TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1193
miRNA Sequence: GGGAUGGUAGACCGGUGACGUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr522002 272 1440 --12067
NM_000081chr1----1747 1113
NM_000084chrX76731 5719 4530 4348 1462 1398 1247 26172 5975 21767 352 --
NM_000092chr254325 4036 3708 3358 1182 12792 --13751
NM_000112chr5105025 4255 4234 4227 3854 3460 1206 801 559 508 21810 1724 ----
NM_000127chr8------1110
NM_000176chr563253 2793 2534 1173 662 65 ------
NM_000189chr262295 2078 1937 1580 591 70 --1234 --
NM_000217chr1285126 5110 4528 3522 1917 1772 1333 653 11864 --24238 4029
NM_000222chr421649 819 --1176 1382
NM_000267chr1753295 2817 2670 395 125 22753 746 ----
NM_000314chr1033206 2055 918 --42746 2670 2447 564 --
NM_000330chrX51922 850 753 722 462 22244 2143 ----
NM_000337chr5106242 5484 4836 4582 2270 2169 1320 1289 321 276 14306 11376 1342
NM_000362chr2242784 2306 1199 463 12814 2384 172 1923
NM_000393chr22791 37 155 11477 --
NM_000408chr253473 2693 2501 1200 523 1196 1998 --
NM_000428chr1462160 2132 570 558 506 378 2833 300 22176 382 --
NM_000430chr1713473 --23195 2894 1520
NM_000449chr14938 484 247 111 ------
NM_000451chrX31764 1718 466 12137 --1169
NM_000489chrX72557 1382 1104 1034 981 856 166 11211 --32991 2574 2364
NM_000544chr6_cox_hap162978 2415 1137 1012 990 597 12800 13131 --
NM_000555chrX77475 6163 5600 3016 2744 2409 1987 21979 837 27121 229 --
NM_000595chr64109 75 67 56 --1200 --
NM_000598chr721491 454 11010 11525 --
NM_000609chr1062821 2003 1260 1247 607 150 2658 508 ----
NM_000612chr1183687 3620 3446 3341 846 662 624 83 --23570 39 --
NM_000617chr1232283 1642 34 2919 508 11611 --
NM_000618chr1246384 5658 5170 590 54683 2081 1510 1443 376 --11026
NM_000618chr1246384 5658 5170 590 54683 2081 1510 1443 376 --11026
NM_000633chr1855167 3800 3460 3259 1734 --1400 1774
NM_000719chr12106353 5990 4846 4142 2352 2319 2103 965 558 374 --16427 12603
NM_000793chr1464931 3785 3751 1723 1082 635 11252 ----
NM_000806chr52557 77 21932 1801 ----
NM_000809chr478678 8547 7737 7687 6890 3204 1140 --26257 243 --
NM_000813chr565157 3643 2050 1280 152 131 ------
NM_000814chr1553616 3555 3440 691 346 11685 21185 392 1942
NM_000827chr532074 165 54 11702 11822 --
NM_000828chrX41341 794 330 209 1440 ----
NM_000829chr1152069 1765 839 681 127 32123 1953 1773 1641 --
NM_000831chr1125638 5516 5494 4866 4240 4193 1303 991 968 521 490 191 26082 5061 ----
NM_000875chr15105853 5337 5208 4838 2395 1857 1559 1477 569 546 52719 708 555 431 87 ----
NM_000899chr1274115 3930 3346 1437 1094 331 210 ----13707
NM_000926chr11129405 9285 9244 8746 7860 3630 2589 2013 989 603 330 267 48659 7642 3761 2133 ----
NM_000944chr462217 1988 1980 1767 1551 154 --12164 --
NM_000961chr2053790 3770 3126 2686 918 --24034 2887 --
NM_001001323chr1252354 2114 1233 542 247 ----13130
NM_001001331chr342308 2040 1857 1020 171 12737 12680
NM_001001396chr1113814 3714 3438 2729 1787 1433 1354 1300 1088 338 307 3511 344 48 12969 --
NM_001001481chr842736 1195 1082 905 1401 ----
NM_001001556chr151185 ----11334
NM_001001685chr1742897 801 793 786 11092 1909 --
NM_001001701chr432260 2167 190 ----11599
NM_001002909chr1761988 1713 643 482 419 180 1587 1506 --
NM_001002926chr72698 206 ----1968
NM_001003652chr18128611 6838 6216 5816 5717 5404 5350 2412 2375 1216 789 745 17724 --192
NM_001003674chr1896092 5867 5603 4692 2642 2022 974 588 196 35820 5810 2669 14775 --
NM_001003675chr1896092 5867 5603 4692 2642 2022 974 588 196 35820 5810 2669 14775 --
NM_001003681chr2241547 630 403 41 --11347 --
NM_001003712chr1242931 2532 1581 180 13815 --12537
NM_001003945chr9------11922
NM_001004304chr1253204 3068 2223 1229 1147 12909 12246 --
NM_001004419chr1284360 4245 3403 1468 1195 634 505 455 ----14396
NM_001005404chr1764283 2841 1025 744 143 115 41721 1343 97 45 --1811
NM_001005473chr576366 5199 4899 2457 2044 1356 63 45849 5405 4972 505 ----
NM_001007023chr1464931 3785 3751 1723 1082 635 11252 ----
NM_001007094chr1063819 3551 3399 3089 1048 968 ----24082 3021
NM_001007097chr964984 4896 3375 3105 1327 574 14187 ----
NM_001007156chr1551691 352 323 256 209 21853 175 1641 --
NM_001007466chr655014 3944 3824 1662 1139 11901 ----
NM_001007595chr152280 218 ----1131
NM_001008220chr573550 2761 894 867 805 556 173 31369 1002 874 23760 3346 --
NM_001008239chr1852864 1440 429 403 50 ------
NM_001008408chr756194 5595 5565 2554 2375 25532 662 15538 --
NM_001008495chr81889 ----12115
NM_001008541chr104762 712 619 316 --21733 1678 --
NM_001008541chr104762 712 619 316 --21733 1678 --
NM_001008738chr542362 2169 781 105 ------
NM_001008756chr392211 2028 1994 1950 1913 1018 659 209 190 --1229 --
NM_001009554chr474733 4029 3162 2959 1520 1113 105 23293 1215 21728 884 --
NM_001009554chr474733 4029 3162 2959 1520 1113 105 23293 1215 21728 884 --
NM_001009555chr441442 412 61 49 --1677 11198
NM_001009899chr355401 5012 4438 1255 293 --36433 5390 2174 --
NM_001009959chr222137 1826 --12571 22600 587
NM_001010853chr653226 3030 931 286 235 --12795 --
NM_001010861chr122700 499 --140 154
NM_001010862chrX52870 2680 2596 2549 174 --21256 89 --
NM_001010888chrX21812 474 ----13933
NM_001010895chr92624 470 11629 1801 11516
NM_001010922chr163620 3438 3414 1208 634 587 14064 1824 --
NM_001010986chrX62472 2131 1775 412 141 40 ------
NM_001011513chr453849 3733 3482 2772 635 --11222 --
NM_001011666chr741733 1432 1112 762 25384 4544 11564 12456
NM_001012393chr1174918 2008 1038 981 972 593 302 41838 1162 836 489 34652 633 547 21533 865
NM_001012751chr1041856 1773 1482 322 1673 11666 --
NM_001012755chrX104838 4751 4603 4512 4381 4038 3301 3182 1984 98 1897 ----
NM_001012968chrX4636 402 315 259 ----1785
NM_001013031chr1042719 2705 2533 2423 1776 ----
NM_001013398chr721491 454 11010 11525 --
NM_001013620chr1298004 7269 6404 6182 5766 5226 1582 886 49 21793 1366 --26519 1705
NM_001014797chr10167708 7452 6946 6001 5951 5621 3087 3077 3012 3006 2938 2911 2324 1733 1532 1399 26611 2815 ----
NM_001017440chr7148243 6526 6369 6185 6009 2460 2099 2062 984 897 697 493 394 277 26611 333 27955 1323 --
NM_001017995chr564803 4241 4227 3732 1628 508 1836 11163 --
NM_001018065chr985266 4833 2128 1944 1519 1067 529 239 15577 --15767
NM_001018066chr985266 4833 2128 1944 1519 1067 529 239 15577 --15767
NM_001018067chr123671 1014 11949 --1121
NM_001018068chr123671 1014 11949 --1121
NM_001018069chr123671 1014 11949 --1121
NM_001018074chr563253 2793 2534 1173 662 65 ------
NM_001018075chr563253 2793 2534 1173 662 65 ------
NM_001018076chr563253 2793 2534 1173 662 65 ------
NM_001018077chr563253 2793 2534 1173 662 65 ------
NM_001024094chr563253 2793 2534 1173 662 65 ------
NM_001024372chr831605 1548 40 1600 12251 --
NM_001024455chrX32067 1063 1030 11852 1153 --
NM_001024912chr1931437 1305 88 21833 1360 11316 --
NM_001025076chr1075660 5403 5195 3938 2448 1541 1245 14295 ----
NM_001025077chr1087018 6761 6553 5296 4693 2899 2603 1197 15653 ----
NM_001025079chr373340 3100 2987 2941 1175 1028 620 --23685 2597 --
NM_001025108chr233311 650 365 --12642 --
NM_001025233chr1221069 322 1546 --11114
NM_001025266chr384542 4051 3816 3480 1554 1489 422 392 21406 1239 --11499
NM_001025580chrX43408 2876 155 97 ----11137
NM_001025603chr14938 484 247 111 ------
NM_001029858chr632448 866 58 22172 1155 11295 --
NM_001029863chr643071 3041 2808 38 11120 ----
NM_001030007chr1632910 2753 781 13028 1462 --
NM_001030055chr1434649 3220 1158 14565 ----
NM_001031684chr21425 ----1105
NM_001031690chr742113 878 838 471 --22861 2449 --
NM_001031695chr2255090 3821 1466 1272 639 23973 1249 24961 3376 --
NM_001031804chr1654357 4257 3453 3033 590 14107 ----
NM_001032288chr2041599 1465 1136 557 1130 2561 214 --
NM_001032394chr622529 584 --21807 23 12542
NM_001033044chr131350 315 45 --11835 1739
NM_001033047chr45961 302 248 227 41 2762 526 1295 --
NM_001033056chr131350 315 45 --11835 1739
NM_001035chr1--21122 983 2378 254 1841
NM_001037132chr71896 ----1783
NM_001037133chr71896 ----1783
NM_001037317chr122700 499 --140 154
NM_001037332chr542562 739 570 304 12007 1312 --
NM_001037333chr542562 739 570 304 12007 1312 --
NM_001037334chr1852299 2068 508 423 293 --1408 --
NM_001038707chr182261 1866 1437 916 726 697 42 27 11888 ----
NM_001038707chr182261 1866 1437 916 726 697 42 27 11888 ----
NM_001039618chr1175477 5465 4311 3639 1687 857 301 14298 ----
NM_001039690chr1672044 1951 1705 1579 908 831 206 12210 ----
NM_001039840chrX1273 35859 5049 4441 1936 --
NM_001039937chr1333130 2522 34 --13331 11215
NM_001040144chr1672044 1951 1705 1579 908 831 206 12210 ----
NM_001040146chr1672044 1951 1705 1579 908 831 206 12210 ----
NM_001040151chr1174491 4345 3634 3447 3357 2993 2961 33808 2955 146 --24196 4098
NM_001040152chr784771 3424 3163 1949 1732 1133 469 338 14369 --21490 838
NM_001040214chr632082 1594 247 1388 11484 --
NM_001040272chr921548 420 31953 1827 466 ----
NM_001040284chr1695656 5187 4634 4147 3979 3600 1674 1296 489 13681 ----
NM_001040441chr155388 1179 1017 759 164 12113 24539 3380 --
NM_001040446chr542500 829 508 414 1573 ----
NM_001040458chr52730 470 --1133 11565
NM_001040712chr953340 3312 3074 2800 804 13318 22751 309 22724 2451
NM_001042413chr963897 3858 2722 1423 1182 607 ------
NM_001042481chr1442582 1992 975 638 ------
NM_001042492chr1753295 2817 2670 395 125 22753 746 ----
NM_001042494chr1533751 677 172 --21443 1022 --
NM_001042495chr1533751 677 172 --21443 1022 --
NM_001042496chr1533751 677 172 --21443 1022 --
NM_001042497chr1533751 677 172 --21443 1022 --
NM_001042510chr832128 2107 222 --11864 11695
NM_001042511chr832128 2107 222 --11864 11695
NM_001042543chr441565 1156 1008 114 ------
NM_001042599chr297608 7117 6828 6128 5691 2312 1615 866 295 36061 2532 1936 27791 2024 --
NM_001042603chr1275208 4741 3932 1375 1334 853 665 ------
NM_001042604chr354056 3986 3733 1866 393 143 ----
NM_001042681chr132218 1621 1061 22287 1674 --12133
NM_001042682chr132218 1621 1061 22287 1674 --12133
NM_001042682chr132218 1621 1061 22287 1674 --12133
NM_001044305chr6--124 --11153
NM_001046chr531131 742 476 22324 360 1970 --
NM_001071775chr1341946 1514 1373 183 ------
NM_001079874chr131610 1413 622 1389 ----
NM_001099678chr345558 4418 1516 868 24504 159 11059 14087
NM_001100108chr197848 6779 6656 5103 2219 2012 1779 1568 296 12650 15495 --
NM_001106chr3128843 7389 7138 3653 3481 3132 2871 2552 2454 1617 931 383 28110 3403 --17745
NM_001113490chrX53592 3012 2382 1085 792 23386 2239 21195 444 --
NM_001128chr1632910 2753 781 13028 1462 --
NM_001167chrX76458 4956 4495 1360 1196 601 321 ------
NM_001173chr1434649 3220 1158 14565 ----
NM_001196chr2221284 507 1895 --1242
NM_001198chr622366 473 1866 --22235 1799
NM_001204chr287453 6344 5518 5101 2235 1896 1056 605 --37175 5281 4906 --
NM_001257chr1621210 437 167 1410 --
NM_001259chr764390 4330 1903 1511 1155 1115 --11646 --
NM_001331chr1162717 951 666 645 212 22 11835 ----
NM_001332chr521494 413 ----11169
NM_001343chr521180 492 ----128
NM_001346chr342380 2247 1954 618 --32610 2125 1909 --
NM_001356chrX4668 629 459 256 1469 ----
NM_001364chr1184604 4280 3728 3334 3151 1767 1172 517 13764 13200 --
NM_001387chr592855 2743 2613 2566 2521 2286 2141 1218 668 --12175 --
NM_001390chr1853428 3178 2806 720 330 ------
NM_001391chr182357 163 ----1174
NM_001396chr2142224 872 424 203 --1563 --
NM_001408chr171603 1343 1280 1213 471 416 131 1183 1207 --
NM_001419chr1974608 4534 3610 3569 1806 1736 1186 1570 23066 1683 --
NM_001438chr183021 2506 2276 511 377 304 201 27 1805 ----
NM_001440chr84900 578 564 556 22738 372 12546 --
NM_001453chr621467 649 ----1708
NM_001455chr654735 4713 4595 3922 334 1676 33028 517 465 --
NM_001460chr142969 2901 2661 48 1612 12696 12711
NM_001482chr152776 112 ----1305
NM_001490chr973725 3615 3422 2703 1301 682 396 12353 22316 1002 13736
NM_001527chr664655 3343 3001 1805 1397 306 ------
NM_001560chrX52422 2293 1656 107 54 11667 ----
NM_001616chr263516 3510 2862 1177 852 737 ------
NM_001655chr1171791 1590 1516 1404 1382 862 805 11596 ----
NM_001659chr1242673 1060 1010 728 22448 1776 1897 --
NM_001678chr1791631 1465 1272 1261 1198 571 516 454 23 1298 21354 474 --
NM_001682chr1242068 1828 947 256 ----12844
NM_001683chr342308 2040 1857 1020 171 12737 12680
NM_001684chr1103531 3431 3155 1504 1150 1071 1017 805 55 24 2228 61 12686 --
NM_001701chr9------21259 1087
NM_001720chr132007 862 227 41407 747 671 324 11982 1418
NM_001731chr12124 ----1790
NM_001755chr1642265 2204 325 78 --12014 --
NM_001759chr1284867 4655 3830 3507 3208 2088 1250 525 24459 1717 21219 957 --
NM_001777chr373340 3100 2987 2941 1175 1028 620 --23685 2597 --
NM_001858chr661230 972 535 428 80 66 --24218 4202 1526
NM_001859chr963673 3040 2880 788 339 276 13013 183 11068
NM_001895chr2031096 375 367 11033 21012 390 --
NM_001918chr1129125 7745 7051 6865 6380 5607 3125 1724 1591 1142 817 570 12857 12036 --
NM_001949chr672486 2072 1134 1009 859 736 728 ------
NM_001968chr42296 116 2912 322 1212 --
NM_001981chr131549 857 592 12283 ----
NM_001987chr1274327 2732 1136 1125 826 807 266 11488 13626 --
NM_002006chr475429 4842 4184 3830 1727 889 151 1641 ----
NM_002024chrX62002 1896 1597 833 303 36 ------
NM_002025chrX98715 8209 7354 6553 6304 3287 2823 2524 2188 --46499 3653 408 252 36473 1508 1360
NM_002044chr151185 ----11334
NM_002061chr141500 1335 1226 179 2757 730 ----
NM_002065chr131350 315 45 --11835 1739
NM_002076chr1243052 527 492 454 2716 339 --1508
NM_002182chr342793 305 283 194 --12172 --
NM_002214chr744481 2116 2015 823 --13882 --
NM_002241chr173136 3074 2092 2057 720 106 24 22036 408 ----
NM_002264chr374482 4175 3698 3685 1883 1457 583 24693 1940 34814 4460 1156 1609
NM_002271chr1322439 118 1869 1832 --
NM_002285chr233311 650 365 --12642 --
NM_002293chr142089 1708 1107 608 2566 222 ----
NM_002310chr544224 1790 1489 31 22201 511 25742 2109 --
NM_002336chr1284472 4064 3361 3328 1017 860 598 408 ------
NM_002500chr231135 889 21 11296 ----
NM_002515chr1461508 1479 1438 1360 657 611 --11310 --
NM_002545chr1174918 2008 1038 981 972 593 302 41838 1162 836 489 34652 633 547 21533 865
NM_002556chr1171922 1778 1721 1480 840 678 507 --21999 1707 --
NM_002581chr972186 2076 1977 1350 860 328 212 11169 1456 --
NM_002588chr531157 319 280 31429 342 225 1588 --
NM_002641chrX31635 798 364 ----1645
NM_002645chr1152947 2442 2058 1952 964 ------
NM_002655chr851229 741 592 176 60 ------
NM_002657chr20113236 2999 1508 1036 974 847 716 692 678 606 526 12497 ----
NM_002698chr1961120 322 211 205 196 164 1948 ----
NM_002709chr22338 27 ----182
NM_002718chr332196 231 118 21653 980 12241 12595
NM_002719chr1431824 1729 1717 ------
NM_002737chr17116551 6541 6176 5825 5160 4448 2337 2325 833 504 336 46535 5751 5313 823 14382 14094
NM_002745chr2224176 4168 54381 3433 3084 1489 1225 ----
NM_002776chr1981778 1651 1360 1320 606 191 185 77 41990 1711 1332 1247 ----
NM_002827chr2051827 1695 1176 182 153 ------
NM_002835chr73726 607 79 ----1142
NM_002839chr953340 3312 3074 2800 804 13318 22751 309 22724 2451
NM_002857chr172386 809 727 716 236 123 64 1129 1524 --
NM_002886chr384848 4413 4073 3822 3398 1666 1232 197 11789 21824 1703 --
NM_002906chr1152329 2203 743 537 476 ------
NM_002959chr143954 3126 1472 506 23429 3245 33656 3486 420 13312
NM_002998chr81108 11762 --1577
NM_003042chr361718 1512 801 709 122 88 21886 1394 ----
NM_003059chr5------1324
NM_003100chr5------184
NM_003108chr2117039 6539 5399 5363 4809 4413 2904 2075 1886 1824 600 16473 11458 --
NM_003137chr65686 623 585 480 346 11654 ----
NM_003165chr951883 1322 1277 1180 135 1623 11895 --
NM_003174chr10------1211
NM_003199chr1875206 4519 1841 1414 1273 1112 584 ------
NM_003202chr541862 1225 587 578 1612 2486 46 --
NM_003221chr683728 3466 2683 1661 1569 976 792 476 --33840 3240 239 --
NM_003291chr13--1101 --1108
NM_003320chr1133334 1306 80 12960 21380 949 23042 1616
NM_003348chr1251315 1240 617 274 211 ------
NM_003349chr2041599 1465 1136 557 1130 2561 214 --
NM_003392chr364275 4119 3394 655 369 125 2964 922 --1145
NM_003406chr831697 1627 53 162 11515 --
NM_003421chr1063819 3551 3399 3089 1048 968 ----24082 3021
NM_003458chr393546 2998 2971 2728 2703 2671 1167 785 773 11263 1763 --
NM_003463chr672627 2559 2415 2168 2149 1281 552 ------
NM_003471chr342107 2070 1965 197 ------
NM_003489chr2123051 1055 1314 3964 892 866 13276
NM_003507chr221821 1455 --11672 11362
NM_003559chr1783509 2740 2520 1573 1167 722 647 421 13480 ----
NM_003574chr18104861 4829 4406 4213 917 903 548 217 103 73 11619 ----
NM_003583chr1263151 3000 2904 2609 1060 916 ------
NM_003590chr262839 2676 1570 1378 215 127 13344 192 --
NM_003615chr31692 12985 23948 2636 13532
NM_003625chr12------178
NM_003663chr363261 3232 2736 2145 754 562 --11160 --
NM_003679chr193256 2759 2419 2267 2254 1199 605 586 556 ------
NM_003722chr331874 439 27 11030 ----
NM_003735chr531157 319 280 31429 342 225 1588 --
NM_003736chr531157 319 280 31429 342 225 1588 --
NM_003758chr1511421 ----1347
NM_003758chr1511421 ----1347
NM_003762chr121166 958 --1432 1916
NM_003825chr151261 ----1996
NM_003838chr141520 1347 1328 317 --11601 --
NM_003848chr34852 820 631 391 ------
NM_003850chr13--1116 --1166
NM_003872chr262661 2461 1214 794 524 482 1511 --12930
NM_003901chr1031843 1836 263 12026 11001 --
NM_003953chr152829 2786 494 314 180 --12035 --
NM_003958chr6103875 3645 3021 2952 2667 1324 1049 1001 443 183 13857 --13122
NM_003966chr5107857 7658 6744 6211 5025 4771 1965 1358 249 207 25457 1247 17713 22986 1391
NM_003983chr1654257 3948 2953 1514 447 --11612 13476
NM_003994chr1274115 3930 3346 1437 1094 331 210 ----13707
NM_004024chr15607 526 483 125 118 ------
NM_004087chr341647 714 677 480 11417 ----
NM_004096chr1031759 699 180 --21601 1500 1429
NM_004114chrX------1164
NM_004124chr1441243 960 308 165 22259 1373 12252 --
NM_004171chr11109124 7404 7246 6529 6332 3359 3215 2526 967 207 18494 26259 1445 --
NM_004172chr581973 1958 1926 1785 584 190 65 48 ----1724
NM_004200chr1193105 2838 2791 2649 2590 1108 768 459 180 11134 22898 2539 --
NM_004229chrX21421 1414 ----1171
NM_004232chr1843751 2482 880 80 1313 13034 --
NM_004274chr1463144 3085 3029 766 77 32 ------
NM_004319chr192791 2417 2233 2163 1197 1036 745 182 58 21130 281 13123 --
NM_004327chr2281897 1815 1796 967 559 431 121 64 ----11916
NM_004338chr1896092 5867 5603 4692 2642 2022 974 588 196 35820 5810 2669 14775 --
NM_004397chr1161667 789 711 664 489 414 13860 --1479
NM_004430chr862695 1876 1077 982 858 700 22313 346 ----
NM_004438chr242366 2338 737 375 149 ----
NM_004458chrX42184 1860 1719 477 12049 ----
NM_004459chr1752058 1656 490 203 95 ------
NM_004469chrX2527 24 1143 1484 --
NM_004481chr162370 2361 658 515 41 25 --22621 2167 --
NM_004504chr252569 2436 2140 2111 439 ------
NM_004580chr1531898 1680 459 --21873 118 --
NM_004586chrX84908 4349 4066 3633 3382 3374 1723 917 1442 --14861
NM_004598chr563067 2995 2115 2106 2093 988 ------
NM_004602chr2051515 1471 1423 546 23 11276 ----
NM_004654chrY41348 1204 1048 436 ------
NM_004663chr151375 ----1162
NM_004703chr1732520 1860 536 ----1788
NM_004711chr2263503 3113 3008 2399 2322 36 23593 3049 1681 --
NM_004726chrX55318 5109 3629 1364 615 1936 ----
NM_004742chr341202 510 461 124 --1495 --
NM_004772chr5190 ----11200
NM_004798chr2043613 2821 860 552 13013 33259 815 740 --
NM_004815chr174618 4364 3281 1907 1883 1341 493 1971 1883 --
NM_004834chr252949 1196 1024 252 183 ------
NM_004841chr111128 21087 960 1849 --
NM_004859chr1752927 2699 2236 2198 1931 1715 1709 --
NM_004898chr452778 2643 2552 2310 684 ----12154
NM_004904chr741733 1432 1112 762 25384 4544 11564 12456
NM_004947chr362478 2381 961 833 726 711 1557 11859 --
NM_004956chr763217 1427 1369 1222 1161 762 11646 ----
NM_004961chrX41534 1035 209 124 31519 1232 186 ----
NM_004976chr1175104 4817 4093 3290 1389 1118 1017 24100 3349 44593 4468 4419 3957 --
NM_004985chr1264096 3756 3583 1781 756 507 11070 21721 353 11578
NM_004992chrX158450 8013 7891 7749 6263 6179 6003 5385 5185 1984 1299 1279 1253 745 407 --17487 --
NM_004992chrX158450 8013 7891 7749 6263 6179 6003 5385 5185 1984 1299 1279 1253 745 407 --17487 --
NM_004999chr654243 4106 4080 1604 272 --179 --
NM_005010chr71896 ----1783
NM_005016chr12159 ----1137
NM_005023chr511066 ----1985
NM_005056chr1275452 4985 4176 1619 1578 1097 909 ------
NM_005065chr1445145 4836 3706 1189 11986 1365 14767
NM_005095chr111666 --12170 11767
NM_005121chr1742434 1324 981 700 23187 2404 12933 --
NM_005135chr1533751 677 172 --21443 1022 --
NM_005151chr1852299 2068 508 423 293 --1408 --
NM_005188chr1186840 5047 3107 2614 2025 1949 1766 636 45563 2388 2149 496 27515 3124 15641
NM_005197chr1495584 5466 5158 2374 2050 452 408 298 37 23871 2242 ----
NM_005206chr1731293 523 284 2196 80 ----
NM_005233chr352293 2128 993 473 308 --160 1793
NM_005235chr297608 7117 6828 6128 5691 2312 1615 866 295 36061 2532 1936 27791 2024 --
NM_005238chr1122874 2592 --23034 2683 22444 320
NM_005259chr22522 417 --1430 1182
NM_005277chr441490 1403 444 27 2219 60 --168
NM_005313chr154998 841 372 59 --21343 906 --
NM_005339chr484179 3457 3422 3398 1554 1266 494 131 1373 ----
NM_005359chr1822421 1173 22321 549 11747 24325 4059
NM_005398chr1051443 1357 1291 1127 518 ------
NM_005400chr262184 2136 1880 970 441 269 13002 ----
NM_005431chr722136 1980 --11531 11693
NM_005433chr1842045 1997 1973 440 ------
NM_005436chr1063748 3709 2621 2552 933 241 21126 40 11417 1132
NM_005455chr141650 354 335 59 --169 --
NM_005479chr1021558 1471 --1508 11413
NM_005487chr2241547 630 403 41 --11347 --
NM_005504chr12116496 5720 5712 5611 5205 2518 2358 2157 1233 609 179 --26346 4344 --
NM_005575chr5--2159 35 --1234
NM_005578chr3114836 4048 3973 1839 1189 935 608 454 412 256 77 1262 13869 14522
NM_005607chr8----2781 130 1942
NM_005611chr1621048 186 ----1213
NM_005638chrX11126 11410 --1208
NM_005665chr154782 4216 3876 3462 202 --1317 --
NM_005668chr553050 3030 1163 1060 760 --1396 --
NM_005717chr13910 233 220 ------
NM_005737chr232249 2209 2045 --12891 --
NM_005744chr151188 ----143
NM_005748chr1222161 1264 --23373 2317 --
NM_005759chr2134544 4072 3389 2981 1687 1336 1277 1173 946 931 502 238 193 ----14657
NM_005819chr153322 2796 1116 164 99 1422 ----
NM_005840chrX107714 7620 6451 6299 6204 5492 1942 1466 1384 193 11391 ----
NM_005868chr721943 1534 12196 --12533
NM_005880chr1631380 1252 1238 11502 1598 --
NM_005898chr1142559 2270 820 130 ------
NM_005901chr18128611 6838 6216 5816 5717 5404 5350 2412 2375 1216 789 745 17724 --192
NM_005902chr1553719 3267 3203 3005 1521 14325 --14042
NM_005920chr153600 2776 2738 245 221 --13221 --
NM_005924chr731125 785 25 ------
NM_005933chr1152231 2150 1055 706 361 149 21924 512 --
NM_005935chr484955 4770 4575 2114 2018 1543 518 405 ------
NM_005962chr104762 712 619 316 --21733 1678 --
NM_005962chr104762 712 619 316 --21733 1678 --
NM_006011chr15124024 4018 3922 3575 3543 3523 2901 2854 2711 1733 1023 274 33799 2741 481 11588 --
NM_006016chr631831 584 67 --1151 --
NM_006036chr22484 380 21018 135 ----
NM_006037chr264323 3556 3434 1604 1026 654 ----14672
NM_006047chr2032643 252 240 1970 ----
NM_006052chr2142011 1936 250 38 --1746 --
NM_006054chr1191377 1371 1303 1101 601 544 203 145 42 1376 ----
NM_006080chr732475 2310 2139 2559 331 12785 1566
NM_006095chr454535 4133 2845 842 367 13390 24283 192 --
NM_006113chr131610 1413 622 1389 ----
NM_006134chr2121077 288 1438 11544 --
NM_006135chr151437 513 487 389 294 ----11421
NM_006154chr1562494 2361 2210 2051 1813 770 ------
NM_006203chr555549 5347 3696 1355 190 14025 25326 4081 --
NM_006237chr1332059 577 152 1719 11671 --
NM_006241chr342153 952 783 229 ------
NM_006290chr631820 413 68 ----1599
NM_006306chrX95862 4817 4373 2118 2035 1719 1432 1383 240 14504 ----
NM_006315chr434487 1573 561 11713 --11438
NM_006386chr2242449 1694 662 137 1832 1811 --
NM_006393chr1034376 4269 1041 33664 3329 1425 ----
NM_006411chr63317 38 28 2385 192 1736 --
NM_006420chr2032437 820 288 12322 23339 2903 12248
NM_006457chr453849 3733 3482 2772 635 --11222 --
NM_006459chr1012036 1482 --1388
NM_006464chr254650 1726 1706 1650 286 21773 1671 13348 --
NM_006465chr1562191 2155 1765 887 796 105 1155 2902 719 --
NM_006467chr541904 1597 1488 219 --1694 --
NM_006482chr1263151 3000 2904 2609 1060 916 ------
NM_006489chr1461508 1479 1438 1360 657 611 --11310 --
NM_006500chr111234 --2209 40 1398
NM_006504chr10102812 2455 2163 1183 1085 818 751 727 650 630 1895 22916 2528 --
NM_006517chrX41615 1546 928 48 22118 427 11858 --
NM_006544chr1475812 5602 5293 4457 2295 380 235 12061 ----
NM_006546chr1766524 6489 6206 5908 1393 1157 14430 1721 --
NM_006548chr321175 308 1262 1108 1274
NM_006561chr1075660 5403 5195 3938 2448 1541 1245 14295 ----
NM_006599chr1686980 6827 6263 5683 5500 2509 2222 1611 12370 17984 --
NM_006650chr573550 2761 894 867 805 556 173 31369 1002 874 23760 3346 --
NM_006690chr2041913 406 399 271 21883 24 21651 926 --
NM_006699chr141681 709 603 554 --123 --
NM_006706chr52696 254 --1104 --
NM_006729chrX105044 4843 4640 4480 4193 3681 2008 1698 1509 1174 14966 14517 --
NM_006751chr21105 ----1661
NM_006775chr62286 270 --12076 1143
NM_006814chr2082437 2370 2156 1819 722 503 232 39 --11733 --
NM_006820chr173951 3883 3763 3650 2983 568 216 12846 11029 13128
NM_006827chr1493280 3056 2786 2546 2312 830 710 376 94 1937 --11120
NM_006888chr1463172 2717 1070 885 834 795 --11269 --
NM_006914chr9145 ----11346
NM_006924chr1724353 3689 ----11260
NM_006940chr1231398 568 58 1645 ----
NM_006965chr182423 149 --1434 --
NM_006981chr93828 788 305 1771 ----
NM_007008chr22882 190 --1695 --
NM_007011chr1566546 6251 1135 574 113 80 12221 11780 --
NM_007034chr1------2311 198
NM_007043chr1261984 1768 1560 1351 225 30 11537 ----
NM_007106chr1332071 324 299 ----12707
NM_007107chr341933 1896 1766 1475 --12007 --
NM_007114chr342999 2812 2666 1311 1683 ----
NM_007124chr642013 1980 1616 343 11623 --1162
NM_007153chr1944294 3648 3197 1589 ----12891
NM_007172chr2242594 2547 2073 779 --1830 --
NM_007195chr1853088 2754 871 201 42 ------
NM_007198chr8----41624 1385 1061 136 --
NM_007212chr162163 2053 1998 1497 618 287 ------
NM_007218chr82892 670 154 ----
NM_007236chr1542048 406 259 249 2286 223 1677 --
NM_007249chr13108576 8285 6033 5778 3668 2602 1880 1478 843 195 --49449 5877 402 108 26914 2223
NM_007271chr63321 222 193 31508 652 579 --1326
NM_007325chrX41341 794 330 209 1440 ----
NM_007350chr1264537 4511 3459 3083 801 371 11625 ----
NM_012072chr2084571 4428 3553 3420 2979 2892 933 67 1799 21431 44 1358
NM_012081chr522592 1148 ----12582
NM_012095chr1083432 3107 2769 2460 2147 874 590 414 33395 2222 345 32246 684 265 --
NM_012102chr132218 1621 1061 22287 1674 --12133
NM_012104chr1153160 2995 2894 1433 705 --1307 --
NM_012104chr1153160 2995 2894 1433 705 --1307 --
NM_012141chr1333130 2522 34 --13331 11215
NM_012156chr2093177 3042 3036 2910 2831 2546 2160 555 53 --22996 2730 --
NM_012164chr9137063 6462 6330 6257 6143 5551 2965 2930 2796 2046 1204 220 112 35719 2588 2445 24645 2559 --
NM_012193chr1164895 4835 3697 2094 2082 406 --13420 --
NM_012214chr236246 4936 4125 16080 11342 --
NM_012218chr19103062 2945 2491 1081 1009 956 790 630 163 112 1118 --1766
NM_012229chr1061450 1432 1269 1157 1100 524 --1298 --
NM_012234chr32457 402 21042 948 23117 2542 --
NM_012252chr734074 891 393 13411 24149 1280 --
NM_012262chr164596 4363 3596 3385 1923 1050 14320 --23189 1445
NM_012287chr374216 4113 3685 1431 1191 1161 266 1137 11388 --
NM_012288chr675245 5134 5042 2250 1909 1468 519 24749 901 35181 588 194 --
NM_012296chr11103738 3436 3408 3357 3302 3237 1548 1515 1480 58 33155 2895 92 13325 --
NM_012297chr452435 2386 1683 1001 252 22242 2166 22510 2472 --
NM_012300chr521950 335 11885 1698 1491
NM_012301chr752029 2017 1506 1408 585 21700 347 ----
NM_012306chr1263053 2667 2171 952 543 219 21197 449 124 --
NM_012316chr175036 4887 4720 3719 2267 1938 93 --1189 --
NM_012382chr544243 3710 2900 1471 34407 4391 3366 14164 --
NM_012434chr621676 1439 1456 21483 1104 --
NM_012471chrX41644 464 261 226 1477 2373 135 --
NM_013231chr1463560 3137 1764 1757 1638 1150 23484 2969 13696 --
NM_013233chr241402 1242 953 925 1381 ----
NM_013255chr7138661 8142 7893 6670 6656 6430 6122 3558 2880 1963 801 187 133 23547 1700 26940 6050 --
NM_013269chr1284287 4172 3330 1395 1122 561 432 382 ----14323
NM_013283chr51677 ----1754
NM_013314chr10127 ----1104
NM_013386chr131188 625 443 ------
NM_013437chr83916 326 260 --11144 --
NM_013449chr1272975 2412 2126 1147 724 706 611 21094 595 ----
NM_013943chr183330 3099 2493 2177 1064 520 306 286 2805 317 ----
NM_013989chr1464931 3785 3751 1723 1082 635 11252 ----
NM_014011chr211879 12049 11899 11784
NM_014043chr321431 1105 11578 ----
NM_014048chr1675227 4421 3518 2107 1828 1299 949 15059 ----
NM_014109chr841097 458 416 401 ------
NM_014112chr823399 406 13972 1255 11206
NM_014141chr7105204 4985 3972 3482 2012 1831 1438 1431 776 283 24075 1151 11502 --
NM_014155chr1146215 4972 2327 1350 --15570 --
NM_014231chr1262230 1945 1791 693 129 102 2788 38 21578 95 --
NM_014250chr2241547 630 403 41 --11347 --
NM_014279chr91112 ----1968
NM_014309chr2255080 3811 1456 1262 629 23963 1239 24951 3366 --
NM_014323chr223767 405 158 --134 1676
NM_014333chr1172768 2739 2257 2217 2089 1993 1908 1996 ----
NM_014352chr1141446 352 239 117 1594 ----
NM_014372chr132075 1936 38 --1691 --
NM_014376chr542562 739 570 304 12007 1312 --
NM_014388chr1155950 5723 5650 5386 5201 4872 4460 4382 2382 1689 1300 1024 830 688 204 11171 15875 --
NM_014411chr741780 1749 1488 673 --22011 419 --
NM_014421chr421681 21 11835 --11381
NM_014423chr534661 4564 1663 11681 --14743
NM_014489chr112546 258 --164 1303
NM_014504chr752168 1707 1367 621 548 11387 ----
NM_014554chr124634 621 594 275 --22245 2197 --
NM_014667chr342433 1801 890 589 --12381 --
NM_014670chr231388 636 536 11233 ----
NM_014690chr742113 878 838 471 --22861 2449 --
NM_014701chr1533250 2503 2307 11358 1617 --
NM_014705chr721487 470 ----11389
NM_014715chr112929 689 2287 186 ----
NM_014721chr6116449 5662 5282 4756 2891 2834 2112 2045 598 574 38 25411 1620 25089 4818 --
NM_014729chr822307 127 11486 --1238
NM_014730chr1285208 5054 4919 4891 4676 4599 2032 379 21505 1334 1826 --
NM_014730chr1285208 5054 4919 4891 4676 4599 2032 379 21505 1334 1826 --
NM_014746chr243732 3517 1198 816 --2543 71 --
NM_014764chr1241194 938 485 469 1225 ----
NM_014765chr142544 2113 2107 932 --12529 --
NM_014774chr142614 2266 1146 178 --22197 924 --
NM_014810chr183267 2700 2622 2324 1091 883 534 80 12770 1818 2621 192
NM_014827chr151665 1440 428 221 192 11360 ----
NM_014828chr1421846 669 11729 21671 561 --
NM_014873chr164316 3943 1351 863 367 298 --1286 14113
NM_014877chr1776733 6124 5776 2575 2493 1204 1059 37436 1453 606 --11223
NM_014893chrY4927 294 141 25 ------
NM_014903chr1252297 876 493 409 351 ------
NM_014904chr1042704 635 162 94 12902 13196 --
NM_014906chr1743525 1300 881 52 13086 2302 264 --
NM_014909chr1473721 3710 3637 3223 1413 1011 996 ----12876
NM_014935chr193036 2717 1248 1240 1065 928 490 226 69 13283 2484 283 --
NM_014946chr242978 2761 2343 2260 --1997 --
NM_014991chr443165 2750 1131 340 22670 2646 12008 --
NM_015020chr1642524 505 470 208 43749 3453 3361 958 ----
NM_015033chr952595 2381 466 451 115 ----13097
NM_015039chr174298 941 897 356 317 84 40 33993 3800 1637 14006 12879
NM_015040chr242643 2402 1311 1180 13024 1361 13074
NM_015042chr1574266 4228 2834 2744 1069 470 458 13872 43106 1725 1478 109 --
NM_015057chr133257 99 45 ----1126
NM_015064chr1263343 2804 529 475 315 294 11010 --146
NM_015068chr733623 801 584 23221 1057 --1342
NM_015071chr5105685 4907 4885 4653 4494 2510 1533 1092 1056 173 21085 697 25359 572 --
NM_015074chr174935 4081 3142 1937 1779 1683 161 1603 24675 1900 --
NM_015075chrX81922 1757 1512 779 759 404 224 94 1799 ----
NM_015086chr1271309 1207 1053 612 124 62 40 11322 ----
NM_015094chr2283770 2986 1854 1794 1522 1515 1501 224 24644 3837 ----
NM_015100chr131705 1604 809 ----1822
NM_015137chr821985 1795 --1677 11800
NM_015192chr2052393 2361 666 500 465 --189 --
NM_015291chr183094 2972 2721 2654 1233 716 268 249 ------
NM_015313chr1153719 3548 1554 238 214 14214 24796 4635 --
NM_015315chr5112673 2611 2584 2329 1237 1217 1064 750 578 520 152 12826 11329 --
NM_015326chr142303 2218 886 789 22457 378 12199 --
NM_015328chr773047 2998 2707 2214 829 495 489 ------
NM_015336chr1221694 1070 --32286 2212 2089 1780
NM_015346chr1431751 1591 535 11357 --1753
NM_015355chr1731277 698 58 11434 ----
NM_015365chrX43408 2876 155 97 ----11137
NM_015375chr164900 4392 3042 1769 305 217 14057 ----
NM_015393chr433652 2895 2390 12820 23442 191 11419
NM_015453chr331610 1545 124 --1831 --
NM_015455chr531436 1210 758 --13357 13511
NM_015458chr894593 4581 4180 3885 1711 1346 1321 813 171 --23988 1333 24781 1892
NM_015550chr753405 2974 2416 2217 1052 33556 2586 2463 ----
NM_015564chr573318 3278 2927 2243 997 414 397 12999 ----
NM_015569chr144109 1551 1004 442 23806 1143 ----
NM_015575chr273509 2350 1094 838 124 83 24 11110 ----
NM_015602chr141607 1443 1127 439 11414 ----
NM_015640chr123671 1014 11949 --1121
NM_015686chrX52375 2080 1872 1794 527 32201 258 210 ----
NM_015691chrX32723 978 247 32650 2630 1978 ----
NM_015879chr18178636 8531 7998 7674 7446 6254 3215 2707 2346 2316 1688 1392 1342 1177 1063 881 479 36240 2121 719 47271 5533 1954 491 --
NM_015886chr835567 1285 1157 34860 1767 1462 11789 --
NM_015892chr1062107 1546 973 208 145 49 22267 2132 ----
NM_015906chr124090 2959 13382 --23554 3317
NM_015938chr33905 834 73 ------
NM_016009chr133415 1185 121 ----34691 4438 1774
NM_016045chr203503 214 185 11337 ----
NM_016061chr22549 22 21589 184 21539 585 --
NM_016083chr672834 2686 2554 1548 1273 313 184 ----11256
NM_016096chr832128 2107 222 --11864 11695
NM_016124chr131380 1055 184 1281 1388 --
NM_016131chr232323 735 598 130 --3923 585 121
NM_016132chr1542678 2236 2095 1098 1528 ----
NM_016206chr3138830 8579 8258 8132 7215 5550 3593 3214 3048 2590 1887 1781 1127 32147 887 81 ----
NM_016257chr173086 2885 2588 2397 2156 443 402 --12752 --
NM_016260chr242981 2076 1706 1108 ------
NM_016271chr182166 43 --31920 1872 1824 --
NM_016272chr2252449 2438 1866 730 490 21961 509 21807 711 --
NM_016277chr641568 1553 1064 623 159 11143 --
NM_016320chr114811 325 315 88 2847 38 1222 1445
NM_016383chrX1453 ----1179
NM_016401chr11--167 --1223
NM_016418chr2243370 2398 1026 457 23712 143 1461 13278
NM_016436chr2042425 2143 2124 2046 ----12498
NM_016507chr1762402 2345 2337 1091 643 101 32639 53 41 1564 --
NM_016531chr4113768 3298 3038 3030 2809 2691 1640 1440 929 902 895 ----1140
NM_016577chr384439 4391 3334 1275 958 791 505 443 13912 43998 3473 2761 1540 1420
NM_016598chr351286 1106 921 540 322 --3925 192 57 --
NM_016622chr252121 1422 1381 522 388 ------
NM_016929chr663724 3688 1272 427 420 22 33932 682 391 1176 --
NM_017415chr534567 4213 172 12783 13494 --
NM_017420chr1443332 1246 1063 376 22525 2344 ----
NM_017452chr2051515 1471 1423 546 23 11276 ----
NM_017453chr2051515 1471 1423 546 23 11276 ----
NM_017454chr2051515 1471 1423 546 23 11276 ----
NM_017596chr1104324 4125 4035 3515 3458 3224 951 748 441 344 --1185 --
NM_017628chr475231 4787 3279 1833 1430 1188 1110 33942 1131 922 --11723
NM_017637chr9128506 8429 8183 8000 7209 6489 6106 5857 5734 3527 3421 1793 17861 ----
NM_017641chr124967 918 792 363 --1172 --
NM_017644chr365190 4268 1859 1822 1256 767 ------
NM_017650chr755260 4032 1829 1598 916 --11129 --
NM_017709chr113524 1245 1654 13977
NM_017769chr1463129 2189 1120 982 720 81 ------
NM_017778chr84989 251 116 21 11224 11452 --
NM_017779chr122210 2066 1240 12462 --
NM_017813chr895292 5196 4867 4488 3559 1436 716 308 103 --15454 --
NM_017824chr1062714 2594 770 236 156 35 ------
NM_017831chr1884793 3923 3140 1746 1011 815 343 44 ------
NM_017847chr12766 81 ----131
NM_017848chrX104394 3942 3762 3562 3349 2994 1440 645 324 140 ------
NM_017893chr1051238 1090 559 315 280 1329 ----
NM_017902chr10105377 4791 4623 4614 1781 1478 1097 1068 509 41 25131 47 12234 --
NM_017915chr121779 ----146
NM_017919chr9125535 5083 4974 4898 4851 4453 3573 2096 2082 1635 848 40 23531 1957 25217 3785 --
NM_017944chr1123147 786 ----11245
NM_018003chr1552240 1931 1807 1643 292 ------
NM_018027chr103398 189 142 52983 2256 1208 956 45 ----
NM_018045chr152664 2276 2201 1964 592 11239 ----
NM_018085chr197784 7090 6832 6001 2693 1832 376 229 50 16462 ----
NM_018126chr41539 ----1429
NM_018155chr322644 322 --12691 1354
NM_018157chr1253138 2139 1279 796 505 --23128 725 --
NM_018178chr151544 774 638 366 169 --11335 --
NM_018182chr1792210 2178 2143 1921 1705 791 637 540 294 12184 --11426
NM_018184chr342121 1714 1694 322 11559 1293 --
NM_018200chr1572040 1890 1796 1699 806 268 150 167 ----
NM_018211chr121420 619 22044 1467 ----
NM_018227chr441961 1269 994 748 --13132 --
NM_018247chr642904 2713 2681 25 --1512 13107
NM_018299chr842736 1195 1082 905 1401 ----
NM_018351chr12134236 4087 3951 3795 3728 2967 1836 1550 1383 1211 625 283 259 13690 13594 --
NM_018364chr143766 3595 1565 1059 ------
NM_018374chr753557 2071 1647 542 246 --13379 12108
NM_018400chr1174491 4345 3634 3447 3357 2993 2961 33808 2955 146 --24196 4098
NM_018409chr462979 2943 2830 2494 379 28 --31141 269 106 --
NM_018440chr8108254 7284 6983 6416 2731 2060 1910 1779 1630 474 27971 376 --17978
NM_018469chr1751422 1265 1091 148 67 --11296 --
NM_018509chr1721190 105 --11416 1562
NM_018566chr154865 4525 3619 3592 688 14662 1113 --
NM_018638chr1245623 3551 2216 194 1963 ----
NM_018704chr151882 1574 1392 249 140 22001 746 1111 11906
NM_018717chr442334 2254 706 78 ----1959
NM_018834chr51301 1362 1786 --
NM_018841chr163978 3903 2979 1184 669 529 --13940 11207
NM_018912chr531157 319 280 31429 342 225 1588 --
NM_018913chr531157 319 280 31429 342 225 1588 --
NM_018914chr531157 319 280 31429 342 225 1588 --
NM_018915chr531157 319 280 31429 342 225 1588 --
NM_018916chr531157 319 280 31429 342 225 1588 --
NM_018917chr531157 319 280 31429 342 225 1588 --
NM_018918chr531157 319 280 31429 342 225 1588 --
NM_018919chr531157 319 280 31429 342 225 1588 --
NM_018920chr531157 319 280 31429 342 225 1588 --
NM_018921chr531157 319 280 31429 342 225 1588 --
NM_018922chr531157 319 280 31429 342 225 1588 --
NM_018923chr531157 319 280 31429 342 225 1588 --
NM_018924chr531157 319 280 31429 342 225 1588 --
NM_018925chr531157 319 280 31429 342 225 1588 --
NM_018926chr531157 319 280 31429 342 225 1588 --
NM_018927chr531157 319 280 31429 342 225 1588 --
NM_018928chr531157 319 280 31429 342 225 1588 --
NM_018929chr531157 319 280 31429 342 225 1588 --
NM_018945chr643135 1356 734 130 2691 224 12858 13090
NM_018976chr1261883 711 417 365 258 33 11810 ----
NM_018979chr1232326 661 341 ----12635
NM_018999chr10104423 4405 3558 3479 1861 1818 1451 995 737 399 1359 --13840
NM_019001chr354056 3986 3733 1866 393 143 ----
NM_019008chr2252872 2659 1097 601 118 32849 1455 626 12491 --
NM_019027chr442389 2035 592 245 ------
NM_019041chr621782 647 --2504 438 --
NM_019072chr554027 3542 3417 2894 864 12708 ----
NM_019106chr2242518 2467 2442 2244 23253 2570 12537 --
NM_019596chr2152848 1101 746 709 535 32781 2021 159 --11189
NM_020122chr275168 4806 2215 2152 1879 1428 67 22085 1534 ----
NM_020133chr675653 5233 4903 1967 1221 506 350 55632 4227 4009 2161 1895 22592 21 36156 4772 4173
NM_020141chr162394 1986 1674 536 312 101 ------
NM_020177chr563195 3153 2383 499 433 306 ------
NM_020193chr11------1362
NM_020239chr182261 1866 1437 916 726 697 42 27 11888 ----
NM_020245chr654920 3850 3730 1568 1045 11807 ----
NM_020297chr1273022 2794 2676 2639 2629 2417 65 11253 12896 13291
NM_020310chr1732507 2037 793 --11793 22767 2017
NM_020336chr2023311 3168 43182 2706 889 511 11390 --
NM_020338chr1083472 2829 1414 1340 994 695 382 22 12977 12364 --
NM_020346chr113500 324 156 3670 208 199 ----
NM_020348chr1052637 2528 385 127 72 12419 ----
NM_020357chr331527 553 83 ------
NM_020390chr343528 1652 1618 1229 14247 ----
NM_020455chr622529 584 --21807 23 12542
NM_020463chr231464 516 482 ------
NM_020473chrX31635 798 364 ----1645
NM_020532chr22882 190 --1695 --
NM_020647chr82334 303 --2788 430 --
NM_020673chr20107238 7085 6421 2945 2260 1559 1402 1134 620 537 24769 2730 26269 5501 --
NM_020699chr1135309 4860 4748 4468 4242 4206 3904 3765 3433 3420 982 358 28 11004 ----
NM_020711chr222137 1826 --12571 22600 587
NM_020717chrX74933 4507 3913 3235 1874 1285 358 13457 54766 4142 3631 3559 1233 13553
NM_020718chr1675735 5102 4789 4189 2096 1238 368 25976 527 ----
NM_020766chrX54057 3143 1015 934 335 13016 ----
NM_020776chr1893088 2590 1975 1137 596 576 531 461 288 --22437 1025 --
NM_020791chr1731360 963 67 11092 ----
NM_020792chr362815 2160 2064 1889 1846 98 --12127 --
NM_020808chr121088 117 ----1133
NM_020809chr1152311 1985 1676 1621 1402 --22328 1977 1406
NM_020810chr1483214 2394 2358 1089 710 656 373 21 --2747 727 --
NM_020819chr61349 ----1138
NM_020830chr212423 --12917 11054
NM_020834chr1441715 1442 1362 759 --1427 11459
NM_020841chr1242931 2532 1581 180 13815 --12537
NM_020850chr1662872 2842 2836 2044 1025 842 1393 22135 1085 --
NM_020859chr443948 3698 402 93 --12622 --
NM_020861chr63548 488 46 --11326 --
NM_020871chrX32414 1787 850 ------
NM_020899chr1761022 530 482 452 258 175 --21604 377 --
NM_020917chr1953800 2996 2577 1310 145 --1727 12509
NM_020921chr1443588 3513 3306 2700 11461 ----
NM_020935chr273324 1692 1648 1551 1430 1118 805 1425 --11869
NM_020940chr1062277 2085 753 559 516 134 ------
NM_020948chr153454 2732 2718 2517 1368 23492 3018 ----
NM_020964chr1863702 3665 3151 1859 1580 1121 1628 14300 --
NM_021033chr1353398 2965 2440 870 197 ------
NM_021061chr884365 4046 2859 1766 1268 552 320 26 ------
NM_021097chr2102577 2568 2498 908 862 832 216 185 171 160 1894 --1417
NM_021116chr7178614 8531 8392 7541 6992 6483 5907 3489 3316 2446 2432 2286 2266 2246 831 603 262 37105 7004 2650 38594 8147 5805 11221
NM_021145chr73778 761 175 1827 ----
NM_021255chr1473597 3591 3513 3490 3448 2566 1378 --21216 1015 --
NM_021574chr2281897 1815 1796 967 559 431 121 64 ----11916
NM_021629chr364743 3484 3457 3297 1991 1825 14799 14251 --
NM_021633chr121032 506 ----11229
NM_021647chr474733 4029 3162 2959 1520 1113 105 23293 1215 21728 884 --
NM_021648chr65810 788 502 181 88 1571 1950 11907
NM_021738chr10------1211
NM_021813chr675836 4480 3934 3564 1508 1033 512 35236 1295 42 --14925
NM_021815chr242089 2032 1210 654 1202 12231 --
NM_021911chr565157 3643 2050 1280 152 131 ------
NM_021912chr1553616 3555 3440 691 346 11685 21185 392 1942
NM_021940chr6--124 --11153
NM_021947chr1751343 1323 1060 850 276 --1905 --
NM_021961chr1196241 5984 5454 2827 2787 2599 2138 1931 189 15412 --15610
NM_021964chr365843 5051 2423 1537 1250 1008 16338 --11760
NM_021977chr613866 73889 3235 2598 2367 607 142 35 --1447
NM_021984chrX41534 1035 209 124 31519 1232 186 ----
NM_021987chrX41534 1035 209 124 31519 1232 186 ----
NM_021988chr2041599 1465 1136 557 1130 2561 214 --
NM_021990chrX41534 1035 209 124 31519 1232 186 ----
NM_022037chr2------1159
NM_022048chr15115988 5130 5063 4422 4357 4226 4057 3872 1131 554 187 1868 14349 15071
NM_022060chr1471207 1166 1158 1061 872 447 430 2464 255 11314 --
NM_022114chr184314 3882 3614 3204 3099 1604 1022 966 23425 255 23842 200 --
NM_022130chr551449 1255 1249 242 230 --122 --
NM_022143chr7--11440 --1424
NM_022153chr1083322 2785 2691 2363 1084 1057 819 532 12370 13391 --
NM_022166chr16196067 6034 5175 5064 5033 5006 4521 4510 2227 2176 2078 1949 1772 1763 1700 1516 1403 1295 1011 22115 1119 25810 4265 15158
NM_022173chr2------1159
NM_022336chr252257 1943 1743 660 277 1673 11465 --
NM_022351chr893391 3179 2860 1021 1003 987 646 512 480 33048 2680 583 ----
NM_022442chr2041599 1465 1136 557 1130 2561 214 --
NM_022459chr1335532 4938 2322 21767 1087 11490 --
NM_022462chr1943249 3196 1222 422 13636 --13489
NM_022473chr1553963 3172 940 900 623 ----11665
NM_022477chr204585 93 37 25 173 ----
NM_022484chr741380 1305 1255 463 1455 ----
NM_022491chr1243203 2510 1188 966 ----1579
NM_022716chr172984 2948 1933 768 727 554 58 12324 ----
NM_022745chr142338 2200 2039 1016 12364 12449 --
NM_022781chr942890 2130 888 672 --12693 163
NM_022831chr131813 1367 56 ----11266
NM_022836chr131829 428 341 ----1548
NM_022841chr1531818 543 348 ----1262
NM_022845chr1642219 2158 279 32 --11968 --
NM_022894chr211579 21530 239 11282 --
NM_022898chr1494381 4363 4079 3768 3555 3548 3175 3117 327 21585 1114 1888 --
NM_022977chrX42184 1860 1719 477 12049 ----
NM_023016chr242449 2267 1164 891 --1326 --
NM_024017chr172483 43 --1630 1449
NM_024052chr17122621 2547 2505 2419 2412 2056 1945 968 661 504 319 307 12069 ----
NM_024090chr451949 1356 749 242 213 --1584 --
NM_024345chr985629 5453 5010 2010 1649 1360 488 206 25581 162 24564 1035 --
NM_024513chr383333 3320 3277 3056 1389 504 291 102 131 ----
NM_024569chr152906 2863 571 391 257 --12112 --
NM_024636chr732031 2001 188 12426 --12316
NM_024689chrX51868 1249 1215 590 570 ------
NM_024740chr1143649 3357 1658 617 --23168 33 --
NM_024761chr975377 3453 3368 1785 1185 777 574 14100 ----
NM_024770chr276294 5227 4250 2562 1518 1395 244 --14697 --
NM_024812chr821499 1442 1494 12145 --
NM_024834chr103721 459 296 --11723 --
NM_024854chr1231549 1451 510 --21411 348 --
NM_024884chr1494134 3106 3089 2852 2839 2788 1631 1208 655 ------
NM_024909chr651552 1318 1219 1122 481 1497 ----
NM_024946chr1671690 1540 1238 1111 684 619 557 11382 11227 --
NM_024949chr454432 4061 4043 3082 535 23604 1375 --13233
NM_024989chr256731 1374 910 807 252 27800 5930 ----
NM_025054chr853447 3368 3131 1616 703 --23686 404 13500
NM_025134chr161203 11750 --1460
NM_025160chr154026 3787 3511 3314 127 --1331 --
NM_025179chr1114656 3646 3287 3217 1983 1609 730 476 464 212 123 33072 3027 426 23688 1301 11123
NM_025211chr9------1218
NM_025248chr1752757 2158 1076 347 164 33043 2215 745 12717 11183
NM_030621chr1444107 3821 1274 414 ----11697
NM_030625chr1062412 1963 1757 972 739 89 --12528 --
NM_030634chr161787 946 814 524 331 127 ------
NM_030647chr766047 4283 1747 1685 180 23 21448 1307 13837 --
NM_030650chr254284 4117 4068 3559 266 13654 12966 --
NM_030674chr12105515 4879 4769 4610 3734 1944 1847 1500 522 401 44558 1161 648 279 ----
NM_030780chr851710 1451 596 476 224 ----11415
NM_030786chr141518 605 453 126 ------
NM_030806chr1108652 7144 6236 6161 3467 3405 3263 3179 1611 441 56407 5885 3165 1590 790 11011 --
NM_030809chr1282232 2113 1745 1568 829 712 65 32 ------
NM_030816chr132410 594 381 --13215 --
NM_030881chr2242449 1694 662 137 1832 1811 --
NM_030918chr194985 4801 4571 4441 4293 4230 895 854 137 31649 1164 679 ----
NM_031427chr1455829 4729 1583 1549 1379 21328 275 15525 --
NM_031442chrX42384 2216 827 290 ----139
NM_031444chr2242541 2256 127 40 --11667 --
NM_031445chr273154 2878 2525 2488 666 660 109 ----12632
NM_031468chr7148243 6526 6369 6185 6009 2460 2099 2062 984 897 697 493 394 277 26611 333 27955 1323 --
NM_031989chr12159 ----1137
NM_032012chr964987 3736 1530 1372 1362 904 23484 1265 15126 --
NM_032013chr204585 93 37 25 173 ----
NM_032050chr223767 405 158 --134 1676
NM_032052chr2221152 543 --1419 11061
NM_032088chr531157 319 280 31429 342 225 1588 --
NM_032092chr531157 319 280 31429 342 225 1588 --
NM_032160chr1844148 2797 795 780 --11115 --
NM_032182chr1041578 1165 378 155 ----1664
NM_032189chr13124792 4706 4113 3987 1475 1094 1065 970 954 457 251 219 1289 24163 461 --
NM_032199chr1083908 3442 3307 2803 2674 2467 1408 315 11313 ----
NM_032208chr253146 2499 950 761 407 32803 2290 233 --12360
NM_032217chr43872 188 179 11326 1192 --
NM_032228chr1133496 3474 3236 --1105 --
NM_032324chr1------1204
NM_032329chr233332 3218 1017 24253 4178 12911 13229
NM_032373chr1095443 5231 5134 4310 4166 4000 1835 1235 191 --1207 1713
NM_032403chr531157 319 280 31429 342 225 1588 --
NM_032439chr1031206 649 160 11280 ----
NM_032445chr1542510 2367 796 437 --12020 --
NM_032446chr532368 936 66 12854 --11528
NM_032457chr453773 2946 906 495 474 13417 1196 1837
NM_032486chr1642707 489 276 254 21810 401 2979 192 1826
NM_032505chr332553 1805 161 2992 980 ----
NM_032682chr363459 1062 782 632 276 160 12378 ----
NM_032741chr63317 38 28 2385 192 1736 --
NM_032804chr1052406 2099 316 277 261 12481 ----
NM_032826chr775306 5276 4141 3426 855 480 394 2667 238 34909 3723 3691 1324
NM_032842chr731212 347 288 --11136 --
NM_032846chr1431392 1367 1300 11360 1532 --
NM_032873chr1194507 4173 3081 2969 1318 1285 845 655 536 ------
NM_032900chr1063782 3305 3083 1506 1058 762 ----1253
NM_032968chrX43844 3665 1284 303 --14022 --
NM_032969chrX43844 3665 1284 303 --14022 --
NM_032973chrY43836 3657 1284 303 --14014 --
NM_032975chr1853428 3178 2806 720 330 ------
NM_032978chr182357 163 ----1174
NM_032979chr182357 163 ----1174
NM_032980chr1853428 3178 2806 720 330 ------
NM_032981chr182357 163 ----1174
NM_032983chr763406 3002 2480 2340 2107 960 2408 306 11217 1834
NM_033020chr124090 2959 13382 --23554 3317
NM_033030chr22652 281 --11568 --
NM_033129chr2062008 1979 565 229 217 187 3647 620 473 2527 399 --
NM_033133chr1763565 3185 1511 1346 941 497 --11189 1226
NM_033136chr541549 1537 266 38 ----11615
NM_033137chr541549 1537 266 38 ----11615
NM_033181chr672834 2686 2554 1548 1273 313 184 ----11256
NM_033224chr786879 6563 6280 5780 1337 452 372 75 47766 7136 4926 616 21401 42 11998
NM_033225chr822864 1165 1977 23051 970 1729
NM_033360chr1254217 3877 3704 877 628 11191 21842 474 11699
NM_033375chr173557 525 144 --1938 11012
NM_033389chr1743758 3685 3620 3212 23829 499 14309 --
NM_033505chr276004 5834 5288 2258 1680 1391 67 15649 --14544
NM_033512chr892873 2609 1949 1135 993 738 663 575 333 ------
NM_033551chr5112673 2611 2584 2329 1237 1217 1064 750 578 520 152 12826 11329 --
NM_033631chr152770 2507 1074 994 477 --41566 677 272 58 11525
NM_033642chrX------1164
NM_033644chr521950 335 11885 1698 1491
NM_033645chr521950 335 11885 1698 1491
NM_052885chr1274813 4797 4445 4117 971 638 320 ----13432
NM_052896chr13611 490 107 1171 12237 12215
NM_052898chr861542 1309 541 129 120 78 21823 583 ----
NM_053016chr976836 6411 5971 3096 2372 916 735 11913 27168 6531 --
NM_053042chr432994 2959 519 2946 337 ----
NM_053043chr756194 5595 5565 2554 2375 25532 662 15538 --
NM_053056chr1152823 2806 465 402 166 --22886 1004 2752 737
NM_053064chr1423062 270 1800 21220 115 --
NM_054114chr61733 ----1640
NM_080491chr11103738 3436 3408 3357 3302 3237 1548 1515 1480 58 33155 2895 92 13325 --
NM_080654chr114953 339 261 52 1855 ----
NM_080743chr662181 2070 1926 800 228 216 ------
NM_080867chr1433430 1927 462 13113 21240 769 1520
NM_080927chr382821 2165 1347 691 649 537 438 159 ------
NM_130391chr953340 3312 3074 2800 804 13318 22751 309 22724 2451
NM_130392chr953340 3312 3074 2800 804 13318 22751 309 22724 2451
NM_130393chr953340 3312 3074 2800 804 13318 22751 309 22724 2451
NM_130435chr10102812 2455 2163 1183 1085 818 751 727 650 630 1895 22916 2528 --
NM_130436chr2142224 872 424 203 --1563 --
NM_130438chr2182801 1001 780 397 131 113 86 33 --11140 --
NM_130439chr104762 712 619 316 --21733 1678 --
NM_130439chr104762 712 619 316 --21733 1678 --
NM_130798chr151261 ----1996
NM_133264chr1753874 3327 689 229 70 23947 159 ----
NM_133265chrX53592 3012 2382 1085 792 23386 2239 21195 444 --
NM_133334chr4155710 5621 5338 5314 4256 2333 2073 1916 1820 1040 932 611 589 526 44 16296 22104 1852 14584
NM_133367chr653479 2943 2574 406 276 1821 ----
NM_133372chr542362 2169 781 105 ------
NM_133445chr973778 3478 3271 2599 1093 617 82 23433 2484 11455 23522 1037
NM_133468chr752366 2218 729 702 672 32105 962 898 11708 --
NM_133478chr212031 --31895 1031 619 12243
NM_133496chr164392 4158 3139 2875 645 358 21434 916 1350 --
NM_133647chr1533751 677 172 --21443 1022 --
NM_134268chr1751153 1131 1125 1113 1107 ----1374
NM_138270chrX72557 1382 1104 1034 981 856 166 11211 --32991 2574 2364
NM_138277chr6----171 2185 126
NM_138286chr1944311 4004 1551 1501 --1771 --
NM_138328chr1732568 1246 1083 --13084 13000
NM_138444chr1354681 4539 4511 3237 108 --11090 24838 3140
NM_138468chr275232 4497 4483 2520 738 705 490 46105 1818 1808 1319 11441 --
NM_138473chr1264777 3135 1299 351 180 172 --34627 1494 489 --
NM_138576chr1494381 4363 4079 3768 3555 3548 3175 3117 327 21585 1114 1888 --
NM_138694chr653095 2976 2949 2379 2337 13348 ----
NM_138713chr1686980 6827 6263 5683 5500 2509 2222 1611 12370 17984 --
NM_138714chr1686980 6827 6263 5683 5500 2509 2222 1611 12370 17984 --
NM_138959chr1146769 5959 5436 5060 4996 4916 2577 1505 1395 1350 1238 1099 711 242 --36610 2026 146 --
NM_138971chr1153160 2995 2894 1433 705 --1307 --
NM_138971chr1153160 2995 2894 1433 705 --1307 --
NM_138972chr1153160 2995 2894 1433 705 --1307 --
NM_138972chr1153160 2995 2894 1433 705 --1307 --
NM_138973chr1153160 2995 2894 1433 705 --1307 --
NM_138973chr1153160 2995 2894 1433 705 --1307 --
NM_139057chr1582784 2504 2241 1883 1173 1105 1058 290 1516 ----
NM_139132chr114811 325 315 88 2847 38 1222 1445
NM_139246chr942139 1757 1699 769 1429 1512 --
NM_139321chr2093619 3575 3114 2988 891 738 557 175 57 23458 3269 ----
NM_144567chr11560 ----12614
NM_144571chr476596 6579 6265 6055 1126 365 88 15215 --12508
NM_144578chr1445325 3457 3417 1233 14293 25558 1677 --
NM_144599chr1543396 2131 1515 1079 31654 1326 486 1220 --
NM_144778chr1311697 1828 173 1898
NM_144949chr211879 12049 11899 11784
NM_144973chr1233395 1895 962 34590 877 455 ----
NM_145013chr1142877 2381 2071 647 --1790 1510
NM_145055chr1852864 1440 429 403 50 ------
NM_145207chr444391 3598 1231 277 ------
NM_198581chr246766 5835 4814 42 26973 2487 ----
NM_198686chr1452568 1866 1009 884 591 52530 2347 2232 645 340 21675 427 --
NM_198793chr373336 3096 2983 2937 1171 1024 616 --23681 2593 --
NM_198859chr3134934 4358 3798 1821 1766 1664 1558 884 844 710 698 520 282 14061 ----
NM_198889chr43872 188 179 11326 1192 --
NM_198900chr12137016 6973 6541 6423 6100 6020 5887 5670 5491 3002 2454 1399 271 17061 --36648 6025 1639
NM_198990chr762402 2028 1235 366 357 59 ----1414
NM_199000chr732107 1615 858 12012 --1556
NM_199044chr172666 2153 817 683 620 224 110 ------
NM_199144chr2041599 1465 1136 557 1130 2561 214 --
NM_199189chr51301 1362 1786 --
NM_199203chr2041599 1465 1136 557 1130 2561 214 --
NM_199245chr1252636 2351 2197 535 508 1444 21984 501 --
NM_199320chr432461 2087 852 12732 --1412
NM_199320chr432461 2087 852 12732 --1412
NM_199421chr1433430 1927 462 13113 21240 769 1520
NM_199436chr242978 2761 2343 2260 --1997 --
NM_199454chr184314 3882 3614 3204 3099 1604 1022 966 23425 255 23842 200 --
NM_199462chr164900 4392 3042 1769 305 217 14057 ----
NM_201266chr262661 2461 1214 794 524 482 1511 --12930
NM_201279chr262661 2461 1214 794 524 482 1511 --12930
NM_201403chr13544 528 27 11171 --11342
NM_201428chr1191377 1371 1303 1101 601 544 203 145 42 1376 ----
NM_201429chr1191377 1371 1303 1101 601 544 203 145 42 1376 ----
NM_201430chr1181303 1297 1229 1027 527 470 129 71 1302 1614 --
NM_201559chr654735 4713 4595 3922 334 1676 33028 517 465 --
NM_201591chr441490 1403 444 27 2219 60 --168
NM_201592chr441490 1403 444 27 2219 60 --168
NM_201632chr541862 1225 587 578 1612 2486 46 --
NM_201634chr541961 1324 686 677 1711 2585 145 --
NM_203350chr131545 249 230 ------
NM_203394chr1252001 1731 884 148 141 1114 22080 77 --
NM_203454chr151035 972 910 314 251 --1935 --
NM_203463chr231436 520 349 13295 1181 11565
NM_203504chr452435 2386 1683 1001 252 22242 2166 22510 2472 --
NM_203505chr452435 2386 1683 1001 252 22242 2166 22510 2472 --
NM_206594chr183021 2506 2276 511 377 304 201 27 1805 ----
NM_206595chr183021 2506 2276 511 377 304 201 27 1805 ----
NM_206876chr22338 27 ----182
NM_206914chr1241996 1584 728 101 22182 826 --1219
NM_207012chr1083432 3107 2769 2460 2147 874 590 414 33395 2222 345 32246 684 265 --
NM_207043chr131935 1908 1895 22352 1736 ----
NM_207044chr131935 1908 1895 22352 1736 ----
NM_207047chr131935 1908 1895 22352 1736 ----
NM_207171chr131705 1604 809 ----1822
NM_207303chr1063964 3885 3830 3085 881 221 23261 674 --1105
NM_207304chr13--1715 --1785
NM_207372chr1032289 707 179 --1617 1111
NM_207404chr361930 1848 1795 1469 1443 572 11579 11883 176
NM_207406chr495439 4125 2321 2094 1927 1116 1050 710 506 34215 2359 1549 ----
NM_207422chrX61200 1148 1027 957 534 200 1160 ----
NM_207467chr131111 532 146 21755 1386 11697 --
NM_207520chr22882 190 --1695 --
NM_207521chr22882 190 --1695 --
NM_212464chr1551727 1519 1324 827 647 21583 458 ----
NM_212554chr1031544 1322 1141 --11121 --
NM_213589chr284948 4790 3679 2117 1864 1543 661 64 ------
NM_213648chr541862 1225 587 578 1612 2486 46 --
NM_213651chr131188 625 443 ------