TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1185-5p
miRNA Sequence: AGAGGAUACCCUUUGUAUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542004 1322 751 426 --11639 --
NM_000044chrX1374 1302 ----
NM_000051chr1152607 2330 768 725 690 12445 1682 --
NM_000052chrX123201 3127 2513 2359 2327 2156 1372 1108 855 569 558 157 ------
NM_000055chr31363 ------
NM_000067chr82524 37 --1684 --
NM_000074chrX2936 111 ------
NM_000081chr12676 271 ----1750
NM_000084chrX96593 4908 2547 2214 2095 1963 1769 1496 906 35032 4826 1036 26537 531 --
NM_000089chr74703 659 335 94 ------
NM_000091chr252824 2718 2344 1787 467 ----1880
NM_000092chr253922 3409 2838 1184 148 34207 4122 281 13012 13107
NM_000111chr7--127 ----
NM_000112chr5124815 4719 2008 1760 1633 1414 855 829 776 566 337 238 25252 3871 11873 --
NM_000114chr203931 479 397 --1206 --
NM_000125chr663804 3521 1437 898 512 173 ------
NM_000138chr1552442 1004 810 301 135 ------
NM_000141chr102966 181 11156 11092 --
NM_000163chr532196 1998 1482 ------
NM_000165chr661332 1288 1050 644 572 462 ------
NM_000167chrX41509 1416 606 336 2500 322 ----
NM_000168chr7113141 3062 2995 2608 2574 2336 2236 2033 441 322 183 1747 12183 --
NM_000176chr553564 2887 2414 747 75 ------
NM_000189chr262305 2270 1847 1632 468 418 ------
NM_000204chr4129 1175 ----
NM_000208chr1994397 4117 3985 3784 3610 3367 2922 1368 1360 21560 86 ----
NM_000217chr1275220 3388 1774 1663 1407 970 655 15204 1676 24292 3601
NM_000222chr421859 1447 ------
NM_000232chr472799 2392 704 684 670 153 35 32609 735 202 --1476
NM_000238chr72397 151 ------
NM_000240chrX82109 1797 1465 1447 876 837 417 311 ------
NM_000248chr341953 692 559 181 --1775 --
NM_000252chrX41381 1271 948 409 ------
NM_000259chr15115962 4958 4940 4152 3906 2472 2246 1991 1931 1658 200 44640 4040 329 220 26369 5438 --
NM_000264chr962988 2247 1262 789 743 599 ------
NM_000266chrX3878 130 111 ------
NM_000267chr1793287 2932 2825 2818 2636 1120 780 690 69 --13188 --
NM_000276chrX82149 2002 1805 1484 352 321 164 25 --2792 645 1521
NM_000284chrX41711 1703 1283 811 11785 11658 --
NM_000291chrX2899 633 1168 ----
NM_000297chr461961 1620 1360 816 130 51 1241 ----
NM_000314chr1022041 124 ------
NM_000321chr1341314 1105 495 443 --1453 1111
NM_000332chr6106979 6431 5799 5426 2867 2759 2437 2427 2062 1112 16266 36287 497 99 --
NM_000337chr5116465 6256 6231 6151 5175 4518 4227 4160 1452 721 696 36245 5317 379 2408 205 --
NM_000340chr331397 1189 410 ------
NM_000346chr1731785 1587 415 --1431 --
NM_000353chr1641189 827 198 176 ----11117
NM_000368chr964809 4271 3081 2955 1561 1417 ------
NM_000393chr221966 736 21907 189 1160 --
NM_000408chr273457 2694 2626 799 525 312 290 12771 --11155
NM_000414chr5172 --1217 1240
NM_000428chr1472505 2190 2134 1826 1696 1648 572 ------
NM_000430chr1783475 2494 2335 1176 509 468 115 98 23198 2704 23430 786 --
NM_000437chr132219 2133 720 --11930 --
NM_000449chr161126 940 472 248 113 91 --21317 1267 --
NM_000451chrX22010 1950 1364 22001 1767 --
NM_000461chr384352 3426 1482 1427 1072 953 912 563 33162 1109 720 14132 --
NM_000462chr152275 229 --11390 --
NM_000474chr72663 524 1253 ----
NM_000478chr11170 1285 ----
NM_000484chr214770 338 291 193 ------
NM_000489chrX103216 3193 2720 2447 2253 639 594 568 205 122 13417 1776 --
NM_000495chrX21040 953 --1789 --
NM_000503chr811804 ------
NM_000522chr731175 1015 411 11100 ----
NM_000523chr21444 1875 --1403
NM_000533chrX51966 1339 1238 747 410 --1440 --
NM_000538chr1341389 1372 212 38 ----11445
NM_000540chr19------148
NM_000544chr6_cox_hap1113439 3349 3343 3301 3240 2744 2495 2471 2220 2178 1108 --43133 3122 912 489 --
NM_000555chrX127544 7483 6958 5884 5639 5602 5560 5263 5018 2943 2404 231 27844 2385 1949 --
NM_000574chr131144 1001 917 --11064 --
NM_000582chr42424 396 ------
NM_000598chr711504 11067 ----
NM_000602chr721503 1048 ------
NM_000610chr1122604 932 2694 484 --12344
NM_000611chr11127004 6401 5018 2789 2757 2395 2248 1818 1766 1110 730 405 34832 907 508 1646 15603
NM_000615chr1112546 12959 ----
NM_000618chr12146594 6525 6047 5660 5636 5397 5160 4978 4220 4188 1929 1794 282 48 25844 2320 11905 --
NM_000618chr12146594 6525 6047 5660 5636 5397 5160 4978 4220 4188 1929 1794 282 48 25844 2320 11905 --
NM_000621chr1341322 1151 449 139 ------
NM_000633chr1875088 3846 3835 3643 3376 1491 869 11638 ----
NM_000663chr1653118 1154 725 589 408 22823 2596 ----
NM_000684chr1021162 104 ------
NM_000693chr1521640 1571 ------
NM_000719chr1286034 5196 4591 2536 1889 1846 1215 386 26522 2242 26331 4479 --
NM_000726chr221048 951 ------
NM_000788chr421355 430 --2524 59 --
NM_000809chr4159320 8694 7653 7373 6929 6570 6233 6145 6086 3623 3601 2195 2102 440 83 13418 57141 5608 3246 2585 577 18424
NM_000810chr151100 ------
NM_000813chr5135320 5294 5076 5050 5009 4623 1205 1165 527 407 368 311 132 --11939 --
NM_000814chr1544035 3565 2648 2616 24072 1188 23106 522 --
NM_000817chr23770 403 118 --11249 --
NM_000826chr472402 2380 1792 1632 1023 778 250 ------
NM_000829chr1142275 2071 732 103 ------
NM_000831chr1115860 5495 5088 2048 1502 1089 971 713 552 204 193 15119 15257 --
NM_000833chr161170 --41385 1281 1225 1121 --
NM_000838chr632573 2139 1966 1592 1330 --
NM_000842chr111251 ------
NM_000844chr311067 ----1176
NM_000855chr111334 ------
NM_000859chr521660 561 ------
NM_000860chr421262 272 --11488 165
NM_000864chr13108 38 29 1982 ----
NM_000868chrX22026 1936 12038 --12279
NM_000875chr1556915 5948 1851 508 312 1116 14571 15941
NM_000885chr241963 822 760 290 1804 ----
NM_000891chr1753401 3235 3066 2843 917 21141 1111 1990 --
NM_000899chr12114232 4075 4063 3662 3504 3248 2998 874 413 382 96 13946 12718 --
NM_000901chr472569 2510 2345 1730 908 866 441 ------
NM_000908chr52555 302 ------
NM_000922chr116981 776 719 258 201 144 ------
NM_000926chr11149462 9149 8499 8227 8139 7898 5980 5800 5725 3248 1125 862 835 269 59409 8854 7800 7537 829 58211 3772 2396 982 724 22596 1411
NM_000935chr341093 1043 983 772 --11019 11156
NM_000944chr462341 1770 903 759 721 366 11548 1695 --
NM_000945chr231878 1559 176 1448 ----
NM_000956chr1421012 772 1751 ----
NM_000964chr1721416 502 2365 327 ----
NM_000983chr13521 412 195 --172 --
NM_000984chr17146 --1151 1397
NM_001001323chr1262866 2356 2134 1040 379 161 11994 12798 --
NM_001001344chrX22057 828 1480 ----
NM_001001389chr1122604 932 2694 484 --12344
NM_001001390chr1122604 932 2694 484 --12344
NM_001001391chr1122604 932 2694 484 --12344
NM_001001392chr1132650 978 64 2740 530 --12390
NM_001001395chr1232403 1128 51 --22264 767 --
NM_001001419chr574250 3934 1972 1644 1047 653 403 13864 44600 4301 3731 3379 1927
NM_001001420chr574250 3934 1972 1644 1047 653 403 13864 44600 4301 3731 3379 1927
NM_001001664chr2114083 3539 3485 2531 1575 1417 998 656 404 360 169 ----1221
NM_001001701chr452192 1891 1747 933 463 --32169 1485 633 --
NM_001001872chr143627 211 45 ----1611
NM_001001890chr2143805 3179 1440 775 --12837 --
NM_001001928chr22148288 8254 8029 7694 7654 7571 7267 7179 7145 6403 1892 1640 1233 159 25525 3215 --15064
NM_001001936chr1041130 907 765 466 ------
NM_001001971chr1061427 1284 1166 923 513 69 --1231 --
NM_001001973chr101150 122 ----
NM_001001995chrX31584 1443 740 ----1422
NM_001002009chr71202 ----194
NM_001002010chr71202 ----194
NM_001002255chr63335 327 127 164 ----
NM_001002269chr91160 ------
NM_001002838chrX71794 1408 1347 1302 1161 691 438 1493 1238 --
NM_001002860chr14114684 4436 4047 3958 3543 3395 3317 1703 1495 1423 550 14033 13991 --
NM_001002901chr12187 95 1459 ----
NM_001002909chr172629 497 11850 1203 --
NM_001002919chr22377 75 1403 ----
NM_001003652chr18188569 8331 8150 7516 7497 6672 6414 5937 5720 5708 5647 3248 3092 2919 2396 1866 1263 607 12208 26218 936 27637 760
NM_001003674chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_001003675chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_001003679chr111405 --1616 --
NM_001003712chr12123642 3615 3432 3360 2999 2962 2933 1550 785 326 181 151 --21115 537 21561 160
NM_001003760chr693525 3516 3159 2469 2378 1357 1196 1130 141 --22264 816 --
NM_001003800chr953283 3101 2398 612 295 32855 2761 217 13133 --
NM_001003894chrY--182 ----
NM_001003895chrY298 53 ------
NM_001003940chr1523850 3223 --11172 --
NM_001003942chr1523850 3223 --11172 --
NM_001004065chr923926 657 22587 119 12952 11571
NM_001004196chr3186 --11092 --
NM_001004304chr1263195 2204 2173 1975 1242 1102 --23070 2248 --
NM_001004306chr1731830 1663 1263 --11755 --
NM_001004317chr694478 4261 3523 3027 1652 1617 1347 1292 926 ----14455
NM_001004360chr241431 692 619 379 --11409 --
NM_001004419chr12104533 4470 4433 4061 3115 1505 1228 711 636 464 14298 23451 543 --
NM_001004722chr2--2884 122 ----
NM_001005266chr152730 694 1463 ----
NM_001005267chr152730 694 1463 ----
NM_001005268chr152730 694 1463 ----
NM_001005269chr152730 694 1463 ----
NM_001005375chrY3700 236 94 ------
NM_001005386chr242430 969 850 134 ------
NM_001005404chr1763958 1352 666 540 273 127 11556 14286 14193
NM_001005463chr103857 839 651 1592 1713 199
NM_001005473chr5166669 6347 6251 5514 5422 5371 4920 4536 4515 2630 2459 2371 2324 1544 1279 82 15202 --25608 4168
NM_001005474chr321469 538 --11235 --
NM_001005476chr21747 ------
NM_001005502chr12104918 4547 4503 3381 2028 1219 1171 998 382 117 15238 ----
NM_001005527chr341265 1205 408 229 1374 --11039
NM_001005609chrX63827 3462 3344 2372 907 540 --12608 --
NM_001005612chrX1147 --1184 --
NM_001005732chr21--1164 ----
NM_001005733chr21--2247 164 ----
NM_001005743chr1441007 972 892 24 --21172 1105 --
NM_001005744chr1441007 972 892 24 --21172 1105 --
NM_001005745chr1441007 972 892 24 --21172 1105 --
NM_001005746chr221048 951 ------
NM_001005747chr221048 951 ------
NM_001005845chr821687 747 21244 694 --178
NM_001005849chr172397 124 161 ----
NM_001006600chr532329 2298 2008 12216 ----
NM_001006610chr161872 11020 ----
NM_001006623chr232276 1863 368 21620 177 --1199
NM_001006684chrX168 ------
NM_001006932chr6102983 2940 2733 2691 2326 2205 1318 612 301 41 ------
NM_001006946chr231644 1537 1458 ------
NM_001007067chr841079 1045 198 125 ------
NM_001007068chr841079 1045 198 125 ------
NM_001007069chr841079 1045 198 125 ------
NM_001007070chr841079 1045 198 125 ------
NM_001007097chr994867 3888 3293 3154 1678 1581 1307 1161 1104 14932 ----
NM_001007102chr62356 243 ------
NM_001007156chr1541872 643 325 258 --1451 --
NM_001007214chr12599 138 1253 ----
NM_001007246chr213521 230 119 ------
NM_001007250chr11916 294 22 ----
NM_001007257chr121283 1028 ------
NM_001007466chr685069 4027 3560 1840 1490 1324 468 440 35017 1027 538 1476 --
NM_001007471chr93563 100 52 --1672 --
NM_001007527chr51144 ------
NM_001007538chr1321793 58 ------
NM_001007553chr151162 923 497 334 112 --11112 --
NM_001007559chr1841410 833 489 88 ------
NM_001007794chr15581 518 264 154 124 ------
NM_001008388chr42183 133 --1208 --
NM_001008391chr112724 588 --3282 210 176 --
NM_001008405chr721647 676 11413 ----
NM_001008408chr785005 4466 4150 2559 1518 1208 221 114 --25307 1107 1417
NM_001008495chr832083 1697 1438 11646 ----
NM_001008529chr17382 44 33 ----174
NM_001008541chr104763 671 533 319 ----12113
NM_001008541chr104763 671 533 319 ----12113
NM_001008564chr1321446 1425 1221 --1898
NM_001008660chr1141380 1104 436 371 2454 60 ----
NM_001008701chr1911894 ----12910
NM_001008707chr1441501 1399 549 283 1353 11385 11526
NM_001008726chr143625 407 166 ----11435
NM_001008738chr552387 1907 901 150 131 32315 2222 997 11031 --
NM_001008783chr63906 744 91 ------
NM_001008895chr1321304 181 11280 ----
NM_001008925chr453436 2858 2634 663 654 --158 22189 1047
NM_001009554chr4124575 4434 4282 4134 3808 3066 1501 1372 1063 886 524 325 21714 508 14031 13165
NM_001009554chr4124575 4434 4282 4134 3808 3066 1501 1372 1063 886 524 325 21714 508 14031 13165
NM_001009555chr461698 1648 708 650 504 396 11723 ----
NM_001009571chr741530 1309 234 70 1643 1434 --
NM_001009880chr22124608 4435 3956 3854 3819 3796 3384 1265 1214 885 827 502 24283 3378 14006 --
NM_001009899chr3146435 6424 6347 6250 5947 5392 5083 5067 4784 4390 2403 1778 1433 189 15505 64616 4404 1080 869 747 130 1552
NM_001009909chr1142484 1235 288 51 23056 172 --13586
NM_001009959chr272103 1961 1696 967 597 389 220 125 ----
NM_001009993chr273981 3658 3473 3091 584 486 270 --1938 --
NM_001010853chr633060 1163 613 12365 ----
NM_001010861chr162773 2701 2641 2494 2466 2139 21037 402 ----
NM_001010862chrX63332 2682 2259 1257 267 91 1488 12598 --
NM_001010867chr166246 5390 5243 2320 2312 1971 --25798 5056 14292
NM_001010870chr61492 ----1522
NM_001010888chrX83835 3738 3307 3040 1829 735 264 166 ----14121
NM_001010891chr5146890 6798 6688 6402 6315 5989 5402 5186 2224 1367 1178 955 936 170 32310 1576 756 11680 24809 4407
NM_001010895chr941547 1475 1464 782 1473 1519 --
NM_001010927chr61545 ------
NM_001010934chr731150 1081 923 ------
NM_001010986chrX51960 1593 634 543 125 ------
NM_001011513chr473814 3521 2928 2902 2632 917 447 23980 3680 14016 --
NM_001011537chr342343 2161 2013 1991 ----12399
NM_001011546chr202797 133 --148 --
NM_001011553chr7------2614 257
NM_001011645chrX1374 1302 ----
NM_001011658chrX51795 1530 1391 687 356 --12104 1109
NM_001011666chr796122 5708 5125 5090 5067 4110 1642 1565 1416 --34717 4202 1434 14741
NM_001011705chr131126 --1285 --
NM_001011708chr221166 563 --11173 12517
NM_001011713chr1421382 631 ------
NM_001011885chr1521322 722 ------
NM_001012264chr141235 --2732 180 --
NM_001012267chr931341 438 375 21436 524 --1272
NM_001012393chr11104654 4513 4135 1157 1068 596 548 440 320 112 24921 1058 34932 2063 954 --
NM_001012398chr1631099 865 828 ----1803
NM_001012410chr33509 385 355 123 ----
NM_001012420chr1562696 2347 2026 1172 1017 326 ------
NM_001012716chr183371 280 97 ------
NM_001012751chr1051668 1315 706 424 271 ------
NM_001012755chrX135073 4753 4384 4155 3516 1637 1569 1288 1084 1036 101 43 35 13378 33196 3184 369 11712
NM_001012761chr542266 632 386 126 11094 22564 709 --
NM_001012968chrX62686 2433 2419 926 813 383 1405 11820 --
NM_001013031chr1062208 1056 840 803 752 334 22393 2147 ----
NM_001013398chr711504 11067 ----
NM_001013406chr761748 1491 1389 1356 1208 505 ----21564 494
NM_001013438chr331013 927 891 ------
NM_001013439chr34859 773 737 333 ------
NM_001013620chr12188441 8276 7829 6411 5991 5335 3208 2815 2763 2096 1979 1946 1898 1534 955 908 707 487 57995 6844 1231 983 114 48359 7539 1693 349 --
NM_001013659chr1974579 1985 1580 1448 1434 1402 142 --31185 436 293 24071 358
NM_001013690chr1242395 933 394 385 ------
NM_001014435chr16140 ------
NM_001014797chr1032940 2291 1851 17266 1435 26512 6249
NM_001014972chr21208 ------
NM_001015045chr442240 1915 426 387 1634 ----
NM_001015048chr1453236 2492 2184 591 238 ------
NM_001015049chr1453236 2492 2184 591 238 ------
NM_001015877chrX73090 2533 2245 2155 640 123 58 ------
NM_001015880chr1041264 601 545 224 --1420 11420
NM_001015882chr91342 ----1727
NM_001015887chr341848 1833 687 216 --11157 --
NM_001017368chr1762511 2488 880 583 468 406 1806 ----
NM_001017371chr221315 81 ------
NM_001017395chr332993 1432 1398 13639 12486 13448
NM_001017415chr13657 616 89 ------
NM_001017416chr13657 616 89 ------
NM_001017424chr131430 1408 484 ------
NM_001017425chr131430 1408 484 ------
NM_001017523chr1221184 695 ----11758
NM_001017920chr2----1125 --
NM_001017923chr1421553 248 ----11094
NM_001017926chr82641 399 ----1339
NM_001017969chr91153 ------
NM_001017995chr554357 4229 4185 659 84 --14243 14306
NM_001018056chr93524 382 178 ------
NM_001018064chr9125 21997 1399 ----
NM_001018065chr9105904 5684 5277 4835 4811 4782 4250 2101 1959 783 11569 45432 894 602 571 --
NM_001018066chr9105904 5684 5277 4835 4811 4782 4250 2101 1959 783 11569 45432 894 602 571 --
NM_001018067chr145148 3506 1609 1366 35043 3278 1493 ----
NM_001018068chr145148 3506 1609 1366 35043 3278 1493 ----
NM_001018069chr145148 3506 1609 1366 35043 3278 1493 ----
NM_001018072chr1221184 695 ----11758
NM_001018074chr553564 2887 2414 747 75 ------
NM_001018075chr553564 2887 2414 747 75 ------
NM_001018076chr553564 2887 2414 747 75 ------
NM_001018077chr553564 2887 2414 747 75 ------
NM_001018111chr782896 2782 2518 1371 1272 911 644 584 ------
NM_001018676chr81436 ------
NM_001018677chr81436 ------
NM_001020825chr521039 362 ------
NM_001023567chr1542083 2032 1786 210 ------
NM_001023587chr33844 736 198 --1985 --
NM_001024071chr142708 229 ----1161
NM_001024094chr553564 2887 2414 747 75 ------
NM_001024218chr142154 56 ------
NM_001024226chr111039 ------
NM_001024227chr111039 ------
NM_001024228chr111039 ------
NM_001024372chr872252 1611 1461 784 530 510 150 12245 1656 --
NM_001024455chrX32194 2174 2026 12466 21032 388 --
NM_001024647chr12117513 6780 6148 6069 6045 5849 4986 4818 1562 544 179 16755 11953 11179
NM_001024809chr1721416 502 2365 327 ----
NM_001024847chr332440 2342 951 1974 1931 12174
NM_001024855chr351730 1490 1360 1185 154 11213 ----
NM_001024912chr1991900 1699 1597 1568 755 533 490 146 34 ------
NM_001024947chr5------1760
NM_001024948chr153467 2669 2632 754 526 22741 2342 ----
NM_001025076chr1066003 5492 4689 2450 1816 1246 153 11543 35962 3837 2413
NM_001025077chr1067361 6850 6047 5057 2604 1224 11411 32901 1050 245 27320 5195
NM_001025079chr364084 3726 2706 2541 1308 1176 1601 1736 --
NM_001025105chr521388 182 ------
NM_001025107chr151789 1752 630 248 162 12082 --12382
NM_001025107chr151789 1752 630 248 162 12082 --12382
NM_001025108chr292964 2823 2644 1624 1479 1449 1229 1078 1033 --33313 3287 3180 13614
NM_001025233chr1262086 2004 792 582 503 324 12199 ----
NM_001025266chr3104026 3818 3685 3043 1685 1365 437 428 211 68 --14396 --
NM_001025356chr1252995 2953 2188 1181 660 --22549 686 1351
NM_001025366chr671877 1643 1445 1346 1306 602 429 ------
NM_001025366chr671877 1643 1445 1346 1306 602 429 ------
NM_001025367chr671877 1643 1445 1346 1306 602 429 ------
NM_001025367chr671877 1643 1445 1346 1306 602 429 ------
NM_001025368chr671877 1643 1445 1346 1306 602 429 ------
NM_001025368chr671877 1643 1445 1346 1306 602 429 ------
NM_001025369chr671893 1659 1461 1362 1322 618 445 ------
NM_001025369chr671893 1659 1461 1362 1322 618 445 ------
NM_001025370chr671877 1643 1445 1346 1306 602 429 ------
NM_001025370chr671877 1643 1445 1346 1306 602 429 ------
NM_001025580chrX73717 3697 3356 1699 1600 1467 937 --1318 --
NM_001025595chr431668 1594 236 ------
NM_001025603chr161126 940 472 248 113 91 --21317 1267 --
NM_001029858chr6102907 2719 2548 2116 1297 940 868 625 223 131 ------
NM_001029860chr8184 ------
NM_001029863chr631093 801 726 ----23170 2591
NM_001029875chr572825 2816 2456 2378 2233 1114 592 12185 11921 --
NM_001030006chr172695 245 ----22522 2196
NM_001030007chr1633804 3249 2737 1465 23155 182 --
NM_001030055chr14104642 4006 3649 3513 1713 1613 1584 1387 1359 1111 13996 --14351
NM_001030272chr112434 417 ------
NM_001030273chr112434 417 ------
NM_001030287chr121169 280 31101 46 35 ----
NM_001031679chr1233422 2605 71 12819 ----
NM_001031690chr772863 2804 2784 2730 2632 2115 131 --32826 1168 960 --
NM_001031695chr22125092 4756 4711 4457 4378 4023 3850 1550 1219 860 477 316 --21868 1294 --
NM_001031702chr3----2770 244 --
NM_001031709chr10------1345
NM_001031711chr541780 1414 1246 1233 ------
NM_001031716chr21120 --1323 --
NM_001031722chr61141 124 ----
NM_001031732chr473704 3608 3555 2398 793 784 732 23526 3283 ----
NM_001031738chr2197 --153 --
NM_001031804chr1633777 3262 292 33759 878 767 ----
NM_001031812chr53942 556 335 ----11978
NM_001031855chrX189 ------
NM_001032221chr971204 736 668 420 226 213 140 11182 11349 1488
NM_001032282chr841321 1274 1099 1004 --21181 486 --
NM_001032283chr12----1407 --
NM_001032284chr12----1407 --
NM_001032288chr2021138 145 11244 ----
NM_001032293chr17----1117 --
NM_001032296chr1372625 2277 1912 1851 801 369 52 ------
NM_001032380chr104689 442 150 127 --1492 --
NM_001032393chrX3775 585 159 ------
NM_001032394chr652745 1938 1060 804 533 ----1621
NM_001032395chr652612 1805 927 671 400 ----1488
NM_001033045chr253692 1003 699 260 37 23951 2826 12735 22843 2719
NM_001033057chr321831 1749 ------
NM_001033059chr641441 772 476 188 1380 21501 222 --
NM_001033085chr21120 ------
NM_001033087chr20102664 2259 2156 2081 2036 1221 931 704 325 122 --21322 250 12233
NM_001033117chr394898 4864 4851 4426 3325 3277 1274 892 330 11399 ----
NM_001033503chr51408 ------
NM_001033507chr121512 52 21962 276 ----
NM_001033561chr172906 167 ------
NM_001033576chr1762654 2539 2515 788 684 170 1924 ----
NM_001033578chr852166 1662 569 247 203 ------
NM_001033581chr1------156
NM_001033581chr1------156
NM_001033582chr1------156
NM_001033659chr1731392 1354 1111 ------
NM_001033756chr671811 1577 1379 1280 1240 536 363 ------
NM_001033756chr671811 1577 1379 1280 1240 536 363 ------
NM_001033925chr1032155 1916 331 ------
NM_001034837chr52623 135 ------
NM_001034838chr52623 135 ------
NM_001034845chr42534 461 11267 ----
NM_001034850chr551555 1518 504 329 316 11211 ----
NM_001034852chr1461976 1765 1405 1323 802 481 --1233 --
NM_001034915chr831238 575 172 126 ----
NM_001034954chr1053156 3076 2923 2657 2240 --1785 1906
NM_001034955chr1053156 3076 2923 2657 2240 --1785 1906
NM_001034956chr1053156 3076 2923 2657 2240 --1785 1906
NM_001034957chr1053156 3076 2923 2657 2240 --1785 1906
NM_001035260chr103554 454 220 --1486 --
NM_001035511chr151724 1479 746 651 342 --21847 165 11785
NM_001035512chr171831 1586 853 758 449 113 27 --21954 272 11892
NM_001035513chr171831 1586 853 758 449 113 27 --21954 272 11892
NM_001035521chr24792 735 665 22 ----1811
NM_001037132chr741366 649 220 47 11772 1446 --
NM_001037133chr741366 649 220 47 11772 1446 --
NM_001037165chr798522 8225 7375 7085 6749 5778 1975 1519 1379 1997 28364 5541 12239
NM_001037174chr252016 1898 1428 1405 247 --1541 --
NM_001037317chr162773 2701 2641 2494 2466 2139 21037 402 ----
NM_001037332chr562246 2014 1936 1817 1790 517 12565 ----
NM_001037333chr562246 2014 1936 1817 1790 517 12565 ----
NM_001037334chr1831575 425 187 --1897 --
NM_001037339chr11369 --2562 36 11266
NM_001037340chr11369 --2562 36 11266
NM_001037341chr11369 --2562 36 11266
NM_001037341chr11369 --2562 36 11266
NM_001037582chr451288 1201 1124 613 308 ------
NM_001037954chr1163158 2498 847 676 252 153 22651 2345 13395 --
NM_001038628chr331500 1381 393 --11315 --
NM_001038640chr153394 278 84 ------
NM_001038702chr531878 1093 207 1812 ----
NM_001038707chr132170 613 530 --11539 21701 694
NM_001038707chr132170 613 530 --11539 21701 694
NM_001039029chr1211944 ------
NM_001039348chr22912 311 ------
NM_001039349chr22912 311 ------
NM_001039459chr721138 457 ------
NM_001039479chr1482243 2070 1834 1632 1587 1552 969 893 --12043 --
NM_001039538chr242678 2587 1331 369 --12558 --
NM_001039547chr3228005 7824 7335 6714 6583 6573 6472 6301 6174 6165 5227 3080 2912 2718 2605 1853 1666 1638 1328 1193 832 290 --36446 1497 224 --
NM_001039577chr144388 3957 1717 174 156 13521 1929
NM_001039585chr183462 1634 1609 1499 1307 112 94 81 --13474 --
NM_001039590chrX83505 3322 1522 1479 1393 1154 1017 605 23316 1286 ----
NM_001039591chrX83505 3322 1522 1479 1393 1154 1017 605 23316 1286 ----
NM_001039618chr11115900 5877 5625 5291 3799 1901 1585 1536 1334 1259 1130 25480 84 11107 --
NM_001039649chr131279 ------
NM_001039697chr981404 1269 634 459 332 299 280 266 --11138 --
NM_001039762chr1041743 932 641 181 ------
NM_001039840chrX135449 4436 4322 4148 3850 2249 1180 1075 937 814 498 123 103 54605 3665 1998 1159 1018 25065 4951 14135
NM_001039888chr11548 ------
NM_001039916chr1231010 445 155 --11038 2355 340
NM_001039917chr1231010 445 155 --11038 2355 340
NM_001039918chr1231010 445 155 --11038 2355 340
NM_001039919chr1231010 445 155 --11038 2355 340
NM_001039920chr1231010 445 155 --11038 2355 340
NM_001039937chr1373294 3131 2907 2734 2702 1141 138 12971 137 --
NM_001040001chr621646 344 --1554 --
NM_001040058chr42424 396 ------
NM_001040060chr42424 396 ------
NM_001040100chr36974 873 425 371 244 133 --1431 --
NM_001040142chr232251 939 916 1574 --11619
NM_001040143chr232251 939 916 1574 --11619
NM_001040152chr773850 3768 3426 1704 1269 1164 93 33484 3175 1767 35077 852 456 24774 1248
NM_001040159chr431348 581 300 1535 175 --
NM_001040167chr71892 ------
NM_001040202chr422475 1021 1186 22051 537 --
NM_001040272chr922152 1761 ------
NM_001040273chr10--1378 32108 2096 1840 --
NM_001040284chr16105272 5021 4778 3759 3685 3671 2350 1898 1105 726 13734 25978 1310 --
NM_001040409chr23930 805 90 ------
NM_001040441chr154923 1414 1265 539 268 14122 1248 --
NM_001040446chr542568 811 355 328 12419 ----
NM_001040450chr1551971 1843 1834 1803 588 --22304 334 --
NM_001040453chr1551971 1843 1834 1803 588 --22304 334 --
NM_001040458chr531812 1290 268 11396 ----
NM_001040619chr141619 1182 1137 127 31551 496 485 ----
NM_001040653chr362560 2521 2408 2298 75 63 1191 ----
NM_001040665chr774675 4449 4374 1914 1607 1320 673 14943 24854 4248 11011
NM_001040708chr821084 163 ------
NM_001040712chr942362 1047 806 679 ------
NM_001042355chr16115211 4927 4749 4642 4328 4236 3881 1160 1030 502 121 12019 11870 --
NM_001042388chr182264 199 ------
NM_001042403chr122331 287 ------
NM_001042404chr131284 542 172 --21933 1587 --
NM_001042412chr16115211 4927 4749 4642 4328 4236 3881 1160 1030 502 121 12019 11870 --
NM_001042413chr953821 3441 2822 2692 1622 21517 425 1609 --
NM_001042424chr432913 2833 2526 22728 167 1762 1855
NM_001042437chr21877 ------
NM_001042440chr531516 1445 167 145 11760 --
NM_001042441chr531516 1445 167 145 11760 --
NM_001042442chr531516 1445 167 145 11760 --
NM_001042443chr531516 1445 167 145 11760 --
NM_001042444chr531516 1445 167 145 11760 --
NM_001042445chr531516 1445 167 145 11760 --
NM_001042446chr531516 1445 167 145 11760 --
NM_001042453chrX51367 1321 657 430 229 1362 ----
NM_001042473chr1032009 713 470 11537 1320 --
NM_001042476chr1662033 1994 1970 1632 1410 26 21776 1401 ----
NM_001042479chrX32097 504 328 --1385 12076
NM_001042480chrX32097 504 328 --1385 12076
NM_001042481chr1462565 2445 977 670 445 240 --2657 93 --
NM_001042492chr1793287 2932 2825 2818 2636 1120 780 690 69 --13188 --
NM_001042494chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_001042495chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_001042496chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_001042497chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_001042510chr842109 1472 821 224 11867 ----
NM_001042511chr842109 1472 821 224 11867 ----
NM_001042537chrX52256 1838 850 473 147 ------
NM_001042555chr12134569 4431 4285 4017 3775 3513 3272 1293 1089 895 689 461 292 14540 11324 1846
NM_001042599chr2157708 7610 7580 6437 6131 5762 5754 5554 5470 5117 2195 1917 1523 868 554 12027 --37078 1292 857
NM_001042601chr373077 3016 1230 860 560 219 52 32183 2009 698 ----
NM_001042603chr1264109 1430 1393 855 645 174 --11541 --
NM_001042604chr394686 4554 3928 3293 1869 1187 1072 789 608 34256 3436 1608 ----
NM_001042646chr351753 1573 1479 1445 1378 1489 21670 1550 11248
NM_001042681chr132529 2445 2193 1494 22458 103 --
NM_001042682chr132529 2445 2193 1494 22458 103 --
NM_001042682chr132529 2445 2193 1494 22458 103 --
NM_001042683chr651620 1518 1366 442 418 ------
NM_001042723chr19------148
NM_001042749chrX31830 723 346 --11814 11438
NM_001042750chrX31830 723 346 --11814 11438
NM_001042751chrX31830 723 346 --11814 11438
NM_001042762chr761026 934 893 786 251 101 --1877 1909
NM_001043318chr1484145 3945 3252 2710 1595 1571 1485 1047 --33710 3391 694 13152
NM_001043351chr131978 1499 613 11874 ----
NM_001044305chr641647 1278 1082 1052 ------
NM_001044385chr2104069 3753 3667 3648 3635 3354 1574 1480 1330 1203 ------
NM_001044722chr53942 556 335 ----11978
NM_001044723chr53942 556 335 ----11978
NM_001046chr532266 1108 834 168 2972 369 --
NM_001070chr171172 ------
NM_001079874chr12654 123 ----1378
NM_001083620chr472400 2378 1790 1631 1022 777 249 ------
NM_001083621chr174400 4246 3944 3816 1025 211 89 1797 11170 11061
NM_001099678chr395989 5123 5069 4494 4179 2396 1145 1001 782 1915 1634 21250 95
NM_001100108chr1148237 7891 6976 6651 6369 6017 5174 2864 1847 1570 1536 1277 1150 596 11384 11612 26923 1192
NM_001106chr3139777 8668 7597 7398 3796 3447 3373 1600 1222 1053 709 588 314 39678 3661 2555 16608 --
NM_001111chr151789 1752 630 248 162 12082 --12382
NM_001113490chrX43655 2924 445 330 ----23206 1163
NM_001117chr1832003 702 650 --11586 --
NM_001126chr13998 805 791 ------
NM_001128chr1633804 3249 2737 1465 23155 182 --
NM_001140chr171463 --1221 --
NM_001146chr852240 1993 1904 1849 414 1603 1521 --
NM_001148chr45803 738 527 369 328 --21658 1497 --
NM_001152chrX159 ------
NM_001155chr51455 ----1139
NM_001167chrX106782 6414 5653 4558 1957 1369 1205 1172 1112 336 65935 2228 1666 1512 1353 1199 --15994
NM_001173chr14104642 4006 3649 3513 1713 1613 1584 1387 1359 1111 13996 --14351
NM_001177chr1262419 1530 403 369 249 216 ------
NM_001178chr112434 417 ------
NM_001186chr2153295 3102 3003 1129 467 12918 ----
NM_001187chr212512 227 --1183 --
NM_001198chr642368 2240 826 360 ------
NM_001201chr463588 2482 1010 934 907 886 23772 1348 31267 1230 495 11538
NM_001204chr2177413 6950 6004 5291 5208 2275 2152 2129 2086 2061 1950 1766 1373 1131 1043 574 473 37178 6285 6128 21322 92 15597
NM_001206chr942745 2451 1073 138 --12404 --
NM_001219chr732257 1670 1552 2379 309 11733 --
NM_001241chr241845 1536 674 237 12297 ----
NM_001241chr241845 1536 674 237 12297 ----
NM_001256chr1752327 1957 1031 623 316 ------
NM_001257chr1661502 1135 411 260 212 185 ------
NM_001259chr774996 4616 4581 4060 1967 1905 1709 15389 24632 2541 1606
NM_001260chr13--1113 ----
NM_001273chr121113 ------
NM_001274chr113142 79 60 ------
NM_001282chr172695 245 ----22522 2196
NM_001290chr42849 279 ------
NM_001304chr1793371 3318 2976 2784 2731 2464 1473 837 777 11267 21459 139 12956
NM_001310chr1232116 345 41 --2700 514 --
NM_001315chr621526 305 11957 --11613
NM_001329chr1011634 11407 ----
NM_001331chr1142784 2719 2227 728 1352 11868 1954
NM_001333chr9159 ------
NM_001346chr372803 2612 2249 2203 2188 1911 509 12401 ----
NM_001351chr341647 632 604 148 ------
NM_001356chrX62455 2242 1621 630 347 119 22226 2147 ----
NM_001358chr41402 ------
NM_001364chr1164442 3689 3337 3306 3230 1918 --24172 3371 --
NM_001380chr101418 --1992 1742
NM_001381chr2--2413 362 ----
NM_001385chr81112 1423 ----
NM_001386chr871635 1576 889 735 724 611 348 ------
NM_001389chr21--1247 ----
NM_001396chr2122710 493 2566 206 1228 12647
NM_001399chrX63827 3462 3344 2372 907 540 --12608 --
NM_001401chr93615 533 33 ------
NM_001406chr177665 489 450 403 298 240 24 --1140 --
NM_001412chrX123631 3383 3194 2940 2932 2837 2831 2595 1409 685 177 45 13641 13046 1342
NM_001415chrX51710 1350 806 753 393 --1141 --
NM_001417chr1221935 411 1434 11868 --
NM_001418chr111210 --1522 --
NM_001418chr111210 --1522 --
NM_001419chr1964432 3612 3570 3080 1784 1315 11885 ----
NM_001421chrX41577 609 545 429 --11395 --
NM_001423chr1231908 1672 161 ------
NM_001438chr15427 379 306 204 29 ------
NM_001447chr521461 482 1379 ----
NM_001448chrX31649 1449 458 11631 ----
NM_001451chr162964 451 ------
NM_001453chr651563 1274 1257 645 417 --1651 --
NM_001455chr6104836 4715 4597 4424 3924 3653 3217 1986 1115 236 11948 1627 1829
NM_001457chr311456 ------
NM_001460chr183393 3006 2680 2579 2430 1357 1131 222 32309 926 52 12663 --
NM_001482chr152959 68 1779 --1634
NM_001491chr631677 871 841 ------
NM_001493chrX4712 190 168 67 1124 ----
NM_001521chr24792 735 665 22 ----1811
NM_001530chr1431162 1061 982 1716 ----
NM_001540chr7----186 --
NM_001543chr564511 4215 3378 3294 1837 1048 1627 1396 11169
NM_001546chr611302 21328 1054 1222 --
NM_001552chr1721036 409 --1942 --
NM_001557chr211334 --1864 --
NM_001560chrX62528 2295 2192 2016 838 56 21659 210 ----
NM_001584chr1171198 1131 1061 983 873 493 75 ------
NM_001587chrX82149 2002 1805 1484 352 321 164 25 --2792 645 1521
NM_001609chr1074487 4336 3727 2917 1135 1053 384 32801 1177 372 14384 11752
NM_001616chr252868 2352 2279 1223 994 ------
NM_001621chr752876 1107 628 604 264 --1331 13036
NM_001621chr752876 1107 628 604 264 --1331 13036
NM_001634chr641441 772 476 188 1380 21501 222 --
NM_001635chr72393 375 31101 993 196 ----
NM_001650chr1863625 2996 1618 1328 679 397 13409 --148
NM_001656chr521456 340 ------
NM_001658chr111039 ------
NM_001659chr1242179 1875 886 201 21013 900 32675 341 315 --
NM_001660chr32199 78 --1219 1756
NM_001661chr173699 636 208 --1532 --
NM_001665chr11------1222
NM_001668chr132279 1587 682 --12122 1411
NM_001674chr121169 280 31101 46 35 ----
NM_001678chr1751633 1574 1356 737 134 --21607 1217 --
NM_001681chr122780 646 ------
NM_001682chr1252580 2070 1848 754 93 --12512 --
NM_001690chr331934 725 298 11739 12550 --
NM_001695chr8104128 3742 3374 3114 2980 1537 1386 974 131 31 23593 449 23709 95 11699
NM_001699chr1931623 1232 1204 ------
NM_001701chr921327 1293 11066 21471 1166 --
NM_001703chr1--1226 ----
NM_001704chr6198 ------
NM_001707chr71167 ------
NM_001709chr1122283 644 12056 2424 336 --
NM_001730chr1311301 ------
NM_001730chr1311301 ------
NM_001731chr122945 306 ------
NM_001742chr72158 83 1490 176 --
NM_001745chr571174 909 840 385 254 158 48 --11045 --
NM_001748chr1----1937 --
NM_001750chr531516 1445 167 145 11760 --
NM_001753chr741848 1667 555 113 1533 ----
NM_001754chr2143805 3179 1440 775 --12837 --
NM_001755chr1631625 922 766 11845 2908 660 --
NM_001759chr1264785 3832 3571 3459 3210 1981 11723 35046 4632 604 --
NM_001768chr221292 42 1108 ----
NM_001777chr364084 3726 2706 2541 1308 1176 1601 1736 --
NM_001788chr7------2614 257
NM_001792chr182811 457 ------
NM_001825chr51116 ------
NM_001830chrX23879 1389 1763 32693 1582 1098 --
NM_001831chr831088 981 262 1833 ----
NM_001833chr92258 38 ------
NM_001839chr12561 81 ------
NM_001845chr132917 84 --1517 --
NM_001858chr6115013 4371 4286 3750 2055 1917 1305 1015 781 536 403 --11201 1930
NM_001873chr41191 ------
NM_001874chr12104918 4547 4503 3381 2028 1219 1171 998 382 117 15238 ----
NM_001892chr521388 182 ------
NM_001893chr171353 ------
NM_001918chr1149278 9127 9083 9031 8888 8764 8255 6724 5958 5661 2224 1152 1144 794 --46858 3128 2982 2038 --
NM_001920chr122662 248 ------
NM_001924chr1--1450 ----
NM_001933chr1461250 539 460 444 374 220 --11410 --
NM_001938chr121921 120 11740 ----
NM_001939chrX73586 3443 2594 1519 1389 738 36 53305 2462 1179 757 233 --2839 607
NM_001941chr1873809 2459 1375 1171 1029 677 163 --21099 1048 --
NM_001942chr1841875 1477 1317 312 ------
NM_001946chr1221102 184 ------
NM_001968chr41829 ----124
NM_001977chr44648 373 302 240 --11695 11596
NM_001981chr171937 1895 1551 880 453 369 37 --1409 --
NM_002006chr465431 5150 4844 4267 3550 464 --25237 196 --
NM_002009chr1521842 824 32056 773 548 ----
NM_002015chr1332835 2391 908 12056 12322 --
NM_002019chr133701 251 103 2762 225 ----
NM_002023chr121124 1038 11657 --11245
NM_002024chrX61784 1547 879 561 438 285 21815 340 11683 1837
NM_002025chrX198329 7553 7424 7083 6849 6812 6783 6687 6333 6084 6066 5690 3487 3401 3054 2660 2363 1411 794 57336 6502 3254 764 490 27774 6306 --
NM_002027chr81436 ------
NM_002040chr2132596 2410 88 23008 2674 12872 --
NM_002047chr7------1121
NM_002054chr2195 127 ----
NM_002056chr22866 769 2662 116 ----
NM_002076chr1273187 3175 2970 1315 1024 279 270 ------
NM_002077chr942091 1969 525 292 ------
NM_002078chr3--151 ----
NM_002092chr444908 4867 4117 3752 24256 3380 23791 1795 --
NM_002126chr1744153 3587 3548 3131 --34026 2661 1249 --
NM_002128chr1362575 2045 836 784 475 184 1321 1568 --
NM_002129chr41141 ------
NM_002131chr61135 11052 11340 --
NM_002140chr921171 42 ------
NM_002147chr172186 67 1700 ----
NM_002154chr51200 ------
NM_002158chr293395 3228 2574 2380 1420 1332 1223 734 304 12701 13615 12880
NM_002193chr231422 608 579 21793 1729 --11785
NM_002199chr44917 851 665 359 ------
NM_002202chr5------11076
NM_002207chr3284 45 --160 --
NM_002210chr253454 3384 3353 2800 697 12610 ----
NM_002214chr7165728 4852 4645 4631 4468 4452 4316 3480 2124 2025 1467 1139 916 642 438 283 --42200 1569 1040 871 23885 151
NM_002223chr1253288 2594 1533 1193 42 23548 1370 --23659 3052
NM_002228chr111195 --11179 11138
NM_002239chr231177 301 73 ------
NM_002240chr21164 1141 ----
NM_002252chr2--198 133 --
NM_002264chr363766 3073 1158 854 404 56 41136 984 543 77 11590 --
NM_002267chr1332021 978 471 --1449 --
NM_002268chr311405 1379 ----
NM_002270chr565435 4057 3914 1640 1572 1110 --25449 2001 --
NM_002271chr1332347 1934 834 ------
NM_002285chr292964 2823 2644 1624 1479 1449 1229 1078 1033 --33313 3287 3180 13614
NM_002312chr133373 201 97 ------
NM_002333chr1931209 1004 892 ------
NM_002336chr1294836 4807 4614 4465 3267 3123 1421 1389 1335 24350 4101 11045 --
NM_002355chr1251108 1092 945 438 144 --1995 --
NM_002356chr632639 2364 1976 11042 ----
NM_002372chr5--1700 ----
NM_002374chr242678 2587 1331 369 --12558 --
NM_002375chr352152 2013 1701 1684 773 1849 --2885 482
NM_002376chr141100 ------
NM_002387chr595175 5037 5025 4477 4290 3585 1529 1245 398 1699 24176 371 --
NM_002389chr15693 669 507 257 183 1169 ----
NM_002395chr651524 1057 1036 600 228 ------
NM_002445chr851383 1158 464 98 28 2641 306 ----
NM_002449chr551261 1042 973 944 207 1882 ----
NM_002451chr973868 3852 1197 1027 675 655 270 ------
NM_002468chr361726 1693 1681 1605 1446 172 1304 11363 --
NM_002469chr122311 69 ------
NM_002480chr1231004 116 91 ------
NM_002481chr1157910 7491 7223 6939 6637 6443 5141 2941 2597 2468 1987 1697 1535 800 548 43187 3180 2770 1873 52548 914 699 403 375 --
NM_002486chr962504 2283 737 544 242 41 2696 686 198 1522
NM_002487chr152636 314 ------
NM_002492chr3165 1439 133 --
NM_002499chr1582286 2276 2199 1633 911 900 585 233 1932 ----
NM_002518chr2------1948
NM_002522chr1743895 3462 2445 527 ----1152
NM_002539chr21329 ------
NM_002542chr3----1209 --
NM_002543chr1241021 508 64 47 11102 1972 --
NM_002545chr11104654 4513 4135 1157 1068 596 548 440 320 112 24921 1058 34932 2063 954 --
NM_002546chr82517 95 ------
NM_002547chrX3736 202 172 13218 13560 12779
NM_002569chr15176 ------
NM_002576chr1131258 907 142 1308 ----
NM_002581chr985547 5314 4619 3645 2278 2139 1228 861 1112 1458 21217 1211
NM_002586chr631315 1161 366 21449 1408 11287 --
NM_002590chr132478 417 ------
NM_002600chr11369 --2562 36 11266
NM_002605chr152775 354 ----11108
NM_002610chr2113121 3017 2890 2655 2442 2211 2019 1247 1229 390 287 --22361 2283 12971
NM_002613chr1665078 3333 3323 1858 1352 733 --25323 4970 --
NM_002620chr4150 --169 --
NM_002629chr102880 795 ------
NM_002636chr62425 221 ------
NM_002645chr1162855 2832 2608 2213 1171 766 12396 ----
NM_002655chr8104986 3286 2016 1516 1427 1206 759 743 555 211 --14404 --
NM_002656chr651095 1006 177 148 30 ------
NM_002657chr20103852 3739 3238 3163 3149 2729 2501 1510 976 850 --12490 12531
NM_002670chr351438 1249 1047 422 140 ------
NM_002687chr1431323 1150 275 --2431 404 --
NM_002699chr121470 1460 ------
NM_002706chr22652 590 ------
NM_002709chr252968 2567 2540 1175 989 1254 ----
NM_002711chr73682 560 166 ------
NM_002716chr1183624 3531 3459 3109 3018 2626 2285 375 1292 43273 2493 2441 2349 --
NM_002718chr342198 1878 939 751 1595 12567 --
NM_002719chr1442434 2377 2187 724 42271 1858 551 308 31867 1557 221 --
NM_002726chr62354 156 ------
NM_002729chr102119 110 168 ----
NM_002731chr142899 2789 772 574 1918 1675 --
NM_002734chr1732051 889 636 ------
NM_002736chr741741 854 759 751 ------
NM_002737chr1776350 6205 4783 2430 1384 506 193 22071 67 1919 --
NM_002744chr1------156
NM_002745chr2284178 3481 3309 2834 1653 1545 579 335 23895 2848 --21661 1146
NM_002747chr182744 615 ----11800
NM_002748chr1561223 1213 813 273 31 23 ------
NM_002752chr54538 511 436 399 ------
NM_002755chr154888 842 773 178 ------
NM_002764chrX5886 802 678 671 626 --1696 --
NM_002776chr1941487 1397 193 79 1461 ----
NM_002815chr171246 ------
NM_002822chr121676 ------
NM_002827chr202184 155 1529 21697 727 --
NM_002833chr1531596 598 442 21381 1353 ----
NM_002836chr20292 56 ------
NM_002837chr1293913 3539 2981 2869 2858 1739 820 487 357 23628 1328 --11202
NM_002839chr942362 1047 806 679 ------
NM_002858chr151397 399 352 241 235 ------
NM_002867chr11140 1572 ----
NM_002868chr1242139 2031 886 305 --11688 --
NM_002869chr1152020 1979 887 567 429 21433 663 1510 11697
NM_002873chr51451 ------
NM_002890chr521030 293 ------
NM_002894chr18195 ------
NM_002907chr121333 ------
NM_002924chr12626 503 ------
NM_002941chr321315 655 ------
NM_002942chr331311 1088 270 11325 ----
NM_002945chr171885 --2587 567 --
NM_002948chr32213 173 1947 11170 --
NM_002956chr1221439 481 1144 11211 11165
NM_002970chrX1268 ------
NM_002971chr3--1117 ----
NM_002977chr26985 956 770 557 530 91 --23273 108 --
NM_002994chr451963 1850 1512 681 649 --21442 655 1458
NM_002997chr231644 1537 1458 ------
NM_002998chr81699 21944 1924 ----
NM_003001chr171831 1586 853 758 449 113 27 --21954 272 11892
NM_003010chr1782362 2355 2145 1908 1831 629 535 171 1789 22431 1815 --
NM_003011chr92658 624 ------
NM_003014chr711080 --21292 1183 --
NM_003016chr1761982 1964 712 690 476 354 --1423 1656
NM_003017chr621217 170 ------
NM_003026chr9----1184 1830
NM_003031chr161872 11020 ----
NM_003042chr3--21515 1390 --12031
NM_003043chr334138 3560 381 53768 3148 2966 2860 59 11303 --
NM_003045chr1371733 1288 1163 818 550 421 346 14184 ----
NM_003068chr81202 ------
NM_003069chrX--1202 1761 --
NM_003071chr321900 1434 --1293 --
NM_003074chr351529 1403 405 397 262 31478 237 186 ----
NM_003079chr171773 1693 1289 --
NM_003099chr1576211 5618 2123 1975 1827 1570 764 46185 6075 6069 868 31503 676 57 21631 1480
NM_003108chr2147337 5976 5487 5364 5262 4995 4437 2151 1557 1368 1265 1134 1099 257 16542 35026 4968 4620 --
NM_003111chr221315 81 ------
NM_003112chr742667 1014 405 274 ------
NM_003115chr1----1463 --
NM_003128chr272630 2599 2404 2040 1935 399 387 ----12005
NM_003133chr12806 48 ------
NM_003137chr6102203 2084 1782 1664 625 483 391 348 311 293 1651 11856 --
NM_003145chr13437 307 88 ------
NM_003155chr842060 687 616 536 ------
NM_003161chr1742910 2190 856 248 --1361 --
NM_003165chr961303 767 519 325 312 239 21281 34 21448 1213 1587
NM_003178chr3--1473 1295 --
NM_003182chr71549 ------
NM_003182chr71549 ------
NM_003185chr20--11120 1462 --
NM_003189chr193040 2996 2645 2567 2424 1355 1011 923 272 21297 487 22831 1302 12289
NM_003199chr1865450 4639 4036 1695 1043 67 14993 ----
NM_003201chr101123 ------
NM_003203chr23898 364 346 --41839 1686 563 481 --
NM_003206chr61312 ------
NM_003221chr693890 3683 3561 3301 3242 1305 984 594 546 --13842 --
NM_003234chr362154 2135 1694 1559 859 387 22125 1502 ----
NM_003242chr332440 2342 951 1974 1931 12174
NM_003244chr181340 ------
NM_003246chr1531328 426 219 ------
NM_003253chr2121588 377 --21610 222 1254
NM_003257chr1511213 --11059 --
NM_003262chr3115276 4513 4149 3567 3389 3237 2081 2058 1073 728 440 23920 2038 25058 3603 13815
NM_003286chr203794 332 178 --11119 --
NM_003290chr19194 ------
NM_003291chr131630 1592 ----
NM_003292chr122290 115 ------
NM_003298chr395728 5425 4723 4651 4402 3833 2203 176 38 1265 24359 4067 --
NM_003304chr311245 --11204 --
NM_003336chrX1127 ------
NM_003337chr531124 224 158 ------
NM_003338chr1031391 559 450 2614 262 --11890
NM_003339chr521039 109 ------
NM_003341chr31164 ------
NM_003342chr1763071 2976 2097 996 697 686 --1539 --
NM_003344chr711681 ------
NM_003345chr161131 ------
NM_003348chr1231349 681 168 21292 122 21703 1578 --
NM_003349chr2021138 145 11244 ----
NM_003359chr441376 1280 983 205 ------
NM_003368chr13657 616 89 ------
NM_003369chr1122691 580 ----1318
NM_003372chrX146 ----165
NM_003374chr52797 71 ----1725
NM_003376chr671877 1643 1445 1346 1306 602 429 ------
NM_003376chr671877 1643 1445 1346 1306 602 429 ------
NM_003380chr10163 ------
NM_003383chr93524 382 178 ------
NM_003387chr2--1675 1196 --
NM_003392chr394343 3415 2689 1701 1542 856 662 625 458 ----1593
NM_003403chr144588 571 204 42 ------
NM_003406chr851732 1698 1450 1444 357 --11756 --
NM_003410chrX52882 2263 1114 721 275 ------
NM_003412chr352709 2430 2283 721 119 ------
NM_003439chr763062 2825 2766 809 184 130 23130 2810 --1668
NM_003442chr112149 46 1188 ----
NM_003452chr92225 102 1917 ----
NM_003457chr17----1117 --
NM_003463chr633117 2309 2170 ----11359
NM_003469chr24319 174 104 85 ------
NM_003471chr352301 2064 1668 231 211 11475 --1517
NM_003472chr631334 141 98 ------
NM_003473chr10173 --11087 191
NM_003474chr1062381 2263 1772 788 319 49 11962 --12395
NM_003477chr111503 1159 ----
NM_003478chr1163017 2542 2521 2356 2102 416 1384 --13194
NM_003483chr1242808 2374 498 80 --2879 621 --
NM_003489chr2141050 780 685 609 1886 22629 2190 --
NM_003503chr12953 202 --11317 --
NM_003566chr1222963 580 23439 932 2857 453 --
NM_003567chr12393 30 ------
NM_003574chr1895603 4992 3972 3552 3491 1841 1557 1329 1231 1551 14142 15691
NM_003576chr1372625 2277 1912 1851 801 369 52 ------
NM_003583chr1263945 3062 1200 1098 440 119 12977 1366 --
NM_003589chr1321304 181 11280 ----
NM_003590chr2103554 3207 2943 2721 1214 951 572 549 454 27 34086 3147 1068 11149 11240
NM_003591chr101329 ------
NM_003597chr231884 1837 188 ------
NM_003603chr452133 1901 1595 468 447 ------
NM_003615chr362739 2562 1159 992 925 225 23447 780 1884 --
NM_003617chr194919 4815 3807 3270 3105 3098 1590 959 550 --23354 82 34390 997 239
NM_003618chr221002 398 21264 894 ----
NM_003628chr21747 ------
NM_003630chr62536 115 ------
NM_003633chr512086 22214 1746 ----
NM_003642chr21120 ------
NM_003663chr393356 3304 3233 1361 1161 1080 564 445 252 11383 12123 1490
NM_003664chr51353 ------
NM_003672chr111515 --11922 --
NM_003677chr1241977 1739 538 256 --1280 --
NM_003679chr183098 2778 2534 1235 1201 1118 757 263 ------
NM_003685chr192362 225 ------
NM_003688chrX2262 237 ------
NM_003701chr1311022 ------
NM_003714chr532796 2194 843 --1250 --
NM_003718chr7--1215 ----
NM_003744chr1441007 972 892 24 --21172 1105 --
NM_003749chr1352301 2022 884 833 548 ----1276
NM_003750chr102811 315 ------
NM_003758chr151114 ------
NM_003758chr151114 ------
NM_003759chr4114034 3517 3070 3036 2619 2609 1657 1243 426 374 41 --14047 --
NM_003762chr131336 960 940 --1166 --
NM_003768chr151817 1632 590 333 62 ------
NM_003781chr331500 1381 393 --11315 --
NM_003783chr121114 357 ------
NM_003794chr31865 1961 --1851
NM_003795chr61542 --1485 --
NM_003797chr11166 ------
NM_003798chr9277 71 ------
NM_003816chr821301 361 1308 ----
NM_003825chr1521326 263 11559 ----
NM_003850chr131513 --1209 1441
NM_003861chr1472741 2331 2276 2067 1985 1049 590 --12140 --
NM_003872chr232632 930 526 --1424 1974
NM_003873chr1042135 1832 1739 720 --21000 743 22471 2091
NM_003884chr331619 1557 420 ------
NM_003885chr1752512 2341 2158 1931 947 1505 ----
NM_003887chr242255 2057 1692 587 --11923 --
NM_003895chr2152190 1981 1577 839 382 ----1114
NM_003896chr21877 ------
NM_003902chr1------1581
NM_003909chr863031 2962 2173 2153 804 274 --12007 11931
NM_003913chr644134 4030 3992 3427 24159 902 ----
NM_003930chr731748 678 119 ----11024
NM_003932chr2251890 1732 1177 613 485 1249 ----
NM_003934chr941039 484 436 332 ------
NM_003938chr194767 325 207 182 --1984 --
NM_003941chr742250 2099 1623 185 --12314 --
NM_003943chr431009 950 308 ----11130
NM_003948chr492518 2430 2085 1945 1734 702 662 634 54 ------
NM_003953chr152037 1035 822 809 168 22856 2443 --124
NM_003954chr171276 ------
NM_003972chr102950 309 ----1167
NM_003983chr1644191 1144 980 865 ----11564
NM_003994chr12114232 4075 4063 3662 3504 3248 2998 874 413 382 96 13946 12718 --
NM_004024chr141528 1091 1046 127 31460 405 394 ----
NM_004028chr1863625 2996 1618 1328 679 397 13409 --148
NM_004033chr51455 ----1139
NM_004035chr17105069 4866 4410 3614 3302 1462 1317 1289 1093 788 13591 ----
NM_004040chr221143 857 --11207 --
NM_004056chr82857 809 ----2918 110
NM_004061chr52636 205 --1642 --
NM_004067chr721141 563 --1580 --
NM_004081chrY3700 236 94 ------
NM_004087chr3--11448 ----
NM_004100chr642567 2191 1959 377 ------
NM_004105chr22912 311 ------
NM_004113chr341777 1743 719 149 --11764 --
NM_004114chrX21188 136 11057 --1780
NM_004124chr14133211 3172 3026 3009 2308 2236 1324 1307 1126 1107 1048 757 536 1169 22778 518 --
NM_004134chr53637 208 114 ------
NM_004136chr1532956 1298 165 22065 72 --21125 547
NM_004161chr221315 250 --11068 --
NM_004162chr3--1880 ----
NM_004170chr941725 1477 1345 368 ------
NM_004171chr11199594 9280 8502 8386 8298 7009 6531 6211 6070 5976 5964 3282 2943 2527 2463 2046 1644 707 47 69429 7381 6262 6184 3378 1401 42775 1447 1110 555 27744 1005
NM_004180chr21244 --1458 --
NM_004215chr82407 145 ------
NM_004225chr84607 535 455 241 11157 ----
NM_004229chrX41486 667 267 120 2848 456 21636 1611 --
NM_004232chr1863205 2898 979 674 580 275 11108 1882 --
NM_004235chr91216 ------
NM_004261chr12212 21 --127 --
NM_004267chr32555 108 ------
NM_004272chr521360 547 ------
NM_004274chr1463218 2973 2255 388 157 79 ------
NM_004286chr2282423 2102 1825 1061 1028 482 433 277 --1219 --
NM_004290chr541245 1031 372 48 ------
NM_004293chr953633 2651 2448 2395 1176 22982 178 12687 --
NM_004296chr142895 808 1581 --1359
NM_004302chr1222790 2304 11031 ----
NM_004319chr162472 2434 2236 901 647 143 13126 12420 --
NM_004329chr1051256 952 508 501 433 11107 --1961
NM_004330chr151305 --1775 --
NM_004331chr842511 1668 1648 553 ------
NM_004338chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_004342chr772140 2131 1731 1478 1452 443 111 --11699 --
NM_004349chr851223 1101 225 155 116 165 --11316
NM_004354chr42333 167 ------
NM_004370chr622001 1723 11410 21826 591 --
NM_004371chr141295 1270 222 135 --2959 64 --
NM_004382chr1721053 246 ------
NM_004384chr53942 556 335 ----11978
NM_004397chr1163898 3568 3063 3009 1669 367 ------
NM_004405chr22985 738 ----149
NM_004415chr61671 --1177 --
NM_004417chr52481 468 ------
NM_004432chr932357 1886 190 ----12060
NM_004434chr1441501 1399 549 283 1353 11385 11526
NM_004438chr262957 2248 839 739 730 351 ------
NM_004440chr64735 610 436 99 --1592 --
NM_004446chr11137 --164 --
NM_004454chr352282 2010 1724 884 305 ------
NM_004457chr2--21402 1144 11078 --
NM_004458chrX72618 2300 1862 1021 936 483 466 ----11682
NM_004459chr1791872 1788 1627 1464 764 498 208 152 96 ------
NM_004464chr453016 1399 1117 947 656 ----11356
NM_004472chr53643 594 140 ------
NM_004480chr141700 ------
NM_004482chr23751 139 37 1966 ----
NM_004483chr162453 210 ------
NM_004492chr15285 33 ------
NM_004496chr1421191 280 ------
NM_004500chr1451383 740 530 127 83 --12027 199
NM_004501chr1113298 3227 3073 2990 2916 2893 1548 1162 1081 937 487 1441 --11361
NM_004504chr252551 2124 1200 935 407 1944 ----
NM_004505chr1741514 1488 785 111 11359 --1773
NM_004506chr63476 281 228 ------
NM_004513chr1513890 32388 1425 69 ----
NM_004523chr1031483 1227 1160 ------
NM_004525chr241191 280 210 138 ------
NM_004529chr961412 1337 1172 1109 1064 429 11454 ----
NM_004535chr2021364 1097 ------
NM_004537chr12--21554 1186 ----
NM_004569chr142774 530 ------
NM_004575chr421433 360 ------
NM_004583chr172773 241 ------
NM_004586chrX105135 4980 4682 4247 4016 3729 1918 1038 667 355 14921 13654 --
NM_004588chr1153606 2744 2688 2639 2515 11548 ----
NM_004598chr572870 2852 2750 2579 2231 729 430 22708 2271 --12538
NM_004599chr223705 513 64 ------
NM_004602chr201582 --11425 11377
NM_004612chr983933 3495 3352 1632 1270 1072 808 516 1415 --1912
NM_004615chrX--1894 ----
NM_004617chr32459 360 ------
NM_004642chr121266 ------
NM_004654chrY31349 1127 472 ------
NM_004657chr231521 1021 424 1971 ----
NM_004660chrY62326 2205 776 626 345 118 12148 11566 --
NM_004670chr1041264 601 545 224 --1420 11420
NM_004680chrY298 53 ------
NM_004681chrY3676 543 534 ------
NM_004684chr42407 37 ------
NM_004685chr131714 12738 ----
NM_004686chr831559 724 537 --2433 307 --
NM_004687chr1771548 1429 461 440 181 129 51 --1809 --
NM_004690chr62652 153 --1607 --
NM_004696chr12762 232 2831 788 ----
NM_004703chr171543 1744 --12548
NM_004705chr112623 89 ------
NM_004713chr142542 251 1819 ----
NM_004726chrX95631 5280 4329 3836 2222 1198 1100 823 241 24470 1058 15320 --
NM_004730chr512120 1474 ----
NM_004736chr142141 1868 272 51 ------
NM_004741chr102630 149 31014 562 287 ----
NM_004742chr32666 126 ------
NM_004744chr483528 2815 2755 2687 1588 327 187 31 12716 --11090
NM_004745chr8116851 6490 6220 5998 5563 5521 5171 1921 1118 793 108 14827 --36953 957 921
NM_004748chr1562983 2853 1062 563 466 200 54083 3272 1436 1429 589 --11153
NM_004755chr141243 ----2861 154
NM_004764chr122469 90 --1203 --
NM_004768chr15800 789 443 424 242 --1320 --
NM_004774chr1712823 12733 22885 2444 12470
NM_004775chr1852112 1600 1558 1515 177 11846 --22394 960
NM_004779chr51879 1412 171 --
NM_004788chr1152110 1978 1860 454 282 1473 32041 1693 718 --
NM_004789chr9149 ------
NM_004796chr1432298 1936 1683 --11814 --
NM_004824chr611336 182 ----
NM_004827chr441969 1748 1688 1468 ----132
NM_004836chr21213 ------
NM_004841chr1--2858 852 ----
NM_004845chrX23203 1094 14173 ----
NM_004849chr611423 135 ----
NM_004850chr2144 11193 --11343
NM_004854chr2129 ------
NM_004857chr1464299 4007 3451 1718 1124 953 14116 11310 --
NM_004859chr1732746 2599 686 --12659 --
NM_004865chr61412 ------
NM_004866chr5114922 4517 3360 3242 3166 1656 1477 1254 878 695 62 45062 4791 1989 1428 24651 234 13402
NM_004869chr1861695 1683 1516 1280 1248 36 ------
NM_004873chr1453236 2492 2184 591 238 ------
NM_004874chr81398 --1525 --
NM_004883chr5143 ------
NM_004891chr21210 ------
NM_004896chr103469 369 135 --2608 401 --
NM_004898chr432753 2523 535 11087 32413 1956 1139 11975
NM_004902chr203534 173 66 ------
NM_004904chr796122 5708 5125 5090 5067 4110 1642 1565 1416 --34717 4202 1434 14741
NM_004906chr62660 624 ------
NM_004912chr761748 1491 1389 1356 1208 505 ----21564 494
NM_004926chr1421345 1257 11280 ----
NM_004932chr551586 1475 1333 687 306 1584 ----
NM_004949chr1842041 1742 688 66 --1423 --
NM_004956chr794349 3809 3565 3470 3000 2942 629 214 150 23228 826 11134 --
NM_004976chr1194825 3262 1875 1746 1397 1128 981 665 634 14715 --13472
NM_004985chr1263598 3387 1783 1428 493 360 21724 829 ----
NM_004992chrX117751 7686 7087 6005 5386 5191 2607 1281 1255 952 760 23248 748 22047 1377 12029
NM_004992chrX117751 7686 7087 6005 5386 5191 2607 1281 1255 952 760 23248 748 22047 1377 12029
NM_004993chr1431359 179 47 --11243 --
NM_004999chr6113690 1754 1491 1227 1011 832 704 693 613 274 258 13793 21592 233 --
NM_005006chr22953 65 2929 271 --1297
NM_005010chr741366 649 220 47 11772 1446 --
NM_005023chr561538 1378 518 460 318 287 1376 --11031
NM_005028chr1032324 2243 775 1129 --11815
NM_005036chr22148288 8254 8029 7694 7654 7571 7267 7179 7145 6403 1892 1640 1233 159 25525 3215 --15064
NM_005056chr1264353 1674 1637 1099 889 418 --11785 --
NM_005063chr1053523 3262 2505 442 131 23540 975 33274 234 209 1469
NM_005066chr1193 1616 1716 --
NM_005076chr141186 1033 450 166 --12913 13669
NM_005080chr222634 229 --1298 --
NM_005086chr1251638 706 405 333 277 1512 11648 --
NM_005087chr34859 773 737 333 ------
NM_005095chr132172 1918 95 1229 ----
NM_005105chr161993 1894 757 626 368 183 11818 11909 --
NM_005116chr2074568 4147 2845 1796 1569 670 266 44255 3586 3131 3081 ----
NM_005121chr17--22847 1278 22992 80 12936
NM_005126chr352054 1906 756 668 368 ------
NM_005134chr182264 199 ------
NM_005135chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_005151chr1831575 425 187 --1897 --
NM_005154chr152607 29 ------
NM_005156chr954132 3511 1749 1104 638 21708 1425 ----
NM_005159chr1521826 1587 12239 11944 --
NM_005164chr122674 334 22355 2017 ----
NM_005174chr101116 ------
NM_005180chr1031398 424 362 ----157
NM_005182chr16140 ------
NM_005188chr11198161 7927 7857 7525 7122 6760 6646 6051 5691 5658 5515 5158 2257 2230 1596 874 638 399 225 18124 --27795 2563
NM_005191chr321433 1415 ----21286 900
NM_005197chr1485468 5011 3843 2236 1732 1714 1186 616 25418 4483 --11639
NM_005206chr1731065 998 401 ------
NM_005215chr181758 ------
NM_005220chr171314 ------
NM_005233chr332383 2035 824 --1509 --
NM_005235chr2157708 7610 7580 6437 6131 5762 5754 5554 5470 5117 2195 1917 1523 868 554 12027 --37078 1292 857
NM_005241chr32388 295 --1185 --
NM_005252chr14183 1668 ----
NM_005254chr1531434 1366 493 ------
NM_005259chr21297 1433 ----
NM_005261chr82993 642 ------
NM_005275chr6237 23 ------
NM_005277chr431624 1414 618 ------
NM_005279chr24860 735 175 48 ------
NM_005292chr13------1125
NM_005296chrX21027 982 --1839 1803
NM_005312chr972657 2578 1948 1844 524 454 411 12494 ----
NM_005337chr122422 356 --1297 --
NM_005339chr474126 4081 3840 1446 648 571 425 ------
NM_005347chr921445 535 1103 ----
NM_005358chr1341511 1326 520 435 --1502 --
NM_005359chr18145899 5353 4983 4180 4015 2184 1949 1680 1614 1158 1147 1117 768 105 --15233 --
NM_005375chr61255 ------
NM_005385chr352177 1935 861 312 26 ------
NM_005387chr113599 260 182 ------
NM_005397chr782896 2782 2518 1371 1272 911 644 584 ------
NM_005398chr1021006 971 11083 21445 529 --
NM_005400chr241882 955 655 457 --22139 2106 --
NM_005406chr1831514 604 140 ------
NM_005407chr1461382 1152 1141 987 454 237 --11282 --
NM_005410chr52588 527 ------
NM_005413chr2----1429 --
NM_005433chr1862808 2748 2737 1703 906 89 ----22710 475
NM_005436chr1083243 3204 1106 972 769 702 359 322 1228 --1715
NM_005437chr1041351 1116 914 371 ------
NM_005439chr121494 ------
NM_005440chr1742951 2711 701 344 33191 2154 774 --1418
NM_005443chr42520 202 ------
NM_005445chr101263 153 ----
NM_005455chr121660 1468 1561 ----
NM_005465chr1--31654 131 35 12040 --
NM_005475chr1273252 2873 2147 996 866 776 741 ------
NM_005493chr61268 ------
NM_005497chr1775089 4935 4800 1935 1859 1495 1203 ----1102
NM_005502chr932200 908 730 52530 2377 1087 765 417 --22110 338
NM_005504chr12146249 5721 5618 5391 5372 5029 4482 4132 1900 948 614 513 430 325 35840 1673 1129 34270 1706 1577 --
NM_005506chr442805 2453 2083 41 22531 552 12325 --
NM_005509chr541472 1394 615 76 1483 --11457
NM_005522chr75542 528 391 345 81 --11005 --
NM_005524chr3----1324 --
NM_005525chr12270 87 ------
NM_005542chr7179 ------
NM_005544chr2153 2275 175 1117 --
NM_005546chr542021 1599 917 599 32164 2033 1663 --21608 60
NM_005574chr112705 63 ------
NM_005578chr3114964 4348 3927 3775 1958 1619 1586 1145 990 916 482 11842 --11137
NM_005587chr1541000 952 775 340 ------
NM_005593chr123525 447 209 ------
NM_005595chr12827 362 ------
NM_005596chr975565 4232 2458 2280 2063 1799 470 14552 --26052 4477
NM_005604chr61819 12530 1187 --
NM_005607chr8------21005 88
NM_005610chr11795 ------
NM_005625chr841079 1045 198 125 ------
NM_005627chr63939 209 175 ------
NM_005637chr1841410 833 489 88 ------
NM_005638chrX1160 --3679 607 601 --
NM_005647chrX1543 22479 165 2587 75 --
NM_005655chr841321 1274 1099 1004 --21181 486 --
NM_005660chrX1253 ------
NM_005665chr194467 3451 3287 3048 1901 1471 1345 896 173 11427 --14459
NM_005667chr23332 274 38 ------
NM_005668chr564529 3306 3300 762 577 398 24099 1746 12836 --
NM_005684chr12282 55 ------
NM_005713chr5133 ------
NM_005715chr642298 2039 1002 182 173 12033 --
NM_005722chr242430 969 850 134 ------
NM_005724chr151546 1558 ----
NM_005725chr122251 2234 1850 ----
NM_005730chr1273163 3083 1132 1098 979 790 503 23216 898 ----
NM_005731chr22432 108 ------
NM_005734chr11----1202 --
NM_005737chr262893 2878 2817 1064 786 597 --12807 --
NM_005739chr1551796 1786 1523 784 774 ------
NM_005741chr161234 ----1891
NM_005746chr762721 2568 2435 2334 924 692 --12072 11763
NM_005748chr1252855 1235 1080 316 37 23301 3021 1472 13144
NM_005752chr1631009 994 959 1809 121 --
NM_005754chr541043 951 813 78 ------
NM_005756chrX51282 1217 532 325 214 11328 1103 --
NM_005759chr294414 4402 3661 3614 3556 3256 3245 963 559 14128 ----
NM_005765chrX164 ------
NM_005779chr543677 3556 2759 584 ------
NM_005786chr181246 ------
NM_005802chr91775 ------
NM_005813chr231926 892 267 --21642 984 --
NM_005832chr341391 1268 430 117 ------
NM_005839chr12739 670 ------
NM_005840chrX176250 5894 5668 5466 5206 5101 4969 4798 3025 2531 2494 2321 2096 1315 880 616 512 35699 5693 541 24715 1574 15226
NM_005857chr151403 545 366 226 47 ------
NM_005862chr32966 231 1865 --1844
NM_005871chr102977 278 ----158
NM_005896chr22801 131 --2807 630 --
NM_005898chr1193088 2418 2290 1293 1264 1147 1028 862 211 13156 12718 12830
NM_005899chr17153 ----2437 422
NM_005901chr18188569 8331 8150 7516 7497 6672 6414 5937 5720 5708 5647 3248 3092 2919 2396 1866 1263 607 12208 26218 936 27637 760
NM_005902chr1594523 4265 4001 3140 2849 1489 1423 1272 707 13945 14579 --
NM_005903chr574250 3934 1972 1644 1047 653 403 13864 44600 4301 3731 3379 1927
NM_005907chr63679 489 23 --1186 --
NM_005909chr564169 3727 3220 3178 2910 1695 21718 1450 ----
NM_005920chr183826 3800 3602 3585 3223 2896 194 121 ------
NM_005923chr6258 21 ------
NM_005924chr741166 1127 842 744 128 --11062
NM_005930chr142820 660 1121 ----
NM_005937chr1754106 3597 3377 3273 1036 11314 --14039
NM_005941chr863589 3008 2803 1584 1142 858 11265 11450 1743
NM_005944chr3186 --11092 --
NM_005955chr1105167 5030 4090 3601 2082 1163 1000 836 750 178 34379 3843 118 24938 4929 14372
NM_005962chr104763 671 533 319 ----12113
NM_005962chr104763 671 533 319 ----12113
NM_005964chr1761445 1365 1296 1289 997 151 ------
NM_005966chr242054 1975 1878 707 ------
NM_005977chr131319 ------
NM_005982chr141151 ------
NM_005990chr552061 1858 626 332 60 --22190 239 --
NM_006007chr933732 1333 472 12904 13508 --
NM_006011chr1594341 4210 4177 3890 3884 3684 3674 3363 1025 --13665 --
NM_006016chr652091 1741 869 206 69 ----1481
NM_006020chr1461312 1124 906 517 482 445 ------
NM_006033chr181470 12185 ----
NM_006036chr272227 2106 2056 1882 976 382 332 --1176 1922
NM_006037chr254893 4866 4160 3868 1839 --14821 --
NM_006047chr2042491 2440 1271 1019 2464 34 ----
NM_006054chr1151366 1348 1141 205 147 11374 1485 --
NM_006055chr252641 2561 1169 1016 141 ----12862
NM_006060chr743123 2985 891 608 --43749 3306 3239 1113 14195
NM_006063chr2166 1219 ----
NM_006080chr722905 2128 12142 --11919
NM_006090chr15581 518 264 154 124 ------
NM_006095chr474373 3842 2943 2847 1010 299 259 --14500 11279
NM_006106chr1183469 3258 2894 2759 2681 2503 2291 139 1867 33272 3197 982 --
NM_006113chr12654 123 ----1378
NM_006133chr1152443 2358 1738 1688 604 1782 12272 1416
NM_006135chr141409 962 489 295 --21440 391 --
NM_006136chr731169 1008 66 ------
NM_006147chr12446 125 ------
NM_006154chr1552958 2850 911 760 319 ----12278
NM_006158chr841823 1817 1396 36 --11323 --
NM_006166chr1242514 1722 1688 99 --1842 1825
NM_006178chr1731468 464 451 168 21375 525 11303
NM_006180chr9125 21997 1399 ----
NM_006183chr12--1186 ----
NM_006186chr221146 964 ----1288
NM_006190chr23817 441 324 1201 --1144
NM_006195chr92959 513 ------
NM_006197chr852278 2088 1879 317 32 ----11635
NM_006201chrX2426 78 ------
NM_006203chr574862 4480 4197 4003 3787 2228 1684 24400 210 24083 1666 15363
NM_006206chr422552 551 1745 1404 --
NM_006211chr82241 51 ------
NM_006212chr1104538 3783 3654 3440 3427 1985 1236 1131 715 328 24660 253 21423 1007 1362
NM_006218chr31285 ------
NM_006223chrX3456 133 63 ------
NM_006224chr1742521 1839 906 443 --1938 --
NM_006226chr221028 324 ------
NM_006237chr1351968 1673 396 154 105 --1726 --
NM_006239chr4--1220 177 --
NM_006246chr1451235 1070 851 517 467 ------
NM_006251chr563193 3018 2685 1100 947 598 --1452 --
NM_006252chr1157011 6847 6749 6725 5848 3036 2573 1581 1571 1168 682 653 231 66 51 1895 ----
NM_006256chr162561 2485 2376 1737 992 820 ------
NM_006258chr101981 ------
NM_006259chr42864 98 --1329 --
NM_006265chr82466 327 ------
NM_006281chr82350 31 --1223 --
NM_006281chr82350 31 --1223 --
NM_006282chr2064765 4246 3139 2952 1517 1130 11229 --14126
NM_006283chr8134384 4253 4058 3965 3761 3680 1893 1830 1581 1421 940 291 65 1796 ----
NM_006298chr642689 2675 887 549 --31101 687 239 --
NM_006306chrX84397 2089 2020 1721 1525 1463 1255 202 14709 ----
NM_006310chr1721100 898 1871 ----
NM_006313chr1221546 128 ------
NM_006321chr332175 1822 719 ------
NM_006327chr10152 --178 --
NM_006330chr821025 195 ------
NM_006333chr22169 42 1594 ----
NM_006345chr421385 432 1425 ----
NM_006350chr51335 --1329 --
NM_006352chr111774 ------
NM_006357chr2144 --1127 --
NM_006359chrX52256 1838 850 473 147 ------
NM_006363chr203504 241 167 2638 451 ----
NM_006366chr621309 1044 --11189 --
NM_006369chr12413 94 ------
NM_006371chr364582 3823 3401 3214 209 58 --14957 34911 540 179
NM_006372chr63498 367 211 ------
NM_006379chr731825 708 248 1200 --11850
NM_006380chr1784369 3862 3761 3545 3374 2741 1122 149 24290 2909 ----
NM_006393chr1084271 4050 3526 2960 2830 646 385 31 --33229 1160 114 --
NM_006403chr61522 11574 ----
NM_006411chr6140 1136 1120 --
NM_006420chr2033124 2687 1335 12965 1895 --
NM_006421chr841222 869 472 466 ------
NM_006430chr21491 --1200 --
NM_006434chr1053156 3076 2923 2657 2240 --1785 1906
NM_006451chr52702 381 --1308 --
NM_006457chr473814 3521 2928 2902 2632 917 447 23980 3680 14016 --
NM_006460chr1711191 11147 --1601
NM_006465chr1572307 2203 1993 830 798 721 231 1578 12267 --
NM_006469chr131349 1131 1080 ----1549
NM_006471chr18151 ----1114
NM_006482chr1263945 3062 1200 1098 440 119 12977 1366 --
NM_006520chrX31406 343 186 21543 1169 21729 56 --
NM_006534chr2093351 3344 2996 2566 2386 2328 751 593 508 13263 ----
NM_006538chr253227 3005 2826 934 845 13863 --21669 413
NM_006540chr821539 1072 ----11359
NM_006542chr12149 36 --1139 --
NM_006544chr1495136 3683 2262 2191 1378 1186 1056 288 260 ------
NM_006546chr1796526 6437 6196 5421 5034 2436 2052 494 417 34937 4526 724 16514 --
NM_006547chr731742 850 308 ------
NM_006557chr921459 258 ------
NM_006558chr82444 361 ------
NM_006561chr1066003 5492 4689 2450 1816 1246 153 11543 35962 3837 2413
NM_006565chr162883 504 1981 ----
NM_006572chr17113396 3293 3128 2981 2398 972 962 350 322 302 30 33022 2843 921 21368 405 --
NM_006575chr1441105 579 331 243 2472 406 ----
NM_006593chr21700 --2581 269 --
NM_006595chr1111350 ------
NM_006599chr16138062 7179 6147 5792 3222 3102 2540 2442 2188 2065 1700 1612 45 26492 198 47545 6982 1519 772 25503 3053
NM_006603chrX31830 723 346 --11814 11438
NM_006609chr262290 2166 1979 964 526 170 ----1444
NM_006614chr343418 3123 2786 2673 --11305 1818
NM_006618chr131462 1079 1001 31246 1140 413 ----
NM_006620chr674293 3656 3202 3147 882 781 689 34832 1920 843 ----
NM_006626chr952700 2249 1680 267 40 1592 ----
NM_006628chr1594375 4155 3955 3438 1436 1418 1410 1008 1001 ----11244
NM_006629chr1842230 891 644 323 11813 ----
NM_006633chr5----1775 --
NM_006636chr23930 805 90 ------
NM_006646chr1383030 2340 2116 2105 1931 929 242 79 --11139 --
NM_006654chr12134569 4431 4285 4017 3775 3513 3272 1293 1089 895 689 461 292 14540 11324 1846
NM_006656chr1131069 321 98 21105 989 ----
NM_006660chr15198 ------
NM_006670chr6188 ----1410
NM_006698chr2041427 1291 1124 556 ----1148
NM_006699chr162579 2494 2079 1864 1074 849 126 12358 --
NM_006704chr132336 94 ------
NM_006706chr52718 256 ------
NM_006710chr22839 759 131 ----
NM_006716chr72336 46 11240 ----
NM_006717chr963380 2653 2635 2365 2062 328 ----13387
NM_006718chr651095 1006 177 148 30 ------
NM_006722chr341953 692 559 181 --1775 --
NM_006729chrX95251 5077 4730 4050 3688 3523 3442 1864 182 44463 3655 3592 1606 ----
NM_006731chr974635 3590 2107 1652 1433 583 152 44305 3826 2330 1666 12033 35742 996 843
NM_006734chr641535 620 268 98 ------
NM_006735chr71358 ----1291
NM_006738chr1564600 3667 1786 1556 792 120 23821 3113 ----
NM_006750chr16177889 7606 7457 7176 7081 5622 5499 5461 5237 4940 2920 2639 2065 1743 939 814 192 --26515 1721 37470 506 236
NM_006754chr731265 1166 1098 ----2316 189
NM_006763chr142049 578 511 174 21575 1469 ----
NM_006766chr882483 2401 2358 2263 1794 1644 348 161 11914 ----
NM_006774chr771426 1221 666 494 241 148 122 ------
NM_006775chr632793 2686 2676 --1175 --
NM_006777chrX72870 2764 2495 2406 909 894 775 1387 12177 --
NM_006790chr5----1149 --
NM_006791chr152497 459 1641 ----
NM_006814chr2031779 684 41 --22637 309 --
NM_006823chr81250 11258 --11040
NM_006827chr1452589 2195 2082 512 300 22473 2365 1825 --
NM_006828chr62212 44 ------
NM_006838chr1251597 1567 1466 1283 327 ------
NM_006851chr1272610 2487 2441 2305 1086 916 790 ------
NM_006870chr202797 133 --148 --
NM_006873chr263378 3215 3111 1043 672 194 22612 2441 23240 552 --
NM_006874chr411055 --11126 --
NM_006885chr1663518 2934 2586 1392 441 255 23167 1228 22814 1326 1503
NM_006888chr1463217 3115 2528 2308 1308 547 --12900 --
NM_006895chr232149 437 190 11811 ----
NM_006902chr133292 215 36 13064 1605 23154 568
NM_006913chr6--1307 ----
NM_006915chrX32220 1815 264 ------
NM_006920chr2------11495
NM_006922chr282597 2334 1044 933 864 723 697 21 ----12527
NM_006937chr172397 124 161 ----
NM_006939chr141434 1221 --1186
NM_006940chr1231583 1400 1243 2356 61 ----
NM_006947chr441393 1200 430 149 --1261 --
NM_006948chr21131963 1703 1664 818 741 720 707 691 596 580 563 321 208 --12044 --
NM_006951chr101807 ------
NM_006955chr1063415 2707 1195 1102 1050 201 22967 2470 ----
NM_006956chr732229 643 334 ----1614
NM_006963chr1031208 837 261 ------
NM_006965chr181163 1140 ----
NM_006997chr101450 ------
NM_007005chr921142 60 1205 ----
NM_007007chr1294819 4245 4011 3713 3173 1418 1406 681 538 ------
NM_007008chr21239 ------
NM_007010chr1751834 1403 1386 1295 260 --1742 --
NM_007011chr1566792 6692 5296 4742 2666 406 1723 1821 --
NM_007013chr81164 1220 --11003
NM_007015chr131126 --1285 --
NM_007017chr52312 57 ------
NM_007023chr22868 262 --11078 11102
NM_007034chr12860 716 ------
NM_007036chr52843 821 ------
NM_007038chr2156034 4299 4287 1442 399 25203 4514 21826 639 --
NM_007039chr1451636 632 507 364 302 ------
NM_007042chr332585 1803 313 ------
NM_007052chrX3584 228 131 ----149
NM_007054chr562745 2641 932 783 413 377 13278 33602 3264 3188 144
NM_007067chr1731244 1152 138 --31160 316 108 --
NM_007073chr673748 3650 3266 3201 2886 1272 91 23828 631 --14227
NM_007096chr92258 38 ------
NM_007106chr1362740 2564 2115 1792 1758 282 ----11877
NM_007111chr131873 ------
NM_007114chr393200 3106 2912 2777 2604 2201 2082 450 210 ----1281
NM_007124chr61601 11619 11833 --
NM_007137chrX75536 4838 4269 3942 3546 1834 709 11778 15158 14920
NM_007145chr1931217 307 77 ------
NM_007153chr1922929 1591 5455 293 202 117 33 1797 --
NM_007157chrX52359 2330 2291 564 64 11993 22310 897 --
NM_007158chr151162 923 497 334 112 --11112 --
NM_007166chr1141380 1104 436 371 2454 60 ----
NM_007195chr1873528 3474 3155 1405 1270 1039 203 --2892 817 13244
NM_007200chr1564600 3667 1786 1556 792 120 23821 3113 ----
NM_007203chr923926 657 22587 119 12952 11571
NM_007212chr171896 707 523 496 402 344 321 21452 511 --1466
NM_007214chr63549 529 252 ------
NM_007222chr82641 399 ----1339
NM_007236chr1582049 1714 1579 679 535 408 252 58 1811 12464 --
NM_007238chr2054775 4498 3927 1341 1030 21170 823 13655 11019
NM_007246chr41372 11016 ----
NM_007249chr13199256 9173 8706 8684 7878 7727 7457 7404 6624 6422 6020 3755 2792 2604 2502 1904 1883 1441 1162 18899 1266 19203
NM_007285chr163501 329 44 1387 ----
NM_007292chr17105069 4866 4410 3614 3302 1462 1317 1289 1093 788 13591 ----
NM_007347chr1583013 2889 2552 2331 2136 1282 869 691 ------
NM_007350chr1263438 3103 2907 1489 1424 750 --23939 1615 --
NM_007351chr441051 1001 263 61 --11058 --
NM_007358chr141513 576 189 87 11500 --11784
NM_007363chrX3960 779 735 ------
NM_007365chr162138 820 798 585 543 452 --1175 --
NM_007373chr101562 --11763 21114 402
NM_007375chr142320 2149 1948 601 --12038 --
NM_012074chr141447 --1117 1354
NM_012081chr543437 2515 2382 190 12869 ----
NM_012082chr82792 394 ------
NM_012089chr131552 1475 419 ------
NM_012090chr141302 366 340 71 ------
NM_012092chr261609 1424 1213 199 115 69 11831 1785 --
NM_012095chr1093479 3368 2956 2545 1389 1210 359 213 93 2878 593 ----
NM_012097chr252016 1898 1428 1405 247 --1541 --
NM_012102chr132529 2445 2193 1494 22458 103 --
NM_012104chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_012104chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_012120chr642312 2118 2054 924 --32006 1825 527 --
NM_012134chr161839 1810 1346 1227 761 117 ------
NM_012137chr172020 1929 1885 1813 1005 434 332 ------
NM_012141chr1373294 3131 2907 2734 2702 1141 138 12971 137 --
NM_012156chr2093322 2912 2833 2633 2548 1043 770 201 80 ----12078
NM_012158chr13----1348 1116
NM_012175chr111920 ------
NM_012177chr61117 1205 1489 --
NM_012193chr1134897 4031 522 35203 3700 1116 13450 14779
NM_012214chr255893 5803 5093 730 67 14506 25909 3951 1190
NM_012215chr1041777 1327 536 373 --1697 --
NM_012224chr411111 125 ----
NM_012234chr393399 3147 3013 2702 2626 1428 929 404 91 13120 1417 --
NM_012238chr1011193 --11704 1237
NM_012242chr101325 1212 ----
NM_012249chr222987 2521 12344 --1130
NM_012250chr112428 48 1977 ----
NM_012252chr764722 2118 1609 1131 860 395 1628 ----
NM_012255chr202304 27 ------
NM_012257chr731052 786 281 ----194
NM_012259chr63973 545 342 --3940 163 40 --
NM_012262chr144499 3981 3354 1743 13652 21548 1532 --
NM_012281chr732382 212 87 1809 ----
NM_012287chr374115 3822 1579 1339 986 909 406 23559 2973 14489 --
NM_012288chr663488 430 372 259 180 28 45184 963 490 197 13667 1249
NM_012290chr231466 1227 28 ------
NM_012297chr472582 2431 1689 1027 545 320 244 --12348 12438
NM_012301chr772206 1570 1420 1410 742 587 456 --11870 --
NM_012302chr131046 977 471 ------
NM_012307chr1821018 173 ------
NM_012309chr1164790 4145 3319 1914 1499 393 44139 3379 1078 262 --24815 3637
NM_012316chr1105405 4398 2118 1655 1458 1175 744 436 409 388 35225 4922 3935 24182 1639 --
NM_012323chr2221174 986 --11075 1599
NM_012327chr1861578 984 552 239 104 40 --2623 558 --
NM_012329chr1731154 1055 117 1543 ----
NM_012330chr1031261 1114 242 11597 ----
NM_012333chr131319 1169 465 --11294 --
NM_012334chr553622 3078 1581 403 153 33697 3523 1108 13462 --
NM_012338chr73964 451 134 ------
NM_012382chr574459 3662 3028 1452 1281 991 304 21561 724 14040 13012
NM_012395chr763201 3163 3102 2557 2438 274 --32805 2353 2226 13110
NM_012399chr2251657 1538 732 652 111 ----21628 329
NM_012417chr173395 229 68 ------
NM_012420chr1041731 1425 507 238 ------
NM_012428chr155841 756 729 694 284 ------
NM_012448chr1712498 32254 37 22 42157 2083 684 673 --
NM_012454chr61545 ------
NM_012463chr1251616 1607 1477 598 470 1100 21257 1199 --
NM_012479chr72827 132 2677 520 --11942
NM_013230chrY142 ------
NM_013231chr1484326 3860 3300 3235 1704 1116 851 179 33460 1642 754 ----
NM_013233chr22992 289 --1208 --
NM_013254chr122283 194 --1529 --
NM_013255chr7148685 8654 8496 7684 7247 7020 3472 3323 2500 2117 1481 916 844 272 27494 3391 23268 2612 --
NM_013257chr852166 1662 569 247 203 ------
NM_013261chr483422 2772 2400 1407 1063 915 740 479 1876 22969 2623 --
NM_013269chr12104460 4397 4360 3988 3042 1432 1155 638 563 391 14225 23378 470 --
NM_013277chr123987 817 105 ------
NM_013281chr201384 ----1622
NM_013282chr1931239 429 191 11327 ----
NM_013309chr1562641 2474 1743 898 726 37 --11928 --
NM_013341chr221166 563 --11173 12517
NM_013354chr811142 ----11077
NM_013357chr82683 604 1151 170 --
NM_013363chr3298 31 ------
NM_013372chr1553417 2769 2213 463 29 ------
NM_013374chr343106 2055 938 660 1514 12215 12417
NM_013377chr121603 --1689 --
NM_013381chr1272307 2137 1552 898 839 828 365 11877 --1516
NM_013396chr2131028 335 298 ----11566
NM_013434chr221738 694 ------
NM_013434chr221738 694 ------
NM_013444chrX4834 415 351 34 ------
NM_013447chr1953622 2428 247 184 24 23044 1057 ----
NM_013448chr14----1172 1128
NM_013449chr1232715 708 153 12269 ----
NM_013450chr21460 --1843 --
NM_013943chr1113263 3101 2805 2763 2754 2656 2613 730 521 195 156 --22141 639 --
NM_013958chr81333 ------
NM_013959chr81333 ------
NM_013961chr81333 ------
NM_013962chr81333 ------
NM_013981chr5143 ------
NM_013982chr5143 ------
NM_013983chr5143 ------
NM_013996chr71549 ------
NM_013996chr71549 ------
NM_013997chr71549 ------
NM_013997chr71549 ------
NM_013998chr71549 ------
NM_013998chr71549 ------
NM_014005chr552559 2303 2099 1964 817 32798 2705 2267 22230 634 12664
NM_014010chr91210 --160 --
NM_014016chr361734 1326 1270 678 284 221 ------
NM_014021chr163441 3038 2966 2327 643 595 12865 ----
NM_014028chr643160 2580 593 301 11044 1318 --
NM_014089chr1321446 1425 1221 --1898
NM_014106chr1552787 1145 953 674 126 11156 ----
NM_014109chr841201 1099 408 24 11173 1355 --
NM_014112chr884907 4698 4628 4220 3664 3511 682 144 15466 31899 1682 771 11167
NM_014117chr1622528 92 22608 52 --1306
NM_014141chr7115378 5296 5176 4247 3927 3483 3234 1043 506 427 151 21654 98 14713 --
NM_014149chr72804 343 1629 ----
NM_014155chr11157568 7299 6217 5628 4715 2733 2199 2181 1831 1595 1489 1352 1220 1146 867 14774 ----
NM_014181chr242114 689 615 72 ------
NM_014182chr123721 298 69 1538 180 --
NM_014217chr131430 1408 484 ------
NM_014240chr384009 4002 3363 2918 2677 657 574 298 24042 677 ----
NM_014245chr331114 809 187 ----1178
NM_014251chr71859 --1808 --
NM_014253chrX22501 1891 1362 ----
NM_014258chr201652 --142 --
NM_014263chr1011482 ----1167
NM_014267chr112868 675 ----1813
NM_014268chr181342 --11121 --
NM_014294chr841333 1146 399 57 ------
NM_014309chr22125082 4746 4701 4447 4368 4013 3840 1540 1209 850 467 306 --21858 1284 --
NM_014316chr1662033 1994 1970 1632 1410 26 21776 1401 ----
NM_014317chr102240 32 ------
NM_014323chr225700 407 357 198 160 --1422 --
NM_014331chr4147210 6930 6086 6060 5309 5213 5062 3004 2462 1854 1059 664 298 214 77226 7203 4859 2939 2687 2315 804 ----
NM_014335chr154930 432 303 60 ------
NM_014352chr1111158 1539 2962 342 --
NM_014372chr141939 1829 1722 622 ----12053
NM_014376chr562246 2014 1936 1817 1790 517 12565 ----
NM_014382chr351517 1462 1361 1337 330 --11655 --
NM_014386chr5179 ------
NM_014397chr91441 ------
NM_014399chr72962 832 ------
NM_014405chr1721589 1487 178 1702 --
NM_014408chr13582 134 114 ------
NM_014415chr331630 1559 581 ----1408
NM_014423chr5115040 4459 2245 2102 1979 1791 1702 970 595 508 451 --34383 2169 1151 --
NM_014432chr6------21460 146
NM_014445chr341920 1656 480 30 ----1975
NM_014447chr431667 1593 236 ------
NM_014458chr131040 912 40 --2470 251 11075
NM_014497chr21208 ------
NM_014552chr251398 1326 1193 1135 560 ------
NM_014562chr21773 ------
NM_014563chrX51795 1530 1391 687 356 --12104 1109
NM_014574chr1421128 453 --21585 999 --
NM_014585chr221196 23 --11182 1485
NM_014592chr52623 135 ------
NM_014600chr251684 1611 1476 1439 118 ----11373
NM_014607chr212175 --12063 1856
NM_014614chr211109 --11258 --
NM_014615chr1643653 3288 2735 2341 ----12556
NM_014618chr9--1136 ----
NM_014623chr6193 ------
NM_014630chr1553299 2925 2468 897 266 22817 2482 33819 3499 2504 --
NM_014634chr2273585 2952 2874 2723 1298 809 40 ------
NM_014637chr851370 1239 1116 558 550 11065 1435 --
NM_014646chr1842716 1992 644 136 1690 12458 12400
NM_014647chr1631680 1555 81 1252 ----
NM_014660chr73950 128 27 2984 934 ----
NM_014667chr322383 1997 1245 2893 746 --
NM_014670chr23603 83 68 1639 1251 --
NM_014671chr721550 1447 11174 ----
NM_014674chr3103979 3493 2767 2653 2624 2486 1074 612 459 155 22991 965 ----
NM_014682chr831701 486 341 ----1429
NM_014683chr1751878 1696 1506 576 307 1543 21884 1690 --
NM_014686chr1952552 2455 2210 850 818 ------
NM_014689chr21411 ------
NM_014690chr772863 2804 2784 2730 2632 2115 131 --32826 1168 960 --
NM_014701chr1553236 3187 1182 1072 937 12128 ----
NM_014702chr683290 2918 2393 655 645 411 336 257 2777 205 1160 --
NM_014705chr722032 1726 --11373 --
NM_014709chr22604 472 1184 ----
NM_014711chr1621460 706 --11470 --
NM_014717chr193858 772 55 ------
NM_014720chr1021794 62 --11345 11746
NM_014721chr667384 6163 5720 5566 888 257 35151 2969 1181 25956 4510 25285 1510
NM_014730chr1295056 4987 4370 4323 1747 1318 273 209 203 44602 3802 688 291 13836 --
NM_014730chr1295056 4987 4370 4323 1747 1318 273 209 203 44602 3802 688 291 13836 --
NM_014735chrX41617 729 552 380 11554 ----
NM_014739chr6113966 3540 2827 1345 1192 1158 929 889 357 327 153 11520 11635 --
NM_014746chr253217 1443 1284 1075 481 13682 ----
NM_014747chr175153 4537 4012 3731 1960 900 103 --35140 2103 62 --
NM_014751chr8--1491 ----
NM_014752chr1171930 1900 1564 1377 1269 142 124 ------
NM_014755chr232780 1330 405 --13154 --
NM_014757chr562313 2203 1794 1571 814 758 ----153
NM_014764chr1231136 381 353 11087 ----
NM_014765chr152531 1086 934 867 472 ----21951 1049
NM_014774chr192616 2308 2287 2199 2007 625 308 92 84 12242 12134 --
NM_014776chr1253064 2967 2424 2135 2114 ----22916 2609
NM_014800chr721138 457 ------
NM_014802chr121380 --172 --
NM_014803chr1052894 2762 2469 2429 1949 12910 32540 831 785 --
NM_014810chr1123438 3303 3154 2958 2684 2664 2624 2540 2484 2375 2298 115 13271 ----
NM_014812chr131284 542 172 --21933 1587 --
NM_014819chr562310 2203 2132 2124 1943 355 1639 ----
NM_014820chr352049 1631 1424 682 586 11986 ----
NM_014824chr1151762 1738 1619 1527 628 21692 398 ----
NM_014827chr141580 1573 361 149 11443 ----
NM_014828chr1472352 2165 2023 1017 886 843 671 1564 ----
NM_014829chr5101957 1948 1913 1706 815 713 355 270 222 106 ------
NM_014830chr1283362 3301 3093 2872 2432 1144 1066 679 ------
NM_014832chr1311911 12066 --11397
NM_014836chr104689 442 150 127 --1492 --
NM_014838chr2241106 538 341 225 ----11828
NM_014839chr132377 2292 2059 ------
NM_014841chr651066 1045 973 893 414 ------
NM_014844chr1422981 1184 11037 24156 1201 13728
NM_014847chr1132 ----1505
NM_014850chr394898 4864 4851 4426 3325 3277 1274 892 330 11399 ----
NM_014857chr1--137 ----
NM_014859chr1711411 --11121 --
NM_014860chr252086 1836 917 667 309 ----11641
NM_014864chr1103851 3771 3711 3286 3098 1281 1115 945 835 460 1766 13603 --
NM_014870chr174400 4246 3944 3816 1025 211 89 1797 11170 11061
NM_014873chr174408 4382 4153 3649 3228 1306 560 13258 ----
NM_014876chr222896 44 1676 11724 11658
NM_014877chr17167618 7164 6951 6924 6317 6008 5837 5402 5176 2953 2621 2362 1438 1320 1215 499 25882 1616 --17534
NM_014883chr442240 1915 426 387 1634 ----
NM_014885chr43166 46 35 ------
NM_014887chr131637 --2812 203 --
NM_014893chrY31987 1755 568 ----11502
NM_014897chr1732567 2277 750 12969 1922 --
NM_014899chr542857 2612 806 261 ----13029
NM_014900chr231074 936 313 ------
NM_014904chr1083215 2868 2706 2521 1336 729 637 496 1227 33911 1631 114 1306
NM_014906chr1794122 4061 3951 3614 3385 3093 1336 1147 266 12713 23747 1000 1582
NM_014916chr7--1530 ----
NM_014918chr151187 11426 11133 --
NM_014921chr1911894 ----12910
NM_014932chr3------11314
NM_014934chr1393637 3081 2507 1319 1280 1232 1027 784 777 1473 --13806
NM_014935chr153888 2708 2513 403 71 2773 286 1492 --
NM_014937chr1021306 21 11244 ----
NM_014946chr273112 2794 2775 2763 2345 1005 851 160 ----
NM_014950chr1411178 143 --1322
NM_014951chr10102595 2558 2458 2292 1936 1051 783 737 704 527 22055 1679 ----
NM_014953chr1354116 3928 3676 1543 711 122 13860 1911
NM_014961chr461816 1603 1398 867 747 369 1645 --1569
NM_014962chr2052638 2496 2372 1120 1098 ------
NM_014969chr121011 838 ------
NM_014974chr1051475 671 660 490 359 ------
NM_014982chr14125314 4563 4336 4083 3972 3720 3614 3402 2107 1622 1360 517 1274 ----
NM_014988chr442757 2163 1142 814 --1310 --
NM_014989chr621994 357 --1732 --
NM_014990chr1431346 465 419 ------
NM_014991chr473001 2678 2512 2144 2120 964 53 32011 343 291 ----
NM_014999chr1241474 1396 635 338 ------
NM_015000chr1233087 2004 459 ------
NM_015002chr123620 515 257 --143 11519
NM_015008chr332993 1432 1398 13639 12486 13448
NM_015009chr32639 197 ------
NM_015020chr1683768 3683 2603 2574 1084 931 689 210 ----12859
NM_015027chr1622012 213 11798 2611 424 --
NM_015032chr1362602 2384 1835 805 529 262 22689 564 22764 425 --
NM_015035chr2084869 2520 2046 1858 1765 1295 720 138 11381 12572 --
NM_015039chr184070 3343 3328 2860 2795 1585 358 319 1944 ----
NM_015042chr1533679 1500 1055 13705 21079 239 --
NM_015045chr102625 308 ----148
NM_015046chr972323 2164 2141 1832 745 335 219 31118 160 135 ----
NM_015057chr133650 545 438 --1203 --
NM_015059chr1563287 2627 1460 508 409 198 23378 3020 1966 13624
NM_015068chr752702 2620 978 556 121 21096 619 13929 23626 100
NM_015071chr596184 4999 4655 4215 2175 1897 1740 1657 765 --21475 1078 --
NM_015073chr1922041 1722 21830 1692 ----
NM_015075chrX21663 96 1656 11898 --
NM_015076chr674529 4172 3421 2841 1564 730 347 13923 14223 --
NM_015082chr562541 2503 1871 1822 480 462 --1675 12154
NM_015086chr1261379 614 601 126 103 42 ------
NM_015090chr1126199 5797 5161 4708 2435 2415 1785 1556 1151 476 460 383 11488 --15694
NM_015092chr1654467 4438 3772 3474 468 14042 ----
NM_015093chr631886 1842 1803 1283 121 --
NM_015097chr34895 794 457 89 --22304 1518 1168
NM_015116chr1341651 1518 1166 668 ------
NM_015132chr75798 670 496 299 61 21719 160 ----
NM_015144chr1663918 3786 3543 2761 1457 815 31309 1238 929 1852 --
NM_015149chr161859 1669 1432 469 431 213 11451 ----
NM_015153chr6155 --1677 --
NM_015155chr1062571 2231 1156 583 280 154 2884 124 ----
NM_015156chr1443783 1321 1112 885 ------
NM_015170chr821884 1842 --21897 614 --
NM_015172chr141171 1105 637 107 2313 243 21654 1048 --
NM_015192chr2042244 1892 502 91 --1650 1472
NM_015198chr71236 ------
NM_015199chr332441 1972 1018 --12231 12767
NM_015206chr1563694 2997 2976 904 234 57 42461 1344 723 592 --12943
NM_015215chr143177 2845 2434 255 1493 12409 --
NM_015226chr1623198 169 ----1748
NM_015230chr441808 1591 1507 554 ------
NM_015231chr112866 847 1674 ----
NM_015235chr104836 825 655 43 --11874 --
NM_015239chr9147 ------
NM_015247chr16115211 4927 4749 4642 4328 4236 3881 1160 1030 502 121 12019 11870 --
NM_015250chr931585 1403 700 --11435 --
NM_015264chr22124608 4435 3956 3854 3819 3796 3384 1265 1214 885 827 502 24283 3378 14006 --
NM_015265chr242615 2254 2063 1999 --1321 --
NM_015267chr122884 353 ------
NM_015270chr121254 11939 ----
NM_015271chr473919 3781 3196 1044 931 637 446 13249 14112 --
NM_015272chr1631610 853 513 11665 11928 --
NM_015275chr122556 464 12045 ----
NM_015278chr663146 2968 2581 1361 1052 163 2992 663 21258 1126 --
NM_015296chr1331038 956 398 154 ----
NM_015310chr8157675 7423 7340 7247 6392 6222 5359 3319 3187 2392 1360 1181 1148 1029 961 --1878 1324
NM_015313chr1174543 4074 3982 3721 1740 1261 875 1747 ----
NM_015314chr732486 1753 720 --1431 --
NM_015315chr553417 3289 2332 752 581 12514 11181 11318
NM_015317chr252516 2379 1941 1880 361 194 ----
NM_015321chr19114914 4876 4177 4062 4033 3650 3544 3391 1632 1409 828 --13040 11854
NM_015326chr162871 2808 2551 2010 1055 63 ------
NM_015328chr773139 2708 2546 2259 1979 1924 1203 1298 ----
NM_015330chr2242601 2132 2000 1016 12369 --11906
NM_015335chr1251781 727 399 327 93 11725 ----
NM_015336chr1252607 2091 1029 314 88 32422 926 886 ----
NM_015339chr201918 --1729 --
NM_015345chr672759 2579 1993 675 645 532 235 12154 ----
NM_015347chr1222513 1873 12665 --22492 680
NM_015349chr662693 2264 2112 221 204 141 12211 ----
NM_015358chr2151307 895 533 170 127 ------
NM_015359chr872973 2745 2666 2239 838 341 168 --1926 --
NM_015361chr22749 333 ------
NM_015365chrX73717 3697 3356 1699 1600 1467 937 --1318 --
NM_015367chr2251532 1154 1102 313 296 11262 ----
NM_015375chr154991 4433 3664 3539 3278 24946 382 14845 --
NM_015378chr11410 1141 11158 --
NM_015382chr141506 1297 ----
NM_015384chr51118 ------
NM_015385chr1053156 3076 2923 2657 2240 --1785 1906
NM_015387chr221579 414 1301 --1735
NM_015397chr93589 291 221 31830 1650 45 11560 --
NM_015429chr321023 1000 ----1449
NM_015431chr1103529 2950 2836 2512 1304 986 639 631 457 341 13064 1326 --
NM_015435chr811240 --11023 --
NM_015439chr6186 ------
NM_015455chr573991 3973 3865 2787 2563 1001 927 --1322 --
NM_015457chr1131103 433 215 ------
NM_015458chr8114726 4707 4583 4537 4432 4349 3846 3801 3621 961 635 ----24230 561
NM_015460chr332055 1532 146 11297 ----
NM_015464chr71241 1418 ----
NM_015469chr92291 70 ------
NM_015483chr72973 107 1810 ----
NM_015496chr8------1295
NM_015507chrX----1191 --
NM_015509chr1251562 1537 1431 1363 1120 ------
NM_015520chr332529 2447 1879 161 ----
NM_015530chr23364 289 159 ------
NM_015535chr2144173 4128 3759 3084 3070 2966 2812 2584 1637 1486 1307 1194 982 121 12920 12878 22762 1679
NM_015541chr31247 ------
NM_015542chr103502 248 61 11223 ----
NM_015550chr783508 3168 2982 2917 2826 2219 1354 461 ------
NM_015554chr1542672 2441 2327 1911 1137 11174 --
NM_015560chr322588 482 11784 ----
NM_015564chr573586 3441 3287 2596 2291 547 416 42459 2433 1060 481 12866 --
NM_015565chr2121518 474 --21512 808 --
NM_015568chr2074156 3582 3489 2821 1642 601 292 12860 ----
NM_015569chr163596 1940 1723 1601 1404 966 33025 1877 149 ----
NM_015570chr731742 1483 1393 11804 ----
NM_015571chr652502 2072 1991 1733 333 ------
NM_015575chr252784 2515 2378 770 647 1983 --12310
NM_015576chr352239 1821 461 291 89 --12278 11960
NM_015589chr141161 170 ----
NM_015626chr1721169 347 ----1791
NM_015630chr21377 ------
NM_015640chr145148 3506 1609 1366 35043 3278 1493 ----
NM_015657chr21292 ----189
NM_015670chr171473 1348 ----
NM_015676chr142293 144 ------
NM_015678chr1321547 1054 11077 ----
NM_015686chrX42220 2082 1583 915 22006 436 ----
NM_015695chr631674 1363 503 ----1480
NM_015840chr151789 1752 630 248 162 12082 --12382
NM_015841chr151789 1752 630 248 162 12082 --12382
NM_015852chr733112 2765 2744 2846 174 --21098 930
NM_015853chr11--177 147 --
NM_015865chr181328 --21063 175 --
NM_015866chr121283 1028 ------
NM_015886chr885703 5188 4520 4000 3726 1317 750 170 15551 13931 31836 1160 471
NM_015888chr142665 997 631 53 12711 ----
NM_015902chr82914 277 ------
NM_015906chr183773 3719 3207 3047 1132 1049 278 101 11168 14610 14094
NM_015912chr852489 2094 1737 1705 1592 1470 1526 --
NM_015939chr203635 270 257 ------
NM_015948chr63466 398 322 ------
NM_015975chrX31126 335 75 11394 ----
NM_015984chr11420 ------
NM_015999chr12685 185 ------
NM_016009chr164244 1665 1215 1138 948 221 --24222 83 --
NM_016018chr832749 2178 1762 12102 12069 --
NM_016019chr73888 381 257 ----11077
NM_016021chr682598 2361 2303 2049 914 524 272 126 32627 2397 2198 ----
NM_016023chr862041 1769 1539 752 407 328 --1649 --
NM_016025chr161428 11393 11406 21273 1227
NM_016061chr221261 515 --11541 --
NM_016071chr73238 201 94 ------
NM_016072chr121606 1310 --11709
NM_016075chr1363174 3068 2004 910 552 22 1283 ----
NM_016076chr172126 1243 1196 863 751 285 79 43160 3076 2343 344 ----
NM_016078chr17------1770
NM_016081chr411733 ------
NM_016083chr683181 3020 2785 2530 1108 439 237 186 --23740 771 13522
NM_016090chr1121049 314 ------
NM_016096chr842109 1472 821 224 11867 ----
NM_016103chr51408 ------
NM_016107chr531201 1047 546 1327 1445 --
NM_016121chr11124 2993 362 ----
NM_016125chr171219 --1571 --
NM_016131chr262357 2325 1810 1495 507 323 ------
NM_016132chr1532855 2200 753 1943 --12428
NM_016133chr231257 1190 1131 --11547 --
NM_016141chr33304 190 26 --1809 --
NM_016156chr1121606 527 ------
NM_016201chr332357 842 34 --12157 --
NM_016205chr431254 933 421 2123 87 11037 --
NM_016206chr3148532 8143 7771 7075 6873 6817 3600 2971 2937 2078 1777 1652 872 256 17218 18581 27895 6359
NM_016217chr673441 3320 2928 2803 2486 391 59 ----1913
NM_016224chr642076 1510 486 372 11680 12107 1693
NM_016231chr1711526 ------
NM_016248chr1363968 3222 1354 906 632 210 ------
NM_016255chr643112 2556 1236 625 12353 11106 --
NM_016257chr1113253 3088 2542 2532 2399 1367 1149 677 328 197 125 12595 --12697
NM_016260chr2156913 6525 6495 6439 6305 6226 5469 5180 4995 4970 4667 2939 1788 1110 431 --47332 4712 2864 2551 --
NM_016271chr182824 269 ------
NM_016272chr2272552 2440 1868 1784 849 691 107 --22487 492 --
NM_016275chr332698 2018 435 11859 ----
NM_016277chr641607 1570 1539 1145 ------
NM_016287chr152061 1851 1424 820 259 ------
NM_016301chr121161 --1415 --
NM_016308chr141784 1531 601 22 1826 ----
NM_016320chr113305 143 90 2429 225 ----
NM_016322chr963206 2638 2505 2273 607 369 1390 41120 628 577 251 12995
NM_016338chr521118 303 --1396 --
NM_016357chr121826 ----1999
NM_016374chr131628 1365 567 ------
NM_016374chr131628 1365 567 ------
NM_016376chr1773063 2903 2670 1077 1048 709 499 24270 742 11542 12951
NM_016395chr1571889 1869 1810 1435 573 450 163 1111 1125 --
NM_016396chr1552893 1933 833 715 124 22158 420 22526 649 1819
NM_016410chr9266 24 ------
NM_016422chr11103185 2937 2825 2698 2422 2291 1052 802 340 130 1917 ----
NM_016424chr171789 --1307 --
NM_016426chr2282187 2090 1812 1398 702 684 636 517 ----22151 1775
NM_016433chr121191 11584 11371 11081
NM_016441chr222228 1997 ------
NM_016442chr542355 1971 1495 722 1921 ----
NM_016447chr71201 ------
NM_016470chr20--1156 ----
NM_016485chr621532 428 11483 --2538 66
NM_016486chr1------1340
NM_016488chr1261709 1480 1364 768 375 204 ------
NM_016489chr71202 ----194
NM_016507chr1763129 3064 2506 2312 2218 46 22067 646 ----
NM_016519chr41182 1485 --1385
NM_016530chr1573935 3664 2936 1605 1501 741 278 ------
NM_016542chrX51367 1321 657 430 229 1362 ----
NM_016577chr354538 4276 3006 1189 1012 24546 3337 --11732
NM_016586chr14--1155 ----
NM_016588chr62148 100 ------
NM_016589chr31360 ----1200
NM_016599chr441445 1044 581 464 --1594 --
NM_016603chr541830 1437 568 276 1392 2303 219 --
NM_016605chr51139 22083 1933 ----
NM_016612chr8138 --1451 --
NM_016613chr462759 2522 2471 1847 1824 285 --11704 --
NM_016620chr11528 --1972 --
NM_016621chr1143848 3024 183 175 34369 4082 398 14102 --
NM_016623chr83209 99 44 ------
NM_016652chr2031809 1384 112 11157 11748 --
NM_016653chr221045 296 ------
NM_016654chr1531434 1366 493 ------
NM_016819chr3--1104 1516 --
NM_016823chr173935 868 271 ------
NM_016929chr684338 4163 3726 3566 3244 3138 1362 155 2603 424 12848 13264
NM_016941chr192401 102 ------
NM_016946chr153423 3211 2786 378 171 --1564 --
NM_016950chr431348 581 300 1535 175 --
NM_017410chr1211276 ------
NM_017415chr594569 4463 4421 4215 3476 2953 1202 615 404 13615 23503 634 --
NM_017420chr1443212 2635 1293 926 ------
NM_017423chr412194 11623 12046 --
NM_017426chr4141 ------
NM_017437chr1442096 620 187 59 --1967 --
NM_017452chr201582 --11425 11377
NM_017453chr201582 --11425 11377
NM_017454chr201582 --11425 11377
NM_017455chr155841 756 729 694 284 ------
NM_017489chr841279 1232 468 182 ------
NM_017551chr1042594 2441 2403 596 22421 2390 ----
NM_017554chr32447 182 --132 12184
NM_017575chr1721535 123 1435 ----
NM_017577chr33660 605 191 ------
NM_017580chr10--1334 ----
NM_017589chr11--199 ----
NM_017590chr2252648 2610 1974 406 146 22218 666 ----
NM_017596chr184508 4385 4238 3178 2916 1293 443 137 11042 24546 508 13510
NM_017599chr122612 389 11657 11914 --
NM_017610chr1541978 717 448 44 1547 1639 --
NM_017612chr121531 ----1189
NM_017628chr4124118 3884 3624 3466 3385 2120 2031 1979 1871 1432 1059 1006 21191 1091 34031 3443 3265 1385
NM_017629chr141549 1445 571 215 ------
NM_017633chr642673 238 198 161 --1216 --
NM_017634chr851442 1420 1292 1237 185 ------
NM_017637chr9178992 8412 8200 7990 7212 6848 6452 5926 5742 5736 3767 2596 2259 1344 1215 1143 790 1499 59025 6668 6297 1653 1329 1874
NM_017638chr12897 181 --1291 136
NM_017641chr127969 737 213 173 152 72 53 ------
NM_017643chr1782701 2579 2421 1921 1903 987 781 691 ----11980
NM_017644chr354738 4141 3387 779 593 13265 11861 --
NM_017650chr754075 3915 2260 2141 2067 44628 1777 1153 515 35003 1517 728 --
NM_017658chr1454597 3388 1624 1162 966 12992 --1870
NM_017660chr1933109 2179 1103 13219 --13089
NM_017666chrX51560 1406 560 203 182 ------
NM_017679chr171595 ------
NM_017686chr151147 768 385 308 281 ----11085
NM_017694chr241767 776 595 393 ------
NM_017697chr81172 126 ----
NM_017714chr204966 956 853 87 ------
NM_017734chr14630 466 250 28 1549 ----
NM_017736chr1623086 2077 --12379 22279 1033
NM_017737chr132176 1378 397 21450 751 ----
NM_017740chr1641741 1212 567 367 ------
NM_017753chr92893 41 ------
NM_017754chr674974 4820 4580 4471 3271 295 274 13383 14277 --
NM_017758chr173999 387 201 2989 40 ----
NM_017769chr1452583 2565 908 894 477 --11165 11047
NM_017770chr662909 2141 2041 647 401 279 12707 ----
NM_017786chr82272 94 --1716 1173
NM_017787chr1042515 2402 1133 789 12054 ----
NM_017789chr21214 ------
NM_017798chr202408 325 11080 --1266
NM_017813chr875836 4221 3703 2045 1112 1011 761 1332 14912 1954
NM_017824chr1031908 1749 241 138 1579 --
NM_017848chrX74684 4263 4253 4193 3880 2996 127 11720 ----
NM_017856chrX32097 504 328 --1385 12076
NM_017880chr22435 322 1132 ----
NM_017890chr851754 1693 1686 638 115 1273 ----
NM_017915chr123955 804 768 1782 ----
NM_017919chr9125516 5498 5390 5019 4928 4918 4121 2042 1083 808 596 41 --33665 2098 533 --
NM_017922chr14--1655 ----
NM_017933chr221593 1134 ------
NM_017935chr41238 ----1163
NM_017938chrX62027 1791 1582 642 408 216 1652 12211 --
NM_017944chr1152973 2384 1004 801 607 1873 ----
NM_017954chr741530 1309 234 70 1643 1434 --
NM_017975chr152832 135 2883 395 ----
NM_017987chr1091882 1700 848 789 710 532 446 422 268 --1125 11683
NM_017988chr121281 ------
NM_017994chr742745 663 98 49 ----11034
NM_017998chr931388 67 60 ------
NM_018004chr31381 ------
NM_018018chr12174 1386 11685 --
NM_018030chr18190 ----1451
NM_018036chr1473464 3283 2797 602 542 481 286 13298 ----
NM_018051chr72340 114 ------
NM_018061chr171715 1580 1169 1163 1115 532 270 --1569 --
NM_018078chr461078 904 818 260 122 79 --1407 --
NM_018085chr155568 3229 2436 691 384 37684 6004 440 --11567
NM_018105chr821170 504 --149 1475
NM_018110chr1631036 383 295 ------
NM_018116chr1--3633 538 532 ----
NM_018121chr1041031 969 787 327 ------
NM_018126chr441400 576 562 421 11215 ----
NM_018133chr331480 731 199 ----12163
NM_018137chr11158 21181 950 11154 --
NM_018155chr373375 2693 2125 1114 767 547 118 22667 326 22147 722 --
NM_018156chr11410 1141 11158 --
NM_018157chr1283290 3242 2813 2412 2038 791 344 273 12588 ----
NM_018159chrX21517 315 --11687 --
NM_018171chr1231009 975 681 --1336 --
NM_018178chr141604 794 652 535 --1632 --
NM_018181chr1821273 723 --2158 119 --
NM_018182chr1762205 1806 1642 1452 173 165 --2793 523 --
NM_018184chr341606 1507 653 164 ------
NM_018193chr153664 153 77 ------
NM_018202chr13846 367 291 --1764 --
NM_018211chr121612 1388 --192 --
NM_018214chr641087 517 115 91 --1322 --
NM_018221chr22450 299 ------
NM_018222chr1121201 557 1413 ----
NM_018227chr453133 2557 2199 814 549 ----12353
NM_018243chr483802 3141 2973 1384 781 723 716 476 --23365 1341 11580
NM_018247chr653165 2463 1055 930 816 ------
NM_018254chr121798 277 ------
NM_018257chr2051705 1691 1026 884 776 3909 764 254 --12427
NM_018263chr232432 1615 561 ------
NM_018279chr1282887 2354 2268 2240 1901 681 616 487 --1929 22484 744
NM_018293chr321030 418 ------
NM_018313chr362638 2575 1813 521 463 285 22197 1737 ----
NM_018314chr113494 244 35 2158 119 ----
NM_018327chr2041886 1757 1203 223 ------
NM_018328chr21413 ------
NM_018330chr1031625 1513 651 ------
NM_018339chr951773 1696 1660 1409 730 ------
NM_018351chr1284683 4209 3595 3407 1265 1064 507 285 44007 3798 3643 1672 23788 1031 --
NM_018362chr1153273 2887 692 226 120 --23780 3496 --
NM_018364chr1134145 4008 3738 3417 3325 2840 2627 1453 914 342 289 187 150 1794 23597 1633 --
NM_018373chr1485521 4802 4650 3982 906 396 161 67 15943 12024 --
NM_018374chr744986 4279 4017 3615 41805 1651 1061 702 23976 2053 22079 1570
NM_018375chr1441915 1298 1292 226 ----1279
NM_018403chr353865 3138 1210 1130 202 43919 757 317 158 13539 --
NM_018409chr483192 2741 2680 2579 721 628 622 107 23291 211 1294 --
NM_018416chr1252671 1973 1013 949 232 21052 592 3989 555 112 --
NM_018424chr941823 1740 1497 1235 21522 198 ----
NM_018429chr552819 2659 2496 2301 2284 12511 12353 --
NM_018433chr2193 1204 ----
NM_018439chr1852671 2174 1775 1728 769 22526 811 191 --
NM_018440chr8178593 7998 7545 7396 6998 6985 6865 6109 3395 3343 3222 3211 3005 2283 1556 1223 576 38087 6038 5343 ----
NM_018444chr821817 334 128 ----
NM_018448chr121843 --11218 --
NM_018449chr9139 1526 ----
NM_018452chr6_random62810 2441 2337 1507 1153 447 ------
NM_018462chr34710 324 310 114 ------
NM_018464chr101308 ----1334
NM_018471chr22482 158 ------
NM_018482chr852058 704 232 157 34 12482 --22615 384
NM_018489chr122356 1956 1340 1441 --
NM_018490chr1141404 1324 541 410 1438 --168
NM_018509chr1741448 1417 1192 663 ------
NM_018557chr231304 1115 112 ----11227
NM_018566chr193784 3749 1940 1406 1369 1251 690 251 115 23829 920 ----
NM_018584chr131185 1037 941 --1894 --
NM_018638chr1285666 5646 3871 2012 1961 1488 447 111 14213 21476 21 11527
NM_018639chr1211126 --1417 --
NM_018640chr1232403 1128 51 --22264 767 --
NM_018644chr1131369 121 54 --11949 --
NM_018650chr132070 1806 564 ------
NM_018652chr153394 278 84 ------
NM_018657chr32719 627 ------
NM_018682chr71198 ------
NM_018684chrX61327 1034 457 372 302 68 1508 ----
NM_018685chr72381 149 ------
NM_018691chr571256 1221 1176 1120 985 187 57 --11016 --
NM_018695chr532329 2298 2008 12216 ----
NM_018704chr151983 867 578 513 470 11659 ----
NM_018717chr422081 80 12600 --1370
NM_018834chr52679 631 ------
NM_018841chr193827 3760 3369 2633 1587 1397 631 401 161 --33695 3067 2452 12688
NM_018847chr931899 1828 1410 --167 --
NM_018931chr54847 785 318 241 ------
NM_018945chr673579 3426 2473 987 662 133 109 11013 ----
NM_018947chr784741 4674 4484 3773 1866 1516 1306 68 ----14690
NM_018970chr723088 1137 12539 1842 --
NM_018976chr1222183 2114 ------
NM_018979chr1252419 2328 1897 1758 770 --12105 --
NM_018992chr1651594 1479 1327 1295 134 ------
NM_018999chr1033544 1820 892 --21847 698 13056
NM_019000chr551555 1518 504 329 316 11211 ----
NM_019001chr394686 4554 3928 3293 1869 1187 1072 789 608 34256 3436 1608 ----
NM_019004chr731758 1734 303 --22106 1673 1455
NM_019005chr72358 55 ----1338
NM_019006chr15199 --1217 --
NM_019008chr22113766 3721 2927 2835 2662 2493 1343 1196 1099 603 48 12574 ----
NM_019022chr1883185 2528 2096 2020 2009 1138 849 286 ------
NM_019027chr432118 1852 725 12032 ----
NM_019035chr43826 787 590 11797 --22005 1683
NM_019041chr6142610 2304 1922 1841 1784 1648 1010 736 614 512 506 199 127 32 ------
NM_019053chr1011006 --1979 1866
NM_019058chr101535 ------
NM_019063chr221708 685 1797 11482 --
NM_019072chr573913 2896 1597 1430 1038 549 149 22831 782 ----
NM_019083chr151668 1163 1086 1066 197 11204 1349 --
NM_019084chr1021918 456 --21664 146 --
NM_019087chr561752 1737 1463 1287 568 155 --2242 221 --
NM_019091chr21169 ------
NM_019114chr922156 952 1677 ----
NM_019556chrX21411 545 11286 --11183
NM_019557chr12248 99 ------
NM_019593chr2032436 1031 1010 --33113 2613 2109 13186
NM_019597chrX3775 585 159 ------
NM_019605chr11692 ------
NM_019606chr72476 221 ------
NM_019610chr161926 1900 1845 1836 341 66 ------
NM_019891chr121003 296 --1305 --
NM_020061chrX194 ------
NM_020062chr20--1979 ----
NM_020066chr13899 663 386 1297 ----
NM_020116chr491771 1562 1392 1228 1191 1169 1134 369 97 ------
NM_020122chr275715 5487 5111 2306 1430 628 69 24540 917 129 --
NM_020123chr1041321 556 394 257 ------
NM_020141chr132410 613 522 ----1728
NM_020143chr22287 25 1126 ----
NM_020150chr1072244 2192 1526 1440 750 422 224 --11610 --
NM_020177chr53908 799 426 --1526 12519
NM_020182chr2033357 2806 2294 32469 2305 1267 12476 23177 2638
NM_020193chr1121030 534 ------
NM_020198chr1711512 1125 ----
NM_020200chr102927 887 196 1761 --
NM_020205chr142588 2292 2201 642 ----1562
NM_020225chr42395 23 ------
NM_020228chr1172476 2361 2336 2073 1669 544 459 1653 12387 --
NM_020239chr132170 613 530 --11539 21701 694
NM_020240chr531878 1093 207 1812 ----
NM_020245chr694975 3933 3466 2034 1746 1396 1230 374 346 34923 933 444 1382 --
NM_020307chr31300 ------
NM_020336chr2073817 3766 2805 2645 1241 703 619 13522 --11248
NM_020337chr453126 3057 1068 762 468 22746 826 22837 2437 11184
NM_020338chr1072831 2653 2642 1453 1079 735 384 ------
NM_020341chr2041265 655 301 160 ------
NM_020342chr222076 571 11758 12057 --
NM_020346chr1141510 1447 1126 577 21165 564 11753 --
NM_020357chr3185 11109 --1653
NM_020386chr31149 ------
NM_020390chr344380 1672 1320 1023 23397 482 24258 1738 13531
NM_020403chr1331493 1214 627 11121 11751 --
NM_020416chr442253 2156 1895 876 12134 --21705 704
NM_020420chrY3700 236 94 ------
NM_020429chr742114 673 465 283 11900 22939 2930 --
NM_020432chr71749 --1795 --
NM_020440chr151069 919 728 301 106 13162 --1382
NM_020444chr5--11525 --1532
NM_020453chr43349 279 28 ----21660 1314
NM_020455chr652745 1938 1060 804 533 ----1621
NM_020456chr1382150 2134 1735 932 887 727 423 94 ------
NM_020532chr21239 ------
NM_020546chr552840 958 746 680 106 22298 567 1326 --
NM_020640chr342270 900 725 326 1104 1277 --
NM_020644chr112750 272 --1989 --
NM_020648chr1882776 2549 2418 2255 2040 1763 80 58 --1657 --
NM_020651chr221457 419 --21355 1191 1300
NM_020654chr341563 1357 1329 435 11011 --1608
NM_020661chr124755 434 379 93 ------
NM_020673chr2057707 6068 1695 1560 1317 25504 1274 22460 1721 --
NM_020686chr1653118 1154 725 589 408 22823 2596 ----
NM_020699chr1104628 3435 2128 1221 1157 944 931 842 38 30 --1380 --
NM_020711chr272103 1961 1696 967 597 389 220 125 ----
NM_020714chr1954071 3760 1324 470 118 34580 3685 1593 24341 1803 --
NM_020717chrX94559 4309 4123 3251 1876 1780 1564 680 61 --24144 3287 --
NM_020718chr1675573 2628 2293 1895 1417 424 191 --16635 14603
NM_020727chr2172653 1472 1422 1185 513 464 166 ----11604
NM_020734chr1252962 2870 2521 2079 2054 12678 12546 --
NM_020739chr1562983 2853 1062 563 466 200 54083 3272 1436 1429 589 --11153
NM_020742chrX52598 2470 2055 2031 1821 32620 2503 885 ----
NM_020748chr1732178 1764 1625 ------
NM_020752chr1062537 2505 2308 1974 1885 477 --12339 --
NM_020755chr621623 1227 --1257 --
NM_020766chrX63726 2921 1476 1435 1364 1168 --12833 --
NM_020769chrX3950 342 316 ------
NM_020770chr131260 834 346 ------
NM_020771chr651258 1217 1051 502 258 --11225 --
NM_020772chr17158533 7700 7241 6684 6654 5866 5599 5453 3479 2054 1697 1167 1009 893 420 33283 2866 88 15582 28072 3437
NM_020774chr1886113 5540 4753 4357 2391 2050 1995 1557 15666 44200 1429 362 279 --
NM_020778chr15114750 4522 4141 3383 3361 1817 1200 605 560 544 323 11163 24827 504 1452
NM_020783chr1832183 1856 502 --1459 1406
NM_020794chr151394 1313 1298 1048 527 1150 ----
NM_020800chr341354 971 185 32 1297 ----
NM_020801chr562571 2515 2246 1735 642 75 ------
NM_020805chr1821500 1357 ----1691
NM_020806chr142154 56 ------
NM_020808chr11858 ------
NM_020809chr1162163 878 556 333 288 146 ------
NM_020810chr1473632 3596 3373 2920 735 712 338 ----12473
NM_020819chr61212 ------
NM_020824chr101615 ------
NM_020832chr13614 608 155 ------
NM_020839chr331127 1014 133 11335 ----
NM_020841chr12123642 3615 3432 3360 2999 2962 2933 1550 785 326 181 151 --21115 537 21561 160
NM_020843chr152413 335 ------
NM_020850chr1623164 1184 22845 1079 1910 13198
NM_020856chr1921344 264 --11316 --
NM_020858chr1542262 2202 1861 35 --1901 --
NM_020859chr473911 3827 3409 2864 379 182 136 --12645 --
NM_020860chr42396 389 ------
NM_020861chr641376 1198 518 490 --21104 49 --
NM_020868chr241431 692 619 379 --11409 --
NM_020871chrX52431 2183 1892 1880 228 --1990 --
NM_020872chr341811 1780 1758 160 ------
NM_020873chr34717 703 224 58 ------
NM_020888chr151782 1770 1519 1309 426 --11861 1174
NM_020899chr1751606 844 754 608 532 ----12020
NM_020901chr112428 277 ------
NM_020917chr1993557 3255 2717 2696 2612 1090 958 447 404 1591 --21458 164
NM_020918chr1052954 2488 889 587 166 22287 2240 ----
NM_020922chrX71794 1408 1347 1302 1161 691 438 1493 1238 --
NM_020925chr11939 1573 ----
NM_020935chr241790 1772 1480 1440 --34593 3478 212 --
NM_020940chr1041039 398 375 346 --11901 --
NM_020948chr193456 3347 2996 1486 793 718 624 493 264 ------
NM_020952chr93563 100 52 --1672 --
NM_020962chr1572494 2331 1000 917 829 455 322 --12417 --
NM_020964chr18134494 4302 4137 3757 3474 3082 3008 1861 1813 1703 1354 1124 926 14098 12921 1642
NM_020977chr45803 738 527 369 328 --21658 1497 --
NM_020983chr121254 11939 ----
NM_020988chr1611296 ------
NM_021007chr232251 939 916 1574 --11619
NM_021032chr341777 1743 719 149 --11764 --
NM_021033chr132624 587 ----1205
NM_021045chr1042635 2238 1695 1662 ------
NM_021061chr863727 3691 3467 3459 1541 878 129 24052 450 --
NM_021069chr452133 1901 1595 468 447 ------
NM_021072chr531815 748 72 ------
NM_021083chrX43626 2671 1188 421 --11094 11180
NM_021097chr273024 2570 2506 2400 2255 2053 745 22580 268 ----
NM_021101chr322465 1734 12341 31991 1013 192 1348
NM_021105chr32624 338 --2734 140 --
NM_021116chr7178977 8577 7625 7388 7231 6135 5842 5554 3502 2562 2399 2067 1851 1593 906 778 264 38535 2435 2082 ----
NM_021120chrX103070 2910 2807 2757 1944 1153 753 678 485 22 ------
NM_021135chr6102983 2940 2733 2691 2326 2205 1318 612 301 41 ------
NM_021136chr141282 ------
NM_021140chrX------11113
NM_021145chr71444 21062 453 1763 --
NM_021155chr19123007 2846 2336 2190 2101 674 552 504 315 178 122 46 11886 22619 2444 --
NM_021156chr2051130 1114 1104 901 409 181 ----
NM_021188chr142487 474 ------
NM_021190chr1--21102 864 ----
NM_021191chr1242319 1702 784 382 1202 21989 723 --
NM_021202chr2072131 2040 1899 449 314 260 161 ------
NM_021215chr2062438 2325 2147 540 444 146 ------
NM_021238chr1241828 1423 331 182 ------
NM_021239chr1441148 1034 192 139 ------
NM_021240chr92469 453 ------
NM_021245chr101170 ----199
NM_021252chr101331 1512 ----
NM_021255chr1443775 3614 1300 237 14110 13516 --
NM_021260chr1441426 932 563 478 11203 1107 --
NM_021624chr1851996 1885 1656 198 71 2586 210 ----
NM_021627chr31313 1848 ----
NM_021629chr354744 4025 3113 1407 1332 14113 ----
NM_021637chrX2439 95 ----1880
NM_021638chr474747 4407 3985 3477 1465 1295 168 14531 --157
NM_021643chr261900 1875 750 680 665 609 ----11627
NM_021647chr4124575 4434 4282 4134 3808 3066 1501 1372 1063 886 524 325 21714 508 14031 13165
NM_021648chr662503 2425 2254 490 427 116 2953 138 ----
NM_021785chrX185 ------
NM_021813chr635605 4049 934 34855 4232 3736 35681 3579 155 --
NM_021814chr621362 1339 ------
NM_021911chr5135320 5294 5076 5050 5009 4623 1205 1165 527 407 368 311 132 --11939 --
NM_021912chr1544035 3565 2648 2616 24072 1188 23106 522 --
NM_021913chr1931623 1232 1204 ------
NM_021914chr1452047 1876 1528 581 533 --1619 --
NM_021940chr641647 1278 1082 1052 ------
NM_021943chr622192 2073 11799 --1450
NM_021949chrX32352 1846 1123 1775 ----
NM_021954chr1383343 2970 2886 2443 1391 1369 1309 343 22923 266 ----
NM_021960chr142636 2532 1812 1792 ----1656
NM_021961chr11137282 7195 7110 6273 4982 2685 2423 2235 2199 2140 1333 639 508 47036 6858 6038 1121 15897 2746 668
NM_021963chrX2695 238 ------
NM_021964chr3136631 6609 6161 6011 5817 5024 4587 2631 1774 1612 1174 1059 484 ----11327
NM_021967chr541020 895 529 459 141 ----
NM_021970chr41700 ----2570 34
NM_021977chr663641 3075 2842 2496 1135 48 23766 337 --13267
NM_021988chr2021138 145 11244 ----
NM_021992chrX--1326 1115 --
NM_021998chrX11366 ------
NM_021999chr132529 126 ------
NM_022003chr1111063 --31309 1204 813 11277
NM_022037chr22748 243 ------
NM_022048chr1556000 2247 1439 1366 1006 2898 23 34691 1570 325 15473
NM_022058chr222097 1997 21792 104 ----
NM_022068chr181609 --1144 166
NM_022073chr142124 55 21433 184 11526 --
NM_022080chr2071983 1942 1877 1134 998 486 322 ------
NM_022093chr12889 21 1690 --1262
NM_022116chr761026 934 893 786 251 101 --1877 1909
NM_022123chr142532 164 ------
NM_022130chr531451 916 24 1246 ----
NM_022133chr841670 1614 1358 402 ----11559
NM_022137chr1461976 1765 1405 1323 802 481 --1233 --
NM_022143chr721430 475 1332 ----
NM_022166chr16125622 5163 4720 4574 3962 2327 1951 1829 1765 1541 1488 896 32230 1775 252 1715 --
NM_022173chr22748 243 ------
NM_022336chr221658 679 12233 31831 662 24 --
NM_022361chr6------1371
NM_022365chr10148 ------
NM_022366chr12303 83 ------
NM_022442chr2021138 145 11244 ----
NM_022444chr761822 1631 1561 1526 560 25 11366 ----
NM_022454chr82352 331 2799 76 ----
NM_022456chr12117513 6780 6148 6069 6045 5849 4986 4818 1562 544 179 16755 11953 11179
NM_022458chr722649 420 32277 1977 935 22437 663 --
NM_022461chr371349 1289 1193 1026 926 206 56 --11168 --
NM_022465chr1252125 653 596 375 166 32480 2045 444 31873 226 154 1874
NM_022474chr1472243 2207 1101 958 380 271 186 --22628 193 --
NM_022475chr46667 150 107 80 52 24 1524 ----
NM_022476chr1631099 865 828 ----1803
NM_022477chr2061199 693 489 149 95 39 1427 1249 --
NM_022484chr721000 917 11226 ----
NM_022491chr1263403 3212 1311 1114 519 353 ------
NM_022494chr101390 --125 --
NM_022550chr52409 104 ------
NM_022648chr284562 4452 3782 3695 1208 1183 878 659 1602 32852 1761 1269 24147 324
NM_022650chr521030 293 ------
NM_022652chr1221102 184 ------
NM_022716chr133136 1240 59 12908 1449 22998 412
NM_022726chr651188 400 316 267 126 --21080 229 --
NM_022739chr174917 797 300 248 ------
NM_022748chr71136 32046 1935 1137 12106 12743
NM_022753chr152385 849 599 495 390 ------
NM_022756chr131385 470 77 ------
NM_022758chr652480 2367 791 635 441 12600 11069 --
NM_022763chr352418 2349 2015 1193 842 --22961 2838 12787
NM_022766chr2262636 2547 961 912 456 415 1515 ----
NM_022771chr121857 ------
NM_022780chr221735 201 ----11151
NM_022781chr962991 2832 2660 1021 822 793 ------
NM_022782chr121127 --1317 --
NM_022784chr15154 --1841 --
NM_022789chr141511 ------
NM_022802chr1011634 11407 ----
NM_022817chr231712 1420 739 172 1424 --
NM_022824chr551844 1697 1583 1376 712 --1581 --
NM_022828chr521270 1125 1143 ----
NM_022841chr1532265 860 387 --12167 --
NM_022843chr1321495 1043 153 ----
NM_022845chr1631579 876 720 11799 2862 614 --
NM_022893chr232937 888 701 --12562 --
NM_022894chr23697 520 183 --11617 --
NM_022898chr14113802 3629 3557 3550 3162 3097 1617 1441 889 542 403 --24714 1230 11851
NM_022912chr252914 2883 2838 701 42 11195 --12262
NM_022918chr1121426 854 ------
NM_022970chr102966 181 11156 11092 --
NM_022977chrX72618 2300 1862 1021 936 483 466 ----11682
NM_022978chr541020 895 529 459 141 ----
NM_023037chr1321132 408 ----1394
NM_023039chr51305 1321 ----
NM_023068chr2041218 1036 519 309 21169 362 21563 527 --
NM_023074chr193884 185 137 --1948 --
NM_023927chr511033 --1918 --
NM_023929chr842662 2333 1084 872 ------
NM_024007chr532809 781 243 --11001 --
NM_024019chr421064 1050 --1182 --
NM_024052chr1722259 1925 22508 2416 --22853 2632
NM_024077chr92717 213 ------
NM_024089chr13------1153
NM_024090chr431437 425 179 2632 587 11466 --
NM_024294chr652480 2367 791 635 441 12600 11069 --
NM_024295chr852061 1995 1737 1497 1460 22022 186 ----
NM_024345chr996089 5563 5539 4907 4508 1474 1316 1058 565 25917 491 13827 26099 740
NM_024422chr1831833 1534 480 --1215 --
NM_024430chr1831403 608 231 --11678 --
NM_024501chr22623 273 1484 ----
NM_024520chr2--184 ----
NM_024524chr31284 --12534 1219
NM_024529chr12862 341 --1898 --
NM_024539chrX31243 800 360 ------
NM_024548chr331645 1348 1290 ------
NM_024551chr1231823 1590 248 11649 11013 12575
NM_024551chr1231823 1590 248 11649 11013 12575
NM_024554chr121410 268 11435 1204 2700 177
NM_024561chr1331195 197 126 ------
NM_024569chr162114 1794 1112 899 886 245 22933 2520 --1101
NM_024586chr14631 464 99 68 ------
NM_024595chr11186 ------
NM_024596chr843628 3467 1914 872 23516 3405 ----
NM_024612chr1721090 1008 ------
NM_024641chr632637 2391 886 12514 --22188 2015
NM_024645chr831224 365 339 2601 377 ----
NM_024646chr14880 465 67 39 --21020 683 --
NM_024657chrX1707 --2668 36 --
NM_024665chr374548 4348 4268 3619 3005 917 387 --34625 3659 3172 --
NM_024674chr163054 2515 2192 728 691 24 --1953 1466
NM_024680chr112492 85 1517 ----
NM_024686chr11585 1447 ----
NM_024692chr231354 1261 305 --1114 --
NM_024699chr83892 818 322 1194 ----
NM_024721chr852651 2097 2019 1855 576 1418 ----
NM_024749chr131649 517 506 167 ----
NM_024753chr23707 501 314 ------
NM_024769chr11--1728 ----
NM_024770chr2106660 6630 5061 4287 4278 4221 1791 1723 1520 620 36011 5194 4392 11197 11209
NM_024778chrX189 ------
NM_024779chr1251558 1494 1105 185 74 11161 11328 --
NM_024786chr53889 846 163 1216 ----
NM_024812chr872146 1505 1355 678 424 404 44 12139 1550 --
NM_024817chr1565103 3730 2273 2225 2211 1853 1506 ----
NM_024835chr171104 ----1153
NM_024837chr152746 32 1350 ----
NM_024847chr1631152 1110 948 --11176 --
NM_024852chr12590 442 1141 ----
NM_024854chr1231480 1042 197 21302 1286 --11189
NM_024857chr171343 176 ----
NM_024893chr201215 --1157 --
NM_024909chr651531 1399 1239 507 305 ------
NM_024920chr431359 1121 303 ------
NM_024921chrX31341 653 611 ------
NM_024930chr562717 2612 1898 1773 904 666 --12383 --
NM_024947chr3189134 9106 9068 8682 8603 8155 7991 7801 7769 6878 5832 3259 3065 1729 1122 1056 994 329 13594 26601 2722 28753 3458
NM_024948chr104597 505 190 165 ------
NM_024953chr1242761 2225 1717 55 11926 ----
NM_024969chr22731 121 ------
NM_024971chr93563 100 52 --1672 --
NM_024989chr2158050 7856 7044 6860 6839 6439 6331 6013 5441 2088 2053 1980 1932 1312 95 27100 2516 31418 1396 695 --
NM_024991chr1053156 3076 2923 2657 2240 --1785 1906
NM_025004chr112616 310 --1634 --
NM_025054chr8113472 3424 1188 1162 1147 1115 836 556 465 316 122 11048 13890 22958 1613
NM_025057chr1451175 916 251 73 58 --1330 --
NM_025073chr1114492 4187 3966 3595 1472 1364 1174 973 822 693 477 ------
NM_025074chr462966 2728 2249 952 933 613 ------
NM_025076chr22664 266 ------
NM_025133chr21790 1340 ----
NM_025134chr1642593 2167 2102 1883 --11809 --
NM_025138chr1331221 515 252 --121 --
NM_025146chr372583 2340 2299 2179 885 389 314 --2579 533 11790
NM_025152chr1421854 1278 ------
NM_025164chr1141708 1448 671 524 21532 894 ----
NM_025179chr1104873 4619 4519 4186 3636 3254 3219 1985 1477 1244 24537 215 13502 1791
NM_025191chr112662 12222 1847 --
NM_025202chr23993 393 284 2362 73 21011 262 --
NM_025222chr342984 798 542 114 1308 ----
NM_025244chr22265 86 ------
NM_030594chr1511025 ------
NM_030623chr221670 564 186 ----
NM_030625chr1052535 914 761 474 156 --2799 720 22231 93
NM_030627chr593499 3334 2818 1610 1492 1270 1147 945 95 --1236 --
NM_030634chr1112493 2482 2465 1789 1563 992 947 526 516 470 333 ----1796
NM_030647chr796183 5938 5521 5365 4680 4244 2281 2004 1311 24046 1868 --24745 4596
NM_030648chr4105228 4795 4778 3899 3755 3658 757 683 495 111 --3736 574 452 --
NM_030650chr273960 3370 3290 3222 2925 890 208 2602 539 22832 2783 13236
NM_030660chr1431359 179 47 --11243 --
NM_030661chr721693 1608 11059 ----
NM_030670chr1242163 2113 361 301 ------
NM_030671chr1242163 2113 361 301 ------
NM_030674chr12125336 5281 5244 5108 4665 4551 4307 3888 1806 1598 1155 659 13762 14289 --
NM_030751chr102399 366 --161 --
NM_030751chr102399 366 --161 --
NM_030753chr171292 ------
NM_030759chr10------1316
NM_030761chr152741 2659 2311 1043 1031 1131 ----
NM_030762chr1242006 1709 1542 645 ------
NM_030763chrX1921 1134 --1602
NM_030774chr1121279 28 ------
NM_030780chr821560 598 11244 11763 --
NM_030799chr511366 11920 --21977 760
NM_030806chr1129169 8631 8531 8068 7057 6308 5789 3435 3265 1820 775 644 12335 57156 7034 3452 3420 2856 --
NM_030809chr124714 418 316 34 11732 ----
NM_030812chr12211 163 ------
NM_030816chr152427 2368 1307 998 732 23218 2340 ----
NM_030884chr352152 2013 1701 1684 773 1849 --2885 482
NM_030885chr331838 1470 657 1340 21553 920 --
NM_030912chr102903 34 ------
NM_030918chr1125450 5300 4987 4573 4417 4252 2120 2068 1928 1092 1086 856 14547 24423 1525 34296 384 225
NM_030920chr1122 11787 ----
NM_030927chr1021646 1562 1575 ----
NM_030934chr1----21895 1825 --
NM_030939chr62251 77 ------
NM_030962chr1161058 603 428 346 215 77 --11182 --
NM_030978chr9184 ------
NM_031216chr1812181 ----11744
NM_031262chr911114 ------
NM_031263chr921171 42 ------
NM_031267chr7--1215 ----
NM_031268chr1665078 3333 3323 1858 1352 733 --25323 4970 --
NM_031291chr42649 612 --1667 --
NM_031314chr1451383 740 530 127 83 --12027 199
NM_031362chr242750 2644 2270 393 ----1806
NM_031365chr252886 2780 2406 1849 529 ----1942
NM_031366chr252886 2780 2406 1849 529 ----1942
NM_031371chr131628 1365 567 ------
NM_031371chr131628 1365 567 ------
NM_031372chr461658 1475 1079 541 469 183 ------
NM_031407chrX2179 147 ------
NM_031417chr1942169 777 589 359 22813 2427 1512 12257
NM_031418chr1132541 786 467 22776 244 11775 22496 2119
NM_031419chr321469 538 --11235 --
NM_031426chr972635 2455 2359 1124 1034 1022 342 1566 --12186
NM_031442chrX63083 3022 2247 2098 1098 426 --12927 --
NM_031445chr272967 2946 2792 1283 1186 1124 1071 21147 663 ----
NM_031461chr862275 2253 2226 2009 761 572 --11992 --
NM_031469chr663643 3005 2670 600 555 215 13591 --14119
NM_031483chr2032882 2511 54 --23251 1189 --
NM_031492chr11------1225
NM_031844chr1113298 3227 3073 2990 2916 2893 1548 1162 1081 937 487 1441 --11361
NM_031845chr242678 2587 1331 369 --12558 --
NM_031847chr242678 2587 1331 369 --12558 --
NM_031858chr17153 ----2437 422
NM_031862chr17153 ----2437 422
NM_031889chr451911 1600 1393 1315 779 31511 590 117 21941 472 --
NM_031890chr2252934 1111 736 684 229 12879 22247 981 --
NM_031911chr4102658 2298 2277 2250 1945 997 962 823 393 214 1330 --1855
NM_031935chr14985 930 258 185 ------
NM_032012chr943306 1853 1290 498 13325 11374 14709
NM_032013chr2061199 693 489 149 95 39 1427 1249 --
NM_032025chr341926 1323 186 51 22019 409 1371 22050 571
NM_032042chr542507 968 950 695 --11089 11858
NM_032050chr225700 407 357 198 160 --1422 --
NM_032102chr1143055 1014 947 700 11149 12549 --
NM_032121chrX32396 745 175 --21906 211 --
NM_032142chr182242 59 ------
NM_032144chr241835 739 446 416 1515 1359 11553
NM_032147chr122331 287 ------
NM_032153chr332145 1887 1873 1121 ----
NM_032160chr1884118 3715 3408 3277 3227 1020 468 83 --3802 755 439 --
NM_032186chr11528 --1972 --
NM_032192chr171530 ----172
NM_032195chr213510 473 345 145 ----
NM_032199chr1053501 3456 3051 1022 719 13213 ----
NM_032208chr252996 2871 2717 937 906 23556 1429 --12569
NM_032221chr2022006 1726 21974 224 --11618
NM_032228chr1183538 3466 3047 2848 2448 2335 938 645 ----13477
NM_032229chr1341135 1093 287 221 ----1186
NM_032239chr43497 250 176 ------
NM_032246chr154956 899 862 505 ------
NM_032268chr1653105 2584 729 705 588 11150 22494 219 12795
NM_032288chr342343 2161 2013 1991 ----12399
NM_032291chr1------1546
NM_032307chr91724 2934 121 ----
NM_032312chr23742 353 222 ------
NM_032320chr112568 524 ------
NM_032325chr1131903 1794 1251 2797 89 --1651
NM_032328chr1176 ------
NM_032352chr1441252 362 311 238 1197 --196
NM_032364chr123970 653 212 --11003 --
NM_032373chr10115919 5763 5353 5233 4857 1653 1204 776 571 437 394 ------
NM_032379chr11------188
NM_032410chr85994 868 793 356 159 --1287 --
NM_032434chr271256 1219 1054 1014 313 234 219 --21020 536 --
NM_032436chr134986 802 692 189 ------
NM_032438chr62356 243 ------
NM_032446chr573643 3120 3069 2421 1229 1153 757 169 --12745
NM_032452chr145620 578 550 392 103 ------
NM_032457chr443494 3001 508 198 ----1718
NM_032458chrX73420 2863 2575 2485 970 453 388 ------
NM_032466chr821098 542 ------
NM_032468chr831736 1098 542 ------
NM_032471chr62931 781 ------
NM_032486chr1652234 1918 1637 1073 602 1150 11734 12034
NM_032499chr1531132 713 358 --1302 --
NM_032505chr352540 2088 854 785 163 1460 11781 --
NM_032511chr62330 97 ------
NM_032521chr2062990 2746 2688 977 591 404 ------
NM_032547chr421147 1070 ------
NM_032550chr1041130 907 765 466 ------
NM_032557chr42411 85 --1731 1317
NM_032558chr961441 931 574 562 154 107 ------
NM_032578chr1051294 1253 1123 1077 567 ------
NM_032582chr1731537 1511 111 11378 ----
NM_032603chr2--1726 ----
NM_032622chr431464 530 72 ------
NM_032632chr1421432 359 --11505 11331
NM_032664chr82395 89 --1235 --
NM_032679chr1941091 928 896 46 ------
NM_032682chr353496 3473 2855 2276 784 22904 2655 23251 2289 --
NM_032689chr191350 11019 ----
NM_032717chr42923 336 ------
NM_032727chr1031543 563 150 --1523 --
NM_032741chr6140 1136 1120 --
NM_032765chr54719 673 385 182 ------
NM_032780chr1141173 896 199 66 --126 --
NM_032804chr1012408 1584 42527 1026 728 301 1808
NM_032813chr131284 --11120 --
NM_032838chr192509 64 ------
NM_032842chr731578 1053 485 --1184 11060
NM_032846chr1471457 1394 1369 1203 533 405 27 --2217 169 --
NM_032859chr1333613 3463 3109 21382 948 --1236
NM_032864chr131507 1434 167 ------
NM_032866chr1583149 3032 2666 2300 822 634 621 514 22058 2036 ----
NM_032869chr831768 735 108 --11677 --
NM_032876chr1472047 1867 1770 1406 554 377 114 ----1293
NM_032900chr1093918 3907 3778 3557 3085 2930 2898 559 517 ----1828
NM_032905chr1041280 1212 378 185 2285 40 ----
NM_032918chr1221175 1067 1293 ----
NM_032932chr1765401 4425 2296 1321 1152 957 34956 1079 661 35075 4779 475 --
NM_032943chr11------188
NM_032949chr132478 417 ------
NM_032961chr43500 273 84 ------
NM_032968chrX123815 3598 3402 3183 3047 2948 2712 1410 1315 1097 382 77 --22624 1392 --
NM_032969chrX123815 3598 3402 3183 3047 2948 2712 1410 1315 1097 382 77 --22624 1392 --
NM_032973chrY113807 3398 3178 3042 2943 2707 1410 1315 1097 382 77 --33595 2623 1392 --
NM_033012chr1311022 ------
NM_033018chrX2426 78 ------
NM_033020chr183773 3719 3207 3047 1132 1049 278 101 11168 14610 14094
NM_033027chr32772 146 ------
NM_033030chr2153 --11570 11454
NM_033044chr141302 366 340 71 ------
NM_033055chr141126 890 713 262 ------
NM_033058chr82788 352 --179 --
NM_033081chr202273 105 ------
NM_033083chr332227 1309 921 23023 2560 13413 1324
NM_033089chr2011509 11274 ----
NM_033103chr1931314 1179 939 ------
NM_033119chr164948 920 735 71 ------
NM_033129chr2031702 1389 219 1581 ----
NM_033132chr1352346 2157 1607 756 704 1901 --11458
NM_033133chr1741190 843 611 69 13188 12537 --
NM_033138chr772140 2131 1731 1478 1452 443 111 --11699 --
NM_033139chr772140 2131 1731 1478 1452 443 111 --11699 --
NM_033140chr772140 2131 1731 1478 1452 443 111 --11699 --
NM_033143chr453347 1730 1448 1278 987 ----11687
NM_033157chr772140 2131 1731 1478 1452 443 111 --11699 --
NM_033161chr911965 --195 --
NM_033167chr331500 1381 393 --11315 --
NM_033168chr331500 1381 393 --11315 --
NM_033169chr331500 1381 393 --11315 --
NM_033181chr683181 3020 2785 2530 1108 439 237 186 --23740 771 13522
NM_033211chr511561 ----1374
NM_033221chr941854 762 390 259 1361 --22738 520
NM_033224chr7158004 7284 6698 6213 2763 2570 2541 2489 2169 1763 1633 1380 1227 504 329 47217 2993 1199 1114 26397 1752 --
NM_033225chr863126 2476 2419 2013 1977 536 32043 973 116 ----
NM_033255chr132468 360 1373 --1164
NM_033261chr10------1166
NM_033281chr52919 168 ------
NM_033285chr8124498 3748 3520 3460 3221 3177 2811 1085 959 941 554 143 --23768 2884 43271 3262 1645 396
NM_033326chr1142498 2114 935 423 1375 ----
NM_033360chr1253719 3508 1549 614 481 21845 950 ----
NM_033364chr31196 11895 --11826
NM_033380chrX21040 953 --1789 --
NM_033381chrX21040 953 --1789 --
NM_033389chr1744760 3816 3730 1244 34312 3741 1654 1837 14368
NM_033397chr1031633 734 26 --22119 819 --
NM_033407chr11208 ------
NM_033425chr1163158 2498 847 676 252 153 22651 2345 13395 --
NM_033429chr152461 436 1581 ----
NM_033430chr463874 3586 3013 1610 1251 298 11498 13206 --
NM_033437chr463874 3586 3013 1610 1251 298 11498 13206 --
NM_033484chr53574 562 484 ------
NM_033495chrX51066 970 922 58 37 ----1909
NM_033502chr6--150 ----
NM_033503chr1523850 3223 --11172 --
NM_033505chr286778 6245 5700 4880 2649 1295 926 578 ------
NM_033551chr553417 3289 2332 752 581 12514 11181 11318
NM_033624chr123620 515 257 --143 11519
NM_033631chr162462 1500 1284 1235 874 231 --13863 12612
NM_033642chrX21188 136 11057 --1780
NM_033656chr21115537 4277 4180 3864 3650 2090 1821 1533 1423 1113 1039 25869 4101 ----
NM_052832chr832974 2637 578 2958 705 --11007
NM_052857chr171314 --1401 --
NM_052867chr1341015 984 281 57 --21105 544 --
NM_052879chr1264058 3904 3767 3695 2883 358 13202 ----
NM_052885chr12114563 4501 4076 3897 1967 1730 1664 1526 1268 640 127 --1304 --
NM_052905chr241925 553 244 108 --11182 --
NM_052907chr1244281 4192 3804 446 --1877 1704
NM_052911chr182725 203 --1927 --
NM_052917chr283378 3335 2971 2864 2712 422 115 105 22158 371 13171 --
NM_052918chr1072407 1255 1039 1002 951 533 73 22592 2346 ----
NM_052927chr52850 636 12143 --11983
NM_052932chr1151885 1532 444 394 261 1203 187 --
NM_052937chr852098 2022 1697 990 282 ------
NM_052978chr1431687 1540 298 --11872 --
NM_053001chr81378 ------
NM_053016chr9147621 7592 7558 7170 5585 5529 5300 2823 2340 2217 1468 930 446 197 16534 42471 2374 1188 832 --
NM_053023chr1123276 2620 11051 32343 2232 2155 2459 272
NM_053025chr321106 323 --11432 --
NM_053026chr321106 323 --11432 --
NM_053027chr321106 323 --11432 --
NM_053028chr321106 323 --11432 --
NM_053031chr321106 323 --11432 --
NM_053032chr321106 323 --11432 --
NM_053035chr73238 201 94 ------
NM_053042chr431940 44 32 --12540 --
NM_053043chr785005 4466 4150 2559 1518 1208 221 114 --25307 1107 1417
NM_053056chr1183033 2460 994 864 702 505 404 121 11220 ----
NM_053064chr1412453 32622 1223 295 --1618
NM_054025chr1131369 121 54 --11949 --
NM_057159chr93615 533 33 ------
NM_057169chr1253064 2967 2424 2135 2114 ----22916 2609
NM_057170chr1253064 2967 2424 2135 2114 ----22916 2609
NM_057175chr432312 252 147 ------
NM_057178chr1762511 2488 880 583 468 406 1806 ----
NM_057749chr81317 1420 ----
NM_058170chr131447 512 218 11617 11092 --
NM_058172chr431676 1204 529 --11763 --
NM_058191chr212882 205 --1680 --
NM_058241chr241745 1436 574 137 12197 ----
NM_058241chr241745 1436 574 137 12197 ----
NM_078483chr543299 835 701 485 --12870 164
NM_078487chr932791 650 623 --12364 --
NM_080597chr18190 ----1451
NM_080599chr103502 248 61 11223 ----
NM_080617chr2021045 267 ------
NM_080645chr622001 1723 11410 21826 591 --
NM_080651chr8--1229 ----
NM_080654chr1141042 397 263 53 1191 21125 81 --
NM_080666chr143625 407 166 ----11435
NM_080669chr17114732 4555 4370 4357 3463 3014 1531 1216 1157 894 554 ----24917 3665
NM_080671chr252188 1759 1624 630 428 ------
NM_080676chr20102664 2259 2156 2081 2036 1221 931 704 325 122 --21322 250 12233
NM_080678chr2--2156 88 --1626
NM_080723chr62504 466 21276 1225 ----
NM_080737chrX21208 1080 --1341 11244
NM_080738chr11745 --2310 249 1528
NM_080743chr652502 2329 2010 1963 555 ------
NM_080832chrX31726 1196 526 11450 --1220
NM_080840chr20292 56 ------
NM_080841chr20292 56 ------
NM_080867chr14114557 4232 3667 1893 1659 1557 1313 487 391 370 282 25031 772 11319 11124
NM_080872chr893769 3140 2879 2529 1432 1392 1365 1147 680 43839 3471 2981 1073 13536 --
NM_080927chr373232 2977 1014 770 651 466 218 --33214 2442 2167 --
NM_130391chr942362 1047 806 679 ------
NM_130392chr942362 1047 806 679 ------
NM_130393chr942362 1047 806 679 ------
NM_130434chr151901 --11221 --
NM_130436chr2122710 493 2566 206 1228 12647
NM_130438chr2143287 1070 291 191 21143 783 1805 13224
NM_130439chr104763 671 533 319 ----12113
NM_130439chr104763 671 533 319 ----12113
NM_130442chr721138 457 ------
NM_130768chr71285 ------
NM_130798chr1521326 263 11559 ----
NM_130808chr31332 ------
NM_130809chr553006 2753 2640 2153 189 --1842 --
NM_130830chr363623 3091 1528 1472 291 158 12874 1304 23822 2651
NM_130831chr322588 482 11784 ----
NM_130832chr322588 482 11784 ----
NM_130833chr322588 482 11784 ----
NM_130834chr322588 482 11784 ----
NM_130835chr322588 482 11784 ----
NM_130836chr322588 482 11784 ----
NM_130837chr322588 482 11784 ----
NM_130838chr152275 229 --11390 --
NM_130839chr152275 229 --11390 --
NM_133264chr1743504 1301 990 231 --22519 141 --
NM_133265chrX43655 2924 445 330 ----23206 1163
NM_133329chr231788 1702 445 11561 1129 --
NM_133330chr432913 2833 2526 22728 167 1762 1855
NM_133331chr432913 2833 2526 22728 167 1762 1855
NM_133334chr496224 6114 5712 4197 2106 1423 1094 893 750 32261 1326 433 1528 14709
NM_133335chr432913 2833 2526 22728 167 1762 1855
NM_133338chr51451 ------
NM_133339chr51451 ------
NM_133340chr51451 ------
NM_133341chr51451 ------
NM_133342chr51451 ------
NM_133343chr51451 ------
NM_133344chr51451 ------
NM_133367chr663304 2959 2731 2668 2394 407 2386 280 --23145 719
NM_133370chr473704 3608 3555 2398 793 784 732 23526 3283 ----
NM_133372chr552387 1907 901 150 131 32315 2222 997 11031 --
NM_133433chr52837 250 1198 ----
NM_133445chr922886 1151 23781 1096 --13764
NM_133476chr1231010 445 155 --11038 2355 340
NM_133493chr694352 4250 3865 3627 3541 3202 3148 3034 1430 24676 748 23935 309 --
NM_133496chr1114026 3936 3744 3141 3006 2877 1319 1025 1013 352 281 --32795 1667 780 11130
NM_133503chr122662 248 ------
NM_133504chr122662 248 ------
NM_133505chr122662 248 ------
NM_133506chr122662 248 ------
NM_133507chr121840 1184 ----
NM_133631chr321315 655 ------
NM_133646chr295404 5379 5363 5289 5205 4785 4262 3584 1776 23619 1800 14977 21310 1167
NM_133647chr15113638 3490 3365 3330 2825 2611 2504 2487 1272 1000 52 --33806 3447 474 --
NM_134265chr1721169 347 ----1791
NM_134268chr1731155 754 415 51134 1128 1122 1116 1110 ----
NM_134325chr131799 653 391 11417 1555 --
NM_138270chrX103216 3193 2720 2447 2253 639 594 568 205 122 13417 1776 --
NM_138292chr1152607 2330 768 725 690 12445 1682 --
NM_138316chr1021303 143 ----21347 854
NM_138333chr992475 2289 2263 2222 2204 1810 1697 1661 144 --12344 11789
NM_138335chr45898 696 650 582 166 ------
NM_138340chr181509 1244 ----
NM_138357chr1051661 1351 1263 1155 318 1438 ----
NM_138381chr382352 1938 1922 1828 616 603 399 60 --11986 --
NM_138391chr12921 279 ------
NM_138440chr162526 513 ------
NM_138444chr13133974 3500 1951 1910 1767 1756 1697 1484 945 671 421 185 110 11388 ----
NM_138459chr693644 3576 2652 1125 726 707 666 658 636 1112 --22936 567
NM_138468chr285766 4832 4533 4009 1710 1250 707 184 --1732 1955
NM_138473chr12104779 4501 3364 3230 2027 1952 1647 1204 837 733 --15063 23468 1601
NM_138479chr122098 395 --1797 12018
NM_138576chr14113802 3629 3557 3550 3162 3097 1617 1441 889 542 403 --24714 1230 11851
NM_138621chr253227 3005 2826 934 845 13863 --21669 413
NM_138638chr1452047 1876 1528 581 533 --1619 --
NM_138693chr72297 77 1335 ----
NM_138694chr672366 2333 1080 755 452 341 85 22449 1440 22289 2277 1655
NM_138713chr16138062 7179 6147 5792 3222 3102 2540 2442 2188 2065 1700 1612 45 26492 198 47545 6982 1519 772 25503 3053
NM_138714chr16138062 7179 6147 5792 3222 3102 2540 2442 2188 2065 1700 1612 45 26492 198 47545 6982 1519 772 25503 3053
NM_138731chr1483869 3330 3212 3175 1650 843 830 277 --11532 1345
NM_138771chr731122 221 48 --31264 1016 567 --
NM_138775chr11------1574
NM_138782chr531550 848 187 3614 557 242 ----
NM_138819chrX127 1308 ----
NM_138927chr21--1413 ----
NM_138959chr196747 5639 5546 5475 4628 4520 2466 1878 396 --1137 12056
NM_138969chr831160 924 123 --1463 --
NM_138970chr1432298 1936 1683 --11814 --
NM_138971chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_138971chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_138972chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_138972chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_138973chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_138973chr1183804 3077 1434 1031 930 901 335 319 11096 33767 2397 1389 --
NM_139012chr621526 305 11957 --11613
NM_139035chrX--1202 1761 --
NM_139062chr171435 ------
NM_139068chr54669 642 567 530 ------
NM_139069chr54669 642 567 530 ------
NM_139070chr54538 511 436 399 ------
NM_139131chr113599 260 182 ------
NM_139132chr113305 143 90 2429 225 ----
NM_139136chr123845 813 174 ------
NM_139159chr1911281 --1171 --
NM_139164chr551421 1244 1216 530 296 ------
NM_139168chr531860 217 59 1537 ----
NM_139182chr441808 1591 1507 554 ------
NM_139207chr12--22228 1860 ----
NM_139312chr1011482 ----1167
NM_139316chr72393 375 31101 993 196 ----
NM_139321chr2063438 2877 1549 1189 483 458 23561 1221 ----
NM_144571chr496635 5620 5545 4284 2515 1912 1626 1381 685 24267 92 16072 --
NM_144574chr143462 232 97 ------
NM_144582chr292278 1997 1841 1675 864 825 811 515 260 --12158 --
NM_144590chr1062576 2417 1972 1913 889 202 1881 1450 158
NM_144599chr1574977 4189 3336 2056 1633 523 86 --1283 --
NM_144600chr1641650 1457 1155 324 ------
NM_144632chr242382 588 385 195 21517 825 --11959
NM_144642chr33970 496 43 11057 11163 --
NM_144664chr1122306 1910 11774 12009 --
NM_144709chr22315 270 ------
NM_144767chr1564600 3667 1786 1556 792 120 23821 3113 ----
NM_144777chr13165 ------
NM_144778chr1372603 1762 1707 982 566 307 74 ------
NM_144973chr1245136 773 530 473 21318 130 54932 4463 4384 1445 235 12134
NM_144975chr171710 11124 ----
NM_144977chr13725 718 504 --2279 249 --
NM_144979chr42642 242 ------
NM_144982chr122177 143 1235 --1150
NM_145000chr5----1472 --
NM_145005chr93722 715 295 ------
NM_145025chr641136 393 356 293 --11035 --
NM_145036chr171304 1116 ----
NM_145048chr43823 690 80 ------
NM_145049chr551096 1030 871 755 208 ------
NM_145115chr782292 2097 1538 1522 628 588 444 352 22344 553 --1719
NM_145117chr11103158 2888 2843 2502 2370 2357 2058 1121 1095 968 11044 ----
NM_145176chr642382 2239 495 311 --33359 2364 619 --
NM_145203chr131618 ------
NM_145246chr1051140 907 435 208 197 --1325 --
NM_145259chr2126349 5911 5701 5530 5150 5067 4892 2853 1911 812 691 423 15829 --11794
NM_145284chrX82530 2359 2347 1897 1726 1663 1583 389 --1416 --
NM_145301chr171598 ------
NM_145305chrX21025 892 ----11088
NM_145307chr1084093 3631 3472 3057 2967 2858 961 240 23486 480 --1378
NM_145309chr1131365 432 262 ------
NM_145320chr783508 3168 2982 2917 2826 2219 1354 461 ------
NM_145321chr783508 3168 2982 2917 2826 2219 1354 461 ------
NM_145322chr783508 3168 2982 2917 2826 2219 1354 461 ------
NM_145330chr21136 ------
NM_145649chr631677 871 841 ------
NM_145655chr631677 871 841 ------
NM_145690chr851732 1698 1450 1444 357 --11756 --
NM_145693chr222225 987 ------
NM_145698chr1032009 713 470 11537 1320 --
NM_145735chr1352457 2413 2129 2104 1926 1717 --1286
NM_145756chr1841534 1163 625 448 11371 ----
NM_145808chr773079 2969 2933 2738 2118 2045 872 --11194 --
NM_145861chr11745 --2310 249 1528
NM_145888chr1941487 1397 193 79 1461 ----
NM_145899chr61135 11052 11340 --
NM_145901chr61135 11052 11340 --
NM_145902chr61135 11052 11340 --
NM_145903chr61135 11052 11340 --
NM_145904chr61135 11052 11340 --
NM_145905chr61135 11052 11340 --
NM_145909chr63983 896 155 ------
NM_145913chr122956 324 ----2153 26
NM_147147chr673748 3650 3266 3201 2886 1272 91 23828 631 --14227
NM_147150chr923926 657 22587 119 12952 11571
NM_147156chr1041476 1241 1049 99 --11337 --
NM_148571chr1751901 1379 785 356 247 1818 ----
NM_148904chr14631 464 99 68 ------
NM_148905chr14631 464 99 68 ------
NM_148906chr14631 464 99 68 ------
NM_148907chr14631 464 99 68 ------
NM_148908chr14631 464 99 68 ------
NM_148909chr14631 464 99 68 ------
NM_148955chr1576211 5618 2123 1975 1827 1570 764 46185 6075 6069 868 31503 676 57 21631 1480
NM_148977chr1021303 143 ----21347 854
NM_148978chr1021303 143 ----21347 854
NM_152261chr121981 1327 22403 103 --
NM_152265chr151453 1017 605 556 454 --1362 --
NM_152277chr532034 541 528 ------
NM_152278chrX1405 ------
NM_152300chr1751834 1403 1386 1295 260 --1742 --
NM_152309chr1042218 2099 1893 763 1117 11582 --
NM_152330chr1462565 2445 977 670 445 240 --2657 93 --
NM_152365chr12475 388 ------
NM_152375chr132536 2226 1634 1826 1708 --
NM_152388chr2104069 3753 3667 3648 3635 3354 1574 1480 1330 1203 ------
NM_152409chr533294 3106 818 ------
NM_152414chr841322 1074 309 83 ------
NM_152418chr831242 655 557 ------
NM_152420chr91612 ------
NM_152424chrX64679 3964 764 679 596 450 --11342 --
NM_152437chr123654 509 497 ----22435 533
NM_152448chr151136 ----1214
NM_152450chr151525 --2513 269 --
NM_152470chr1864096 3509 3196 2883 812 567 12748 21487 344 --
NM_152487chr131399 1359 1174 ------
NM_152493chr121145 124 ------
NM_152515chr22926 60 ------
NM_152519chr242090 1867 1492 732 --11917 --
NM_152520chr24497 445 400 325 --1942 --
NM_152522chr21858 1140 ----
NM_152529chr253692 1003 699 260 37 23951 2826 12735 22843 2719
NM_152538chr341848 1833 687 216 --11157 --
NM_152542chr431897 1352 530 ------
NM_152556chr751886 1014 644 457 167 1905 ----
NM_152564chr851754 1693 1686 638 115 1273 ----
NM_152581chrX31413 1190 550 11443 ----
NM_152594chr15--31937 749 686 ----
NM_152607chr13432 333 309 ------
NM_152608chr152198 2043 1848 1829 584 11893 1295 --
NM_152622chr562753 2338 1221 882 303 140 ------
NM_152624chr5166796 6291 6271 5868 5391 5240 4900 4892 4628 2035 1379 1315 776 526 284 255 25578 5548 35720 5624 2293 --
NM_152629chr953821 3441 2822 2692 1622 21517 425 1609 --
NM_152636chr1152886 2703 837 730 492 11112 12155 --
NM_152641chr1262675 1970 1163 755 684 150 11835 ----
NM_152660chr121013 280 1982 1125 --
NM_152663chr11311 ------
NM_152665chr15982 965 804 294 147 ------
NM_152666chr12740 160 --2796 126 --
NM_152678chr341914 556 478 433 --21856 406 --
NM_152688chr61112 --1263 --
NM_152695chrX82288 1824 1551 868 780 389 315 149 ----12162
NM_152703chr73872 858 43 11025 158 172
NM_152716chr1151578 1392 1373 609 246 ------
NM_152725chr101101 ------
NM_152744chr731074 888 470 1669 13306 12610
NM_152745chr72879 847 ------
NM_152749chr721000 371 --11132 --
NM_152756chr543513 2827 1450 1296 --1110 --
NM_152758chr8103042 2845 2787 2482 1882 1170 1117 1105 978 228 1988 ----
NM_152765chr852286 2185 568 562 263 11944 1121 1726
NM_152787chrX33511 3315 1445 --23292 844 --
NM_152793chr764252 4038 3395 3385 1213 935 34841 4822 367 21434 284 --
NM_152826chr1576211 5618 2123 1975 1827 1570 764 46185 6075 6069 868 31503 676 57 21631 1480
NM_152835chr122160 900 --1560 --
NM_152836chr841670 1614 1358 402 ----11559
NM_152837chr841670 1614 1358 402 ----11559
NM_152838chr2042491 2440 1271 1019 2464 34 ----
NM_152862chr22432 108 ------
NM_152878chr2221174 986 --11075 1599
NM_152890chr121259 287 ------
NM_152903chr1362642 2194 1144 1033 399 76 12765 186 --
NM_152919chr1953622 2428 247 184 24 23044 1057 ----
NM_152924chr1566792 6692 5296 4742 2666 406 1723 1821 --
NM_152989chr1231583 1400 1243 2356 61 ----
NM_152991chr113596 284 137 194 ----
NM_152994chr21442 ----1571
NM_152996chr162133 1965 1711 1289 489 309 ------
NM_152999chr774675 4449 4374 1914 1607 1320 673 14943 24854 4248 11011
NM_153013chr532373 1760 140 11989 --1857
NM_153029chr1673930 3146 2879 2836 1472 1286 1128 13469 11085 22716 989
NM_153042chr621480 438 ------
NM_153184chr341886 1801 1487 521 ------
NM_153188chr565435 4057 3914 1640 1572 1110 --25449 2001 --
NM_153207chr1224013 1333 1801 --1913
NM_153235chr642164 2092 1635 1591 ------
NM_153261chr1631555 1546 151 11202 ----
NM_153262chr173176 3124 3101 2807 2301 785 246 33199 2378 1026 12090 --
NM_153332chr892505 2409 2301 2229 1277 1169 394 334 280 --12062 --
NM_153333chrX168 ------
NM_153342chr2197 --153 --
NM_153346chrX32025 575 468 ------
NM_153350chr1621671 521 ------
NM_153354chr51725 1893 --1153
NM_153362chr62982 957 ----1338
NM_153365chr462508 2120 1854 669 531 140 11835 ----
NM_153367chr1063323 3300 3161 1383 1162 1040 12660 13745 --
NM_153371chr1362415 2070 1944 1514 571 33 --11477 --
NM_153442chr10135001 4759 4747 4349 4177 2375 1774 1440 1376 992 917 843 659 24553 3943 ----
NM_153605chr351160 376 356 225 181 ----196
NM_153607chr542786 2643 2526 595 ------
NM_153616chr1542262 2202 1861 35 --1901 --
NM_153617chr1542262 2202 1861 35 --1901 --
NM_153618chr1542262 2202 1861 35 --1901 --
NM_153619chr1553500 3440 3099 1273 219 ------
NM_153620chr721247 472 1316 11396 --
NM_153631chr721693 1608 11059 ----
NM_153632chr721693 1608 11059 ----
NM_153634chr1231680 1331 455 11210 1154 --
NM_153649chr131978 1499 613 11874 ----
NM_153686chr42147 25 32387 2311 2193 --11901
NM_153687chr122158 93 ------
NM_153690chr32792 637 ------
NM_153695chr92109 63 ------
NM_153705chr1162658 2003 1853 540 405 246 --21787 936 --
NM_153748chr123845 813 174 ------
NM_153810chr1063478 3142 2050 1906 1202 1108 14625 14678 14503
NM_153825chr431755 315 191 1201 --11418
NM_153828chr21239 ------
NM_153831chr8------21005 88
NM_170607chr1711203 11398 11535 1157
NM_170665chr1274615 4481 3767 3587 1821 1009 290 13747 13512 --
NM_170672chr22621 274 --1375 --
NM_170675chr152899 217 --1348 --
NM_170676chr152899 217 --1348 --
NM_170679chr52960 404 ----1139
NM_170692chr1--2858 852 ----
NM_170695chr181340 ------
NM_170706chr184070 3343 3328 2860 2795 1585 358 319 1944 ----
NM_170709chr852166 1662 569 247 203 ------
NM_170719chr1331221 515 252 --121 --
NM_170721chr1721209 1019 --2495 204 1172
NM_170723chrY--182 ----
NM_170724chr62990 296 ------
NM_170731chr1122283 644 12056 2424 336 --
NM_170732chr1122283 644 12056 2424 336 --
NM_170733chr1122283 644 12056 2424 336 --
NM_170734chr1122283 644 12056 2424 336 --
NM_170735chr1122283 644 12056 2424 336 --
NM_170751chr611336 182 ----
NM_170752chr611336 182 ----
NM_171827chr221292 42 1108 ----
NM_172037chr831186 973 403 1271 ----
NM_172057chr72397 151 ------
NM_172058chr811804 ------
NM_172059chr811804 ------
NM_172060chr811804 ------
NM_172069chr252136 940 781 543 334 21745 802 135 12060
NM_172070chr252138 1599 618 295 221 1600 ----
NM_172071chr1136774 6218 6142 6056 6012 5647 5452 2733 2583 2401 2299 1222 753 3724 445 435 24865 27 --
NM_172103chr642567 2191 1959 377 ------
NM_172105chr642567 2191 1959 377 ------
NM_172127chr441409 784 112 72 21542 1286 12028 --
NM_172159chr352301 2064 1668 231 211 11475 --1517
NM_172160chr352301 2064 1668 231 211 11475 --1517
NM_172217chr1513890 32388 1425 69 ----
NM_172240chr1251377 1243 1137 960 909 --1493 --
NM_172314chr141511 ------
NM_172344chr231788 1702 445 11561 1129 --
NM_172350chr16701 575 551 389 139 65 151 ----
NM_172354chr15693 669 507 257 183 1169 ----
NM_172359chr16705 579 555 393 143 69 155 ----
NM_172373chr1331396 1357 1339 ------
NM_173060chr531516 1445 167 145 11760 --
NM_173061chr531516 1445 167 145 11760 --
NM_173063chr531516 1445 167 145 11760 --
NM_173076chr21292 ----189
NM_173078chrX2419 382 ------
NM_173082chr651357 1255 1103 179 155 ------
NM_173083chr131304 1298 1211 ------
NM_173084chr352270 2142 934 710 36 ------
NM_173167chr1762654 2539 2515 788 684 170 1924 ----
NM_173171chr221146 964 ----1288
NM_173172chr221454 1272 ----1596
NM_173173chr221146 964 ----1288
NM_173177chr22169 42 1594 ----
NM_173207chr181340 ------
NM_173208chr181340 ------
NM_173209chr181340 ------
NM_173210chr181340 ------
NM_173211chr181340 ------
NM_173214chr16138062 7179 6147 5792 3222 3102 2540 2442 2188 2065 1700 1612 45 26492 198 47545 6982 1519 772 25503 3053
NM_173355chr23873 825 135 ------
NM_173359chr361738 1463 1183 256 125 28 ------
NM_173454chr152775 354 ----11108
NM_173468chr494709 3777 1780 1440 223 194 165 144 99 1797 11520 --
NM_173469chr1531448 1307 192 ------
NM_173470chrX42794 2353 1952 362 11056 12732 1953
NM_173473chr1061000 876 698 631 490 337 --1730 --
NM_173475chr1631673 1220 253 ----11706
NM_173491chr561120 944 522 492 284 64 ------
NM_173494chrX2911 97 --186 --
NM_173495chrX22189 2178 --11675 11793
NM_173496chr1072932 2686 2240 1207 875 217 145 --1488 --
NM_173500chr152101 38 11044 ----
NM_173508chr1------11217
NM_173510chr2262567 2368 1872 923 780 391 --22330 342 --
NM_173511chr263861 3851 2958 2526 2504 354 ------
NM_173531chr1943417 2609 1273 508 2115 31 12491 13147
NM_173552chr332180 962 776 ------
NM_173576chr1052264 2089 1831 546 466 11701 ----
NM_173582chr11116198 5999 2284 1797 1783 1137 1030 797 266 115 88 1908 11191 --
NM_173595chr1295236 5214 4862 3521 2127 2112 1824 1619 1530 --32018 881 784 --
NM_173602chr1273323 3236 2870 2857 2601 915 116 13400 21076 664 --
NM_173609chr152730 694 1463 ----
NM_173614chr16--2326 169 ----
NM_173642chr1109216 8285 7222 6534 6157 2027 1673 1166 1053 625 18985 ----
NM_173648chr2180 2743 737 ----
NM_173681chr71567 22069 1556 11456 11668
NM_173683chr81628 --1222 --
NM_173694chrX62026 1659 700 609 191 37 ------
NM_173803chr1661472 1442 1276 1168 658 400 ------
NM_173808chr174428 4042 3894 1403 1333 213 35 --13795 --
NM_173814chr15------1174
NM_173822chr231758 781 191 --21653 1550 1131
NM_173824chr32246 92 ------
NM_173825chr353004 2542 1082 1064 891 --23013 1159 12922
NM_173833chr841545 1084 663 453 2126 119 ----
NM_173848chr8--1873 ----
NM_173851chr823268 2890 ------
NM_173854chr11774 1128 --12324
NM_174886chr181340 ------
NM_174890chr10--1296 ----
NM_174916chr1541959 946 928 855 ------
NM_175061chr751700 1602 618 608 156 133 ----
NM_175610chr1511213 --11059 --
NM_175623chr12117513 6780 6148 6069 6045 5849 4986 4818 1562 544 179 16755 11953 11179
NM_175634chr851223 1101 225 155 116 165 --11316
NM_175635chr851223 1101 225 155 116 165 --11316
NM_175636chr851223 1101 225 155 116 165 --11316
NM_175736chr12146555 6118 5922 5650 5587 5493 5453 4982 2456 2366 1956 1884 1878 580 67174 5347 5126 4903 3014 2699 27795 5415 26006 5332
NM_175767chr511207 11177 1669 11898
NM_175854chr1331910 1881 656 ------
NM_175861chr12165281 5263 4831 4708 4432 4020 3997 3800 2233 1887 888 875 836 643 428 391 25199 976 25900 575 --
NM_175876chr162678 1982 1902 1124 420 242 1816 2295 223 --
NM_175895chr1221149 1010 1867 11072 --
NM_175907chr1832477 2423 2352 1805 --1474
NM_175921chr573917 3620 3215 3160 1615 1200 813 11683 ----
NM_176787chr1861578 984 552 239 104 40 --2623 558 --
NM_176814chr721061 389 185 ----
NM_176823chr1113740 3665 2701 2584 1335 1198 1078 975 683 596 568 11438 ----
NM_176824chr421064 533 31351 449 403 1833 --
NM_176871chr843112 2981 2196 1250 12166 ----
NM_177398chr121512 52 21962 276 ----
NM_177399chr121512 52 21962 276 ----
NM_177422chr12590 442 1141 ----
NM_177424chr142119 1338 297 247 1668 1489 --
NM_177538chr2138702 8402 7399 6202 5894 5793 5749 5709 3056 2147 1876 277 76 11792 13381 --
NM_177539chr13671 165 158 1204 ----
NM_177966chr331780 431 176 ------
NM_177968chr231471 664 92 ------
NM_177969chr22652 590 ------
NM_177985chr252016 1898 1428 1405 247 --1541 --
NM_177986chr182116 21 ------
NM_177990chr2041265 655 301 160 ------
NM_177996chr2093322 2912 2833 2633 2548 1043 770 201 80 ----12078
NM_178010chr1231583 1400 1243 2356 61 ----
NM_178013chr1452902 2162 1155 980 256 32554 559 460 12231 1783
NM_178026chr201160 1370 ----
NM_178123chr23950 330 209 ----2863 428
NM_178140chr552558 2409 1057 1002 990 12145 ----
NM_178151chrX127544 7483 6958 5884 5639 5602 5560 5263 5018 2943 2404 231 27844 2385 1949 --
NM_178152chrX127544 7483 6958 5884 5639 5602 5560 5263 5018 2943 2404 231 27844 2385 1949 --
NM_178153chrX127544 7483 6958 5884 5639 5602 5560 5263 5018 2943 2404 231 27844 2385 1949 --
NM_178154chr141700 ------
NM_178155chr141700 ------
NM_178156chr141700 ------
NM_178157chr141700 ------
NM_178313chr23543 341 42 ------
NM_178426chr132379 1687 782 --12222 1511
NM_178427chr132279 1587 682 --12122 1411
NM_178439chr22546 177 ----1185
NM_178441chr1441426 932 563 478 11203 1107 --
NM_178454chr12172 75 139 ----
NM_178496chr351228 386 299 184 72 ----1614
NM_178498chr1161503 815 600 571 366 184 12718 ----
NM_178505chr1073556 2920 2841 2831 2520 598 66 --12663 --
NM_178509chr17103585 3328 3201 3091 3076 1526 996 866 609 512 23746 2540 14045 --
NM_178539chr1271917 1555 1491 1432 513 393 385 125 ----
NM_178549chr12171 155 ------
NM_178554chr373488 3384 3266 3120 539 436 393 22935 2430 1516 --
NM_178565chr811302 --11364 1446
NM_178566chr941570 1558 1357 31 ------
NM_178578chr2031779 684 41 --22637 309 --
NM_178585chr473001 2678 2512 2144 2120 964 53 32011 343 291 ----
NM_178586chr1442434 2377 2187 724 42271 1858 551 308 31867 1557 221 --
NM_178812chr831181 470 268 ------
NM_178815chr1072371 2176 1936 741 317 253 35 1197 12770 --
NM_178831chr792604 2489 2428 2409 2210 1100 443 391 162 32441 2178 1870 12104 12367
NM_178839chr21234 ------
NM_178860chr171845 1753 ----
NM_181054chr1431308 1207 1128 1862 ----
NM_181077chr1542081 2030 1784 210 ------
NM_181291chr141783 ------
NM_181302chr143462 232 97 ------
NM_181308chr143462 232 97 ------
NM_181310chr631926 1880 1628 --1296 --
NM_181332chrX52598 2470 2055 2031 1821 32620 2503 885 ----
NM_181349chr742114 673 465 283 11900 22939 2930 --
NM_181351chr1112546 12959 ----
NM_181354chr841348 1266 553 469 --11115 1578
NM_181358chr184171 3892 3315 1381 769 661 275 81 --13556 --
NM_181361chr341391 1268 430 117 ------
NM_181442chr201918 --1729 --
NM_181443chr2052638 2496 2372 1120 1098 ------
NM_181457chr241282 1138 387 50 ----1494
NM_181458chr241415 1271 520 183 ------
NM_181459chr231181 1037 286 ----1393
NM_181460chr231228 1084 333 ----1440
NM_181481chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_181482chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_181483chr18126242 6115 6048 5023 4718 4694 4544 2024 1089 976 684 590 --15132 15958
NM_181504chr523314 21 14191 1941 --
NM_181505chr171530 ----172
NM_181521chr16126742 6472 5938 4646 2843 2200 1247 700 541 474 71 33 --46356 2855 2251 108 12785
NM_181523chr523314 21 14191 1941 --
NM_181524chr523314 21 14191 1941 --
NM_181552chr71774 ------
NM_181571chr104792 292 214 106 ------
NM_181659chr2093351 3344 2996 2566 2386 2328 751 593 508 13263 ----
NM_181659chr2093351 3344 2996 2566 2386 2328 751 593 508 13263 ----
NM_181671chr172706 379 ------
NM_181672chrX51506 1476 1268 698 440 12075 ----
NM_181673chrX51506 1476 1268 698 440 12075 ----
NM_181702chr82993 642 ------
NM_181705chr5105711 5318 4576 4171 2216 1238 986 929 901 815 21031 766 ----
NM_181714chr661695 1463 1362 1258 494 97 ----1349
NM_181723chr842323 1859 1796 1715 --1799 --
NM_181755chr12270 87 ------
NM_181762chrX1127 ------
NM_181777chrX1127 ------
NM_181787chr843636 3105 2447 180 21250 293 ----
NM_181794chr62931 781 ------
NM_181795chr62931 781 ------
NM_181836chr542481 2172 1780 452 1104 150 1943
NM_181838chr521039 109 ------
NM_181839chr81250 11258 --11040
NM_181876chr442253 2156 1895 876 12134 --21705 704
NM_181897chr342198 1878 939 751 1595 12567 --
NM_182485chr423253 1163 --13628 --
NM_182511chr1841283 1157 947 508 ------
NM_182522chr341265 1205 408 229 1374 --11039
NM_182524chr42703 214 ------
NM_182620chr1752317 2243 1433 669 143 1290 22292 2026 --
NM_182641chr1791872 1788 1627 1464 764 498 208 152 96 ------
NM_182646chr423253 1163 --13628 --
NM_182648chr14----1172 1128
NM_182666chr31164 ------
NM_182678chr2144 --1127 --
NM_182691chr7--1110 1440 --
NM_182692chr7--1110 1440 --
NM_182697chr711681 ------
NM_182701chr63743 372 74 ------
NM_182715chr731265 1166 1098 ----2316 189
NM_182717chr1031197 619 511 ------
NM_182718chr104792 292 214 106 ------
NM_182719chr104792 292 214 106 ------
NM_182720chr1031197 619 511 ------
NM_182721chr1031197 619 511 ------
NM_182722chr1031197 619 511 ------
NM_182723chr1031197 619 511 ------
NM_182724chr104792 292 214 106 ------
NM_182725chr104792 292 214 106 ------
NM_182756chr2--1232 ----
NM_182763chr142625 2521 1801 1781 ----1645
NM_182765chr1042239 721 412 269 --11528 --
NM_182767chr1231811 1709 1369 --41798 1753 1473 1344 --
NM_182769chr104792 292 214 106 ------
NM_182770chr104792 292 214 106 ------
NM_182771chr104792 292 214 106 ------
NM_182772chr104792 292 214 106 ------
NM_182789chr52702 381 --1308 --
NM_182830chr1421466 340 11934 ----
NM_182850chr104792 292 214 106 ------
NM_182853chr1031197 619 511 ------
NM_182854chr161330 ------
NM_182896chr341812 1546 1323 544 1532 ----
NM_182898chr796122 5708 5125 5090 5067 4110 1642 1565 1416 --34717 4202 1434 14741
NM_182899chr796122 5708 5125 5090 5067 4110 1642 1565 1416 --34717 4202 1434 14741
NM_182907chr642368 2240 826 360 ------
NM_182911chr22265 86 ------
NM_182920chr32328 210 --21418 1350 --
NM_182931chr71198 ------
NM_182943chr341093 1043 983 772 --11019 11156
NM_182948chr142899 2789 772 574 1918 1675 --
NM_182964chr11103158 2888 2843 2502 2370 2357 2058 1121 1095 968 11044 ----
NM_182972chr142378 901 248 232 ----1544
NM_182976chr12321 307 2802 673 ----
NM_182978chr186769 741 681 636 619 282 ------
NM_183011chr1031197 619 511 ------
NM_183012chr1031197 619 511 ------
NM_183013chr1031197 619 511 ------
NM_183043chr131319 ------
NM_183044chr131319 ------
NM_183060chr104792 292 214 106 ------
NM_183227chr641607 1570 1539 1145 ------
NM_183237chr331176 871 249 ----1240
NM_183323chr52702 381 --1308 --
NM_183397chr2064999 4722 4151 1565 1254 139 21394 1047 13879 11243
NM_183398chr541245 1031 372 48 ------
NM_183399chr541245 1031 372 48 ------
NM_183400chr541245 1031 372 48 ------
NM_183401chr541245 1031 372 48 ------
NM_183419chr811240 --11023 --
NM_183421chr81413 1832 ----
NM_184234chr203534 173 66 ------
NM_194071chr795355 5326 5034 4955 4940 4251 3654 1799 1040 24452 97 21155 446 23462 584
NM_194247chr264237 4126 3689 2884 1172 836 13092 1572 13988
NM_194259chr161131 ------
NM_194260chr161131 ------
NM_194261chr161131 ------
NM_194278chr1484145 3945 3252 2710 1595 1571 1485 1047 --33710 3391 694 13152
NM_194282chr462945 2776 2379 1047 531 485 ------
NM_194283chr563507 3057 2912 914 255 130 24021 1445 21436 699 12715
NM_194291chr882923 2879 2636 2562 1175 1064 1004 159 --1250 --
NM_194292chr141579 1361 1201 268 2304 82 ----
NM_194301chr1431174 293 247 ------
NM_194313chr941756 1504 1447 84 11291 11944 --
NM_194314chr195516 4625 4495 4454 3873 1887 1774 446 327 1115 1571 --
NM_194318chr1341714 1035 720 617 12527 1259 22502 775
NM_194328chr962991 2832 2660 1021 822 793 ------
NM_194329chr962991 2832 2660 1021 822 793 ------
NM_194330chr962991 2832 2660 1021 822 793 ------
NM_194332chr962991 2832 2660 1021 822 793 ------
NM_194356chr1262101 2060 589 121 104 93 --1152 --
NM_194434chr1895603 4992 3972 3552 3491 1841 1557 1329 1231 1551 14142 15691
NM_194439chr421529 1297 21238 546 11372 --
NM_194454chr761748 1491 1389 1356 1208 505 ----21564 494
NM_194455chr761748 1491 1389 1356 1208 505 ----21564 494
NM_194456chr761748 1491 1389 1356 1208 505 ----21564 494
NM_194463chrX31243 800 360 ------
NM_197941chr552977 2965 2933 931 91 ----12819
NM_197970chr2153 --11570 11454
NM_197977chr92225 102 1917 ----
NM_198047chr23519 486 444 ------
NM_198081chr622670 2286 11073 155 --
NM_198086chr1472047 1867 1770 1406 554 377 114 ----1293
NM_198120chr82407 145 ------
NM_198128chr182824 269 ------
NM_198148chr1021033 954 ------
NM_198158chr341953 692 559 181 --1775 --
NM_198159chr341953 692 559 181 --1775 --
NM_198177chr341953 692 559 181 --1775 --
NM_198178chr341953 692 559 181 --1775 --
NM_198181chr1562830 2795 2416 2402 1034 55 ------
NM_198182chr251398 1326 1193 1135 560 ------
NM_198186chr91210 --160 --
NM_198187chr91210 --160 --
NM_198189chr22839 759 131 ----
NM_198204chr1711203 11398 11535 1157
NM_198205chr1711203 11398 11535 1157
NM_198215chr1061427 1284 1166 923 513 69 --1231 --
NM_198225chr104689 442 150 127 --1492 --
NM_198240chr1221439 481 1144 11211 11165
NM_198243chr154752 368 79 38 ------
NM_198256chr232052 589 553 178 147 --
NM_198268chr184171 3892 3315 1381 769 661 275 81 --13556 --
NM_198269chr184171 3892 3315 1381 769 661 275 81 --13556 --
NM_198270chrX42803 910 577 360 1873 ----
NM_198320chr12104918 4547 4503 3381 2028 1219 1171 998 382 117 15238 ----
NM_198391chr201384 ----1622
NM_198392chr652274 1859 1713 1681 218 1771 ----
NM_198395chr541043 951 813 78 ------
NM_198400chr1552958 2850 911 760 319 ----12278
NM_198401chr841725 378 334 140 --11422 --
NM_198465chrX32256 2006 1928 22635 60 ----
NM_198467chr73559 429 26 ------
NM_198468chr6134402 3839 3190 3089 2815 1457 1426 1257 949 815 767 681 198 --13850 13430
NM_198485chr341694 853 711 374 --1385 --
NM_198503chr161514 859 835 589 410 101 --1745 --
NM_198507chr53552 172 32 --1160 --
NM_198513chr831551 800 629 11796 1747 --
NM_198521chr12--141 ----
NM_198566chr51183 ------
NM_198567chr52175 155 ------
NM_198568chr6--166 ----
NM_198569chr652612 1805 927 671 400 ----1488
NM_198581chr2167412 6856 6322 6043 5836 5570 5241 4944 4704 2639 2254 2244 2079 1984 588 51 --37056 2830 1456 26298 1071
NM_198595chr474747 4407 3985 3477 1465 1295 168 14531 --157
NM_198679chr972657 2578 1948 1844 524 454 411 12494 ----
NM_198715chr1105735 5352 4723 4412 3953 3875 2099 1559 1185 674 --15183 11939
NM_198793chr364080 3722 2702 2537 1304 1172 1597 1732 --
NM_198794chr1441105 579 331 243 2472 406 ----
NM_198844chr171392 ------
NM_198859chr364838 4775 4626 4348 3943 1560 34373 3366 714 1322 21939 1055
NM_198881chrX2404 78 ------
NM_198896chr1152020 1979 887 567 429 21433 663 1510 11697
NM_198900chr12146555 6118 5922 5650 5587 5493 5453 4982 2456 2366 1956 1884 1878 580 67174 5347 5126 4903 3014 2699 27795 5415 26006 5332
NM_198902chr151546 1558 ----
NM_198904chr52646 84 11605 --21584 326
NM_198935chr2052555 2370 1263 918 529 13188 22561 252 --
NM_198947chr112815 121 ------
NM_198968chr1393637 3081 2507 1319 1280 1232 1027 784 777 1473 --13806
NM_198990chr793127 2656 2404 1185 935 874 485 443 138 --12458 --
NM_198992chr121474 1525 1225 --
NM_198995chr181530 ------
NM_199000chr742174 884 769 363 ------
NM_199003chr811454 --1333 --
NM_199072chr742909 2780 2727 2643 185 ----
NM_199144chr2021138 145 11244 ----
NM_199169chr2033357 2806 2294 32469 2305 1267 12476 23177 2638
NM_199170chr2033357 2806 2294 32469 2305 1267 12476 23177 2638
NM_199171chr2033357 2806 2294 32469 2305 1267 12476 23177 2638
NM_199188chr1264058 3904 3767 3695 2883 358 13202 ----
NM_199189chr52679 631 ------
NM_199190chr1264058 3904 3767 3695 2883 358 13202 ----
NM_199203chr2021138 145 11244 ----
NM_199280chr2135 ------
NM_199320chr432519 2489 1977 ------
NM_199320chr432519 2489 1977 ------
NM_199321chr171392 ------
NM_199324chr473599 3563 2871 2850 2808 2426 1291 32741 2687 506 11347 --
NM_199344chr14237 221 174 109 --173 --
NM_199421chr14114557 4232 3667 1893 1659 1557 1313 487 391 370 282 25031 772 11319 11124
NM_199436chr273112 2794 2775 2763 2345 1005 851 160 ----
NM_199437chr1172476 2361 2336 2073 1669 544 459 1653 12387 --
NM_199438chr1172476 2361 2336 2073 1669 544 459 1653 12387 --
NM_199439chr1172476 2361 2336 2073 1669 544 459 1653 12387 --
NM_199462chr154991 4433 3664 3539 3278 24946 382 14845 --
NM_199464chr13----3241 106 41 --
NM_199478chrX51966 1339 1238 747 410 --1440 --
NM_199482chr221579 414 1301 --1735
NM_201263chr132000 1307 36 ------
NM_201266chr232632 930 526 --1424 1974
NM_201269chr11528 --1972 --
NM_201278chr1121606 527 ------
NM_201279chr232632 930 526 --1424 1974
NM_201281chr1121606 527 ------
NM_201413chr214770 338 291 193 ------
NM_201414chr214770 338 291 193 ------
NM_201428chr1151366 1348 1141 205 147 11374 1485 --
NM_201429chr1151366 1348 1141 205 147 11374 1485 --
NM_201430chr1151292 1274 1067 131 73 11300 1411 --
NM_201434chr172773 241 ------
NM_201439chr122446 421 174 ----
NM_201440chr122446 421 174 ----
NM_201515chr122446 421 174 ----
NM_201559chr6104836 4715 4597 4424 3924 3653 3217 1986 1115 236 11948 1627 1829
NM_201591chr431624 1414 618 ------
NM_201592chr431624 1414 618 ------
NM_201613chr121321 ------
NM_201999chr411055 --11126 --
NM_203282chr1931713 1559 502 ------
NM_203291chr18195 ------
NM_203292chr18188 ------
NM_203298chr102177 163 ------
NM_203301chr1461731 1625 598 319 137 85 ------
NM_203327chr2074568 4147 2845 1796 1569 670 266 44255 3586 3131 3081 ----
NM_203329chr11127004 6401 5018 2789 2757 2395 2248 1818 1766 1110 730 405 34832 907 508 1646 15603
NM_203330chr11127004 6401 5018 2789 2757 2395 2248 1818 1766 1110 730 405 34832 907 508 1646 15603
NM_203331chr11127004 6401 5018 2789 2757 2395 2248 1818 1766 1110 730 405 34832 907 508 1646 15603
NM_203339chr831088 981 262 1833 ----
NM_203349chr1551844 1514 871 665 144 --1770 1409
NM_203350chr131555 1363 685 1456 ----
NM_203354chr142820 660 1121 ----
NM_203355chr142820 660 1121 ----
NM_203356chr142820 660 1121 ----
NM_203364chr11----2214 80 --
NM_203372chr2--21402 1144 11078 --
NM_203390chr821862 492 1293 131 --
NM_203391chrX41509 1416 606 336 2500 322 ----
NM_203403chr941168 1066 1049 413 --150 --
NM_203406chr582900 2830 2597 1053 1021 925 814 540 ------
NM_203413chr173834 773 26 ------
NM_203446chr2163000 2791 2387 1192 757 304 1459 --1924
NM_203454chr131113 1037 297 11076 ----
NM_203458chr163087 2895 2626 1205 1065 267 1793 33807 2784 2372 33694 3336 601
NM_203459chr151996 645 595 432 387 1179 ----
NM_203463chr273688 3366 1681 1550 844 183 153 ------
NM_203487chr1331493 1214 627 11121 11751 --
NM_203504chr472582 2431 1689 1027 545 320 244 --12348 12438
NM_203505chr472582 2431 1689 1027 545 320 244 --12348 12438
NM_205768chr111774 ------
NM_205836chr51658 ------
NM_206594chr15427 379 306 204 29 ------
NM_206595chr15427 379 306 204 29 ------
NM_206839chr152497 459 1641 ----
NM_206852chr141282 ------
NM_206853chr683699 3441 2963 1628 1463 1445 1436 1038 1798 ----
NM_206854chr654960 4702 4224 1232 539 12059 ----
NM_206855chr685925 5667 5189 4101 3854 2197 1504 699 ------
NM_206857chr141282 ------
NM_206860chr101450 ------
NM_206861chr101450 ------
NM_206862chr101450 ------
NM_206866chr2153295 3102 3003 1129 467 12918 ----
NM_206876chr252968 2567 2540 1175 989 1254 ----
NM_206907chr563193 3018 2685 1100 947 598 --1452 --
NM_206909chr8157675 7423 7340 7247 6392 6222 5359 3319 3187 2392 1360 1181 1148 1029 961 --1878 1324
NM_206914chr1262171 1873 1830 1604 893 86 21983 1866 ----
NM_206927chr11------188
NM_206928chr11------188
NM_206929chr11------188
NM_206930chr11------188
NM_206937chr133373 201 97 ------
NM_206944chr93563 100 52 --1672 --
NM_206945chr93563 100 52 --1672 --
NM_206946chr93563 100 52 --1672 --
NM_206947chr93563 100 52 --1672 --
NM_207009chr1041028 707 404 107 ------
NM_207012chr1093479 3368 2956 2545 1389 1210 359 213 93 2878 593 ----
NM_207015chr33866 467 319 --1360 --
NM_207043chr132041 1610 87 52211 2107 1898 1499 497 ----
NM_207044chr132041 1610 87 52211 2107 1898 1499 497 ----
NM_207047chr132041 1610 87 52211 2107 1898 1499 497 ----
NM_207299chr92893 41 ------
NM_207303chr1072923 2897 2635 2549 1103 223 27 12783 ----
NM_207317chr52410 160 ------
NM_207325chr1961744 1661 1519 476 202 166 ------
NM_207337chr1221000 208 ----1739
NM_207344chr1241062 427 142 119 11080 1242 --
NM_207352chr432722 782 57 ------
NM_207372chr1042399 843 662 41 12476 --1836
NM_207391chr1921236 912 ------
NM_207396chr12499 195 --11354 --
NM_207406chr4146229 5099 5060 4954 4611 4127 1960 1883 1445 1161 1031 416 61 35 55242 5230 5004 303 118 15523 14111
NM_207429chr1132493 875 118 11846 11931 --
NM_207445chr1571822 1750 1678 1612 1595 637 538 11335 ----
NM_207481chr221426 1401 1506 21167 1052 --
NM_207491chr441368 1313 1036 190 ------
NM_207506chr821356 911 ----2989 241
NM_207517chr1551537 1412 789 591 502 32032 1986 307 ----
NM_207520chr21239 ------
NM_207521chr21239 ------
NM_207578chr12566 492 ------
NM_207647chr952612 1708 997 687 299 22452 2273 --12541