264 1253 705 35341 778 467 25516 1133 --
NM_144600chr1651426 572 461 390 37 ------
NM_144767chr1594322 4107 3734 3164 3005 1729 1619 1096 926 24511 690 24490 419 --
NM_144778chr1362705 2545 2180 1826 1815 1778 ----22385 976
NM_144973chr12105185 5098 4263 2129 2078 1613 1482 1008 478 157 25118 222 15132 --
NM_145000chr51574 ------
NM_145025chr611133 ------
NM_145055chr1853542 3353 2551 991 357 13246 --2935 373
NM_145239chr1611193 ------
NM_145259chr2127034 6837 6692 6630 6329 5503 5465 5147 4957 4311 2752 1723 12804 --15033
NM_145291chr43417 393 339 ------
NM_145313chr1031400 1350 110 ------
NM_145735chr13102753 2734 2621 2021 1909 1811 1726 633 517 38 --12034 1328
NM_145805chr151610 ------
NM_147147chr693340 3103 2956 2658 1269 1033 979 767 739 23070 2893 ----
NM_147171chr75324 184 168 125 79 1440 ----
NM_147185chr75324 184 168 125 79 1440 ----
NM_148894chr451166 807 383 253 227 1399 1352 --
NM_148904chr11598 ------
NM_148905chr11598 ------
NM_148906chr11598 ------
NM_148907chr11598 ------
NM_148908chr11598 ------
NM_148909chr11598 ------
NM_148955chr15126559 6543 6159 6001 4907 4466 1567 1297 1148 879 292 30 ----11657
NM_148957chr1372456 2330 1964 1953 1691 904 771 12646 11973 --
NM_148977chr1041242 1014 270 225 --1219 --
NM_148978chr1041242 1014 270 225 --1219 --
NM_152132chr14124 ------
NM_152227chr201702 ------
NM_152261chr1252537 2369 2268 1953 116 1344 22280 2030 --
NM_152280chr142725 2496 706 397 ------
NM_152296chr19180 ------
NM_152309chr1022215 2169 --1476 --
NM_152344chr1711192 ------
NM_152374chr1131095 471 410 400 350 326 302 265 198 187 141 113 37 21706 166 ----
NM_152388chr2103885 3750 2906 2723 1578 950 546 278 87 79 --23722 3156 --
NM_152400chr431730 1324 785 ------
NM_152407chr562087 1237 1056 357 346 77 ----11259
NM_152409chr572576 2531 1299 659 498 451 197 12564 --13032
NM_152412chr821489 557 ------
NM_152415chr82339 128 ------
NM_152422chr931878 415 261 ------
NM_152542chr471811 1706 1525 1515 1448 527 194 11861 --11372
NM_152622chr543469 2314 660 128 22383 415 --1761
NM_152624chr5107131 5865 5049 2886 1575 1062 853 831 281 259 42896 2635 1289 844 11384 --
NM_152641chr1252916 2731 1110 1060 889 1789 --22723 2531
NM_152653chr31709 ------
NM_152666chr13625 194 33 ------
NM_152678chr362411 1879 1842 1662 1049 143 1150 ----
NM_152739chr751025 792 460 291 277 --31071 400 384 --
NM_152754chr743846 3834 3319 63 2798 332 21179 1143 --
NM_152756chr554295 2969 1244 1187 257 44289 4214 4148 1375 11641 --
NM_152758chr852677 2521 1215 1167 700 11192 ----
NM_152765chr862376 2296 2140 1579 254 27 ----11498
NM_152787chrX73594 3508 3492 2498 2439 1238 882 --23848 3416 --
NM_152826chr15126559 6543 6159 6001 4907 4466 1567 1297 1148 879 292 30 ----11657
NM_152829chr761271 1173 1016 949 803 224 1384 11217 --
NM_152836chr861770 1667 1535 1366 332 193 1124 1322 --
NM_152837chr861770 1667 1535 1366 332 193 1124 1322 --
NM_152838chr2083229 2903 2819 2587 2393 2298 708 511 12668 43117 547 497 189 --
NM_152902chr172007 1969 1761 1539 1455 669 662 --11523 --
NM_152903chr1362886 1983 1972 1096 993 857 12738 ----
NM_152996chr111367 ------
NM_152999chr755015 4832 3694 3047 958 54215 3443 1257 1208 549 1793 14869
NM_153013chr531827 864 513 --12363 32061 335 181
NM_153038chr21786 ------
NM_153184chr361798 1484 641 596 329 140 ----11314
NM_153186chr95757 723 666 619 82 --1206 --
NM_153188chr5145637 5111 4799 4750 4522 4495 4447 3800 3700 2048 1675 1481 1146 182 35651 5370 1155 --15192
NM_153207chr1273868 3292 2933 1172 1048 893 588 32864 2839 1032 24072 215 13877
NM_153223chr531558 137 127 ------
NM_153235chr662354 2160 548 498 482 467 --11840 --
NM_153252chrX1385 ------
NM_153262chr193211 3057 2463 2457 2408 1238 790 782 183 --12418 --
NM_153331chr31110 ------
NM_153354chr56952 919 830 238 148 130 --1822 --
NM_153367chr10103997 3811 3180 3165 3079 2564 2510 1607 1037 348 --33959 2681 445 --
NM_153371chr1331716 1698 364 ----11842
NM_153456chr13106239 5942 5845 5782 5552 4084 2153 1361 1043 106 26216 1478 14880 --
NM_153607chr553079 2635 745 608 447 3994 797 645 1789 1986
NM_153616chr1562360 2259 854 397 255 96 22373 2076 1188 --
NM_153617chr1562360 2259 854 397 255 96 22373 2076 1188 --
NM_153618chr1562360 2259 854 397 255 96 22373 2076 1188 --
NM_153633chr121535 ------
NM_153693chr125637 622 604 549 78 ----1800
NM_153702chr41295 ------
NM_153705chr1142672 1021 499 368 1481 127 --
NM_153715chr721232 477 ----11110
NM_153748chr1221020 823 ----1927
NM_153810chr1085079 4920 4616 4384 3624 664 628 63 14109 ----
NM_153812chr121645 369 12294 12322 12273
NM_153819chr111187 ------
NM_170606chr731659 1616 659 11401 --21786 1689
NM_170665chr1294403 3994 3785 3649 3615 1163 1108 1098 1006 21260 296 21393 986 --
NM_170710chr463185 2910 2828 2775 2202 784 22800 2240 12440 --
NM_170719chr1351262 1225 349 272 207 --21170 478 --
NM_170731chr1142757 1153 668 55 1118 12331 --
NM_170732chr1142757 1153 668 55 1118 12331 --
NM_170733chr1142757 1153 668 55 1118 12331 --
NM_170734chr1142757 1153 668 55 1118 12331 --
NM_170735chr1142757 1153 668 55 1118 12331 --
NM_170750chrX4881 822 773 174 ------
NM_171998chrX12538 176 22517 2456 1668
NM_172069chr271734 1561 1549 877 738 605 51 --12146 --
NM_172070chr242104 1633 877 377 12144 2503 457 --
NM_172071chr1107253 5690 5611 5230 2476 2108 1995 1497 1346 380 66540 5950 5843 415 406 354 11801 12711
NM_172103chr652721 2399 1852 1672 980 31083 900 487 12200 1454
NM_172105chr652721 2399 1852 1672 980 31083 900 487 12200 1454
NM_172240chr1271332 1217 1141 1110 1067 463 267 ------
NM_172373chr1331354 1309 306 1395 ----
NM_173177chr22683 623 --1457 --
NM_173214chr16148244 8092 7732 7256 7079 6850 6838 6125 2439 2277 1971 1406 1259 108 37149 6948 5348 25851 560 --
NM_173468chr4106005 5994 5468 5295 2212 2204 1969 1851 897 328 34678 4358 932 25014 4844 --
NM_173475chr1671745 1333 1310 468 249 152 127 11443 ----
NM_173495chrX22515 709 --12499 --
NM_173510chr2292932 2600 2505 1869 989 862 418 388 48 --1277 --
NM_173511chr243233 2655 1571 995 1740 --13813
NM_173531chr1993216 3188 3172 3160 2606 2501 933 615 587 22378 1192 --12953
NM_173554chr101231 ------
NM_173576chr1041903 1577 877 343 ----21664 803
NM_173582chr11146147 6078 6037 5205 4726 4168 2342 2306 2190 2035 1774 351 337 29 12220 1621 12099
NM_173595chr12114818 4707 4540 4383 3430 1859 1680 970 946 479 354 --13517 --
NM_173602chr1263549 2317 1027 609 390 293 33692 1490 678 --13682
NM_173609chr151666 ------
NM_173642chr199139 7977 7202 6927 6431 6318 3161 3106 926 21760 957 28018 3211 11641
NM_173644chr2071882 1876 1847 1802 1641 752 653 1409 ----
NM_173654chr332347 616 150 ------
NM_173698chrX41698 774 613 45 ------
NM_173803chr1621221 242 ------
NM_173822chr292039 2023 2015 2006 1977 1358 350 146 139 1692 1722 --
NM_173829chr5105620 5436 5069 4897 4177 4104 1588 885 275 237 21162 699 --12420
NM_174911chr883856 3793 3504 3186 3146 2581 2548 920 13768 1494 --
NM_174916chr1562416 2183 2091 1632 960 353 12381 --12160
NM_175607chr341533 1236 1126 519 11483 ----
NM_175610chr1511055 ------
NM_175611chr211206 ------
NM_175612chr341533 1236 1126 519 11483 ----
NM_175623chr12157690 7674 7552 7315 7307 7203 6950 5764 4739 2420 2246 1460 1315 287 168 ------
NM_175624chr12157785 7769 7647 7410 7402 7298 7045 5859 4834 2515 2341 1555 1410 382 263 ------
NM_175625chr12157785 7769 7647 7410 7402 7298 7045 5859 4834 2515 2341 1555 1410 382 263 ------
NM_175854chr1372778 2647 1907 1878 700 345 284 --22108 541 --
NM_175856chr52555 74 ------
NM_175863chr631219 320 197 1203 11022 --
NM_175876chr162660 2201 2112 486 75 24 12028 --12017
NM_177400chr10176 ------
NM_177414chr141751 1731 1515 1503 11428 --21638 1082
NM_177974chr1592201 2136 2039 861 606 580 266 184 94 11473 11638 --
NM_177985chr282182 1838 699 618 609 470 463 262 22103 34 ----
NM_177990chr2021796 504 ------
NM_177995chr931878 415 261 ------
NM_178006chr1362357 2117 1903 913 360 335 --1381 --
NM_178007chr1362357 2117 1903 913 360 335 --1381 --
NM_178043chr4174 ------
NM_178151chrX87210 6631 6581 5506 2818 1646 1499 972 27874 7733 37854 1790 826 --
NM_178152chrX87210 6631 6581 5506 2818 1646 1499 972 27874 7733 37854 1790 826 --
NM_178153chrX87210 6631 6581 5506 2818 1646 1499 972 27874 7733 37854 1790 826 --
NM_178313chr231718 1682 1635 21866 433 --1482
NM_178498chr1143880 3286 1208 96 12485 13863 12865
NM_178505chr1053643 3542 1232 595 205 ----12501
NM_178581chr201280 ------
NM_178585chr493202 2990 2837 2519 2227 1171 829 621 419 12807 12875 --
NM_178586chr1432374 2171 626 21981 1793 --11967
NM_178587chr14187 ------
NM_178815chr1042105 2000 1965 1717 1219 ----
NM_178818chr1642482 2434 2426 911 --22270 33 --
NM_181077chr1562027 1665 1460 1423 897 747 32252 2229 1915 1589 --
NM_181265chr463185 2910 2828 2775 2202 784 22800 2240 12440 --
NM_181353chr201581 ------
NM_181354chr851398 1261 423 335 121 ------
NM_181358chr1134213 3167 3153 3042 1457 1420 1371 1360 1338 1111 1077 677 645 24156 2753 ----
NM_181442chr2041047 1016 699 394 1988 --1855
NM_181443chr2032849 2333 1088 22896 915 22233 928 --
NM_181481chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_181482chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_181483chr18116783 6677 6171 5894 5608 5536 5071 4541 2118 1344 501 14731 24995 639 --
NM_181504chr5144181 3887 3873 3859 3841 3793 3484 3155 3051 3035 3027 1455 753 583 --13953 1186
NM_181521chr16107263 7215 7207 5793 5692 4617 2687 2383 2297 301 --27051 4814 11453
NM_181523chr5144181 3887 3873 3859 3841 3793 3484 3155 3051 3035 3027 1455 753 583 --13953 1186
NM_181524chr5144181 3887 3873 3859 3841 3793 3484 3155 3051 3035 3027 1455 753 583 --13953 1186
NM_181659chr2073064 2553 2273 1096 1010 993 467 --1215 --
NM_181659chr2073064 2553 2273 1096 1010 993 467 --1215 --
NM_181705chr585643 5210 4720 4168 2271 715 559 451 15162 23618 925 --
NM_181741chr241081 1053 145 108 1889 1875 1922
NM_181742chr241081 1053 145 108 1889 1875 1922
NM_181787chr873800 3713 3570 3390 3102 3078 2513 1446 13197 --
NM_181802chr201155 ------
NM_181839chr861289 1270 498 479 466 242 ----21335 1007
NM_181861chr1272763 2745 2686 2676 742 502 355 ------
NM_181868chr1272763 2745 2686 2676 742 502 355 ------
NM_181869chr1272848 2830 2771 2761 827 587 440 ------
NM_182314chrX21380 365 ----1448
NM_182485chr4123275 2930 2812 2675 2667 2593 2447 924 590 473 242 59 22965 622 23400 755 --
NM_182493chr16135352 5317 4576 4384 4126 4096 3896 3667 2027 2018 1875 1474 1428 ------
NM_182511chr184505 456 335 328 21426 1343 1467 --
NM_182569chr172189 167 ----1138
NM_182641chr1761820 1359 829 806 495 390 ------
NM_182646chr4123275 2930 2812 2675 2667 2593 2447 924 590 473 242 59 22965 622 23400 755 --
NM_182648chr143718 628 573 1737 --176
NM_182689chr11319 ------
NM_182690chr11381 ------
NM_182701chr68842 740 376 237 212 193 172 165 ------
NM_182758chr15103939 3187 2894 2778 2675 2635 2613 2494 1219 960 12983 --21344 77
NM_182763chr141933 1890 846 686 1866 1873 1414
NM_182765chr1062325 2178 1885 1870 774 647 31990 1759 793 --12283
NM_182767chr1252100 1749 1586 1301 472 21857 656 2646 552 --
NM_182898chr796302 5632 4878 4704 4326 4168 3994 3984 2102 --1283 16231
NM_182899chr796302 5632 4878 4704 4326 4168 3994 3984 2102 --1283 16231
NM_182907chr651543 1506 898 722 250 --2271 220 1503
NM_182931chr73627 502 132 1106 150 1265
NM_182948chr153140 3006 2029 1953 1219 22493 1202 1709 --
NM_182972chr151953 804 338 332 59 11946 22193 2034 1126
NM_183043chr131286 ------
NM_183044chr131286 ------
NM_183227chr631216 1165 636 ----1516
NM_183380chr64954 713 694 135 ----1161
NM_183397chr2085184 3317 1983 1238 1152 1128 395 172 --13504 11318
NM_194282chr472149 1941 1912 1114 467 328 90 22003 339 22124 974 --
NM_194314chr175378 5343 5275 4443 4245 2049 529 25508 1457 25616 4894 11146
NM_194328chr993165 3138 2503 1140 532 444 135 80 50 33339 557 494 ----
NM_194329chr993165 3138 2503 1140 532 444 135 80 50 33339 557 494 ----
NM_194330chr993165 3138 2503 1140 532 444 135 80 50 33339 557 494 ----
NM_194332chr993165 3138 2503 1140 532 444 135 80 50 33339 557 494 ----
NM_194429chr61536 ------
NM_194434chr1885698 5685 5577 3969 1504 882 203 115 14204 21663 1441 --
NM_194454chr751454 1169 1137 662 422 1464 --1552
NM_194455chr751454 1169 1137 662 422 1464 --1552
NM_194456chr751454 1169 1137 662 422 1464 --1552
NM_197941chr532847 570 373 ------
NM_198047chr21532 ------
NM_198123chr821424 1269 ------
NM_198124chr821424 1269 ------
NM_198128chr1872242 933 913 891 821 527 92 11437 ----
NM_198158chr32967 176 --33007 2990 2046 --
NM_198159chr32967 176 --33007 2990 2046 --
NM_198173chr13779 727 614 --1669 1585
NM_198174chr13779 727 614 --1669 1585
NM_198177chr32967 176 --33007 2990 2046 --
NM_198178chr32967 176 --33007 2990 2046 --
NM_198182chr231515 1470 1197 ------
NM_198240chr1241416 1291 1248 388 ------
NM_198243chr151260 ------
NM_198268chr1134213 3167 3153 3042 1457 1420 1371 1360 1338 1111 1077 677 645 24156 2753 ----
NM_198269chr1134213 3167 3153 3042 1457 1420 1371 1360 1338 1111 1077 677 645 24156 2753 ----
NM_198270chrX83497 3408 3374 3275 2987 2409 1247 574 1480 ----
NM_198271chr31375 ------
NM_198273chr573098 3028 2890 2427 2393 2104 1218 23053 2304 12009 --
NM_198320chr1254985 4530 2018 1808 331 1276 11250 --
NM_198391chr2041313 521 350 256 ------
NM_198399chr351801 1628 1545 1528 1185 ------
NM_198400chr1572709 2394 2186 1079 943 887 338 --12196 1297
NM_198441chr134870 863 848 307 ------
NM_198451chrX2637 608 ------
NM_198581chr2197265 7083 6915 6795 6369 6357 5899 5307 5011 2908 1281 1142 1129 1108 926 756 734 615 608 1563 17530 13023
NM_198793chr373819 3265 3182 2771 1271 1069 849 21518 557 22563 1310 --
NM_198844chr174994 397 385 328 --1270 --
NM_198859chr385013 5006 4575 4013 1999 991 454 270 13758 13548 --
NM_198935chr2072382 2295 1131 1042 701 671 228 --1217 --
NM_198990chr773295 3024 2832 2111 1240 1170 648 ------
NM_199000chr742227 2112 1493 635 12249 1711 1573
NM_199188chr1254068 4062 2547 538 489 --13815 --
NM_199190chr1254068 4062 2547 538 489 --13815 --
NM_199320chr452887 2832 2640 1876 733 22075 553 12933 --
NM_199320chr452887 2832 2640 1876 733 22075 553 12933 --
NM_199321chr174994 397 385 328 --1270 --
NM_199324chr4123755 3159 2868 2659 2516 1259 1108 1037 983 642 626 458 33701 3458 1413 12734 --
NM_199421chr1453732 3077 880 356 243 14976 --34900 4721 4043
NM_199454chr164800 4663 4113 3805 2991 1719 1677 34734 4253 1412 --
NM_199461chr1063483 3341 2927 812 664 254 21460 779 1305 --
NM_199462chr1104786 4511 3194 3080 1805 1524 1505 1021 1013 995 21849 247 24996 321 15033
NM_199482chr261999 1495 1482 804 526 121 --31936 177 54 --
NM_201266chr263013 2006 1933 695 306 237 13030 12016 --
NM_201278chr1111938 --12291 1888
NM_201279chr263013 2006 1933 695 306 237 13030 12016 --
NM_201281chr1111938 --12291 1888
NM_201413chr214839 330 266 245 11079 ----
NM_201414chr214839 330 266 245 11079 ----
NM_201570chr1031716 766 125 149 31804 556 549 --
NM_201571chr1031716 766 125 149 31804 556 549 --
NM_201572chr1031716 766 125 149 31804 556 549 --
NM_201590chr1031716 766 125 149 31804 556 549 --
NM_201593chr1031716 766 125 149 31804 556 549 --
NM_201596chr1031716 766 125 149 31804 556 549 --
NM_201597chr1031716 766 125 149 31804 556 549 --
NM_201632chr521847 1505 ------
NM_201634chr521946 1604 ------
NM_203303chrX158 ------
NM_203307chr1941649 1364 1336 125 ----1518
NM_203372chr251611 1598 525 419 361 --11518 31482 511 324
NM_203459chr172502 2406 1669 1658 447 383 239 ------
NM_203463chr284877 4772 4326 3901 3084 848 623 269 11932 1204 --
NM_203499chr172738 317 ------
NM_205768chr142075 843 698 668 ------
NM_205834chr19128 ------
NM_205842chr23811 326 128 1608 --2685 518
NM_205860chr183100 3015 2072 2043 613 552 332 202 12363 ----
NM_206594chr193566 3518 3507 3491 3282 3181 3060 2766 2307 23626 3544 22421 2255 --
NM_206595chr193566 3518 3507 3491 3282 3181 3060 2766 2307 23626 3544 22421 2255 --
NM_206853chr664097 3800 3777 1549 390 207 23988 3070 52923 2897 2573 1633 1250 11318
NM_206854chr6105358 5061 5038 3681 3569 1651 1468 717 317 128 35249 4331 398 44184 4158 3834 307 13399
NM_206855chr6126323 6026 6003 4646 4534 2433 1682 1282 1093 696 605 220 46214 5296 1363 359 55149 5123 4799 3859 1272 14364
NM_206860chr102149 117 ------
NM_206861chr102149 117 ------
NM_206862chr102149 117 ------
NM_206876chr232427 1137 179 --11212 1344
NM_206907chr5113308 3116 2454 2307 2285 2190 1349 1301 1234 820 215 12759 12786 --
NM_206909chr8108384 8272 8209 8134 7672 6307 5356 5242 2155 135 48244 6268 3219 2933 12170 --
NM_206943chr23865 787 286 1858 --145
NM_207012chr1063466 2992 1271 736 611 210 13446 ----
NM_207015chr382371 2154 1782 1685 863 750 577 136 --12133 --
NM_207171chr131250 380 287 ------
NM_207189chr11108 ------
NM_207292chr332221 467 87 --33367 2459 609 22485 965
NM_207293chr332221 467 87 --33367 2459 609 22485 965
NM_207294chr332221 467 87 --33367 2459 609 22485 965
NM_207295chr332221 467 87 --33367 2459 609 22485 965
NM_207296chr332221 467 87 --33367 2459 609 22485 965
NM_207297chr332246 492 112 --33392 2484 634 22510 990
NM_207303chr1033331 269 99 24116 1335 42956 1366 415 23 --
NM_207304chr1362592 2432 2067 1713 1702 1665 ----22272 863
NM_207337chr1231075 962 734 ------
NM_207352chr442361 848 373 176 ------
NM_207396chr12566 262 ------
NM_207406chr4125947 5462 5285 4981 4388 4278 2551 2219 1533 1469 904 618 24256 1011 26261 4784 15549
NM_207517chr1531933 1853 1740 --31927 1601 1313 --
NM_207647chr95991 924 572 275 104 11928 ----
NM_212543chr31134 ------
NM_212554chr1051571 1453 1328 620 311 ------
NM_212558chr964213 4133 3677 3438 1441 1342 33795 3593 977 12992 --
NM_213589chr2135316 4092 3507 3480 1162 426 404 280 199 187 177 142 130 23977 3939 23788 667 --
NM_213590chr1375274 5147 4269 1249 535 296 247 --15135 --
NM_213598chr191424 ------
NM_213618chr111233 ------
NM_213648chr521847 1505 ------
NM_213654chr331548 488 343 21563 649 --11274