TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1197
miRNA Sequence: UAGGACACAUGGUCUACUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr53862 325 293 ------
NM_000038chr571967 1554 1308 804 426 166 135 1300 ----
NM_000044chrX154 ------
NM_000051chr1173460 3202 2594 2423 1299 1085 1029 ------
NM_000074chrX----1355 --
NM_000084chrX166725 6156 6009 5817 5504 5406 4908 4770 4554 2708 2688 2356 2320 2214 2095 1897 12203 ----
NM_000092chr264448 3759 3306 3105 3011 700 ------
NM_000109chrX22123 1960 --12415 --
NM_000125chr644020 3777 1285 179 --13267 --
NM_000134chr411106 11436 11549 --
NM_000138chr1512095 --1936 --
NM_000163chr512327 1260 ----
NM_000165chr61462 --21697 1685 --
NM_000167chrX21864 1563 --1556 --
NM_000168chr763034 2988 2282 2236 870 199 --12102 --
NM_000176chr553850 3311 3017 994 75 --13766 --
NM_000183chr21352 --2377 163 1365
NM_000202chrX83033 3001 2970 2845 2546 1584 1461 1220 --12519 1560
NM_000208chr1984128 3985 3450 3367 2911 1354 650 365 13611 ----
NM_000210chr262240 2128 1913 1824 1607 62 1663 ----
NM_000214chr2031603 1470 232 21425 320 ----
NM_000217chr1265196 3741 3599 3388 3249 1100 ------
NM_000222chr462080 1976 1850 1555 698 128 ------
NM_000227chr181289 ------
NM_000232chr432930 2312 215 1705 ----
NM_000237chr841692 1344 752 271 --11817 --
NM_000245chr732220 2117 2102 ------
NM_000248chr343053 2106 950 774 ------
NM_000253chr41797 --1768 --
NM_000259chr1545208 4845 4152 650 --45852 1467 938 300 --
NM_000264chr932247 828 669 ------
NM_000267chr1773287 2746 2636 2439 1111 241 69 12965 --12826
NM_000280chr112816 685 --2639 135 --
NM_000314chr1022153 2079 --1354 --
NM_000319chr1231102 365 29 ----1162
NM_000332chr677001 6331 6286 5934 2533 990 190 1121 1496 --
NM_000337chr564813 2256 1229 1089 869 147 12342 11210 --
NM_000340chr331113 538 274 11159 ----
NM_000346chr1741943 1892 1867 1260 ------
NM_000362chr2293589 3442 3145 2996 2754 2748 814 571 561 --23627 1364 --
NM_000368chr994809 4089 3174 3023 2955 1354 802 488 264 14824 --1242
NM_000386chr173569 314 285 ------
NM_000389chr621460 1258 --31467 1395 274 191
NM_000393chr221398 535 1607 ----
NM_000408chr213089 13033 ----
NM_000421chr172314 228 --1284 --
NM_000428chr1442474 2335 1826 530 ------
NM_000439chr571857 1827 982 659 422 249 68 ----11001
NM_000448chr1112660 1933 12888 --
NM_000459chr92926 586 1328 ----
NM_000461chr314131 --21072 1053 1564
NM_000462chr1521557 108 1569 1738 --
NM_000486chr1282846 2643 2227 2149 1988 1005 438 415 --12168 --
NM_000489chrX32887 1111 494 12721 ----
NM_000495chrX2776 72 ------
NM_000527chr1912071 12472 1527 --
NM_000533chrX32014 1605 402 ------
NM_000555chrX57830 5547 2558 1335 77 27019 848 12943 17484
NM_000565chr132142 1642 853 11554 ----
NM_000590chr51130 ------
NM_000599chr254601 4310 3242 1238 827 ------
NM_000615chr1143024 2630 2415 2121 --1143 --
NM_000618chr1266122 5595 5281 5154 464 168 36399 2515 244 ----
NM_000618chr1266122 5595 5281 5154 464 168 36399 2515 244 ----
NM_000633chr1874637 4485 3404 994 481 349 291 --13856 --
NM_000635chr1931562 1343 148 ------
NM_000693chr1531592 1199 322 --1391 --
NM_000719chr12106330 6034 5897 4478 4194 4053 2644 1215 1020 80 --22536 350 --
NM_000723chr1741423 1384 562 247 11717 11307 --
NM_000724chr1031706 1526 111 ------
NM_000726chr231489 1093 1075 ------
NM_000735chr6122 ------
NM_000793chr1455126 4084 3855 3424 276 11969 33589 3290 1139 --
NM_000806chr5157 197 ----
NM_000809chr4108146 7838 6929 6207 3211 1792 1238 729 630 51 26469 1019 33303 2246 1575 --
NM_000811chr51281 ------
NM_000813chr585457 5294 5009 4623 1628 846 625 407 23782 979 15076 --
NM_000814chr1533580 3509 3024 11681 1405 --
NM_000816chr51632 164 1646 --
NM_000817chr2--2404 160 21020 181 --
NM_000827chr53856 286 195 ----1361
NM_000828chrX31540 572 367 --1691 --
NM_000829chr1142270 2171 423 369 ------
NM_000838chr632697 1690 329 --11795 --
NM_000841chr65826 744 376 368 91 --1793 --
NM_000844chr31897 1336 1801 --
NM_000859chr541634 1503 1112 92 ------
NM_000861chr362363 2343 2174 1927 1728 611 ------
NM_000868chrX2730 429 12571 21936 1631 --
NM_000872chr1041441 1319 1068 68 --1179 11028
NM_000875chr15125527 5299 4914 4879 4397 2407 2199 1959 1288 640 322 312 --14725 --
NM_000882chr3------1434
NM_000891chr1763612 3436 3401 2843 2655 917 13683 ----
NM_000899chr1274102 3296 3273 1767 1401 313 130 24402 1475 ----
NM_000901chr442534 2305 1958 908 ------
NM_000919chr51207 1571 ----
NM_000922chr112441 81 --1432 --
NM_000944chr432139 1725 94 --11601 --
NM_000950chrX63313 3126 2957 2366 2237 1004 3979 914 328 ----
NM_000965chr33475 392 356 --1951 --
NM_000983chr131580 1064 1043 ------
NM_001001132chr2121249 1155 ------
NM_001001323chr1221936 385 23184 1041 --11018
NM_001001395chr1222521 355 --1616 --
NM_001001396chr164050 3444 2816 1402 858 851 1638 ----
NM_001001483chr111372 ------
NM_001001484chr1032355 1819 417 ----11680
NM_001001549chr752842 2566 2513 1070 1058 1950 22881 750 --
NM_001001550chr752842 2566 2513 1070 1058 1950 22881 750 --
NM_001001555chr752842 2566 2513 1070 1058 1950 22881 750 --
NM_001001557chr831838 543 267 ----1352
NM_001001567chr211190 ------
NM_001001568chr211190 ------
NM_001001571chr211190 ------
NM_001001572chr211190 ------
NM_001001573chr211190 ------
NM_001001574chr211190 ------
NM_001001575chr211190 ------
NM_001001576chr211190 ------
NM_001001577chr211190 ------
NM_001001579chr211190 ------
NM_001001580chr211190 ------
NM_001001581chr211190 ------
NM_001001582chr211190 ------
NM_001001584chr211190 ------
NM_001001585chr211190 ------
NM_001001664chr273686 2950 2879 1417 1404 620 233 1405 33784 3583 1387 1929
NM_001001668chr1933959 3388 2922 23808 1028 14116 --
NM_001001669chr532249 2183 984 --1752 12494
NM_001001787chr13108 84 64 2437 97 ----
NM_001001791chr1041705 1544 1472 637 ------
NM_001001890chr2163179 2666 1440 867 261 236 13750 24046 2875 --
NM_001001924chr871868 1792 1647 1321 724 450 361 ----11672
NM_001001925chr871868 1792 1647 1321 724 450 361 ----11672
NM_001001928chr22107654 7082 6470 6451 5062 2602 2403 1640 1201 360 28289 866 21327 1167 12315
NM_001001931chr871868 1792 1647 1321 724 450 361 ----11672
NM_001001936chr1031121 992 259 1375 1390 --
NM_001001974chr1022296 2119 --1251 1653
NM_001002032chr17267 28 ------
NM_001002243chr22641 273 2727 691 1297 --
NM_001002257chr222258 874 152 ----
NM_001002258chr21617 11911 1304 --
NM_001002259chr12------139
NM_001002264chr13199 ------
NM_001002295chr103966 175 169 --11093 --
NM_001002814chr863754 3341 3004 2701 2577 1430 11328 ----
NM_001002838chrX21347 1302 1511 ----
NM_001002860chr1443958 3950 1238 212 34437 1424 123 14112 --
NM_001003406chr2263078 3059 2931 2695 605 416 ----12379
NM_001003652chr18178569 8489 8295 8050 6916 6292 5309 2884 2362 1707 1593 1580 1361 758 622 271 192 32397 875 249 58364 8150 7622 7339 473 --
NM_001003674chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_001003675chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_001003681chr223601 595 317 1419 1779 --
NM_001003682chr1----1330 --
NM_001003712chr1263799 928 785 338 248 61 31316 1304 794 --13550
NM_001003760chr653516 3308 2441 815 141 22259 1197 13172 --
NM_001003790chr8--1303 ----
NM_001003791chr8--1303 ----
NM_001003792chr31415 1782 ----
NM_001003793chr31415 1782 ----
NM_001003800chr953555 3283 2743 1397 407 --12679 --
NM_001003805chr14------1106
NM_001003810chr4------1324
NM_001003940chr1553817 3223 3054 335 244 12346 183 --
NM_001003942chr1553817 3223 3054 335 244 12346 183 --
NM_001003943chr1553821 3227 3058 339 248 12350 187 --
NM_001004317chr654223 3027 1652 316 21 34474 3869 3811 --13922
NM_001004329chr12122 --21496 153 --
NM_001004346chr421195 1003 ------
NM_001004360chr21303 1380 11699 --
NM_001004419chr1254250 3352 1505 519 269 1401 ----
NM_001005375chrY31851 1739 253 ------
NM_001005386chr2----1142 --
NM_001005404chr1754422 1758 1258 1122 29 21442 233 23008 666 --
NM_001005463chr1032225 946 839 ----11008
NM_001005473chr545928 5514 5479 2332 35372 2631 457 46600 4650 4356 4166 --
NM_001005474chr331543 538 487 --11171 --
NM_001005746chr231489 1093 1075 ------
NM_001005747chr231489 1093 1075 ------
NM_001005845chr831697 416 186 ------
NM_001005849chr172509 37 ------
NM_001005910chr32541 146 1225 1441 --
NM_001005911chr32541 146 1225 1441 --
NM_001006115chr352789 1875 1095 235 59 1665 --1754
NM_001006600chr531998 717 661 ------
NM_001006610chr162902 766 ------
NM_001006657chr282961 2736 2721 1061 887 866 597 496 11977 ----
NM_001006944chr111107 1180 ----
NM_001007023chr1455126 4084 3855 3424 276 11969 33589 3290 1139 --
NM_001007024chr1784359 3750 3639 3170 1575 1487 1445 88 23896 2672 ----
NM_001007025chr1784359 3750 3639 3170 1575 1487 1445 88 23896 2672 ----
NM_001007075chr42878 840 ------
NM_001007097chr944968 1307 1161 1104 1681 14339 --
NM_001007098chr15706 324 297 210 132 ------
NM_001007246chr2131348 1259 321 11881 ----
NM_001007267chr22267 173 ------
NM_001007466chr675129 4381 4066 3677 1263 360 299 11126 1686 --
NM_001007527chr51623 ----1501
NM_001007559chr1831616 1497 600 ------
NM_001008226chr1531778 1246 195 ------
NM_001008239chr1863231 3182 2910 2739 658 503 --1744 --
NM_001008392chr393440 2888 2877 1276 1122 1046 782 314 68 1482 ----
NM_001008407chr741825 1732 1553 1196 ------
NM_001008408chr793988 2565 2281 1678 637 465 298 127 114 --15306 --
NM_001008495chr81419 1726 1321 --
NM_001008539chr8115298 5118 5105 5011 4274 4205 3992 1196 1113 654 515 11119 ----
NM_001008540chr23365 195 120 ------
NM_001008564chr1322227 237 ------
NM_001008660chr1121600 238 --1371 --
NM_001008726chr1431540 1481 374 --11433 --
NM_001008738chr562884 2831 2179 2158 804 352 32819 2684 2509 ----
NM_001008925chr433436 2187 1045 11121 ----
NM_001009552chr81121 1211 ----
NM_001009566chr141388 1264 1061 282 --2938 527 --
NM_001009899chr366233 2403 2389 1767 621 105 16348 --16251
NM_001009993chr2124360 4107 3764 3554 3473 3438 3125 2862 1284 937 845 584 12829 23277 3182 --
NM_001009996chr31110 ------
NM_001010853chr632394 1170 454 --2815 506 --
NM_001010861chr151932 836 244 205 190 22021 547 ----
NM_001010867chr1116475 6102 6039 5673 2393 2312 1709 1650 541 412 314 --42238 1971 1961 1898 14949
NM_001010891chr5126611 6283 6242 5418 4258 2127 1679 1379 764 741 675 333 26721 1179 26109 4485 11233
NM_001010895chr931646 782 466 11523 ----
NM_001010897chr131390 ------
NM_001010934chr71277 ------
NM_001010986chrX32171 1666 530 --11543 --
NM_001010989chr161208 ------
NM_001010990chr161208 ------
NM_001011513chr412756 ------
NM_001011537chr331892 1841 207 ------
NM_001011546chr202534 108 --2694 673 --
NM_001011553chr72300 149 --1189 --
NM_001011645chrX154 ------
NM_001011658chrX12096 ------
NM_001011666chr7106091 6064 4880 4739 4330 2463 2134 1882 1179 154 36166 5126 1536 15067 --
NM_001011708chr242815 1172 1166 758 ------
NM_001011713chr144601 258 176 125 1536 ----
NM_001012393chr1184828 4507 4190 3585 3457 1810 885 239 --12062 1441
NM_001012398chr161712 ----1203
NM_001012420chr1552704 2122 2026 695 416 ------
NM_001012423chr1552704 2122 2026 695 416 ------
NM_001012514chr251120 912 259 250 33 ------
NM_001012516chr251120 912 259 250 33 ------
NM_001012751chr1051605 1302 1255 1215 706 177 --1551
NM_001012755chrX54362 3450 3340 1561 981 --1368 --
NM_001012761chr542563 2535 2285 126 --1191 --
NM_001012968chrX52419 2017 963 926 202 1423 159 --
NM_001012979chrX1165 ------
NM_001012989chrX2163 40 ------
NM_001013031chr1083364 3089 2498 2476 1062 851 840 752 12946 22619 1210 --
NM_001013399chr62921 68 --1839 --
NM_001013415chr441553 1089 372 105 ------
NM_001013437chr181115 ------
NM_001013620chr12107291 7040 6917 3351 2835 1692 1656 1156 1094 1028 12809 28011 1055 18325
NM_001013635chr1271086 934 915 878 431 284 37 ------
NM_001013703chr15--2428 384 ----
NM_001013843chr152920 343 ------
NM_001014443chr1----191 --
NM_001014797chr1098183 7348 7229 6510 6347 2838 2606 2349 1851 1949 28263 6247 --
NM_001015048chr1473182 2469 2265 2257 540 434 238 ------
NM_001015049chr1473182 2469 2265 2257 540 434 238 ------
NM_001015053chr174636 462 264 232 --21593 210 --
NM_001015877chrX42577 2409 569 147 12939 --12877
NM_001015880chr1061709 1499 1253 360 319 132 --1419 --
NM_001015881chrX2812 785 1136 --11087
NM_001015887chr351366 1179 316 216 22 --31480 1461 400 --
NM_001017368chr174304 233 160 52 ------
NM_001017395chr393617 3089 2746 2699 2683 1358 1248 1077 969 22994 2504 ----
NM_001017396chr23443 434 111 21948 66 ----
NM_001017440chr7137446 7381 6884 6752 6237 5204 3027 2887 2798 1611 1591 880 207 ------
NM_001017926chr821627 337 1509 ----
NM_001017930chrX31437 967 108 11467 ----
NM_001017963chr141906 --2896 344 1684
NM_001017969chr91223 1549 ----
NM_001017999chr171956 1860 913 894 682 581 38 ------
NM_001017999chr171956 1860 913 894 682 581 38 ------
NM_001018000chr171956 1860 913 894 682 581 38 ------
NM_001018000chr171956 1860 913 894 682 581 38 ------
NM_001018001chr171956 1860 913 894 682 581 38 ------
NM_001018004chr151447 ------
NM_001018006chr151447 ------
NM_001018007chr151447 ------
NM_001018009chr331032 394 155 11199 ----
NM_001018020chr151447 ------
NM_001018057chr112499 175 1299 1902 --
NM_001018065chr9115277 5058 5033 4719 2249 2042 1645 1404 618 601 335 22208 1108 15431 --
NM_001018066chr9115277 5058 5033 4719 2249 2042 1645 1404 618 601 335 22208 1108 15431 --
NM_001018067chr163828 3822 1693 1359 942 927 35350 1448 1032 ----
NM_001018068chr163828 3822 1693 1359 942 927 35350 1448 1032 ----
NM_001018069chr163828 3822 1693 1359 942 927 35350 1448 1032 ----
NM_001018074chr553850 3311 3017 994 75 --13766 --
NM_001018075chr553850 3311 3017 994 75 --13766 --
NM_001018076chr553850 3311 3017 994 75 --13766 --
NM_001018077chr553850 3311 3017 994 75 --13766 --
NM_001018090chr1572789 2722 2592 2217 556 358 148 --12484 12494
NM_001018091chr1572899 2832 2702 2327 666 468 258 --12594 12604
NM_001018100chr151725 1862 1749 --
NM_001018102chr1572789 2722 2592 2217 556 358 148 --12484 12494
NM_001018108chr1531539 805 724 11501 ----
NM_001018111chr783177 1371 972 695 644 600 418 116 23903 3090 11082 --
NM_001020818chr1931903 1610 45 --21459 541 --
NM_001020819chr1931903 1610 45 --21459 541 --
NM_001020820chr1931903 1610 45 --21459 541 --
NM_001020821chr1931903 1610 45 --21459 541 --
NM_001020825chr521325 492 --11241 --
NM_001023567chr1552091 1669 930 416 326 ------
NM_001024024chr1431059 191 94 2838 782 1802 --
NM_001024070chr1431055 187 90 2834 778 1798 --
NM_001024071chr1431027 159 62 2806 750 1770 --
NM_001024094chr553850 3311 3017 994 75 --13766 --
NM_001024372chr852067 921 798 741 729 21840 241 1150 21739 1725
NM_001024649chr532282 2193 845 --1678 --
NM_001024808chr1241146 1117 257 220 11799 11867 --
NM_001024847chr342456 1739 893 660 ------
NM_001024912chr193771 533 146 1491 ----
NM_001024948chr143232 3144 2434 1259 --23486 2632 --
NM_001024959chr32789 303 ------
NM_001024960chr32789 303 ------
NM_001025068chr311669 1158 ----
NM_001025069chr311669 1158 ----
NM_001025076chr10126172 5856 4836 4689 3835 2161 1984 1573 1032 832 424 139 24910 1817 15915 16053
NM_001025077chr10107530 7214 6194 6047 5193 2931 2390 2190 1782 1497 36268 5025 994 17273 17411
NM_001025079chr362523 1199 855 840 730 492 13150 ----
NM_001025108chr253805 3226 2556 1479 1237 --11229 11361
NM_001025252chr873128 3021 2775 1146 910 422 355 ------
NM_001025253chr873128 3021 2775 1146 910 422 355 ------
NM_001025366chr6----1466 --
NM_001025366chr6----1466 --
NM_001025367chr6----1466 --
NM_001025367chr6----1466 --
NM_001025368chr6----1466 --
NM_001025368chr6----1466 --
NM_001025369chr6----1482 --
NM_001025369chr6----1482 --
NM_001025370chr6----1466 --
NM_001025370chr6----1466 --
NM_001025580chrX53361 3098 2781 1509 317 --11518 12821
NM_001025596chr111387 ------
NM_001029860chr81314 ----137
NM_001029875chr572867 2233 2178 1166 841 715 453 21012 817 11006 --
NM_001030006chr1742630 2542 2515 245 --32687 2431 2049 --
NM_001030007chr1653996 3739 3285 3211 181 11504 --13250
NM_001030055chr14--44643 4428 4007 1725 13557 14776
NM_001030287chr13833 348 86 1816 1280 --
NM_001031679chr1213384 12984 ----
NM_001031695chr2251744 1293 960 617 170 ----24024 1551
NM_001031716chr22379 371 ------
NM_001031732chr453254 2900 2646 296 284 13675 --13649
NM_001031804chr1634312 469 263 22883 912 13620 --
NM_001031812chr531912 1438 53 21785 153 ----
NM_001031855chrX--1194 ----
NM_001032221chr981853 1714 1583 1348 707 644 420 146 --21439 450 --
NM_001032279chr111381 ------
NM_001032280chr681680 1593 1425 1403 1149 1108 675 582 ------
NM_001032296chr1332921 1941 1912 --22625 291 --
NM_001032999chr20104973 4849 4704 4563 4395 3798 1659 1339 1000 904 15352 1911 --
NM_001033044chr111267 ------
NM_001033045chr243986 3474 2959 1551 ------
NM_001033056chr111267 ------
NM_001033081chr141369 492 415 224 130 ----
NM_001033082chr141369 492 415 224 130 ----
NM_001033112chr52832 299 ------
NM_001033117chr354839 3297 1731 399 130 11275 14426 --
NM_001033506chr11------1325
NM_001033507chr121596 780 --2706 666 11213
NM_001033551chr1763140 3132 2572 1208 323 134 --21338 1195 --
NM_001033566chr171810 ----1854
NM_001033568chr171810 ----1854
NM_001033756chr6----1400 --
NM_001033756chr6----1400 --
NM_001033925chr10----1162 --
NM_001034841chr1675522 5276 4933 1823 1430 458 266 --1207 --
NM_001034853chrX21071 959 ------
NM_001034915chr831238 453 375 ------
NM_001034954chr1022502 1155 13157 ----
NM_001034955chr1022502 1155 13157 ----
NM_001034956chr1022502 1155 13157 ----
NM_001034957chr1022502 1155 13157 ----
NM_001035003chr421278 908 ------
NM_001035004chr421278 908 ------
NM_001035254chr9102401 2391 2384 2106 1828 1814 1776 1682 659 403 --1564 --
NM_001037132chr71463 ----1676
NM_001037133chr71463 ----1676
NM_001037163chr72937 303 2959 47 1348 --
NM_001037165chr7178879 8588 8336 8225 8212 7707 7664 6011 5540 3508 3130 2790 2237 1975 1829 1632 549 --11358 18523
NM_001037174chr231898 1768 581 --1612 --
NM_001037317chr151932 836 244 205 190 22021 547 ----
NM_001037334chr183790 623 386 ------
NM_001037339chr121843 428 ------
NM_001037340chr121843 428 ------
NM_001037341chr121843 428 ------
NM_001037341chr121843 428 ------
NM_001037872chr21636 ------
NM_001037954chr1142987 2498 1311 676 1655 12151 1248
NM_001038493chr231330 622 551 --11475 --
NM_001039465chr141200 --1470 --
NM_001039538chr252461 1351 862 721 685 ------
NM_001039547chr386188 2921 2912 2605 1051 865 825 814 24886 1194 ----
NM_001039570chr2253745 3527 1318 549 447 14124 34101 3481 3436 --
NM_001039571chr2253745 3527 1318 549 447 14124 34101 3481 3436 --
NM_001039574chr16962 682 661 299 281 180 ------
NM_001039577chr163829 1717 927 712 497 219 --14388 --
NM_001039585chr143962 3585 3492 112 21500 526 ----
NM_001039590chrX43712 1522 1479 71 21155 139 13234 --
NM_001039591chrX43712 1522 1479 71 21155 139 13234 --
NM_001039618chr1155844 5291 5040 1590 507 35126 4861 1131 11259 --
NM_001039690chr1621882 109 11637 1565 --
NM_001039709chr20104973 4849 4704 4563 4395 3798 1659 1339 1000 904 15352 1911 --
NM_001039772chr11161 ------
NM_001039802chr11951 1909 ----
NM_001039840chrX95542 4459 4148 1830 1432 498 306 176 93 --14322 --
NM_001039916chr1231065 1037 1010 1441 151 --
NM_001039917chr1231065 1037 1010 1441 151 --
NM_001039918chr1231065 1037 1010 1441 151 --
NM_001039919chr1231065 1037 1010 1441 151 --
NM_001039920chr1231065 1037 1010 1441 151 --
NM_001039937chr1342765 2702 1020 1007 13127 43580 3294 2734 2540 --
NM_001040001chr641374 1322 1270 537 --1331 --
NM_001040057chr711191 1999 11501 11145
NM_001040100chr3----180 --
NM_001040110chr761857 1617 1606 1360 1221 742 --11338 --
NM_001040142chr222239 683 --1916 --
NM_001040143chr222239 683 --1916 --
NM_001040144chr1621882 109 11637 1565 --
NM_001040146chr1621882 109 11637 1565 --
NM_001040152chr721887 1164 14211 ----
NM_001040153chr132691 378 ----1355
NM_001040158chr54537 415 235 223 1483 ----
NM_001040214chr631881 716 416 --12310 --
NM_001040272chr942271 1879 1618 700 --1402 --
NM_001040284chr1655606 3691 2210 1800 25 14140 24589 726 --
NM_001040402chr452979 2381 1241 780 177 11124 ----
NM_001040429chr1363122 2660 782 701 374 155 1943 ----
NM_001040439chr16--11485 ----
NM_001040450chr1531843 870 37 1341 --11000
NM_001040453chr1531843 870 37 1341 --11000
NM_001040619chr131283 536 158 11266 ----
NM_001040624chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040625chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040626chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040627chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040628chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040629chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040630chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_001040653chr342521 2408 1756 1077 --22298 837 --
NM_001040709chr162340 2279 2152 1948 827 546 --11987 --
NM_001040712chr92947 924 --23383 3357 --
NM_001042355chr1674927 4560 3435 1189 616 165 105 --1365 --
NM_001042388chr184988 658 652 271 --122 --
NM_001042404chr12598 122 ----1543
NM_001042406chr6--1999 ----
NM_001042412chr1674927 4560 3435 1189 616 165 105 --1365 --
NM_001042413chr974087 3716 3264 2692 890 237 132 12880 ----
NM_001042425chr681680 1593 1425 1403 1149 1108 675 582 ------
NM_001042473chr1062099 1776 1602 804 584 71 --11901 --
NM_001042481chr1442244 953 768 656 1792 ----
NM_001042492chr1773287 2746 2636 2439 1111 241 69 12965 --12826
NM_001042510chr821761 1404 22178 350 12002 --
NM_001042511chr821761 1404 22178 350 12002 --
NM_001042533chr373066 2865 2666 2496 1163 313 202 ----13015
NM_001042537chrX2672 473 --1255 --
NM_001042548chr23682 669 235 --1712 1770
NM_001042555chr12114285 4157 3522 1892 1293 1276 1112 950 895 587 422 44570 3776 3087 876 21781 1752 --
NM_001042599chr2107817 7425 7405 7314 6730 6437 5554 1972 1109 512 1555 26603 5762 --
NM_001042601chr361162 708 530 382 313 219 13287 1560 --
NM_001042603chr12115349 4159 4026 3706 3553 3268 2051 1822 1567 1430 758 11181 41685 1560 1540 203 --
NM_001042646chr341701 1493 1408 206 --51573 1549 1479 738 349 --
NM_001042681chr182438 1034 1021 973 937 921 820 164 --32614 2457 2361 --
NM_001042682chr182438 1034 1021 973 937 921 820 164 --32614 2457 2361 --
NM_001042682chr182438 1034 1021 973 937 921 820 164 --32614 2457 2361 --
NM_001042749chrX31864 1813 723 11831 ----
NM_001042750chrX31864 1813 723 11831 ----
NM_001042751chrX31864 1813 723 11831 ----
NM_001043318chr1454135 3390 3179 693 98 --23709 1047 --
NM_001043351chr132083 508 256 --1149 --
NM_001044385chr233704 835 447 11481 ----
NM_001044722chr531912 1438 53 21785 153 ----
NM_001044723chr531912 1438 53 21785 153 ----
NM_001049chr1411946 11520 ----
NM_001068chr3256 48 ------
NM_001079874chr132071 1664 266 1508 31318 715 654 --
NM_001094chr173790 636 325 ------
NM_001096chr173724 710 560 ----1718
NM_001100108chr1158326 8189 7688 7372 6971 6921 6696 5229 5082 2561 1747 1499 925 832 813 25237 597 28353 73 12536
NM_001106chr3188668 8309 8098 8057 7606 7567 7268 6607 3796 2853 2336 2174 2076 1901 1515 1053 588 314 1392 37185 3115 563 --
NM_001109977chr41625 --153 --
NM_001113490chrX43372 3052 2812 613 32755 1464 1066 ----
NM_001117chr1812262 ----192
NM_001121chr10--11653 11858 1775
NM_001122679chr53862 325 293 ------
NM_001128chr1653996 3739 3285 3211 181 11504 --13250
NM_001145chr142164 38 ------
NM_001146chr862286 2002 1993 1842 1590 520 ------
NM_001153chr2--2720 363 ----
NM_001160chr124498 437 282 222 22516 2386 ----
NM_001167chrX52464 1785 1499 852 33 11108 ----
NM_001173chr14--44643 4428 4007 1725 13557 14776
NM_001177chr121675 1198 12309 --
NM_001198chr652168 1481 613 463 252 ------
NM_001206chr962969 2055 2028 1198 859 596 ------
NM_001219chr711552 --22187 710 --
NM_001233chr732035 760 77 198 ----
NM_001241chr211857 21846 1487 ----
NM_001241chr211857 21846 1487 ----
NM_001254chr171929 ------
NM_001256chr171700 --22887 2855 --
NM_001257chr1611439 11172 --11306
NM_001259chr796400 5738 5246 5184 2386 1457 1296 604 123 24997 2000 11439 --
NM_001260chr131341 ------
NM_001270chr51744 ------
NM_001271chr1542859 2387 693 365 23174 2270 22143 562 --
NM_001282chr1742630 2542 2515 245 --32687 2431 2049 --
NM_001304chr1733371 2545 2464 11319 ----
NM_001331chr1142784 2081 1867 728 --22227 2049 --
NM_001349chr2--1388 ----
NM_001351chr331830 1712 158 ------
NM_001356chrX42138 1608 554 347 12096 11621 --
NM_001363chrX2530 180 2810 308 ----
NM_001364chr1164672 3878 3370 3306 2984 1329 13022 1345 --
NM_001385chr81171 ------
NM_001386chr872361 2188 2141 1635 815 606 336 ------
NM_001387chr583038 3026 2782 2513 1272 1095 929 600 ------
NM_001390chr1873616 3307 2735 2607 2412 1026 231 12705 21171 200 --
NM_001392chr182259 57 ------
NM_001396chr2162645 2525 1788 1097 446 286 ------
NM_001400chr121280 919 ------
NM_001402chr621717 306 --11491 11982
NM_001406chr1751328 1232 433 230 139 ------
NM_001412chrX63374 3323 3045 535 340 205 23571 46 ----
NM_001417chr1211916 1494 ----
NM_001418chr11--1174 ----
NM_001418chr11--1174 ----
NM_001419chr1954447 4279 1824 1119 110 --14314 --
NM_001422chr1121056 41 11007 21042 247 --
NM_001423chr122410 273 21970 1805 ----
NM_001427chr731602 1463 1380 ------
NM_001430chr241494 358 227 217 ------
NM_001432chr443795 3338 3163 1443 1980 12847 --
NM_001451chr161485 ------
NM_001465chr541575 583 491 29 1513 ----
NM_001497chr952743 2730 540 243 57 1588 ----
NM_001498chr61370 11268 ----
NM_001511chr41586 2560 242 ----
NM_001530chr142837 179 ------
NM_001543chr553635 3488 1641 395 312 33379 3295 1128 11167 --
NM_001546chr621486 1191 1555 ----
NM_001552chr1711091 --1218 --
NM_001560chrX42668 2401 2077 2069 12060 1334 --
NM_001564chr4136 ------
NM_001565chr43273 260 108 ------
NM_001567chr113729 492 267 ------
NM_001604chr112816 685 --2639 135 --
NM_001614chr172496 128 ------
NM_001614chr172496 128 ------
NM_001617chr231229 1219 1150 ------
NM_001621chr732816 1079 835 ------
NM_001621chr732816 1079 835 ------
NM_001649chrX102495 2172 2094 2072 1833 1774 778 745 509 88 11624 ----
NM_001650chr1893467 3165 1578 1519 1356 1328 1035 226 46 ------
NM_001660chr31643 --1660 --
NM_001663chr1421704 522 1129 12730 12266
NM_001668chr142279 2121 642 409 --12056 --
NM_001674chr13833 348 86 1816 1280 --
NM_001677chr12746 722 21075 735 1864 --
NM_001679chr34304 274 158 46 --1166 --
NM_001682chr1221010 99 22898 755 --1732
NM_001689chr21617 11911 1304 --
NM_001690chr332415 1615 646 31032 299 187 ----
NM_001695chr863770 3242 1451 1262 867 31 13743 1974 --
NM_001699chr1931302 1239 116 21543 725 --11190
NM_001709chr1162702 2570 2559 1761 1128 335 ------
NM_001711chrX31074 428 314 --1664 --
NM_001716chr1121597 250 --11361 1112
NM_001718chr611010 ------
NM_001744chr52466 54 --1188 --
NM_001745chr531086 385 66 ------
NM_001746chr532282 2193 845 --1678 --
NM_001754chr2163179 2666 1440 867 261 236 13750 24046 2875 --
NM_001755chr161878 12071 ----
NM_001759chr12125079 4965 4785 4767 4595 3865 3757 3412 1129 691 603 74 ------
NM_001769chr122344 166 ------
NM_001777chr362523 1199 855 840 730 492 13150 ----
NM_001781chr121941 --1126 1692
NM_001788chr72300 149 --1189 --
NM_001791chr11951 1909 ----
NM_001797chr162606 37 ------
NM_001806chr1942889 2363 936 279 ------
NM_001830chrX43004 1581 736 587 --12692 13756
NM_001839chr1186 ------
NM_001858chr685006 4920 4655 4332 4085 1538 1200 868 11016 ----
NM_001859chr963067 2476 1407 1084 298 260 ------
NM_001894chr22----138 --
NM_001895chr2031202 856 110 ------
NM_001902chr12379 283 ------
NM_001904chr32178 160 ------
NM_001907chr16175 ------
NM_001918chr1119278 9024 8255 6724 6579 6433 6030 5809 2981 2822 850 1150 --1830
NM_001933chr1431337 444 389 ------
NM_001935chr22355 177 ----1898
NM_001938chr11484 ------
NM_001939chrX33443 1468 837 ----1533
NM_001941chr1853747 3210 2668 1171 1098 1678 13809 --
NM_001946chr122387 34 --1330 --
NM_001949chr663196 2800 584 444 305 287 1804 ----
NM_001967chr3--1587 ----
NM_001968chr44964 259 174 160 ------
NM_001969chr143980 696 366 11115 --1620
NM_001977chr42706 138 1495 ----
NM_001980chr1231807 1729 664 12291 ----
NM_001981chr152341 2156 880 358 239 12041 ----
NM_001995chr441071 576 462 436 ------
NM_001999chr5--2965 127 ----
NM_002006chr421451 828 34638 1720 1705 ----
NM_002009chr1532781 2611 866 ------
NM_002015chr132447 81 --13299 --
NM_002017chr113396 131 99 ------
NM_002025chrX99151 8940 8329 8297 6727 6333 6248 888 794 39013 6222 6133 37874 7083 6984 --
NM_002033chr1164071 3018 985 819 631 601 13411 ----
NM_002037chr61360 ------
NM_002040chr2122938 1253 ------
NM_002051chr103966 175 169 --11093 --
NM_002054chr2--1426 ----
NM_002063chrX2255 70 --1936 --
NM_002065chr111267 ------
NM_002069chr74613 582 449 135 ------
NM_002074chr161433 1415 1408 513 439 263 --11097 --
NM_002076chr1233002 259 71 13292 12984 --
NM_002079chr103473 441 52 ----1639
NM_002080chr16140 ------
NM_002089chr42591 460 1565 ----
NM_002090chr42545 503 ------
NM_002095chr8182 --2255 52 --
NM_002103chr1961121 1062 813 719 445 30 ------
NM_002107chr11478 1444 ----
NM_002120chr62339 95 --1157 --
NM_002126chr1763724 3266 971 812 280 209 ------
NM_002128chr1351006 784 475 361 184 1812 32575 168 133 12115
NM_002129chr41392 1399 ----
NM_002133chr221137 1423 2484 409 --
NM_002135chr12--1205 ----
NM_002136chr122477 215 ------
NM_002137chr7--12280 21910 1604 11681
NM_002138chr4------1324
NM_002139chrX2467 151 --1445 --
NM_002140chr9----1148 1999
NM_002146chr1711386 ----11042
NM_002158chr233065 2878 236 33143 485 282 ----
NM_002163chr1631175 807 411 ------
NM_002190chr631075 836 344 ------
NM_002202chr521024 755 ------
NM_002203chr573865 3472 3085 2849 1333 394 376 12878 ----
NM_002210chr223172 418 13498 13552 --
NM_002214chr784559 2199 2163 2060 1892 1833 1589 1068 25498 1671 --1203
NM_002223chr1223431 1183 31454 723 352 142 --
NM_002230chr17----1177 --
NM_002233chr111454 ------
NM_002234chr127757 647 630 599 584 571 516 ------
NM_002252chr21161 1429 ----
NM_002253chr461203 992 901 391 195 72 --1202 --
NM_002264chr374239 4163 4088 3520 1861 1589 1355 --24921 4363 1782
NM_002265chr171336 ------
NM_002266chr171170 154 ----
NM_002267chr1352415 1944 1659 757 448 ------
NM_002268chr311901 ------
NM_002271chr133929 391 364 12370 1882 --
NM_002285chr253805 3226 2556 1479 1237 --11229 11361
NM_002294chrX1164 --1393 1356
NM_002296chr141304 1288 1249 700 11138 ----
NM_002310chr585951 4109 4029 1813 1447 1431 341 148 --24093 1805 --
NM_002334chr1141319 682 587 102 11967 ----
NM_002336chr1254421 1789 1263 1181 970 14848 ----
NM_002351chrX51634 1069 427 419 385 --1567 --
NM_002356chr632514 498 121 11752 ----
NM_002359chr17173923 3807 3762 3734 3709 3609 3589 3042 2887 2861 2778 1444 1259 1245 816 381 356 --13627 --
NM_002370chr1195 ------
NM_002374chr252461 1351 862 721 685 ------
NM_002381chr23968 780 227 ------
NM_002382chr1431291 1170 1072 --1325 --
NM_002395chr631524 1036 516 11437 ----
NM_002402chr7--11111 ----
NM_002416chr43509 212 206 143 ----
NM_002430chr2232103 982 773 ----12092
NM_002444chrX31661 1258 389 32006 1825 328 ----
NM_002486chr9--2609 57 1501 --
NM_002487chr151740 ------
NM_002499chr1532339 911 269 --42286 2276 454 324 1394
NM_002501chr1943453 1528 1270 730 --1748 14016
NM_002508chr131951 1701 1631 1621 184 1292
NM_002515chr1441626 605 424 209 ------
NM_002519chr1141386 1217 1032 321 ------
NM_002522chr1793297 2854 2835 1312 550 494 326 312 150 --23355 3218 --
NM_002531chr2072252 2208 2083 2048 322 178 23 ------
NM_002539chr2195 ------
NM_002545chr1184828 4507 4190 3585 3457 1810 885 239 --12062 1441
NM_002547chrX74054 3990 3467 3227 1065 975 207 1173 14265 --
NM_002552chr231134 328 137 --1148 --
NM_002556chr1151560 852 670 546 517 1595 ----
NM_002577chr394052 3948 3936 3791 3502 3142 3083 963 790 ------
NM_002581chr955552 5206 4755 4108 1337 14620 --1308
NM_002586chr631181 600 312 --11018 --
NM_002594chr2031617 926 54 22104 222 ----
NM_002600chr121843 428 ------
NM_002606chr211190 ------
NM_002607chr751285 1038 504 148 127 ------
NM_002613chr1674368 4195 3721 3521 1986 1511 1352 ----13481
NM_002628chr34931 860 850 33 1266 1345 --
NM_002645chr1152608 2213 2117 1064 566 11077 12181 --
NM_002646chr121736 795 1390 ----
NM_002655chr874070 3911 3895 3286 2088 211 183 14894 24297 3847 --
NM_002656chr62185 177 11061 1219 --
NM_002657chr2063502 2506 2459 1255 127 70 13150 22529 2489 --
NM_002668chrX1146 ------
NM_002670chr311505 --11612 --
NM_002687chr141403 1839 1833 --
NM_002697chr11233 ------
NM_002702chr124795 742 410 329 ----126
NM_002707chr2170 ------
NM_002711chr71716 ------
NM_002713chr12844 186 ------
NM_002715chr521184 467 ------
NM_002716chr1183695 3267 3109 3018 2415 2380 853 402 --23397 64 12488
NM_002719chr1431556 610 314 12435 32323 1564 220 --
NM_002731chr152784 2652 1274 726 250 22790 520 12748 11992
NM_002734chr171889 22273 2101 ----
NM_002745chr2274020 3914 2834 1708 1545 1471 1139 --21291 53 --
NM_002747chr1851798 1493 693 586 505 ------
NM_002748chr152848 52 ------
NM_002750chr10----151 --
NM_002753chr41588 1776 1635 --
NM_002768chr1661149 1118 553 501 167 59 --1195 --
NM_002788chr14--1106 ----
NM_002809chr171316 ------
NM_002814chrX--1212 --154
NM_002837chr1234461 586 270 44467 2859 488 283 ----
NM_002839chr92947 924 --23383 3357 --
NM_002841chr3--1154 ----
NM_002843chr1152960 1033 1027 659 111 1984 1421 --
NM_002847chr7----182 --
NM_002849chr1231034 957 412 ------
NM_002858chr13927 399 235 2961 405 ----
NM_002859chr1251270 435 429 170 119 1621 ----
NM_002865chr81257 ------
NM_002869chr1132186 2065 1979 --1188 --
NM_002874chr932464 880 743 --12096 --
NM_002886chr394665 4637 3360 2057 1611 1345 1037 743 183 --1119 13861
NM_002892chr1421660 1101 ------
NM_002897chr22556 535 --2486 26 1583
NM_002906chr1141721 828 226 26 11553 ----
NM_002912chr61628 ------
NM_002924chr12481 229 ------
NM_002938chr461910 1770 1469 748 679 375 ------
NM_002941chr331666 1467 314 11029 ----
NM_002968chr16--1968 ----
NM_002971chr331175 247 71 --11017 1809
NM_002994chr431963 1935 1658 21434 1360 1332 --
NM_002998chr842033 862 478 296 --1202 --
NM_002999chr2041739 166 156 139 --21351 742 --
NM_003009chr192262 111 ------
NM_003010chr1742173 1855 1681 124 --1696 --
NM_003011chr931287 419 121 ------
NM_003012chr833138 641 136 ------
NM_003016chr171398 --1578 --
NM_003031chr162902 766 ------
NM_003034chr1278036 6070 5142 3073 2848 1621 855 31640 1379 420 17568 --
NM_003035chr1142 1951 ----
NM_003042chr331774 1697 361 12147 ----
NM_003045chr1364411 3823 550 480 378 249 34768 1885 1164 1818 --
NM_003046chr8115298 5118 5105 5011 4274 4205 3992 1196 1113 654 515 11119 ----
NM_003051chr1--1624 11586 --
NM_003054chr10--182 ----
NM_003059chr51248 ------
NM_003060chr581198 1184 1124 1067 809 125 111 44 --1941 --
NM_003068chr8--1701 ----
NM_003070chr91786 ------
NM_003071chr321900 693 11970 ----
NM_003074chr382114 1752 1687 1403 323 262 127 69 1362 ----
NM_003079chr171677 ----125
NM_003081chr204455 347 175 130 --1168 --
NM_003088chr7----11078 --
NM_003099chr15135686 5595 4909 4073 2429 2215 2179 2123 1150 1072 730 577 56 --15393 --
NM_003108chr296614 2856 2256 2129 1736 1099 673 291 257 16343 21998 1799 --
NM_003112chr742640 2609 2235 898 1799 12667 --
NM_003113chr22615 180 --1164 --
NM_003118chr53755 383 91 1265 1345 --
NM_003137chr65745 546 512 504 467 ----1720
NM_003139chr112878 94 ------
NM_003144chr632276 2103 395 ------
NM_003150chr1742345 2273 355 293 --1231 --
NM_003155chr812156 2701 414 --1522
NM_003156chr112526 36 1265 150 --
NM_003161chr1753546 2873 1259 950 915 1857 ----
NM_003179chrX1116 ------
NM_003182chr71490 ------
NM_003182chr71490 ------
NM_003185chr2021229 1211 ------
NM_003189chr122287 331 22634 1012 12346 --
NM_003199chr1855662 5654 4442 3513 1846 15401 ----
NM_003201chr1021039 23 1707 1398 --
NM_003202chr541832 1162 491 419 ------
NM_003204chr1721553 1282 ------
NM_003215chr421084 625 ------
NM_003220chr681680 1593 1425 1403 1149 1108 675 582 ------
NM_003221chr644129 3301 2772 209 12722 ----
NM_003236chr253156 2745 960 325 300 23140 610 ----
NM_003242chr342456 1739 893 660 ------
NM_003244chr181141 ------
NM_003257chr153976 902 346 ------
NM_003275chr911415 1425 --143
NM_003298chr366098 6064 5742 4197 1571 496 35717 4652 3863 15484 --
NM_003300chr14166 ------
NM_003304chr331404 1155 567 ------
NM_003305chr41354 1339 ----
NM_003309chr651787 1747 1512 476 213 11631 ----
NM_003320chr1174373 2820 2800 1460 809 734 696 ------
NM_003326chr172632 2442 2190 2168 2016 1842 951 ------
NM_003338chr101539 21750 550 11950 --
NM_003340chr41295 ------
NM_003344chr721077 536 --21504 675 --
NM_003347chr2232063 1838 1737 21655 204 ----
NM_003348chr1231413 163 40 ------
NM_003350chr8158 126 1739 --
NM_003376chr6----1466 --
NM_003376chr6----1466 --
NM_003379chr62737 383 --171 --
NM_003390chr1151097 799 788 424 201 --1307 --
NM_003404chr2021999 1359 --1589 --
NM_003406chr861577 1501 1331 1278 537 357 11920 ----
NM_003409chr1851306 290 215 204 173 --11361 --
NM_003410chrX42869 1998 1185 503 --1176 --
NM_003412chr332297 2117 721 1561 ----
NM_003413chrX31987 443 311 11226 ----
NM_003439chr732825 800 666 13063 1152 --
NM_003458chr363997 3960 3798 3048 1589 261 --1357 --
NM_003463chr653097 1214 808 685 676 --11357 12428
NM_003467chr23365 195 120 ------
NM_003468chr243697 1246 636 517 --2727 417 --
NM_003470chr1621822 1789 --11811 --
NM_003472chr641504 1228 1086 464 11245 ----
NM_003474chr1052033 1942 1647 1464 788 ------
NM_003478chr1113042 23069 2103 ----
NM_003483chr1232900 2815 2657 --22795 1035 --
NM_003489chr2132393 1236 592 23027 2812 --11343
NM_003496chr71688 1832 1316 --
NM_003507chr221321 1263 ------
NM_003557chr121389 1146 21290 1134 ----
NM_003558chr92724 614 ------
NM_003566chr1231200 850 742 ----22997 565
NM_003574chr1885094 3939 3813 1985 1675 939 629 278 32074 1933 1232 34992 3491 2049 --
NM_003576chr1332921 1941 1912 --22625 291 --
NM_003583chr1262826 2711 2662 847 668 440 33946 3804 2926 --1224
NM_003590chr243821 3565 1148 688 1120 ----
NM_003591chr10158 --1306 --
NM_003603chr42386 328 --1492 --
NM_003615chr353717 3422 3343 815 130 1838 ----
NM_003618chr221204 101 ----1328
NM_003620chr1721068 394 ------
NM_003622chr1222196 365 1483 ----
NM_003626chr1131273 1221 296 ------
NM_003629chr1103388 3371 3320 3258 3248 2578 2548 2177 812 358 --32984 2939 2124 --
NM_003633chr552404 2077 717 605 263 ----11901
NM_003648chr232602 989 832 --22347 391 12157
NM_003663chr362865 2545 2221 1108 783 480 ------
NM_003671chr973390 3088 2979 2715 744 553 313 ------
NM_003677chr1251977 1893 1497 303 279 ------
NM_003685chr195836 642 193 187 59 ------
NM_003692chr93845 243 53 ------
NM_003704chr42669 445 ------
NM_003705chr2------1251
NM_003713chr131505 1096 242 1250 11198 --
NM_003749chr1332311 1960 534 11561 1325 --
NM_003750chr10------133
NM_003758chr1511273 1457 ----
NM_003758chr1511273 1457 ----
NM_003759chr473368 2980 1189 538 426 354 154 21244 1131 1374 --
NM_003762chr11188 --11233 --
NM_003769chr121261 ----193
NM_003797chr111169 ------
NM_003798chr91181 ------
NM_003799chr1873380 1796 991 471 334 323 212 1240 21162 35 --
NM_003816chr831311 545 30 ------
NM_003822chr152618 703 680 609 554 --11139 1617
NM_003831chr1821547 292 ------
NM_003850chr13178 --165 --
NM_003861chr1442459 1887 317 130 --21085 444 --
NM_003872chr262793 2250 1021 887 818 536 --31984 466 240 --
NM_003873chr1052089 1012 939 742 176 ------
NM_003884chr321668 1512 ------
NM_003885chr1751894 1721 947 552 85 --12014 12216
NM_003888chr1531638 371 322 ------
NM_003899chr1342183 1918 834 411 12552 ----
NM_003901chr1062682 2573 1974 1679 328 154 1825 11884 --
NM_003908chr2041160 1060 540 312 --1864 --
NM_003913chr684200 4048 3715 2956 1321 1248 1029 323 23089 1209 --1184
NM_003916chrX21124 98 11214 ----
NM_003924chr441125 377 357 339 --31429 1333 1317 --
NM_003932chr2221309 468 --11777 --
NM_003934chr91113 --21258 332 --
NM_003939chr1064023 3681 2945 2655 476 237 --1733 --
NM_003941chr721909 946 195 ----
NM_003942chr111107 1180 ----
NM_003947chr321336 1265 --11186 11369
NM_003949chr17111907 1866 1826 1783 1739 1690 1681 1373 1313 1289 750 ------
NM_003951chrX------167
NM_003953chr132692 822 246 --11817 --
NM_003958chr673497 3150 2990 2894 2633 1552 400 --12491 13262
NM_003966chr586361 5851 2688 2668 2536 2463 245 134 --21554 710 --
NM_003968chr31106 ------
NM_003994chr1274102 3296 3273 1767 1401 313 130 24402 1475 ----
NM_004006chrX22123 1960 --12415 --
NM_004007chrX22123 1960 --12415 --
NM_004009chrX22123 1960 --12415 --
NM_004010chrX22123 1960 --12415 --
NM_004011chrX22123 1960 --12415 --
NM_004012chrX22123 1960 --12415 --
NM_004013chrX22123 1960 --12415 --
NM_004014chrX22123 1960 --12415 --
NM_004015chrX22123 1960 --12415 --
NM_004016chrX22037 1874 --12329 --
NM_004017chrX22123 1960 --12415 --
NM_004018chrX22037 1874 --12329 --
NM_004020chrX22123 1960 --12415 --
NM_004021chrX22037 1874 --12329 --
NM_004022chrX22037 1874 --12329 --
NM_004023chrX22037 1874 --12329 --
NM_004024chr131192 445 158 11175 ----
NM_004028chr1893467 3165 1578 1519 1356 1328 1035 226 46 ------
NM_004067chr741250 621 579 150 ------
NM_004081chrY31851 1739 253 ------
NM_004087chr321300 152 --11713 1685
NM_004089chrX2812 785 1136 --11087
NM_004090chr1782838 1162 882 551 241 218 132 59 13475 ----
NM_004093chr1323261 2610 --12591 --
NM_004094chr1433067 1072 964 1135 ----
NM_004096chr1052137 1970 1690 673 666 11489 11788 --
NM_004098chr1011189 ------
NM_004100chr632688 2401 1654 199 ----
NM_004114chrX41188 1149 877 366 1905 ----
NM_004119chr13------1666
NM_004124chr1442520 2169 1381 757 ------
NM_004126chr71293 ------
NM_004130chr32553 545 --2644 202 --
NM_004156chr81121 1211 ----
NM_004163chr182161 108 ------
NM_004171chr1188898 8573 8333 7742 2774 2506 2329 1003 1532 48386 7812 416 182 --
NM_004181chr44323 239 117 109 ------
NM_004200chr1153288 3061 2875 1195 561 ------
NM_004227chr733135 3010 2663 --22737 1195 --
NM_004229chrX62113 1691 1468 745 469 240 11538 ----
NM_004232chr181406 --1170 --
NM_004235chr92578 70 ------
NM_004272chr531672 447 354 --1646 --
NM_004274chr1453137 2946 2320 1037 257 22952 2607 ----
NM_004277chr621148 36 11334 11632 --
NM_004279chr771986 877 865 796 708 334 177 --22359 2348 --
NM_004293chr943437 284 126 100 22652 1177 ----
NM_004302chr1241986 1103 817 633 ------
NM_004319chr132478 544 176 13052 ----
NM_004321chr272371 1267 1258 1224 854 478 64 23508 383 22484 656 --
NM_004329chr1061442 1314 527 501 294 123 1946 1508 --
NM_004331chr821814 725 11757 ----
NM_004338chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_004342chr742302 2175 1853 513 11501 11487 --
NM_004354chr4--1601 ----
NM_004370chr64831 674 565 546 1377 1590 --
NM_004379chr241241 696 616 593 ------
NM_004380chr1652551 2250 950 616 36 --12207 --
NM_004384chr531912 1438 53 21785 153 ----
NM_004386chr1962157 2123 1893 1820 250 208 --12247 --
NM_004392chr133925 423 127 12375 ----
NM_004397chr1143797 3405 957 568 13560 ----
NM_004412chr10105898 5887 4186 4123 1773 1358 841 716 315 118 14360 ----
NM_004414chr214499 298 261 156 1166 ----
NM_004415chr61163 --1653 --
NM_004428chr14757 716 609 70 ------
NM_004430chr812254 --11041 --
NM_004432chr9186 --1384 --
NM_004438chr232747 1061 413 1731 --12413
NM_004440chr621600 99 1290 11337 --
NM_004447chr122729 399 ------
NM_004457chr23521 318 179 --1604 --
NM_004458chrX22641 377 ------
NM_004459chr1721788 545 11465 11347 --
NM_004469chrX1182 ------
NM_004475chr176858 458 267 233 152 132 --1251 --
NM_004481chr152694 2479 2452 2176 1903 --31727 1701 526 --
NM_004483chr16--157 ----
NM_004484chrX1300 ------
NM_004500chr1431896 132 117 11558 ----
NM_004501chr153666 3318 2849 1359 729 12822 1328 --
NM_004504chr22996 76 --1647 --
NM_004514chr1782878 2633 2623 1020 804 597 268 216 --1434 --
NM_004516chr1931211 84 73 1385 ----
NM_004521chr10------1291
NM_004525chr21384 --1147 --
NM_004529chr931337 1301 82 ------
NM_004537chr12--1186 ----
NM_004538chrX3803 295 173 ----1750
NM_004540chr211903 1716 1832 --
NM_004566chr1032229 1809 164 --32467 881 54 --
NM_004569chr14131 --1490 --
NM_004571chr2163414 3261 3180 2840 2109 709 --22973 1284 --
NM_004575chr441578 1459 625 380 ------
NM_004580chr1521622 512 --11225 --
NM_004586chrX23894 1918 11151 24294 1381 --
NM_004588chr1133855 3644 31 24038 3624 12639 --
NM_004598chr552969 1123 1103 622 410 --1430 --
NM_004612chr954529 4498 1484 1276 591 41788 470 374 77 23402 664 --
NM_004630chr111248 --1239 --
NM_004643chr14----1566 --
NM_004645chr17136 ------
NM_004655chr172459 57 11301 ----
NM_004660chrY32063 1552 345 12021 11565 --
NM_004670chr1061709 1499 1253 360 319 132 --1419 --
NM_004673chr1----11101 --
NM_004687chr1761987 1824 1693 1548 536 482 1441 ----
NM_004689chr141449 --1313 --
NM_004703chr1752562 2153 2119 1708 1032 --22546 1797 --
NM_004705chr112730 186 ------
NM_004713chr14----1722 --
NM_004724chr11128 ------
NM_004726chrX75521 5328 4483 4000 2137 1792 1084 14893 --15632
NM_004730chr531697 1466 752 11588 12001 --
NM_004742chr341649 1373 1254 102 --2716 380 2477 61
NM_004744chr452785 2659 989 881 848 --21575 113 --
NM_004745chr8105932 5127 4902 4761 1954 1663 1329 1232 793 722 25564 1119 26665 288 --
NM_004748chr1573724 3676 3379 2995 1271 1062 651 --1681 --
NM_004759chr152169 2121 1836 1712 441 ------
NM_004772chr541296 1263 1158 278 1629 ----
NM_004774chr1742496 2158 2041 540 ----22576 2460
NM_004776chr2072983 2955 2772 2728 2130 1197 112 1299 21045 492 --
NM_004779chr5----2972 459 --
NM_004796chr1462447 2165 2003 1692 741 715 --11813 --
NM_004798chr2062743 2494 1403 1393 498 358 --11381 --
NM_004800chr131229 --1174 --
NM_004801chr22454 257 ------
NM_004815chr144239 4033 3462 1715 34207 3635 933 14886 --
NM_004817chr91602 --1133 --
NM_004834chr262684 2347 1245 975 356 346 ------
NM_004836chr22219 97 1386 --1767
NM_004841chr12836 150 --1794 --
NM_004842chr641494 1440 1293 150 1481 ----
NM_004844chr331032 394 155 11199 ----
NM_004859chr1722473 852 --22482 97 --
NM_004863chr1444614 1971 1792 1436 11154 --13938
NM_004866chr544005 1724 1092 902 23950 159 14887 --
NM_004871chr1784359 3750 3639 3170 1575 1487 1445 88 23896 2672 ----
NM_004873chr1473182 2469 2265 2257 540 434 238 ------
NM_004883chr5--1169 ----
NM_004893chr54537 415 235 223 1483 ----
NM_004897chr101118 ------
NM_004898chr462835 2607 2412 2270 1993 1955 12524 1719 1124
NM_004902chr202218 210 --1582 1593
NM_004904chr7106091 6064 4880 4739 4330 2463 2134 1882 1179 154 36166 5126 1536 15067 --
NM_004926chr141657 --11310 --
NM_004932chr53517 306 277 21513 97 ----
NM_004936chr942060 2030 1184 1143 2960 189 ----
NM_004973chr621392 91 ------
NM_004974chr1------183
NM_004978chr161625 1345 1324 1300 1103 577 ------
NM_004982chr12----2628 97 --
NM_004985chr1234167 1057 259 23599 494 11541 --
NM_004992chrX138359 8055 7058 7004 6612 6504 6309 5315 3260 2448 2205 1376 931 15192 ----
NM_004992chrX138359 8055 7058 7004 6612 6504 6309 5315 3260 2448 2205 1376 931 15192 ----
NM_004993chr1431343 1046 373 --11014 --
NM_004999chr631460 1369 311 11393 2946 906 1548
NM_005006chr22939 692 ------
NM_005010chr71463 ----1676
NM_005011chr761857 1617 1606 1360 1221 742 --11338 --
NM_005012chr1------1144
NM_005020chr71584 --140 --
NM_005036chr22107654 7082 6470 6451 5062 2602 2403 1640 1201 360 28289 866 21327 1167 12315
NM_005044chrX54156 3406 282 267 91 --13959 13882
NM_005045chr72219 204 --1756 --
NM_005054chr221409 1212 ------
NM_005056chr12105593 4403 4270 3950 3797 3512 2066 1811 1674 1002 11425 41929 1804 1784 447 --
NM_005067chr34649 215 138 88 ------
NM_005069chr2151712 1426 628 516 221 ------
NM_005076chr143379 3345 832 320 --43140 2912 2683 1033 --
NM_005079chr873128 3021 2775 1146 910 422 355 ------
NM_005080chr223694 369 297 ------
NM_005093chr20104973 4849 4704 4563 4395 3798 1659 1339 1000 904 15352 1911 --
NM_005095chr132180 637 198 --1769 --
NM_005102chr23682 669 235 --1712 1770
NM_005104chr62656 553 1724 ----
NM_005116chr2074286 4147 2845 1730 1663 226 176 ------
NM_005119chr131007 826 410 1346 ----
NM_005121chr171391 1477 ----
NM_005133chr111381 ------
NM_005134chr184988 658 652 271 --122 --
NM_005151chr183790 623 386 ------
NM_005156chr975106 3910 3803 3587 3576 1716 674 ------
NM_005157chr951953 1242 713 354 223 11208 ----
NM_005168chr231784 1487 1225 11472 ----
NM_005180chr1021494 1363 ------
NM_005184chr1921567 243 ------
NM_005188chr11167793 7611 7352 7292 6895 6256 6051 5773 5515 5435 2780 1710 1681 712 611 378 26993 1788 107000 6760 5927 1915 1424 1175 980 649 399 225 17526
NM_005190chr62921 68 --1839 --
NM_005197chr1476193 5985 5691 5183 4852 4040 754 --44899 4798 1732 902 --
NM_005207chr2273144 2811 1430 1019 598 336 36 31492 466 46 --1885
NM_005222chr71958 ------
NM_005227chr11455 ------
NM_005233chr332507 2162 1655 1615 ----
NM_005235chr2107817 7425 7405 7314 6730 6437 5554 1972 1109 512 1555 26603 5762 --
NM_005238chr1121372 298 11175 1334 --
NM_005245chr44706 489 164 69 1591 ----
NM_005249chr14--1818 ----
NM_005261chr81255 11028 1353 --
NM_005264chr102665 66 ------
NM_005277chr421759 648 --11327 11729
NM_005308chr102527 443 ------
NM_005311chr752842 2566 2513 1070 1058 1950 22881 750 --
NM_005316chr1131119 1049 980 ------
NM_005318chr2241262 1159 348 111 --1893 1839
NM_005336chr262167 1885 1827 893 802 749 11985 ----
NM_005339chr484223 4020 3651 3547 1703 741 595 571 ------
NM_005342chrX102777 2764 2142 2041 2031 1995 1039 565 189 82 --32616 1926 264 --
NM_005348chr141906 --2896 344 1684
NM_005359chr1895433 5359 4983 4810 2484 1820 903 602 95 --15125 --
NM_005374chr1752260 1543 1478 879 114 --21802 711 --
NM_005385chr32871 691 22520 82 ----
NM_005387chr112234 155 ------
NM_005392chr941724 1569 1274 592 ------
NM_005397chr783177 1371 972 695 644 600 418 116 23903 3090 11082 --
NM_005399chr184343 4188 3477 1612 1581 1314 953 893 --23363 2723 --
NM_005400chr262749 2560 2243 2008 1906 457 --22759 640 --
NM_005402chr731562 1458 380 --2682 647 11801
NM_005407chr14193 --21576 1336 --
NM_005410chr51236 1639 --1260
NM_005429chr41121 ------
NM_005433chr1832440 1844 906 ----12518
NM_005436chr1023648 2672 34076 3261 770 23611 886 --
NM_005455chr12653 312 11526 --1178
NM_005458chr942284 2159 803 796 12193 ----
NM_005465chr1--31905 715 250 ----
NM_005471chr571244 1013 898 835 277 132 63 11105 ----
NM_005474chr174636 462 264 232 --21593 210 --
NM_005475chr1242022 776 470 337 11160 11154 --
NM_005476chr961406 1184 1165 963 206 63 ------
NM_005479chr1021455 1380 --1516 --
NM_005487chr223601 595 317 1419 1779 --
NM_005493chr6------1758
NM_005494chr71210 ------
NM_005497chr1756076 2270 797 201 186 26043 1335 1240 --
NM_005502chr952542 908 691 656 206 1731 ----
NM_005503chr154774 284 258 183 --1317 --
NM_005506chr43230 219 41 12672 ----
NM_005529chr111039 ----11011
NM_005537chr1321117 953 1895 ----
NM_005542chr711467 --11924 --
NM_005544chr211015 ------
NM_005566chr112418 74 ------
NM_005575chr5--1310 1177 --
NM_005578chr394589 4542 4374 3308 2060 2045 1933 1244 101 ------
NM_005596chr976050 5834 5091 4577 4344 2152 387 14881 24475 809 --
NM_005599chr141464 1360 1085 152 ------
NM_005604chr682249 2163 1873 904 690 490 258 100 ------
NM_005607chr83879 667 46 --186 --
NM_005611chr162988 196 1435 21259 166 --
NM_005637chr1831616 1497 600 ------
NM_005638chrX41402 1375 606 415 1167 ----
NM_005639chr1221849 1275 1375 ----
NM_005647chrX43301 3130 2242 620 --23466 2166 --
NM_005659chr22----1361 1455
NM_005665chr153716 3336 1896 811 425 11448 ----
NM_005668chr543530 3306 1607 532 --12844 --
NM_005677chr331321 1040 78 1192 11269 --
NM_005682chr1621344 1319 ------
NM_005715chr632337 2039 2014 12601 1978 --
NM_005717chr13932 325 163 --1941 --
NM_005718chr32789 303 ------
NM_005722chr2----1142 --
NM_005730chr1293602 3279 2782 2740 2420 2277 1289 1098 916 --21205 1081 13164
NM_005734chr111186 1511 ----
NM_005736chr1011356 ------
NM_005740chr223910 833 120 ------
NM_005742chr22621 297 ------
NM_005746chr712608 --12080 --
NM_005749chr17------1694
NM_005754chr531124 922 337 ------
NM_005756chrX11457 11218 11165 --
NM_005759chr254534 3661 3074 3043 387 13974 ----
NM_005761chr121125 ------
NM_005766chr1331120 1000 224 ------
NM_005767chr132306 261 --164 --
NM_005778chr31390 ------
NM_005779chr52522 439 ------
NM_005789chr1742077 1865 1417 1335 1752 21775 324 --
NM_005795chr2--21998 767 ----
NM_005808chr393440 2888 2877 1276 1122 1046 782 314 68 1482 ----
NM_005813chr262308 1926 815 778 301 69 1663 --11684
NM_005822chr63803 369 273 1552 11767 --
NM_005826chr11597 1409 ----
NM_005828chr1794453 1810 1644 1599 1367 439 351 331 102 1550 44699 1392 1082 977 --
NM_005832chr31169 1150 1344 --
NM_005839chr12795 169 --1877 --
NM_005840chrX107088 6842 6250 5606 4888 3025 2793 1075 517 175 --27390 5894 25669 5102
NM_005851chr112115 109 --2393 361 --
NM_005853chr16--1188 ----
NM_005857chr121302 47 ------
NM_005862chr31802 ----1232
NM_005863chr1021001 133 ------
NM_005875chr32404 44 ------
NM_005880chr162371 57 ----181
NM_005885chr551643 632 520 165 42 1419 21533 126 --
NM_005896chr22629 33 1290 ----
NM_005898chr1153088 2182 1162 206 90 22419 212 ----
NM_005901chr18178569 8489 8295 8050 6916 6292 5309 2884 2362 1707 1593 1580 1361 758 622 271 192 32397 875 249 58364 8150 7622 7339 473 --
NM_005909chr544099 3434 2910 2843 34146 1300 315 ----
NM_005911chr24543 454 365 98 ----11243
NM_005920chr143489 3048 1455 543 --22896 121 --
NM_005924chr7--1918 ----
NM_005935chr485215 4681 4190 4155 3935 3208 2014 1779 12132 23388 1236 --
NM_005937chr17104159 3801 3780 3305 3232 3011 2913 2862 1406 806 13252 13377 --
NM_005941chr863833 3703 741 729 226 211 11585 ----
NM_005955chr165079 4090 3520 1628 1513 750 24169 837 34988 1000 430 --
NM_005964chr1721365 413 ----1121
NM_005966chr2------11920
NM_005990chr542749 1938 1027 541 --1316 --
NM_006007chr923188 98 23181 129 11062 --
NM_006009chr121208 ------
NM_006011chr1574221 4210 3684 3582 830 688 197 ------
NM_006016chr652181 2169 705 316 183 1229 ----
NM_006020chr1431312 554 261 ------
NM_006036chr232158 1750 830 --3697 476 332 --
NM_006037chr234781 45 23 11840 44353 3089 1825 994 --
NM_006038chr2031821 1610 144 --12217 --
NM_006047chr2022774 2445 --22899 1271 --
NM_006054chr1121584 1408 11349 11247 --
NM_006062chr221255 985 ------
NM_006079chr62702 560 ------
NM_006080chr762775 2299 971 605 520 283 31103 822 716 --11131
NM_006089chrX1279 1531 2652 519 --
NM_006095chr474499 4047 2750 1016 1010 516 505 1902 11044 --
NM_006108chr1161887 1627 1578 1553 1535 570 11806 ----
NM_006113chr132071 1664 266 1508 31318 715 654 --
NM_006135chr121409 163 11481 21249 179 --
NM_006136chr73333 292 219 1185 136 --
NM_006141chr1662372 2032 1949 797 734 395 ------
NM_006145chr191461 --1342 --
NM_006153chr32575 543 ------
NM_006154chr1552578 2276 1806 319 216 ------
NM_006162chr1821748 1567 ------
NM_006166chr1252548 2046 1054 882 457 ------
NM_006167chr841679 967 331 54 --12128 --
NM_006178chr1751559 1301 569 464 187 21103 76 ----
NM_006195chr951357 1143 891 531 434 1120 ----
NM_006196chr23386 104 40 ------
NM_006203chr534003 1302 1173 1970 --11006
NM_006216chr22597 157 ------
NM_006224chr1761599 944 937 397 305 285 ------
NM_006226chr211168 11221 ----
NM_006238chr651980 1475 495 333 203 --1758 --
NM_006245chr63684 190 89 ------
NM_006246chr1431235 387 237 ------
NM_006251chr522739 963 12121 13119 --
NM_006252chr1107458 7431 6847 2967 1566 1502 1085 1008 775 742 16136 17040 --
NM_006256chr122429 899 32486 583 567 ----
NM_006258chr1011003 11171 ----
NM_006265chr811504 11138 1207 --
NM_006268chr112864 395 --31158 361 321 --
NM_006282chr2084765 4712 4403 4388 2995 2961 854 337 --14246 --
NM_006283chr874762 3045 1859 1641 1421 1094 813 31831 1721 1427 ----
NM_006301chr12--2641 525 ----
NM_006306chrX45912 5906 5878 5063 ------
NM_006352chr131502 829 318 21955 611 ----
NM_006353chr661375 1205 338 241 222 142 --11220 --
NM_006359chrX2672 473 --1255 --
NM_006372chr6----2358 326 --
NM_006375chrX71523 1370 1202 711 461 298 244 --21425 506 --
NM_006379chr72812 48 ------
NM_006380chr1724418 1225 ------
NM_006386chr2252437 2321 1775 149 59 ------
NM_006389chr1141212 871 447 210 ------
NM_006393chr1074279 2968 2917 1330 1006 243 216 ------
NM_006420chr2012828 ----13177
NM_006421chr82262 106 ------
NM_006434chr1022502 1155 13157 ----
NM_006439chr41546 ------
NM_006457chr412756 ------
NM_006458chr111407 ------
NM_006460chr1721749 179 --11361 --
NM_006464chr252860 258 249 98 83 11712 23622 1190 --
NM_006465chr1582316 2282 2266 1905 1882 261 231 135 --11975 --
NM_006467chr522263 1479 11804 12171 1472
NM_006469chr121031 642 11081 --11601
NM_006472chr151211 1048 873 826 793 ------
NM_006482chr1262826 2711 2662 847 668 440 33946 3804 2926 --1224
NM_006489chr1441626 605 424 209 ------
NM_006496chr111237 ------
NM_006526chr2061969 1479 1414 802 736 181 1592 ----
NM_006536chr11236 ------
NM_006537chr152628 581 1178 ----
NM_006538chr243800 3766 3521 1067 12892 --12827
NM_006544chr1431563 1261 1056 153 --16038
NM_006547chr721680 468 ------
NM_006548chr351599 1487 1477 1150 341 --11726 --
NM_006555chr732003 1422 1237 --11909 11970
NM_006557chr931765 1491 348 11169 ----
NM_006560chr111387 ------
NM_006561chr10126172 5856 4836 4689 3835 2161 1984 1573 1032 832 424 139 24910 1817 15915 16053
NM_006572chr1763128 2598 1287 1109 972 602 23294 2933 22651 350 --
NM_006575chr1411453 21201 371 ----
NM_006584chr171118 ------
NM_006590chr21295 ------
NM_006595chr1141809 1307 229 178 --11451 --
NM_006597chr11--1214 ----
NM_006599chr16178150 8062 7963 7832 7734 7287 6431 5262 2167 1730 1709 1589 1408 1060 763 376 45 47173 6642 2115 998 11366 --
NM_006603chrX31864 1813 723 11831 ----
NM_006609chr242629 2367 2210 1064 12245 ----
NM_006614chr333425 1091 688 --12802 --
NM_006618chr131409 1273 1059 --11001 --
NM_006622chr51544 ------
NM_006625chr121180 1108 ------
NM_006625chr121180 1108 ------
NM_006625chr121180 1108 ------
NM_006626chr932447 482 251 1773 11935 --
NM_006629chr1842387 2089 1972 30 --21823 1766 --
NM_006646chr1362182 2057 1967 1138 400 242 11120 1929 --
NM_006654chr12114285 4157 3522 1892 1293 1276 1112 950 895 587 422 44570 3776 3087 876 21781 1752 --
NM_006662chr161281 ------
NM_006667chrX5992 732 469 380 67 ------
NM_006690chr2091953 1907 1638 757 693 484 327 227 200 ------
NM_006695chr172231 118 --1279 --
NM_006698chr2031449 1291 593 --1228 --
NM_006699chr132720 2511 200 ------
NM_006700chr122629 36 --1144 --
NM_006703chr61319 2426 331 ----
NM_006713chr5285 54 136 1722 --
NM_006717chr953303 3206 2298 1328 143 13047 ----
NM_006718chr62185 177 11061 1219 --
NM_006722chr343053 2106 950 774 ------
NM_006729chrX35515 4883 219 14272 14821 --
NM_006734chr6--199 21604 989 --
NM_006750chr16167940 7806 7606 7325 7301 5567 4960 4898 3038 2769 1892 1800 1720 1469 504 489 --37369 7216 6152 --
NM_006751chr22746 379 --1978 --
NM_006754chr721074 420 ------
NM_006766chr82704 186 ------
NM_006769chr1--1568 171 --
NM_006775chr642176 1191 1107 174 --12930 --
NM_006777chrX42251 467 427 302 ------
NM_006805chr52302 157 ------
NM_006807chr1731213 106 74 11356 ----
NM_006814chr2032547 221 81 12047 --12056
NM_006823chr831132 412 357 1977 ----
NM_006825chr125991 977 717 398 79 ------
NM_006827chr1432910 819 300 --12258 --
NM_006846chr51238 1102 ----
NM_006852chr1762692 2319 2282 1917 419 402 12544 ----
NM_006854chr741752 785 367 30 11568 --11486
NM_006870chr202534 108 --2694 673 --
NM_006873chr22551 388 33088 673 195 11325 --
NM_006885chr1674022 2656 1292 985 493 311 195 --23055 255 --
NM_006887chr22486 204 ------
NM_006888chr1453217 2979 2711 1294 1221 21248 638 33292 2847 2528 13164
NM_006896chr731091 1024 826 --1971 --
NM_006906chr113807 392 125 --3945 349 334 --
NM_006908chr741353 1207 936 523 1197 ----
NM_006914chr941508 449 112 65 --21519 980 --
NM_006915chrX22258 320 ------
NM_006916chr221334 22 11168 --1299
NM_006920chr221780 217 11842 ----
NM_006922chr211795 1376 11016 --
NM_006924chr1764167 4153 3745 3395 868 610 --32846 357 170 --
NM_006925chr141200 --1470 --
NM_006930chr541591 1419 556 126 1540 --1107
NM_006936chr2151295 1208 1102 971 84 ------
NM_006937chr172509 37 ------
NM_006939chr141212 ------
NM_006947chr421200 501 2544 408 ----
NM_006948chr2152085 1963 1807 1734 707 1156 12282 --
NM_006981chr952638 2630 2441 732 94 22707 630 --2884 428
NM_006999chr571865 1689 1357 1285 819 697 318 --1394 --
NM_007005chr9--11081 --11419
NM_007006chr1653534 3391 3339 2799 1368 12598 --1727
NM_007007chr12104725 3872 3768 3549 3357 1543 1138 538 491 344 23757 3140 34105 1270 620 --
NM_007008chr22184 169 ------
NM_007010chr1721834 1682 11234 11485 --
NM_007011chr1566809 6792 2399 2183 1160 319 12535 56645 2666 1394 820 406 --
NM_007017chr51169 ------
NM_007019chr204179 125 61 22 ------
NM_007030chr5135179 5156 4993 4376 4203 4054 3943 1057 771 484 463 264 35 --13514 --
NM_007038chr2144456 2435 1753 329 --15934 --
NM_007050chr20136978 6795 6646 6406 6049 5813 5022 1979 1023 760 667 312 141 25891 2253 36694 693 411 --
NM_007067chr1741586 1308 315 138 --1343 1441
NM_007073chr642667 1680 1519 232 --140 --
NM_007106chr1342564 2536 346 40 --22583 2149 --
NM_007107chr341903 375 241 33 22402 639 ----
NM_007124chr631832 1773 1530 1805 11764 1135
NM_007125chrY31466 1317 1059 ------
NM_007145chr192536 190 11223 ----
NM_007146chr1722444 1932 11004 12539 --
NM_007157chrX52941 2309 2005 987 380 21955 510 1753 --
NM_007159chr321619 1325 ----11124
NM_007166chr1121600 238 --1371 --
NM_007173chr1131567 491 43 ----1125
NM_007174chr1232011 1794 1661 ----11727
NM_007175chr853157 1335 1308 973 101 13513 2892 385 1803
NM_007187chr1331035 697 226 1913 ----
NM_007192chr143936 926 331 --1223 --
NM_007195chr1843474 2926 2850 891 23516 2642 13618 --
NM_007212chr141777 587 496 344 ------
NM_007214chr6----1963 --
NM_007222chr821627 337 1509 ----
NM_007238chr2044498 3842 1761 346 24152 434 ----
NM_007246chr411052 --1351 --
NM_007249chr13139244 9054 8513 8479 8096 7833 7480 6655 3631 2867 2774 2440 1162 13314 51441 1115 826 765 265 17957
NM_007256chr1141667 531 264 95 ----11151
NM_007313chr951953 1242 713 354 223 11208 ----
NM_007325chrX31540 572 367 --1691 --
NM_007345chr1851872 728 277 199 148 --12078 --
NM_007347chr1533091 2178 1990 12920 12889 --
NM_007350chr1253938 3230 3103 1608 72 21267 347 ----
NM_007357chr13585 404 85 ------
NM_007358chr111912 --1798 --
NM_007372chr17268 34 --1724 --
NM_007375chr142037 1028 904 685 11738 11126 --
NM_012062chr121239 1287 ----
NM_012081chr553053 2529 1362 513 345 23736 1350 11445 --
NM_012086chr2----155 --
NM_012089chr12595 162 --31407 1348 564 --
NM_012095chr1083462 3274 2700 2545 1402 1050 1017 112 12391 ----
NM_012097chr231898 1768 581 --1612 --
NM_012102chr182438 1034 1021 973 937 921 820 164 --32614 2457 2361 --
NM_012104chr1153077 1439 1388 996 392 ------
NM_012104chr1153077 1439 1388 996 392 ------
NM_012105chr213287 154 123 ------
NM_012110chr4141 ------
NM_012124chr111158 ----1241
NM_012129chr732172 873 833 1131 ----
NM_012137chr172323 2157 2109 1885 1873 344 291 1852 ----
NM_012141chr1342765 2702 1020 1007 13127 43580 3294 2734 2540 --
NM_012153chr1162321 2309 1757 1716 1630 682 21967 198 1907 --
NM_012154chr81841 1751 1573 1271
NM_012156chr2063412 3322 2872 2863 694 458 --1770 --
NM_012160chr6--1389 ----
NM_012161chr41796 ------
NM_012164chr976827 6805 5979 5714 5387 4727 547 46574 6058 2677 1239 36725 4917 1543 --
NM_012175chr112819 83 ------
NM_012176chr52259 91 ------
NM_012180chr41488 ------
NM_012191chr3126 ------
NM_012193chr1144777 4263 3634 680 ------
NM_012199chr183456 1724 1701 1539 1492 1373 747 302 13336 24543 1576 11203
NM_012210chr931065 1058 101 --11146 --
NM_012214chr2106223 6074 5803 5686 5093 4604 1128 905 730 188 ------
NM_012218chr1973089 2800 981 870 739 559 316 --1202 --
NM_012223chr231307 222 187 11190 1244 --
NM_012234chr363497 3282 2733 1448 898 389 21418 996 ----
NM_012238chr1021403 615 ------
NM_012242chr101704 --1759 1652
NM_012247chr103948 840 98 1726 1359 --
NM_012249chr263405 3095 2608 1241 405 128 ------
NM_012255chr20--1435 ----
NM_012262chr144562 1064 61 49 --14499 23355 179
NM_012281chr762093 2058 959 684 597 526 ------
NM_012286chrX4470 84 55 31 ------
NM_012287chr33909 406 382 11205 ----
NM_012288chr675522 5404 1077 430 259 247 126 13868 35637 4501 1129 --
NM_012294chr773780 3446 2924 2596 1521 539 150 13287 ----
NM_012296chr1163864 3729 3088 2614 2555 298 --13640 --
NM_012297chr442347 2179 869 852 ------
NM_012308chr1142370 2056 1014 440 12414 1847 --
NM_012309chr1174050 3934 3749 3280 1186 942 150 24571 1209 23837 198 --
NM_012316chr1105478 4592 4491 4181 4023 2118 1458 764 274 85 --1511 --
NM_012319chr184972 825 288 264 ------
NM_012329chr17----1156 11207
NM_012330chr1031552 1157 465 --11261 --
NM_012333chr121061 392 ------
NM_012341chr101427 ------
NM_012342chr101459 --1382 --
NM_012347chr652653 2589 2137 1096 483 --12458 --
NM_012383chr9163 ------
NM_012413chr2----1135 1184
NM_012414chr12328 103 ------
NM_012416chr9--1225 ----
NM_012417chr171639 ------
NM_012431chr753375 3245 2568 2512 24 ------
NM_012434chr631557 1364 94 11301 ----
NM_012446chr5----1643 --
NM_012464chr442181 897 667 534 42299 2098 798 419 1339 --
NM_012475chr1----191 --
NM_012478chr17198 --1405 --
NM_013229chr124498 437 282 222 22516 2386 ----
NM_013231chr1434128 3784 1141 --24286 3603 12707
NM_013233chr2------11362
NM_013238chr1331875 448 264 ----11672
NM_013253chr112499 175 1299 1902 --
NM_013255chr777567 7059 5480 1486 1204 578 563 17016 18645 --
NM_013261chr462708 2542 2400 1319 1136 1039 --33422 2726 2378 --
NM_013262chr621464 509 --1982 --
NM_013269chr1254177 3279 1432 446 196 1328 ----
NM_013281chr20--176 --1302
NM_013283chr53855 669 219 ------
NM_013313chr2293518 2800 2443 2299 2205 1121 304 178 164 ------
NM_013322chr711398 1167 --11459
NM_013341chr242815 1172 1166 758 ------
NM_013346chrX176 ------
NM_013363chr32420 59 ------
NM_013372chr1522917 2360 23374 30 12405 --
NM_013377chr121572 1473 ----
NM_013381chr1262003 746 375 365 210 191 22284 840 ----
NM_013423chrX--21080 476 2321 94 --
NM_013427chrX--21080 476 2321 94 --
NM_013438chr931594 1142 281 --11682 --
NM_013444chrX--1416 11116 --
NM_013446chr731030 527 144 21138 119 182 --
NM_013449chr1272950 2435 2109 1204 1160 694 548 ------
NM_013958chr8------175
NM_013959chr8------175
NM_013961chr8------175
NM_013962chr8------175
NM_013981chr5--1169 ----
NM_013982chr5--1169 ----
NM_013983chr5--1169 ----
NM_013989chr1455126 4084 3855 3424 276 11969 33589 3290 1139 --
NM_013995chrX42406 1945 564 264 1388 --1948
NM_013996chr71490 ------
NM_013996chr71490 ------
NM_013997chr71490 ------
NM_013997chr71490 ------
NM_013998chr71490 ------
NM_013998chr71490 ------
NM_013999chr172966 377 --11067 11139
NM_014007chr91188 1909 ----
NM_014011chr21205 22472 2293 12550 --
NM_014021chr132966 135 35 ------
NM_014023chr1092771 2716 2472 2456 2196 1819 1783 196 127 --21172 1034 11982
NM_014034chr63469 325 219 ------
NM_014043chr321670 417 2513 305 ----
NM_014048chr1665306 3764 3551 1870 1770 176 14952 ----
NM_014055chr122504 401 ------
NM_014089chr1322227 237 ------
NM_014110chr12844 186 ------
NM_014112chr8115437 5359 5267 4698 4072 3580 3565 2169 1165 770 682 34629 3571 72 14588 --
NM_014141chr755309 4683 3473 3425 1586 33301 507 290 11043 1316
NM_014154chr32545 351 11498 1220 --
NM_014155chr11107253 6865 5699 5157 2401 2280 2188 1595 1094 255 --37509 6377 2744 --
NM_014170chr31330 ------
NM_014181chr211874 ----173
NM_014188chr1----2285 88 --
NM_014211chr511699 21425 164 ----
NM_014212chr122310 230 ------
NM_014231chr1282101 2082 1936 1875 1769 1759 637 50 --1609 --
NM_014232chr1761617 1414 1375 227 131 119 ------
NM_014232chr1761617 1414 1375 227 131 119 ------
NM_014243chr421416 178 1562 1523 1795
NM_014246chr2252198 2110 787 767 575 21757 434 ----
NM_014250chr223601 595 317 1419 1779 --
NM_014252chr131123 ------
NM_014253chrX32129 966 497 ------
NM_014271chrX1195 1679 1177 --
NM_014283chr151568 1075 1063 606 45 ------
NM_014285chr94926 869 817 311 1162 ----
NM_014289chrX2993 324 ------
NM_014294chr841333 1216 1205 82 1372 1461 --
NM_014309chr2251734 1283 950 607 160 ----24014 1541
NM_014319chr1221958 67 ------
NM_014325chr1222155 1738 --12244 --
NM_014331chr456739 5062 4952 2804 1304 27319 5813 --15214
NM_014333chr1192817 2633 2292 2163 1883 773 694 167 29 1453 ----
NM_014342chr1131370 151 137 ------
NM_014382chr32690 580 --11139 --
NM_014388chr175382 5278 4387 4185 3798 3792 162 16022 35424 4611 704 --
NM_014393chr82311 267 11615 1849 --
NM_014396chr742272 1879 606 576 ------
NM_014415chr3----11615 --
NM_014423chr574780 4769 4182 3862 2245 2097 665 22149 469 1956 22229 2004
NM_014426chr201707 ------
NM_014431chr1041397 1238 353 56 --21524 527 --
NM_014445chr321755 480 --11601 11907
NM_014454chr61782 ------
NM_014455chr1--1438 ----
NM_014456chr1011236 1472 ----
NM_014470chr122797 751 ------
NM_014472chr102480 168 ------
NM_014480chr191540 ------
NM_014494chr163897 410 262 --1474 11522
NM_014517chr321413 315 --11379 --
NM_014521chr21621 --11777 --
NM_014548chr1541526 1378 1310 295 ----1437
NM_014552chr211494 ------
NM_014554chr1221969 1604 12009 ----
NM_014562chr2--1779 ----
NM_014563chrX12096 ------
NM_014574chr14----1272 --
NM_014620chr12--1239 ----
NM_014630chr1583765 3299 2503 1400 743 735 539 129 --43818 3592 266 48 --
NM_014634chr2283576 3533 3259 2947 2788 559 522 45 --32874 2632 674 --
NM_014635chr221377 1175 11418 ----
NM_014636chr914134 12840 1710 --
NM_014646chr1872316 2129 1992 1204 1092 411 363 12717 ----
NM_014647chr1661965 1860 722 491 457 301 ----1135
NM_014660chr74829 362 333 128 ------
NM_014671chr7--21578 1441 ----
NM_014674chr373953 3564 3081 2678 2514 1017 370 --12521 --
NM_014677chr8----2144 104 --
NM_014685chr161208 ------
NM_014686chr1952353 2116 1871 1805 64 12077 12455 --
NM_014701chr1532343 1351 937 23423 1125 2869 184 --
NM_014702chr622324 87 ----13146
NM_014711chr1631946 1700 807 ------
NM_014723chr2053210 2750 2237 675 338 --32089 2062 1220 --
NM_014729chr842072 1974 1528 892 1871 ----
NM_014730chr1284323 3835 3223 1747 1318 1190 1159 890 --23783 3230 --
NM_014730chr1284323 3835 3223 1747 1318 1190 1159 890 --23783 3230 --
NM_014735chrX4591 521 511 137 12074 21617 1466 --
NM_014739chr652927 2686 1553 1260 1200 13541 1718 13864
NM_014743chr472990 2952 2828 2321 1004 797 419 22512 273 ----
NM_014746chr244000 3672 2688 2655 11050 --14344
NM_014747chr1135431 5352 5256 5139 4821 4394 4062 3780 2102 788 458 103 61 --3413 282 86 --
NM_014751chr832144 510 61 22111 1564 ----
NM_014752chr1141900 1851 1255 124 11270 ----
NM_014755chr221270 1027 13728 13459 --
NM_014764chr122954 892 --21167 122 --
NM_014766chr743276 624 521 148 12326 1534 --
NM_014767chr1063464 3396 2802 2331 2323 1189 --32409 404 245 --
NM_014776chr1262986 2967 2914 2114 1225 602 ------
NM_014779chr31954 --166 --
NM_014781chr831012 385 50 ------
NM_014787chr11532 11751 1946 --
NM_014791chr91211 ------
NM_014795chr211356 ------
NM_014810chr143032 2317 2298 1044 1763 1657 --
NM_014812chr12598 122 ----1543
NM_014820chr31340 11816 11469 --
NM_014822chr41594 ----1523
NM_014824chr1131762 1743 789 --1628 --
NM_014827chr131647 495 375 --1149 --
NM_014830chr124546 287 217 118 11067 2865 679 --
NM_014838chr2251058 829 516 225 145 --22348 2132 --
NM_014839chr122185 922 --164 12284
NM_014847chr1----2528 503 --
NM_014850chr354839 3297 1731 399 130 11275 14426 --
NM_014862chr1584137 3861 3429 2903 1608 955 631 138 22613 607 23666 3463 --
NM_014864chr143338 777 415 136 33099 3048 461 11675 14371
NM_014868chr122578 192 ------
NM_014871chr121569 144 ----
NM_014872chr93943 828 822 1442 22129 1820 --
NM_014873chr163955 3899 3663 3588 819 581 --1612 --
NM_014877chr17107612 6951 5176 2953 2937 2706 1320 1143 1042 120 25838 2368 12686 --
NM_014893chrY11674 --12066 --
NM_014897chr1752770 2493 2446 930 921 12100 123 --
NM_014899chr533027 2056 261 1992 ----
NM_014903chr1221548 894 ------
NM_014904chr1043385 2943 1397 999 11216 ----
NM_014906chr1764082 3918 3093 1462 918 231 11356 11147 --
NM_014912chr1043431 2531 369 181 --22824 85 --
NM_014918chr153586 497 365 --11348 --
NM_014920chr622631 990 33773 996 592 --171
NM_014923chr13--1484 ----
NM_014926chr3----1364 --
NM_014932chr321810 214 ------
NM_014934chr1353186 3081 2959 2433 532 23969 1233 12925 --
NM_014935chr143421 1054 697 194 11099 13657 --
NM_014944chr141388 1264 1061 282 --2938 527 --
NM_014946chr221141 386 1444 1613 --
NM_014947chr142809 2645 889 418 --12782 --
NM_014949chr12848 685 ------
NM_014950chr141108 ------
NM_014951chr1052441 2292 1936 1669 74 --1608 12304
NM_014959chr1963096 2333 2238 1064 844 89 ------
NM_014978chr1021773 89 ------
NM_014982chr1475302 5284 4072 3720 3709 1977 861 14716 ----
NM_014988chr431004 143 51 ----12719
NM_014989chr621353 418 22016 1955 ----
NM_014991chr423001 2521 21244 1010 22194 991 --
NM_014996chr321044 315 --2327 144 --
NM_014999chr1221690 1450 21697 1032 ----
NM_015000chr1243018 2825 2314 1213 ------
NM_015002chr1242010 439 285 257 --1465 --
NM_015005chr1451718 1395 1281 1149 323 11763 ----
NM_015008chr393617 3089 2746 2699 2683 1358 1248 1077 969 22994 2504 ----
NM_015020chr1653463 2794 2603 2494 572 --12978 --
NM_015023chr161776 1708 1653 356 343 88 11859 ----
NM_015025chr222212 148 11728 1229 182
NM_015026chr1263835 3289 2934 1900 1069 978 14117 ----
NM_015032chr1332358 2255 1046 --11032 11812
NM_015039chr174083 3548 3328 1629 1616 538 275 --11585 14071
NM_015040chr253205 2158 634 345 95 --1945 --
NM_015042chr1564378 3750 3658 1487 1430 1055 ------
NM_015045chr1032236 1432 428 ------
NM_015046chr982688 2393 2075 2063 1697 959 536 219 --12164 --
NM_015049chr232877 268 215 12423 --12715
NM_015052chr72941 413 1859 ----
NM_015055chr1122260 585 11811 ----
NM_015059chr1593622 2813 1396 965 520 308 242 138 63 33044 995 199 ----
NM_015064chr1222939 712 --21366 1084 1798
NM_015068chr751411 1227 1064 978 739 13063 11010 --
NM_015071chr5106104 4985 4961 4550 4298 2080 1927 1897 1405 1077 26278 5674 14863 14216
NM_015073chr1932074 2051 1306 11963 ----
NM_015075chrX12237 --11485 --
NM_015076chr654281 3808 3632 490 225 --34172 1457 1075 --
NM_015087chr1362476 2350 2304 2229 335 151 ------
NM_015090chr1156030 5887 5797 5692 5392 5161 4877 4818 4174 3874 2482 2435 1785 1450 895 1363 35109 4708 2415 --
NM_015092chr1684242 3934 3759 3381 3114 2944 1126 263 14476 13037 --
NM_015093chr65535 521 515 305 265 --1125 --
NM_015097chr322099 290 21490 458 1895 --
NM_015100chr141977 1889 731 427 ------
NM_015107chrX52393 2054 1745 303 115 ------
NM_015115chr452979 2381 1241 780 177 11124 ----
NM_015130chr42442 58 --11288 --
NM_015132chr761764 1660 1517 110 90 26 ----1200
NM_015133chr16--11485 ----
NM_015138chr1542739 2696 930 255 12530 1874 --
NM_015143chr441046 929 502 160 --1146 --
NM_015149chr152152 1948 1432 838 87 12095 1469 --
NM_015156chr1422566 463 13528 11112 1904
NM_015163chr1431882 491 33 1806 11767 --
NM_015170chr8------11804
NM_015176chr151656 1640 1243 375 90 31349 652 230 ----
NM_015187chr41103 1274 --1347
NM_015192chr2032568 2489 1935 --1310 --
NM_015197chr1463188 3070 3036 2592 697 430 1569 22972 320 --
NM_015198chr731306 1225 147 ------
NM_015199chr352748 2286 2230 2212 985 ------
NM_015200chr442378 2182 387 232 ----11886
NM_015206chr15103728 3713 3224 1367 1217 904 806 573 485 449 ------
NM_015208chr181503 22568 30 ----
NM_015209chr171956 1860 913 894 682 581 38 ------
NM_015215chr133027 2165 640 --22030 541 --
NM_015216chr531449 79 50 --1439 --
NM_015247chr1674927 4560 3435 1189 616 165 105 --1365 --
NM_015252chr22845 288 ------
NM_015263chr151366 11059 ----
NM_015265chr232590 2150 126 ------
NM_015271chr454267 4124 3898 855 540 13197 1650 --
NM_015272chr1621610 652 ------
NM_015278chr683310 3264 2968 2778 1052 876 632 534 ------
NM_015282chr222847 257 --2499 405 --
NM_015285chr1842363 1943 520 68 ------
NM_015288chr583798 3483 3417 3365 3079 2624 170 93 --12399 --
NM_015291chr181003 977 872 803 537 317 287 151 21113 157 1324 --
NM_015294chr1731098 1090 380 ------
NM_015296chr13------1352
NM_015299chr1453605 3347 2868 1532 687 --13678 --
NM_015308chr113759 584 47 1670 ----
NM_015310chr866474 3118 2992 1983 1646 165 --57247 5657 5630 1029 961 --
NM_015313chr1143996 3099 435 57 23795 1741 ----
NM_015314chr722502 1753 ----11719
NM_015317chr242703 2555 2345 2278 ------
NM_015321chr1994897 4145 1921 1852 1719 1698 1632 828 576 --34504 4062 3039 --
NM_015326chr182295 2214 2192 2144 1920 973 629 115 123 1737 --
NM_015329chr1942786 2499 2377 1878 --12363 --
NM_015330chr2252000 1887 848 728 590 12590 11904 --
NM_015335chr122516 166 1728 22024 327 --
NM_015336chr123534 277 53 --164 --
NM_015339chr204719 327 175 75 ------
NM_015344chr811939 --22047 250 --
NM_015345chr652705 2069 1089 623 156 1667 22759 1787 --
NM_015349chr62741 162 --12693 --
NM_015353chr1772536 2333 2176 1097 1004 940 826 --32302 601 136 --
NM_015354chr91359 ------
NM_015355chr17----11335 --
NM_015359chr852831 2644 2620 2069 1901 --1624 --
NM_015365chrX53361 3098 2781 1509 317 --11518 12821
NM_015375chr1114707 4700 3278 3200 1807 1534 1203 1115 1036 310 236 --33828 3792 269 --
NM_015385chr1022502 1155 13157 ----
NM_015393chr433433 672 37 --12987 13215
NM_015397chr941493 750 735 419 11730 ----
NM_015423chr1141749 1495 1090 551 ------
NM_015429chr321000 924 ------
NM_015443chr1721477 1426 11433 ----
NM_015446chr111674 11620 1278 --
NM_015455chr543645 3439 957 232 22725 928 34099 3348 1239 12564
NM_015458chr8105262 5234 4867 4537 3824 3627 2069 1680 320 46 --1496 --
NM_015460chr331616 475 146 ------
NM_015464chr71265 1142 1952 --
NM_015470chr221112 100 --1210 --
NM_015530chr2154 1862 ----
NM_015532chr1572789 2722 2592 2217 556 358 148 --12484 12494
NM_015535chr243963 3573 3070 338 11638 11335 --
NM_015541chr321417 1256 --11440 --
NM_015542chr1021030 414 ------
NM_015548chr62899 143 ------
NM_015550chr733223 2968 1086 13010 33168 2826 1104 11129
NM_015557chr173140 3127 2398 2351 735 516 360 --23286 225 --
NM_015565chr2132078 1774 1426 1535 ----
NM_015567chr1321207 492 ------
NM_015569chr154713 4665 3106 1823 1383 14291 14220 --
NM_015570chr731813 567 214 11717 ----
NM_015571chr62908 547 1428 --12195
NM_015575chr242805 634 280 154 --31003 647 224 --
NM_015576chr372889 1958 1936 1821 1143 1064 763 1197 1875 --
NM_015577chr541799 649 84 42 ------
NM_015578chr19----2721 454 --
NM_015602chr121745 1144 --1319 --
NM_015627chr141879 1812 1362 1310 --21207 505 --
NM_015630chr231145 946 403 ------
NM_015635chr931939 1455 605 1391 ----
NM_015640chr163828 3822 1693 1359 942 927 35350 1448 1032 ----
NM_015651chr982259 2070 837 718 369 282 268 227 ------
NM_015652chr101494 135 ----
NM_015713chr842699 1426 1060 201 ------
NM_015726chr121783 1194 11498 ----
NM_015850chr852409 1907 1603 680 418 1851 12261 --
NM_015878chr821382 384 21916 230 ----
NM_015879chr18108596 6647 6025 3140 3125 2610 2211 1422 900 128 192 1937 23133 2621
NM_015881chr112499 175 1299 1902 --
NM_015886chr815703 13709 ----
NM_015888chr133408 3045 260 12666 153 --
NM_015891chr621940 1639 ------
NM_015906chr114328 2972 263 --11453
NM_015907chr4122 134 ----
NM_015912chr832482 2213 1634 ------
NM_015934chr21148 ------
NM_015939chr20131 1643 ----
NM_015980chr521670 1080 ------
NM_015984chr11128 1376 ----
NM_015987chr122397 46 ------
NM_015990chr42878 840 ------
NM_015995chr1574475 4422 3821 3507 3472 1283 821 15496 13800 --
NM_016009chr124821 1138 11071 1813 13873
NM_016018chr832221 548 462 12804 ----
NM_016019chr71332 1692 ----
NM_016023chr852081 1890 1584 732 385 22042 77 1178 --
NM_016025chr16169 ----11477
NM_016040chr142517 2453 2372 1798 1289 --12596
NM_016048chr531003 827 767 1833 ----
NM_016061chr221687 661 ------
NM_016072chr1251909 1811 1689 1681 106 12422 ----
NM_016075chr1332107 910 483 12484 22950 782 --
NM_016076chr163014 2846 2225 1132 687 350 ----22127 1111
NM_016078chr173369 310 232 ----11082
NM_016083chr663329 3181 1108 1044 960 439 23021 789 ----
NM_016096chr821761 1404 22178 350 12002 --
NM_016098chr61365 ------
NM_016107chr5--1316 1293 --
NM_016131chr252294 1495 553 507 143 --1944 --
NM_016132chr1543375 3132 2906 2692 22248 298 12749 --
NM_016147chr1131108 393 356 11054 11026 --
NM_016152chr33475 392 356 --1951 --
NM_016156chr1142168 2146 804 796 ------
NM_016173chr353748 3186 1657 1626 758 --32991 1432 1103 23957 3002
NM_016179chr13--1212 ----
NM_016192chr21190 ------
NM_016201chr362260 2139 1838 1701 698 454 ----12086
NM_016206chr337364 2874 2321 18144 33324 2352 2078 --
NM_016217chr693549 3441 3281 3272 2743 2314 2233 911 162 --43381 3320 728 481 --
NM_016221chr562020 866 839 658 288 220 1817 ----
NM_016224chr641908 1468 876 691 1328 ----
NM_016227chr151568 1075 1063 606 45 ------
NM_016228chr41482 ------
NM_016230chr61434 1372 ----
NM_016235chr1621265 1200 --162 --
NM_016248chr1333960 1499 1182 22509 2456 21354 1226 --
NM_016252chr21986 ------
NM_016258chr12602 297 --1532 --
NM_016260chr277429 7363 6783 5674 5180 2255 475 --26895 1089 16496
NM_016272chr2262242 2118 2069 1784 849 394 1692 12042 --
NM_016284chr163793 385 303 1157 ----
NM_016287chr11259 11830 ----
NM_016307chr91289 ------
NM_016316chr21636 ------
NM_016322chr973178 3023 2354 1234 976 250 80 1545 22851 2761 --
NM_016339chr1761535 1509 1463 345 284 266 --1505 --
NM_016376chr1762777 2748 1511 1048 644 343 --32949 1541 102 --
NM_016377chr641494 1440 1293 150 1481 ----
NM_016396chr1532514 1974 1967 ----12894
NM_016418chr2293591 3583 3319 2529 2447 1504 1205 842 311 --23502 372 --
NM_016422chr1142713 2291 716 171 1750 ----
NM_016436chr2032483 1964 1843 ------
NM_016441chr21871 11908 11779 11941
NM_016479chr331126 223 101 11163 31028 428 142 --
NM_016480chr52832 299 ------
NM_016486chr12351 181 ------
NM_016513chr622631 990 33773 996 592 --171
NM_016531chr453222 3180 914 171 58 ------
NM_016544chr243912 3681 3084 2725 11056 12941 --
NM_016545chr12926 253 ------
NM_016559chr331502 423 308 ------
NM_016577chr3104360 4181 3986 3080 2941 2746 1081 593 406 127 14539 1755 --
NM_016598chr321394 1035 ----11004
NM_016599chr42495 210 21436 53 1464 --
NM_016605chr511715 ----1358
NM_016607chrX31564 393 192 ------
NM_016613chr442308 1738 587 388 32320 1948 907 ----
NM_016620chr11236 --11178 --
NM_016824chr10--11653 11858 1775
NM_016836chr22556 535 --2486 26 1583
NM_016839chr22556 535 --2486 26 1583
NM_016932chr24915 372 309 66 ------
NM_017409chr123717 523 310 ------
NM_017415chr531545 1208 1202 24556 2905 54434 3325 3087 1030 633 13477
NM_017420chr1452732 2625 1375 1293 931 --12456 --
NM_017423chr41311 --1433 --
NM_017447chr2133839 1155 921 11094 ----
NM_017451chr171719 11003 ----
NM_017483chr231229 1219 1150 ------
NM_017488chr231564 1554 1485 ------
NM_017495chr2031450 1192 333 --1204 --
NM_017519chr63306 284 70 ------
NM_017544chrX2709 226 --1210 --
NM_017545chr202541 385 ----1184
NM_017548chr351650 1418 810 623 534 --1232 --
NM_017551chr1052249 2226 730 601 551 1253 ----
NM_017577chr331451 1049 512 ------
NM_017580chr1032354 1522 1484 11794 1668 --
NM_017582chr111791 11133 11147 --
NM_017588chr951971 1829 1700 643 249 --2575 69 --
NM_017594chr963349 2344 594 538 138 34 --11145 --
NM_017596chr1124545 4508 4385 4308 4115 4095 3508 3126 1688 545 507 137 13179 11560 14672
NM_017610chr1531863 1533 702 ------
NM_017629chr11330 --11497 --
NM_017633chr613031 --13762 --
NM_017635chr1131547 1525 1487 ------
NM_017637chr9149360 9257 9077 9024 8920 8821 8227 3782 3637 3608 3040 1825 790 467 28400 2313 23311 903 18352
NM_017643chr1752240 1101 901 781 659 12382 ----
NM_017644chr345181 5081 3600 1540 21500 609 1325 --
NM_017650chr775870 4534 4305 3872 1900 1848 818 14040 25166 2209 --
NM_017657chr22641 273 2727 691 1297 --
NM_017658chr1474643 4191 3561 1750 1192 966 911 11643 ----
NM_017664chr1321066 269 11056 1216 11031
NM_017666chrX61901 1783 1665 882 517 486 1412 ----
NM_017667chr71489 --1160 --
NM_017684chr1511349 21800 507 21295 368 --
NM_017691chr152421 141 ------
NM_017697chr82453 375 ------
NM_017719chr362575 2230 534 422 370 310 2756 585 --12075
NM_017737chr161941 1853 508 492 414 344 --12195 1317
NM_017744chr141926 1597 1526 215 --21850 1806 --
NM_017752chrX32151 1559 106 --11534 --
NM_017754chr673750 3677 3349 3230 860 249 164 --24663 3262 --
NM_017758chr1721225 488 ----1398
NM_017769chr1423092 2289 --1833 --
NM_017778chr81436 --1600 --
NM_017780chr83864 239 102 ------
NM_017786chr82563 34 1485 ----
NM_017799chr14--1564 11286 --
NM_017801chr322081 453 11697 --11613
NM_017811chr913101 ------
NM_017813chr855161 3819 1250 206 193 ------
NM_017831chr1834532 1523 374 2858 452 54577 4201 1615 1219 1208 --
NM_017845chr4293 74 ------
NM_017848chrX34635 4610 136 44259 4249 3911 128 23163 1875 --
NM_017850chr141241 1047 611 601 --2414 297 --
NM_017919chr984918 4266 4121 4042 3748 827 703 171 ------
NM_017922chr141108 ------
NM_017926chr143923 324 318 2815 665 --1780
NM_017952chr2103869 3544 3471 2803 1819 1655 1003 733 419 332 14107 ----
NM_017955chr145870 272 262 228 211 1379 ----
NM_017972chr143923 324 318 2815 665 --1780
NM_018018chr1221261 438 2749 499 ----
NM_018036chr1474331 4241 4169 3050 2999 582 497 13197 13015 --
NM_018061chr131100 270 221 11273 ----
NM_018084chr223067 3031 12708 150 --
NM_018085chr197903 6674 2809 2727 1986 1977 1490 933 425 15912 11028 15644
NM_018086chr241650 609 527 328 ------
NM_018105chr821138 1096 ------
NM_018114chr31110 ------
NM_018117chr101704 2714 129 ----
NM_018128chr173917 429 277 124 ----
NM_018133chr351860 1714 1623 471 199 ----21778 699
NM_018155chr31721 11120 22125 729 --
NM_018181chr181586 ----1504
NM_018184chr311838 1237 ----
NM_018189chr351744 1710 1557 1164 332 ------
NM_018193chr15177 ----1548
NM_018195chr11112042 1898 1803 1508 1362 842 722 459 145 128 110 ------
NM_018200chr1582374 2177 1972 1032 1025 927 820 211 11653 11931 --
NM_018201chr922523 251 --22541 685 --
NM_018214chr611273 2281 92 133 --
NM_018241chr41762 ------
NM_018243chr443916 1578 459 258 1477 174 --
NM_018246chr882849 2185 2163 1096 651 361 285 253 --179 --
NM_018247chr653043 2961 2892 2687 305 22464 1118 12511 --
NM_018254chr142259 2122 1878 1523 22285 1839 ----
NM_018257chr2032475 2222 2155 ------
NM_018266chr3--11091 ----
NM_018285chr153464 186 28 ------
NM_018293chr352947 2236 2217 2046 1831 12171 ----
NM_018302chr42483 139 --1836 --
NM_018307chr171810 ----1854
NM_018312chr1132004 1657 697 2511 238 21934 552 --
NM_018315chr441553 1089 372 105 ------
NM_018334chr71520 ------
NM_018357chr151365 --1450 --
NM_018362chr1113495 23071 227 23779 1568 --
NM_018364chr164145 3602 3174 2932 777 600 --1410 --
NM_018374chr764279 4156 4130 3707 2077 1280 ------
NM_018375chr1411488 --1361 --
NM_018386chr131126 ------
NM_018388chrX31477 1398 966 179 ----
NM_018394chr31210 --11580 --
NM_018403chr323138 2521 --43564 2579 1585 1227 13849
NM_018416chr1261922 988 771 747 554 122 --12119 11974
NM_018424chr951823 1740 297 239 135 --31434 101 64 --
NM_018429chr512111 32880 2693 98 ----
NM_018440chr8158700 8694 7641 7432 7396 7337 7273 6998 5960 5654 3343 3185 663 143 41 ----11870
NM_018444chr812102 12299 1250 --
NM_018449chr92740 579 ------
NM_018456chr3--195 ----
NM_018460chr2139 ------
NM_018464chr101150 ------
NM_018482chr862360 2053 1927 1882 1847 1039 2653 267 --12379
NM_018566chr174027 3784 3466 3251 1869 501 191 ------
NM_018569chr441202 1029 449 258 21410 581 11437 --
NM_018584chr111256 --11014 --
NM_018590chr1031485 285 116 --1313 --
NM_018602chr154614 583 116 104 --1141 --
NM_018638chr1265564 5536 5446 4010 3871 3568 ------
NM_018640chr1222521 355 --1616 --
NM_018649chr101396 --1589 --
NM_018650chr162127 1755 1662 1534 424 353 ----11834
NM_018660chr853019 2900 2350 2212 1229 12993 ----
NM_018683chr2041698 1084 410 200 ------
NM_018689chr1572562 2485 2313 2205 1746 564 190 12728 ----
NM_018691chr51788 ----1401
NM_018695chr531998 717 661 ------
NM_018700chr551368 1191 254 208 175 1394 3452 161 94 --
NM_018712chr1131301 1144 50 ------
NM_018718chr72420 33 12181 1698 --
NM_018840chr201333 ------
NM_018841chr183661 3369 2633 1587 1010 860 161 114 23828 3706 11035 --
NM_018847chr921899 233 ------
NM_018890chr741353 1207 936 523 1197 ----
NM_018898chr542035 772 340 142 11744 ----
NM_018899chr542035 772 340 142 11744 ----
NM_018900chr542035 772 340 142 11744 ----
NM_018901chr542035 772 340 142 11744 ----
NM_018902chr542035 772 340 142 11744 ----
NM_018903chr542035 772 340 142 11744 ----
NM_018904chr542035 772 340 142 11744 ----
NM_018905chr542035 772 340 142 11744 ----
NM_018906chr542035 772 340 142 11744 ----
NM_018907chr542035 772 340 142 11744 ----
NM_018908chr542035 772 340 142 11744 ----
NM_018909chr542035 772 340 142 11744 ----
NM_018910chr542035 772 340 142 11744 ----
NM_018911chr542035 772 340 142 11744 ----
NM_018945chr683564 3439 3117 2730 1023 748 309 109 12263 13426 --
NM_018948chr141449 1254 1163 123 ------
NM_018951chr761269 412 333 301 162 60 1265 ----
NM_018959chr192608 247 ------
NM_018970chr732765 2726 2143 11036 --12614
NM_018976chr1242279 2253 1124 1049 --1822 --
NM_018977chrX31042 937 725 --11069 --
NM_018999chr1023116 1633 13568 ----
NM_019008chr2263766 3721 3663 3268 1196 794 11487 33322 372 108 --
NM_019015chr71133 ------
NM_019016chr17----128 --
NM_019027chr41947 ------
NM_019028chr111372 ------
NM_019036chr6--1999 ----
NM_019042chr7--173 ----
NM_019050chr421928 734 --1616 --
NM_019054chr104638 582 195 57 --1494 --
NM_019080chr1331546 984 626 ------
NM_019084chr1012059 1478 ----
NM_019106chr2292679 2171 1357 1181 1072 798 740 637 298 --13170 --
NM_019114chr932149 2028 1028 ------
NM_019116chr1683640 3359 2750 2395 1476 1239 782 737 23752 3384 11099 --
NM_019555chr341339 727 273 229 ------
NM_019556chrX138 ------
NM_019590chr1021514 204 1304 --1570
NM_019593chr2073029 2845 2436 1274 1010 914 45 12281 12108 13180
NM_019610chr141613 475 280 155 11825 11374 --
NM_019849chr19--1170 ----
NM_019859chr1041472 1350 1099 99 --1210 11059
NM_019860chr1041520 1398 1147 147 --1258 11107
NM_019885chr262633 2375 2017 855 597 321 --12547 1847
NM_019896chr22196 115 --1254 --
NM_019903chr10--11653 11858 1775
NM_020116chr431730 579 369 ------
NM_020122chr255833 3837 892 628 28 --35111 2306 1504 14304
NM_020137chrX--1164 ----
NM_020141chr131549 385 323 ----12215
NM_020144chr751957 1718 1681 284 176 ------
NM_020148chr1831945 672 164 --12340 12420
NM_020150chr1021583 1520 12193 ----
NM_020154chr15------1238
NM_020159chr431729 415 357 ------
NM_020166chr3----136 --
NM_020168chr1581386 1206 1141 1015 841 491 401 184 ----1352
NM_020177chr51908 1427 21155 321 --
NM_020182chr2023175 672 --33083 2636 244 --
NM_020184chr221611 437 --22277 2116 --
NM_020192chr71140 ------
NM_020228chr1171941 1676 931 879 680 337 46 1997 ----
NM_020235chr3154 ------
NM_020245chr675035 4287 3972 3583 1169 266 205 11032 22051 592 --
NM_020337chr473057 2836 2713 2564 2436 2119 371 1509 ----
NM_020338chr1083642 3244 2271 1459 1453 1165 1010 365 11080 ----
NM_020341chr20------2668 170
NM_020342chr2----21598 730 --
NM_020346chr111662 21448 1066 ----
NM_020347chr322265 1858 22338 1576 ----
NM_020357chr311652 ------
NM_020374chr1231407 786 516 --1676 11911
NM_020379chr12354 70 ------
NM_020403chr1351811 1590 1468 702 627 ------
NM_020416chr452637 2156 900 685 623 --1702 --
NM_020420chrY31851 1739 253 ------
NM_020429chr722905 1174 32992 2390 1038 ----
NM_020432chr71133 ------
NM_020443chr166611 2786 2280 1515 1263 770 12354 25443 5226 --
NM_020448chr143130 1329 1082 913 13720 ----
NM_020449chrX--1492 ----
NM_020452chr161913 1603 509 493 305 127 ----1569
NM_020466chr655014 4036 3189 3065 1739 --14043 --
NM_020526chr131648 1588 385 --1337 --
NM_020532chr22184 169 ------
NM_020546chr592809 2481 1206 695 623 523 473 339 160 1107 ----
NM_020630chr102730 508 ------
NM_020640chr331879 348 195 1726 ----
NM_020645chr11--1444 ----
NM_020651chr231473 1208 447 11757 ----
NM_020673chr2064851 2991 2212 2147 1955 149 35862 2062 751 ----
NM_020697chr83979 913 184 ------
NM_020699chr171942 1604 1427 1221 1048 228 212 --1379 --
NM_020718chr16136634 6376 6255 5359 4039 2409 1895 1233 1182 1001 746 424 153 14557 15658 --
NM_020728chr751128 938 294 275 252 ----1753
NM_020732chr63306 284 70 ------
NM_020739chr1573724 3676 3379 2995 1271 1062 651 --1681 --
NM_020748chr171104 ------
NM_020749chr871868 1792 1647 1321 724 450 361 ----11672
NM_020752chr1042537 2505 1846 537 1815 22814 2056 --
NM_020760chr221881 798 ------
NM_020766chrX53614 3036 2844 1570 187 13727 ----
NM_020769chrX2717 667 ------
NM_020772chr17108548 7241 6684 6663 6187 5933 2545 2241 596 425 47557 5867 5671 1270 13435 --
NM_020776chr1862667 2320 1150 810 467 90 --11991 --
NM_020779chr282961 2736 2721 1061 887 866 597 496 11977 ----
NM_020783chr1852372 2314 1656 502 458 ------
NM_020786chr1631450 462 200 ------
NM_020795chr1721673 471 --1159 --
NM_020796chr522604 2180 13053 ----
NM_020801chr512571 11818 ----
NM_020803chr442255 1989 868 558 --11720 --
NM_020805chr1831778 400 161 --1689 --
NM_020809chr1161992 1747 1485 878 473 333 21500 1451 21868 556 --
NM_020821chr1511349 21800 507 21295 368 --
NM_020825chr1652786 1035 997 957 797 13099 23510 2796 --
NM_020839chr31248 11028 1606 --
NM_020841chr1263799 928 785 338 248 61 31316 1304 794 --13550
NM_020844chr867486 6561 6128 5543 2932 1710 36955 6045 5436 25404 3085 --
NM_020854chr183249 243 103 --1522 --
NM_020856chr1951592 1397 1302 98 85 ------
NM_020860chr421041 278 11151 ----
NM_020868chr21303 1380 11699 --
NM_020870chr421986 1423 ------
NM_020873chr31816 1297 ----
NM_020888chr151860 1612 1491 578 172 ------
NM_020899chr1742526 2325 704 404 ------
NM_020922chrX21347 1302 1511 ----
NM_020927chr1622320 598 ------
NM_020935chr253705 3683 3477 670 579 23841 246 11016 --
NM_020940chr104898 738 647 346 22442 1040 ----
NM_020948chr183662 3065 2970 2326 718 704 614 453 ------
NM_020962chr1542494 2002 801 416 --22220 670 --
NM_020967chr2041212 954 260 89 164 ----
NM_020983chr1241782 1649 710 530 ------
NM_020993chr1241146 1117 257 220 11799 11867 --
NM_021003chr143604 551 295 ------
NM_021005chr154799 419 400 394 ------
NM_021007chr222239 683 --1916 --
NM_021033chr1333158 388 203 ------
NM_021038chr333307 3041 269 ------
NM_021069chr42386 328 --1492 --
NM_021072chr542605 666 439 233 ------
NM_021076chr22196 1400 ----
NM_021079chr1773329 3256 3010 2178 2059 1320 202 22739 2044 ----
NM_021083chrX53626 2854 1027 421 343 22672 1114 1242 --
NM_021088chr23443 434 111 21948 66 ----
NM_021090chr2264945 4307 3440 3138 1537 739 24072 246 ----
NM_021096chr2263078 3059 2931 2695 605 416 ----12379
NM_021097chr241937 1155 935 541 12820 ----
NM_021111chr911353 --11005 --
NM_021115chr221110 ------
NM_021116chr7118720 8577 6120 3254 2689 2562 2399 1851 1593 1067 253 28978 6692 12113 --
NM_021120chrX82952 2937 2910 1153 943 442 156 104 --13070 --
NM_021132chr1021025 410 ------
NM_021136chr14190 --1299 --
NM_021140chrX31047 340 113 ------
NM_021145chr711074 11184 ----
NM_021148chr732526 2306 1710 ------
NM_021159chr421634 50 1114 ----
NM_021183chrX52321 2130 1776 994 657 --12055 --
NM_021188chr141369 ------
NM_021222chr141184 972 120 91 --1326 --
NM_021239chr1441442 1130 282 77 ------
NM_021242chrX1316 1873 ----
NM_021244chr6121 ------
NM_021252chr1021657 1286 ------
NM_021622chr1022296 2119 --1251 1653
NM_021629chr385026 4878 4722 4536 4099 1278 1089 22 ------
NM_021637chrX21340 978 1848 ----
NM_021638chr444213 3828 1465 680 --1511 --
NM_021639chr12775 172 ------
NM_021643chr261875 1625 1441 665 558 232 11901 ----
NM_021648chr622720 2568 12611 22425 427 1655
NM_021783chrX2865 47 --11896 --
NM_021809chr2052480 1735 1660 997 43 --11886 --
NM_021813chr645605 3684 3646 2295 14146 11590 --
NM_021814chr621602 1572 ------
NM_021825chr11----1167 --
NM_021905chr672258 2239 1796 840 497 280 46 ------
NM_021911chr585457 5294 5009 4623 1628 846 625 407 23782 979 15076 --
NM_021912chr1533580 3509 3024 11681 1405 --
NM_021913chr1931302 1239 116 21543 725 --11190
NM_021942chr41938 1179 ----
NM_021943chr632029 331 33 --11704 12110
NM_021946chrX2430 65 --1422 --
NM_021947chr1711382 11280 2453 36 --
NM_021954chr1382635 2511 1369 1309 1232 318 179 164 --13660 --
NM_021960chr141990 1817 837 534 12605 ----
NM_021961chr11137398 5870 5382 5376 4762 4644 2685 2678 2536 2033 1313 252 181 57167 6274 2969 2580 2200 26871 5536 1640
NM_021964chr335746 4721 1731 22486 1361 26245 5265 1485
NM_021977chr693838 3500 2842 2496 1560 950 545 405 276 --11109 --
NM_021999chr13----1191 --
NM_022041chr1622262 2076 21023 560 ----
NM_022048chr15126361 5807 5692 5515 5460 5401 5358 5160 4184 2247 1948 806 26185 719 ----
NM_022049chr121184 480 ----11447
NM_022072chr31249 1229 ----
NM_022073chr1441518 573 473 138 ------
NM_022080chr2061756 1053 998 405 357 322 151 1865 --
NM_022114chr154422 4371 3905 3807 2993 13665 11093 11705
NM_022123chr141233 ------
NM_022138chr621523 500 --1215 11203
NM_022143chr71461 ------
NM_022166chr16106146 5712 5303 4878 4861 4641 4574 2435 1720 274 11489 25583 1541 --
NM_022336chr252004 1756 365 161 23 ------
NM_022346chr431376 1176 100 1932 11203 --
NM_022351chr833746 3487 1078 --149 --
NM_022373chr7--1298 ----
NM_022459chr1376314 6035 5898 2452 2384 1888 220 180 34825 4414 4227 --
NM_022469chr142855 1350 193 107 --1149 1942
NM_022474chr1451101 840 587 271 127 12244 ----
NM_022476chr161712 ----1203
NM_022482chr2011748 2753 723 ----
NM_022494chr102450 103 ------
NM_022495chr14------1391
NM_022566chr152430 194 ------
NM_022648chr2104280 4145 3555 3069 2861 1807 878 659 587 322 11179 23254 981 --
NM_022652chr122387 34 --1330 --
NM_022658chr1231310 1278 1196 ------
NM_022735chr151806 1756 1712 1519 1420 --1386 1361
NM_022743chr1----136 --
NM_022749chr811003 --21410 949 --
NM_022753chr142363 902 210 68 --11085 --
NM_022756chr121499 350 1148 ----
NM_022763chr362849 2785 983 797 383 311 ----12648
NM_022776chr321398 580 --21449 403 --
NM_022781chr942832 2445 1142 35 --22528 1136 --
NM_022810chrX------167
NM_022822chr111112 ------
NM_022823chr21456 ------
NM_022824chr521322 113 --1134 --
NM_022841chr1522409 179 32122 814 60 ----
NM_022845chr161832 12025 ----
NM_022893chr242325 2035 1121 247 1889 ----
NM_022894chr231107 559 441 21745 385 ----
NM_022898chr1484817 4776 4565 4103 3418 542 150 108 --21162 1020 --
NM_022912chr232654 1900 479 12327 22763 2524 --
NM_022918chr111343 ------
NM_022977chrX22641 377 ------
NM_023000chr1421660 1101 ------
NM_023001chr1421660 1101 ------
NM_023002chr1952105 1771 1674 1361 782 --12083 --
NM_023009chr13618 543 51 1504 ----
NM_023010chrX1777 --126 1569
NM_023015chr11528 ----1769
NM_023018chr161471 1285 519 357 234 78 --21132 1109 --
NM_023037chr132419 106 --173 --
NM_023074chr194947 441 295 241 ----11062
NM_023076chr1662724 2694 2532 2318 2212 951 ------
NM_023079chr1751842 1714 1362 1283 463 21494 574 ----
NM_023105chr852409 1907 1603 680 418 1851 12261 --
NM_023106chr852409 1907 1603 680 418 1851 12261 --
NM_023110chr852409 1907 1603 680 418 1851 12261 --
NM_023111chr852409 1907 1603 680 418 1851 12261 --
NM_023925chr12------139
NM_024007chr532648 2067 316 21200 648 11236 --
NM_024016chr171797 1631 1696 --
NM_024077chr91152 1736 ----
NM_024090chr411331 1577 ----
NM_024092chr1171256 1105 1054 501 395 196 182 ------
NM_024312chr12174 ------
NM_024345chr975101 4997 4366 4351 3826 2127 601 35564 4068 1195 ----
NM_024408chr151350 1239 590 460 133 --1696 --
NM_024501chr21193 ----1227
NM_024519chr162318 225 ------
NM_024524chr312463 1992 ----
NM_024546chr1351294 949 396 187 34 11140 ----
NM_024548chr31385 1135 --1666
NM_024563chr541569 567 445 415 11690 21928 1871 --
NM_024565chr551632 1344 1240 644 545 --1426 --
NM_024569chr132769 899 323 --11894 --
NM_024586chr11250 ------
NM_024594chr511810 ----11658
NM_024607chr874472 3895 3125 1521 592 419 194 --11414 --
NM_024612chr17----11072 --
NM_024624chr231639 1112 25 11592 ----
NM_024639chr672951 1906 1897 911 826 761 621 32090 738 534 ----
NM_024646chr151049 1031 682 465 170 13446 --13543
NM_024665chr364548 4538 3987 1421 1071 465 14025 --11728
NM_024713chr1511208 11184 ----
NM_024721chr852097 2019 1886 881 643 ------
NM_024740chr11114108 2843 2824 2601 1518 1400 588 528 376 201 194 12591 ----
NM_024742chr1651499 1291 483 477 179 1610 1391 --
NM_024744chr22442 255 150 1674 --
NM_024749chr142224 1649 765 395 ------
NM_024755chr152920 343 ------
NM_024770chr286615 6487 6305 6075 5799 5746 1207 488 16093 26630 1196 --
NM_024778chrX--1194 ----
NM_024779chr1261275 1127 1105 1095 432 185 11111 ----
NM_024785chr231175 1026 312 --1538 --
NM_024798chr1522493 2273 153 12311 --
NM_024811chr1111936 --11721 --
NM_024812chr861961 827 815 692 635 623 21734 135 144 21633 1619
NM_024817chr1565953 5492 5278 5066 4891 2211 11581 ----
NM_024824chr1431666 1491 149 ------
NM_024828chr91264 1200 ----
NM_024830chr51114 --1295 --
NM_024835chr17122 ------
NM_024875chr1031552 1527 254 --11564 --
NM_024913chr721190 445 41783 1401 690 371 ----
NM_024944chr2121248 845 21214 439 ----
NM_024947chr3119366 9280 7407 6672 6260 6183 5853 2910 2337 770 501 48977 3572 2396 1057 --21427 542
NM_024949chr484500 3819 3353 1947 969 812 584 383 11422 34729 1212 887 --
NM_024953chr1242654 2161 1762 775 --22529 1801 --
NM_024989chr2107856 7614 7068 6865 6399 6074 5870 1637 1417 551 17119 28197 1980 15711
NM_024991chr1022502 1155 13157 ----
NM_025004chr112622 202 ------
NM_025054chr823280 1598 1858 12836 --
NM_025061chr1931070 266 69 ------
NM_025073chr163439 3113 1708 904 693 55 34188 3926 1365 185 --
NM_025077chr12222 105 ------
NM_025090chr1751148 1043 983 536 394 --1324 1191
NM_025134chr16--22550 1724 ----
NM_025146chr352763 885 394 314 114 22300 2180 ----
NM_025147chr22827 220 ------
NM_025152chr1471424 636 451 440 428 415 130 11874 1724 --
NM_025154chr711490 --1335 --
NM_025160chr154020 3578 2831 1014 310 13916 34341 3856 3250 --
NM_025164chr1142153 1708 238 156 1672 ----
NM_025191chr123109 613 21426 1002 ----
NM_025195chr841649 1628 1597 1381 ------
NM_025202chr261029 915 667 350 284 162 ------
NM_025205chr42575 232 ------
NM_025208chr1142358 1783 901 401 ----12033
NM_025221chr421278 908 ------
NM_025235chr1022145 1587 --2889 355 12218
NM_030621chr1483475 3337 3223 2875 2623 1674 1592 507 --12723 --
NM_030623chr21698 167 ----
NM_030625chr1012573 1356 2798 785 --
NM_030627chr533782 2935 95 14003 ----
NM_030647chr755879 5862 1874 1741 1601 14797 45938 2439 2281 292 24784 4245
NM_030648chr465490 5217 4362 3568 2009 255 23726 684 --15211
NM_030650chr262880 2609 1706 1694 1194 651 ------
NM_030660chr1431343 1046 373 --11014 --
NM_030664chr1032355 1819 417 ----11680
NM_030670chr1221906 667 21722 1713 ----
NM_030671chr1221906 667 21722 1713 ----
NM_030674chr1254752 4288 1952 1279 904 25854 5287 1672 --
NM_030762chr121382 11614 ----
NM_030780chr821762 415 ------
NM_030799chr542229 1825 1792 1774 12126 ----
NM_030806chr1108260 6108 5822 2855 2761 2075 2014 1203 780 265 23619 1539 47155 7033 5789 2088 --
NM_030816chr133597 2278 198 23558 401 ----
NM_030881chr2252437 2321 1775 149 59 ------
NM_030915chr242313 2023 1958 99 --11927 --
NM_030917chr41182 ------
NM_030918chr144132 3910 1092 223 15388 12120 --
NM_030926chr251120 912 259 250 33 ------
NM_030927chr1021023 656 --1246 --
NM_030948chr6133 ------
NM_030949chr621343 507 --190 --
NM_030964chr563286 3259 2431 1206 541 404 22880 2422 33465 792 730 --
NM_031157chr122477 215 ------
NM_031206chrX2150 24 ------
NM_031216chr1842087 1920 1598 1447 ------
NM_031217chr111210 ----1177
NM_031243chr7--12280 21910 1604 11681
NM_031262chr9----191 1942
NM_031263chr9----1148 1999
NM_031268chr1674368 4195 3721 3521 1986 1511 1352 ----13481
NM_031314chr1431896 132 117 11558 ----
NM_031369chr4------1324
NM_031370chr4------1324
NM_031372chr471658 1594 1291 541 512 183 136 ------
NM_031411chr542035 772 340 142 11744 ----
NM_031418chr1122551 1774 ------
NM_031419chr331543 538 487 --11171 --
NM_031426chr962275 2184 1034 939 308 137 --22455 1124 --
NM_031427chr1435448 4858 242 ------
NM_031431chr1321777 1662 --11628 --
NM_031438chr5--3551 318 150 1144 --
NM_031439chr831699 1406 1206 11713 ----
NM_031442chrX42517 2104 1203 1016 12968 32926 2546 2022 --
NM_031445chr252993 2967 2792 2169 1071 --13287 --
NM_031452chr15----166 --
NM_031453chr1041824 770 498 240 ----12147
NM_031461chr8--1285 22009 1839 --
NM_031468chr7137446 7381 6884 6752 6237 5204 3027 2887 2798 1611 1591 880 207 ------
NM_031483chr2062872 2733 2406 850 133 54 1255 1479 --
NM_031844chr153666 3318 2849 1359 729 12822 1328 --
NM_031845chr252461 1351 862 721 685 ------
NM_031847chr252461 1351 862 721 685 ------
NM_031849chr542035 772 340 142 11744 ----
NM_031857chr542035 772 340 142 11744 ----
NM_031860chr542035 772 340 142 11744 ----
NM_031889chr451926 709 685 106 97 --11623 --
NM_031890chr2283068 2934 2310 2246 1111 506 436 56 --1135 --
NM_031892chrX2939 762 ------
NM_031900chr52614 403 ------
NM_031904chr1192120 2080 1998 1971 1580 1496 344 337 56 ------
NM_031953chr41441 ------
NM_031954chr12122790 2715 1788 1175 1169 1077 993 820 771 415 214 173 ------
NM_031964chr173283 140 75 --2317 106 --
NM_031966chr5--1177 ----
NM_032012chr955199 4106 3872 3720 1210 24056 1291 ----
NM_032041chr872508 2480 2291 910 888 231 41 1291 1655 --
NM_032042chr542775 2500 1867 605 ------
NM_032047chr331910 967 507 --11996 --
NM_032102chr1123045 700 13142 ----
NM_032145chr631815 1662 470 11232 11305 --
NM_032146chr31341 ------
NM_032156chr12------139
NM_032160chr1843227 2765 1057 120 --1978 --
NM_032174chr111027 ----11170
NM_032182chr1031503 1418 296 2349 225 ----
NM_032186chr11236 --11178 --
NM_032189chr1394675 4533 4373 4275 4079 3653 1215 1029 810 --23661 236 --
NM_032199chr1013243 32715 1023 720 ----
NM_032208chr242717 2476 1339 560 ----13400
NM_032217chr41281 ----11372
NM_032221chr2011519 ------
NM_032228chr1153544 3433 3399 2750 556 22849 2449 1886 --
NM_032242chr373310 3156 2718 2441 1159 859 89 --22824 979 --
NM_032268chr1652956 2793 2625 2196 292 12158 22493 705 --
NM_032288chr331892 1841 207 ------
NM_032305chr1----126 --
NM_032316chr3102126 1909 1836 1675 1592 639 460 317 203 116 ------
NM_032329chr2104231 3920 3889 1636 1536 1495 1482 1390 1188 806 14016 ----
NM_032352chr1411340 1307 ----
NM_032357chr23640 127 40 1582 ----
NM_032373chr1085822 5731 4999 4809 4714 1758 1204 492 1321 25353 5310 --
NM_032379chr112842 322 ------
NM_032382chr161557 ------
NM_032408chr731215 1162 1137 --1118 --
NM_032410chr84945 780 393 286 --1507 --
NM_032427chr111646 --1449 --
NM_032429chr102527 212 ------
NM_032431chr113976 851 61 --2832 247 --
NM_032434chr25988 535 339 313 151 11015 ----
NM_032452chr142296 171 ----1393
NM_032457chr423730 3355 --13494 --
NM_032458chrX52907 2739 899 477 285 13269 --13207
NM_032466chr831696 1637 575 ------
NM_032468chr831696 1637 575 ------
NM_032491chr1231251 1205 458 --2498 410 --
NM_032505chr321117 55 12568 --1529
NM_032509chr81617 1383 1328 --
NM_032510chr1822210 1865 --1949 --
NM_032521chr2033013 2983 829 ------
NM_032547chr41289 11097 ----
NM_032550chr1031121 992 259 1375 1390 --
NM_032552chr941551 1227 712 258 --11241 11913
NM_032557chr41987 ------
NM_032558chr941416 931 922 522 --11107 --
NM_032560chr141950 1799 ----
NM_032569chr1631928 1290 265 31706 1632 371 ----
NM_032574chr21232 ------
NM_032578chr1021510 1397 ------
NM_032581chr711867 1114 ----
NM_032582chr1721171 568 --11451 --
NM_032632chr1441943 1712 772 52 --1750 --
NM_032649chr181135 ------
NM_032682chr353362 3044 3027 2790 86 ------
NM_032711chr17173923 3807 3762 3734 3709 3609 3589 3042 2887 2861 2778 1444 1259 1245 816 381 356 --13627 --
NM_032717chr411047 11079 ----
NM_032727chr1031611 1430 107 ------
NM_032731chr1751387 949 117 33 25 2985 44 ----
NM_032737chr1932428 1939 894 11765 22663 1670 --
NM_032778chr373066 2865 2666 2496 1163 313 202 ----13015
NM_032781chr113807 392 125 --3945 349 334 --
NM_032784chr61211 ------
NM_032801chr1132131 1970 537 --31987 1851 1834 --
NM_032809chr931436 1042 435 --41025 1014 604 382 --
NM_032833chr13941 259 83 --21769 56 --
NM_032837chr1752032 1702 1527 1438 643 2767 517 ----
NM_032846chr1451126 1014 453 168 27 ------
NM_032859chr1324021 1071 --12875 --
NM_032870chr62516 212 --172 --
NM_032873chr1143318 861 510 241 --33352 197 45 --
NM_032880chr1----1110 --
NM_032900chr1073894 3032 2930 1328 1274 1141 594 13779 ----
NM_032905chr10----11052 1832
NM_032906chr41130 1163 1554 --
NM_032927chr4142 ------
NM_032932chr17105941 5401 4597 4296 4164 3938 2342 950 813 511 35648 2524 1204 24425 474 --
NM_032940chr161845 ------
NM_032943chr112842 322 ------
NM_032966chr1121597 250 --11361 1112
NM_032975chr1873616 3307 2735 2607 2412 1026 231 12705 21171 200 --
NM_032980chr1873616 3307 2735 2607 2412 1026 231 12705 21171 200 --
NM_032982chr772073 2055 809 543 469 330 94 1446 11993 --
NM_032983chr782887 2869 2361 1357 1283 1144 908 401 21260 184 12807 --
NM_033020chr114328 2972 263 --11453
NM_033023chr751261 1014 480 124 103 ------
NM_033030chr211511 1193 1319 --
NM_033056chr10--2692 231 ----
NM_033083chr342291 2199 1309 685 11231 ----
NM_033132chr1341895 1794 924 587 ------
NM_033135chr1142358 1783 901 401 ----12033
NM_033138chr742302 2175 1853 513 11501 11487 --
NM_033139chr742302 2175 1853 513 11501 11487 --
NM_033140chr742302 2175 1853 513 11501 11487 --
NM_033141chr1491956 1650 1547 1540 1451 1400 741 735 199 --11796 1516
NM_033157chr742302 2175 1853 513 11501 11487 --
NM_033181chr663329 3181 1108 1044 960 439 23021 789 ----
NM_033201chr1641231 926 476 53 ------
NM_033211chr522068 118 ----1677
NM_033224chr7127421 7284 7175 6213 6176 6113 4901 2199 2169 1446 692 448 ------
NM_033225chr841152 623 584 536 12420 21254 413 --
NM_033260chr62759 280 ------
NM_033278chr111407 ------
NM_033280chr181121 ------
NM_033281chr5142 ------
NM_033285chr854424 3164 1335 1002 959 --24498 267 --
NM_033290chrX63761 3377 2638 976 806 113 --1170 --
NM_033326chr1112526 32272 308 286 ----
NM_033331chr973390 3088 2979 2715 744 553 313 ------
NM_033360chr1234288 1178 380 23720 615 11662 --
NM_033364chr351702 1417 611 521 489 --1207 --
NM_033375chr173930 610 490 11182 ----
NM_033380chrX2776 72 ------
NM_033381chrX2776 72 ------
NM_033389chr1764865 4496 3730 3477 3287 569 24589 1205 64366 3816 3294 1212 895 836 13878
NM_033393chr432907 1164 87 1675 11072 --
NM_033425chr1142987 2498 1311 676 1655 12151 1248
NM_033429chr15----21288 71 --
NM_033430chr453523 3152 2638 813 88 13765 2518 47 --
NM_033437chr453523 3152 2638 813 88 13765 2518 47 --
NM_033449chr522167 1538 1194 ----
NM_033480chr652653 2589 2137 1096 483 --12458 --
NM_033481chr652653 2589 2137 1096 483 --12458 --
NM_033503chr1553817 3223 3054 335 244 12346 183 --
NM_033505chr286226 5981 4778 4524 1740 1206 926 540 11156 25811 2596 --
NM_033512chr8102769 2439 927 671 588 500 401 308 282 148 22991 2226 33038 2948 655 --
NM_033515chr641193 1028 319 277 --1990 --
NM_033535chr41796 ------
NM_033624chr1242010 439 285 257 --1465 --
NM_033626chrX5709 405 391 375 312 --1366 --
NM_033631chr143232 2462 1421 394 --23259 2610 --
NM_033632chr441553 1089 372 105 ------
NM_033637chr1064023 3681 2945 2655 476 237 --1733 --
NM_033642chrX41188 1149 877 366 1905 ----
NM_033656chr2184193 4030 2247 1944 1821 1597 1588 782 34756 390 85 1897 --
NM_052821chr951971 1829 1700 643 249 --2575 69 --
NM_052832chr822539 31 ------
NM_052834chr1842363 1943 520 68 ------
NM_052840chr1551281 1201 558 552 183 ------
NM_052845chr1242858 2786 2324 2014 --21275 938 --
NM_052864chr432044 822 480 --1276 --
NM_052868chr13237 196 38 ------
NM_052879chr122887 644 23043 988 13904 --
NM_052885chr1254721 3850 3079 1384 1154 --1419 --
NM_052886chr8--32077 1426 580 ----
NM_052898chr811390 11862 31399 1181 332 --
NM_052900chr82456 427 ------
NM_052905chr231797 1638 395 --1670 --
NM_052917chr253307 2629 2279 450 31 12328 ----
NM_052918chr1093563 3288 2697 2675 1261 1050 1039 951 117 13145 22818 1409 --
NM_052927chr521754 1520 1164 ----
NM_052936chrX2654 32 ------
NM_053016chr987912 7711 6966 5529 5516 5089 2149 368 --25738 238 --
NM_053023chr1163329 2620 2154 387 213 176 ------
NM_053024chr361253 1182 1172 355 257 123 1588 1159 --
NM_053042chr453131 2539 970 559 491 11234 1444 --
NM_053043chr793988 2565 2281 1678 637 465 298 127 114 --15306 --
NM_053053chr13667 371 208 --1284 --
NM_053056chr1153033 2373 2353 702 207 --22631 982 12521
NM_053064chr1442876 2850 1896 388 12297 1656 --
NM_053281chrX1297 1365 ----
NM_054016chr141940 1750 465 222 ------
NM_054016chr141940 1750 465 222 ------
NM_054016chr141940 1750 465 222 ------
NM_054110chr33840 377 231 ------
NM_057169chr1262986 2967 2914 2114 1225 602 ------
NM_057170chr1262986 2967 2914 2114 1225 602 ------
NM_057175chr442054 600 359 114 12084 1650 --
NM_057178chr174304 233 160 52 ------
NM_058170chr151172 1091 373 342 218 ------
NM_058237chr141723 2406 353 ----
NM_078467chr621460 1258 --31467 1395 274 191
NM_080491chr1163864 3729 3088 2614 2555 298 --13640 --
NM_080538chr331321 1040 78 1192 11269 --
NM_080539chr331321 1040 78 1192 11269 --
NM_080541chr331321 1040 78 1192 11269 --
NM_080546chr932087 1866 735 21762 279 11618 --
NM_080599chr1021030 414 ------
NM_080617chr2031050 181 92 ------
NM_080632chrX1777 --126 1569
NM_080645chr64831 674 565 546 1377 1590 --
NM_080666chr1431540 1481 374 --11433 --
NM_080669chr1763720 3663 3080 1546 1531 1120 11217 24370 3992 --
NM_080671chr232211 428 74 ------
NM_080723chr641294 447 404 110 ------
NM_080725chr2041680 1488 1330 792 --11833 --
NM_080742chr62218 208 ------
NM_080743chr622515 2354 22154 2145 1445 --
NM_080759chr133925 423 127 12375 ----
NM_080760chr133925 423 127 12375 ----
NM_080874chr42352 186 11849 --11865
NM_080927chr373341 3315 1014 770 659 384 218 --1682 --
NM_130391chr92947 924 --23383 3357 --
NM_130392chr92947 924 --23383 3357 --
NM_130393chr92947 924 --23383 3357 --
NM_130434chr1511101 ------
NM_130436chr2162645 2525 1788 1097 446 286 ------
NM_130438chr2173222 3102 2365 2112 1023 863 263 ------
NM_130809chr553076 2392 2153 2069 340 23014 2404 12317 --
NM_130811chr204455 347 175 130 --1168 --
NM_130830chr393987 3436 3241 3181 2649 2485 895 680 303 --11508 --
NM_130838chr1521557 108 1569 1738 --
NM_130839chr1521557 108 1569 1738 --
NM_130846chr1231034 957 412 ------
NM_133170chr20136978 6795 6646 6406 6049 5813 5022 1979 1023 760 667 312 141 25891 2253 36694 693 411 --
NM_133264chr1762600 1335 990 938 572 140 --1279 --
NM_133265chrX43372 3052 2812 613 32755 1464 1066 ----
NM_133370chr453254 2900 2646 296 284 13675 --13649
NM_133372chr562884 2831 2179 2158 804 352 32819 2684 2509 ----
NM_133445chr953762 3687 3306 2820 2627 2935 378 13633 --
NM_133476chr1231065 1037 1010 1441 151 --
NM_133478chr22578 103 12200 ----
NM_133486chrX--1108 ----
NM_133493chr644260 4191 3777 220 11708 ----
NM_133496chr153332 1068 407 289 281 ------
NM_133509chr1441170 898 824 140 ------
NM_133625chr31970 1315 ----
NM_133631chr331666 1467 314 11029 ----
NM_133634chr212702 97 11789 11683 --
NM_133646chr21406 15581 1836 --
NM_134442chr241241 696 616 593 ------
NM_138270chrX32887 1111 494 12721 ----
NM_138286chr1943942 3469 3318 2852 23242 3227 13994 12700
NM_138288chr1421944 381 11772 1172 --
NM_138292chr1173460 3202 2594 2423 1299 1085 1029 ------
NM_138300chr151587 1548 1476 1172 333 ------
NM_138333chr952319 2029 1826 1681 1644 ------
NM_138344chr143389 380 374 ------
NM_138373chr1931903 1610 45 --21459 541 --
NM_138381chr382431 1985 1916 1828 859 727 293 60 22353 104 1661 --
NM_138415chr2211671 11865 21789 413 --
NM_138426chr732250 880 348 1364 1274 12513
NM_138459chr663667 2836 2513 2274 1198 372 13176 12249 1144
NM_138468chr295987 5629 4998 4533 4236 2504 2070 1250 1060 14881 26051 787 --
NM_138473chr12105075 4981 4261 1847 1599 1381 1156 880 673 587 11456 ----
NM_138479chr131749 1436 439 --1395 --
NM_138485chr31330 ------
NM_138558chr12844 186 ------
NM_138559chr22426 362 ------
NM_138576chr1484817 4776 4565 4103 3418 542 150 108 --21162 1020 --
NM_138609chr54537 415 235 223 1483 ----
NM_138610chr54537 415 235 223 1483 ----
NM_138621chr243800 3766 3521 1067 12892 --12827
NM_138633chr641494 1440 1293 150 1481 ----
NM_138701chr72313 272 ------
NM_138713chr16178150 8062 7963 7832 7734 7287 6431 5262 2167 1730 1709 1589 1408 1060 763 376 45 47173 6642 2115 998 11366 --
NM_138714chr16178150 8062 7963 7832 7734 7287 6431 5262 2167 1730 1709 1589 1408 1060 763 376 45 47173 6642 2115 998 11366 --
NM_138727chr141926 1597 1526 215 --21850 1806 --
NM_138728chr141926 1597 1526 215 --21850 1806 --
NM_138735chr22454 257 ------
NM_138766chr51207 1571 ----
NM_138782chr562341 1974 810 292 96 63 --11550 --
NM_138799chr21379 --11684 --
NM_138821chr51207 1571 ----
NM_138822chr51207 1571 ----
NM_138967chr1572462 1617 1556 694 676 256 250 12127 ----
NM_138970chr1462447 2165 2003 1692 741 715 --11813 --
NM_138971chr1153077 1439 1388 996 392 ------
NM_138971chr1153077 1439 1388 996 392 ------
NM_138972chr1153077 1439 1388 996 392 ------
NM_138972chr1153077 1439 1388 996 392 ------
NM_138973chr1153077 1439 1388 996 392 ------
NM_138973chr1153077 1439 1388 996 392 ------
NM_138980chr41457 1645 1504 --
NM_138981chr41588 1776 1635 --
NM_138982chr41457 1645 1504 --
NM_138991chr213287 154 123 ------
NM_138992chr212351 320 198 --158
NM_139014chr641456 385 248 98 11747 11502 --
NM_139045chr91786 ------
NM_139046chr10----151 --
NM_139048chr311063 11133 ----
NM_139057chr1532746 1787 322 --1316 --
NM_139131chr112234 155 ------
NM_139168chr541992 1720 803 651 11929 11911 --
NM_139169chr1041608 858 295 98 12285 1805 --
NM_139276chr1742345 2273 355 293 --1231 --
NM_139283chr1262405 669 504 276 251 133 ------
NM_139321chr2052877 2663 398 326 181 --11189 --
NM_139323chr2021999 1359 --1589 --
NM_144563chr22180 24 ------
NM_144563chr22180 24 ------
NM_144567chr152710 2494 1744 1142 572 ------
NM_144571chr475620 5422 4706 2761 1536 1356 685 26418 4561 ----
NM_144578chr1465116 4238 4197 3577 1070 573 11982 ----
NM_144580chr1141 ------
NM_144595chr132691 378 ----1355
NM_144599chr15154682 4189 4008 3879 3866 3574 3423 3381 1661 1647 1097 713 617 434 404 14874 24654 3855 11580
NM_144600chr1611233 128 ----
NM_144604chr161515 179 ----
NM_144618chr1130 --198 --
NM_144635chr34962 855 282 197 11255 ----
NM_144636chr32714 97 ----1206
NM_144642chr3--1429 --11354
NM_144721chr412174 12290 1195 --
NM_144726chr52226 70 11239 ----
NM_144778chr1322054 566 2322 308 ----
NM_144949chr21205 22472 2293 12550 --
NM_144963chr832562 888 523 ------
NM_144973chr1265351 4596 3444 1994 924 698 14964 ----
NM_144974chr131130 1116 ----
NM_144977chr13640 256 29 2685 85 ----
NM_145049chr521057 855 ----1677
NM_145055chr1863231 3182 2910 2739 658 503 --1744 --
NM_145112chr1431291 1170 1072 --1325 --
NM_145113chr1431563 1442 1344 --1597 --
NM_145117chr111777 23019 856 32502 2097 1095 --
NM_145173chr19112451 2256 2179 2057 2021 1969 1803 578 371 265 219 ------
NM_145176chr631097 1035 905 1312 155 --
NM_145206chr1043051 2080 206 43 12751 ----
NM_145207chr434933 4923 695 25061 4828 1318 --
NM_145251chr141628 21145 443 ----
NM_145259chr2146989 6602 4878 4747 2542 2457 2245 2063 1364 1016 691 594 586 556 46350 5531 1671 92 11446 --
NM_145284chrX51985 1958 1926 908 415 --21726 1565 --
NM_145307chr1023647 3122 ------
NM_145313chr1051555 1432 1095 680 394 ------
NM_145320chr733223 2968 1086 13010 33168 2826 1104 11129
NM_145321chr733223 2968 1086 13010 33168 2826 1104 11129
NM_145322chr733223 2968 1086 13010 33168 2826 1104 11129
NM_145341chr1011236 1472 ----
NM_145686chr262684 2347 1245 975 356 346 ------
NM_145687chr262684 2347 1245 975 356 346 ------
NM_145690chr861577 1501 1331 1278 537 357 11920 ----
NM_145698chr1062099 1776 1602 804 584 71 --11901 --
NM_145725chr14166 ------
NM_145726chr14166 ------
NM_145733chr221468 --1959 --
NM_145753chr321302 596 ----11608
NM_145793chr102665 66 ------
NM_145800chrX7920 853 418 221 213 205 60 1279 1273 --
NM_145802chrX6869 802 367 170 162 154 1228 1222 --
NM_145808chr742933 2465 2419 1200 12046 11229 --
NM_147147chr642667 1680 1519 232 --140 --
NM_147181chr421278 908 ------
NM_147182chr421278 908 ------
NM_147183chr421278 908 ------
NM_147188chr151383 11353 21072 1033 --
NM_147189chr862347 1835 1690 1468 720 597 --11590 1335
NM_148174chr821382 384 21916 230 ----
NM_148894chr43864 830 809 ------
NM_148904chr11250 ------
NM_148905chr11250 ------
NM_148906chr11250 ------
NM_148907chr11250 ------
NM_148908chr11250 ------
NM_148909chr11250 ------
NM_148955chr15135686 5595 4909 4073 2429 2215 2179 2123 1150 1072 730 577 56 --15393 --
NM_152132chr14--1106 ----
NM_152221chr22----138 --
NM_152227chr201707 ------
NM_152261chr1242062 1995 986 645 2998 434 ----
NM_152263chr156051 3811 1503 332 24 --16088 --
NM_152275chr231958 1864 1638 2703 94 ----
NM_152280chr173473 3030 2877 2389 2340 2270 2172 12470 23490 2904 --
NM_152300chr1721834 1682 11234 11485 --
NM_152309chr10170 ------
NM_152330chr1442244 953 768 656 1792 ----
NM_152380chr111356 --188 --
NM_152388chr233704 835 447 11481 ----
NM_152390chr22561 439 ----1451
NM_152406chr531541 1083 286 ------
NM_152409chr513082 22333 299 ----
NM_152417chr821202 69 1227 ----
NM_152418chr8--11822 ----
NM_152420chr94680 502 233 146 --1302 --
NM_152422chr921680 332 11577 11497 1459
NM_152424chrX103926 3522 1805 1619 1576 1316 962 764 705 679 ----13857
NM_152437chr1241707 654 531 167 ----12083
NM_152446chr142851 679 ------
NM_152450chr1542126 1722 1419 531 ------
NM_152451chr151725 1862 1749 --
NM_152455chr1552796 2721 1747 266 90 ------
NM_152470chr1852586 1577 1327 992 343 14097 --11503
NM_152475chr1942659 2405 643 363 --1629 --
NM_152487chr12489 74 ------
NM_152529chr243986 3474 2959 1551 ------
NM_152538chr351366 1179 316 216 22 --31480 1461 400 --
NM_152556chr731760 1730 877 ------
NM_152588chr1241661 650 480 379 1467 ----
NM_152608chr172455 2187 1965 1837 420 366 38 12344 ----
NM_152624chr5137006 6039 4628 2948 2511 2323 1831 1687 811 776 767 215 62 27284 5956 15537 15302
NM_152629chr974087 3716 3264 2692 890 237 132 12880 ----
NM_152636chr1122287 551 1838 12154 --
NM_152638chr121921 11225 ----
NM_152641chr1242242 1970 775 176 ----1685
NM_152660chr12883 73 ------
NM_152678chr342564 2011 1921 1051 3479 434 253 22397 1845 --
NM_152716chr1131392 1272 1059 2605 247 ----
NM_152738chr61319 --1363 --
NM_152739chr71781 ------
NM_152740chr72166 46 ------
NM_152754chr722738 395 13875 12757 --
NM_152756chr563301 3075 2860 1626 1469 445 ------
NM_152758chr83603 255 228 --22680 978 --
NM_152765chr831798 921 336 ------
NM_152780chrX41290 825 464 385 ------
NM_152789chr711191 1999 11501 11145
NM_152793chr7104675 4472 4395 4379 3964 3319 3179 2036 442 232 --44038 3395 1739 1602 --
NM_152826chr15135686 5595 4909 4073 2429 2215 2179 2123 1150 1072 730 577 56 --15393 --
NM_152835chr132204 2198 303 12481 ----
NM_152838chr2022774 2445 --22899 1271 --
NM_152857chr62985 733 --1362 --
NM_152858chr62985 733 --1362 --
NM_152879chr232602 989 832 --22347 391 12157
NM_152890chr1--1420 ----
NM_152896chr92731 179 ------
NM_152902chr161801 1604 1442 691 282 185 --12027 --
NM_152924chr1566809 6792 2399 2183 1160 319 12535 56645 2666 1394 820 406 --
NM_152991chr112699 632 ------
NM_153020chr62620 525 ----1167
NM_153029chr16114054 3997 3773 3029 2782 2735 2714 1472 1286 922 521 11144 24106 1084 --
NM_153047chr61360 ------
NM_153050chr2264945 4307 3440 3138 1537 739 24072 246 ----
NM_153051chr2264945 4307 3440 3138 1537 739 24072 246 ----
NM_153182chr373066 2865 2666 2496 1163 313 202 ----13015
NM_153184chr31489 1522 ----
NM_153201chr11--1214 ----
NM_153207chr1231267 579 433 --1550 --
NM_153208chr162878 628 ------
NM_153226chr101149 ------
NM_153235chr632340 368 64 ------
NM_153262chr152684 2602 1011 440 93 --13132 --
NM_153264chr33828 589 241 ------
NM_153273chr352789 1875 1095 235 59 1665 --1754
NM_153335chr1711191 --21367 482 --
NM_153350chr161420 ------
NM_153353chr3--138 ----
NM_153354chr51126 ------
NM_153367chr10123813 3807 3686 3161 3155 1592 1383 1011 830 508 301 152 --21040 863 11132
NM_153456chr13135859 5784 5769 5307 5045 4687 3880 2360 1255 945 379 178 142 14809 15967 --
NM_153464chr191804 ------
NM_153487chr6134129 3884 3775 3629 3117 2979 1550 1506 1485 1345 1171 357 53 14827 12954 14849
NM_153490chr17129 ------
NM_153607chr543081 3007 2302 1174 22089 417 ----
NM_153619chr1553544 3178 2251 1074 505 --122 --
NM_153633chr12--1239 ----
NM_153634chr1261168 661 461 424 337 236 1583 ----
NM_153649chr132083 508 256 --1149 --
NM_153686chr422214 107 --11899 --
NM_153715chr761269 412 333 301 162 60 1265 ----
NM_153812chr182065 2034 931 860 737 694 461 384 11589 11825 --
NM_153828chr22184 169 ------
NM_153831chr83879 667 46 --186 --
NM_170665chr1273874 3553 3511 3198 1821 863 198 --2406 273 --
NM_170679chr54896 475 452 137 ------
NM_170692chr12836 150 --1794 --
NM_170695chr181141 ------
NM_170696chr1531638 371 322 ------
NM_170697chr1531638 371 322 ------
NM_170706chr174083 3548 3328 1629 1616 538 275 --11585 14071
NM_170721chr1731019 170 137 21210 113 --1450
NM_170731chr1162702 2570 2559 1761 1128 335 ------
NM_170732chr1162702 2570 2559 1761 1128 335 ------
NM_170733chr1162702 2570 2559 1761 1128 335 ------
NM_170734chr1162702 2570 2559 1761 1128 335 ------
NM_170735chr1162702 2570 2559 1761 1128 335 ------
NM_170750chrX144 1358 --1200
NM_172037chr821427 956 ------
NM_172071chr1106078 5600 5232 2683 2614 2589 1934 1499 1236 257 15731 16348 --
NM_172103chr632688 2401 1654 199 ----
NM_172105chr632688 2401 1654 199 ----
NM_172127chr461993 1958 1469 1359 380 78 11410 ----
NM_172128chr461949 1914 1425 1315 336 34 11366 ----
NM_172230chr113976 851 61 --2832 247 --
NM_172373chr1311209 ------
NM_172387chr1821701 1520 ------
NM_172388chr1821748 1567 ------
NM_172389chr1821748 1567 ------
NM_173054chr72219 204 --1756 --
NM_173082chr62625 600 ------
NM_173157chr12--1205 ----
NM_173198chr952638 2630 2441 732 94 22707 630 --2884 428
NM_173200chr952638 2630 2441 732 94 22707 630 --2884 428
NM_173207chr181141 ------
NM_173208chr181141 ------
NM_173209chr181141 ------
NM_173210chr181141 ------
NM_173211chr181141 ------
NM_173214chr16178150 8062 7963 7832 7734 7287 6431 5262 2167 1730 1709 1589 1408 1060 763 376 45 47173 6642 2115 998 11366 --
NM_173359chr34478 262 125 28 ------
NM_173468chr445269 4390 3815 2397 1100 ----
NM_173470chrX42434 2348 587 485 --1701 --
NM_173495chrX41921 1882 934 911 ----12300
NM_173496chr1032789 247 26 --1487 --
NM_173500chr152204 64 11231 ----
NM_173511chr263987 2526 1066 826 604 27 --13075 --
NM_173535chr24473 431 188 53 ------
NM_173536chr435130 1639 600 13800 15147 --
NM_173552chr342407 1636 506 204 ------
NM_173576chr103879 858 34 ------
NM_173582chr1165871 5207 3874 743 687 266 46056 4373 3969 1803 24878 2513 --
NM_173595chr12105165 4862 4362 3630 1694 1442 991 498 356 246 --34721 4545 2017 --
NM_173602chr1283794 3191 2740 2601 1082 1029 741 419 1735 11075 13764
NM_173644chr2041739 1645 1373 164 11351 ----
NM_173670chr55993 963 802 633 253 --2828 328 --
NM_173685chr8------1205
NM_173694chrX32237 1732 596 138 11609 --
NM_173808chr123622 213 14483 ----
NM_173812chr1211177 --1492 --
NM_173822chr231973 781 406 1827 1741 --
NM_173825chr383078 3012 3004 2607 1029 196 188 67 ------
NM_173829chr566065 5219 4168 585 381 269 25008 810 12462 --
NM_173830chr6--1235 ----
NM_173832chr883585 3382 2548 2489 1463 1455 114 75 --23803 3643 --
NM_173848chr82843 724 ------
NM_173851chr852988 2588 2568 2434 215 --1944 --
NM_173854chr152042 1894 953 554 340 ----12347
NM_174886chr181141 ------
NM_174890chr103646 246 25 ------
NM_174911chr863681 3340 3031 1153 812 250 13941 1892 --
NM_175610chr153976 902 346 ------
NM_175736chr12116296 5330 5297 1895 1884 1878 1707 1657 1105 580 349 25625 2189 12075 --
NM_175747chr621060 861 --1394 --
NM_175767chr51668 1538 ----
NM_175854chr1331847 1759 587 ------
NM_175856chr54753 328 148 122 ------
NM_175863chr63306 284 70 ------
NM_175866chr131458 1354 336 --1496 --
NM_175907chr1832302 667 330 --11069 --
NM_175920chr5--1310 1177 --
NM_176081chr10105898 5887 4186 4123 1773 1358 841 716 315 118 14360 ----
NM_176083chr10105898 5887 4186 4123 1773 1358 841 716 315 118 14360 ----
NM_176823chr191451 1243 1103 1056 1028 568 448 248 49 33100 976 684 1596 --
NM_176863chr1742077 1865 1417 1335 1752 21775 324 --
NM_177398chr121596 780 --2706 666 11213
NM_177399chr121596 780 --2706 666 11213
NM_177401chr1941591 1339 1311 1168 --11616 --
NM_177414chr131505 1096 242 1250 11198 --
NM_177424chr131972 1313 337 ------
NM_177438chr1483475 3337 3223 2875 2623 1674 1592 507 --12723 --
NM_177524chr7--11111 ----
NM_177525chr7--11111 ----
NM_177559chr2031202 856 110 ------
NM_177560chr2031202 856 110 ------
NM_177947chrX31564 393 192 ------
NM_177948chrX31564 393 192 ------
NM_177951chr14188 1150 173 --
NM_177952chr143604 551 295 ------
NM_177972chr1174373 2820 2800 1460 809 734 696 ------
NM_177976chr31341 ------
NM_177977chr17111907 1866 1826 1783 1739 1690 1681 1373 1313 1289 750 ------
NM_177983chr2170 ------
NM_177985chr231898 1768 581 --1612 --
NM_177990chr20------2668 170
NM_177995chr921680 332 11577 11497 1459
NM_177996chr2063412 3322 2872 2863 694 458 --1770 --
NM_178011chr1032973 2667 72 11282 --13263
NM_178013chr1493081 2692 1040 781 701 340 273 232 150 ------
NM_178037chr1222939 712 --21366 1084 1798
NM_178038chr1222939 712 --21366 1084 1798
NM_178120chr231152 444 373 --11297 --
NM_178123chr21896 --1426 --
NM_178140chr542334 2326 2289 850 12410 11002 --
NM_178151chrX57830 5547 2558 1335 77 27019 848 12943 17484
NM_178152chrX57830 5547 2558 1335 77 27019 848 12943 17484
NM_178153chrX57830 5547 2558 1335 77 27019 848 12943 17484
NM_178270chrX2654 32 ------
NM_178313chr262155 2103 1780 1562 1479 1355 ------
NM_178423chr73805 159 80 --1854 --
NM_178424chr51146 ------
NM_178425chr73805 159 80 --1854 --
NM_178426chr142379 2221 742 509 --12156 --
NM_178427chr142279 2121 642 409 --12056 --
NM_178496chr331392 612 414 1948 21228 1030 --
NM_178498chr1152472 1348 1023 717 600 1816 ----
NM_178502chr126589 542 521 506 475 236 ------
NM_178509chr1753328 1540 1332 996 559 ------
NM_178539chr1261975 1432 403 393 385 224 11918 ----
NM_178566chr911252 11626 ----
NM_178578chr2032547 221 81 12047 --12056
NM_178585chr423001 2521 21244 1010 22194 991 --
NM_178586chr1431556 610 314 12435 32323 1564 220 --
NM_178812chr8145 ------
NM_178815chr1062760 2543 1972 1936 990 305 12689 ----
NM_178831chr742894 2867 2210 499 32490 2459 163 12103 --
NM_180976chr63684 190 89 ------
NM_180977chr63684 190 89 ------
NM_181054chr142983 325 ------
NM_181077chr1552089 1667 930 416 326 ------
NM_181310chr621628 1301 ----1381
NM_181349chr722905 1174 32992 2390 1038 ----
NM_181351chr1143024 2630 2415 2121 --1143 --
NM_181354chr831651 1299 172 11485 ----
NM_181358chr194190 3555 3155 2889 2808 1590 1564 304 120 ------
NM_181361chr31169 1150 1344 --
NM_181425chr92400 21 2473 319 ----
NM_181442chr204719 327 175 75 ------
NM_181453chr221377 1175 11418 ----
NM_181457chr231327 962 534 1283 ----
NM_181458chr221460 1095 1416 ----
NM_181459chr231226 861 433 1182 ----
NM_181460chr231273 908 480 1229 ----
NM_181481chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_181482chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_181483chr18147043 6369 6175 5932 5732 5610 5131 4963 4861 4683 4664 2342 1841 646 16516 24718 4544 --
NM_181504chr524154 2663 13193 ----
NM_181521chr16117197 7178 6305 6275 4542 2783 2289 1651 541 107 71 --36742 5938 2626 --
NM_181523chr524154 2663 13193 ----
NM_181524chr524154 2663 13193 ----
NM_181645chr112206 105 1164 ----
NM_181670chr12121 21353 1287 ----
NM_181671chr171950 ------
NM_181672chrX42065 1939 1446 578 ----11435
NM_181673chrX42065 1939 1446 578 ----11435
NM_181702chr81255 11028 1353 --
NM_181704chr2151435 1276 514 406 310 --1967 --
NM_181714chr641475 743 229 97 ------
NM_181726chr41196 ------
NM_181741chr231134 328 137 --1148 --
NM_181742chr231134 328 137 --1148 --
NM_181782chr6--11584 12223 --
NM_181787chr841392 1328 588 180 --2230 72 1892
NM_181802chr204179 125 61 22 ------
NM_181809chr174059 3941 2780 1492 1371 1307 443 --21378 459 --
NM_181828chr2293591 3583 3319 2529 2447 1504 1205 842 311 --23502 372 --
NM_181829chr2293591 3583 3319 2529 2447 1504 1205 842 311 --23502 372 --
NM_181830chr2293591 3583 3319 2529 2447 1504 1205 842 311 --23502 372 --
NM_181839chr831132 412 357 1977 ----
NM_181861chr124498 437 282 222 22516 2386 ----
NM_181868chr124498 437 282 222 22516 2386 ----
NM_181869chr124583 522 367 307 22601 2471 ----
NM_181876chr452637 2156 900 685 623 --1702 --
NM_181886chr41295 ------
NM_181887chr41295 ------
NM_181888chr41295 ------
NM_181889chr41295 ------
NM_181890chr41295 ------
NM_181891chr41295 ------
NM_181892chr41342 ------
NM_181893chr41295 ------
NM_182314chrX71523 1370 1202 711 461 298 244 --21425 506 --
NM_182481chr2171340 1181 538 508 299 191 95 ------
NM_182482chr2171340 1181 538 508 299 191 95 ------
NM_182484chr2151435 1276 514 406 310 --1967 --
NM_182493chr1625338 1697 2658 644 ----
NM_182511chr1841418 1036 963 462 --1452 --
NM_182515chr1976566 5661 5452 4657 4405 2159 1719 16160 --16646
NM_182524chr42488 231 --135 --
NM_182551chr222258 874 152 ----
NM_182641chr1721788 545 11465 11347 --
NM_182662chr41482 ------
NM_182663chr132248 903 893 --1366 --
NM_182664chr112378 --1496 --
NM_182665chr132248 903 893 --1366 --
NM_182685chr14757 716 609 70 ------
NM_182689chr11271 ------
NM_182690chr11333 ------
NM_182691chr731281 1099 195 11430 ----
NM_182692chr731281 1099 195 11430 ----
NM_182697chr721077 536 --21504 675 --
NM_182715chr721074 420 ------
NM_182758chr1553807 2843 2545 2410 666 23825 3473 23183 2435 --
NM_182760chr3143 --1627 --
NM_182763chr141979 1806 826 523 12594 ----
NM_182796chr53855 669 219 ------
NM_182848chr1331383 1025 438 1393 21210 152 --
NM_182894chr1421627 322 ------
NM_182898chr7106091 6064 4880 4739 4330 2463 2134 1882 1179 154 36166 5126 1536 15067 --
NM_182899chr7106091 6064 4880 4739 4330 2463 2134 1882 1179 154 36166 5126 1536 15067 --
NM_182907chr652168 1481 613 463 252 ------
NM_182948chr152784 2652 1274 726 250 22790 520 12748 11992
NM_182964chr111777 23019 856 32502 2097 1095 --
NM_182970chr2074280 3906 3060 2803 1576 1369 770 --1415 --
NM_182972chr132550 901 542 ------
NM_183004chr143980 696 366 11115 --1620
NM_183078chr673403 3056 2896 2800 2539 1458 306 --12397 13168
NM_183234chr1521622 512 --11225 --
NM_183235chr1521622 512 --11225 --
NM_183236chr1521622 512 --11225 --
NM_183377chr173790 636 325 ------
NM_183380chr62899 143 ------
NM_183425chr2051749 1491 1117 632 78 --1503 --
NM_184234chr202218 210 --1582 1593
NM_194247chr233906 3452 293 24127 2885 24380 2990 --
NM_194278chr1454135 3390 3179 693 98 --23709 1047 --
NM_194282chr442930 2913 2566 272 ------
NM_194285chr1143301 2610 2196 1297 1479 ----
NM_194286chr1236112 1183 113 26224 5283 46251 6089 5370 4422 --
NM_194314chr195569 4262 4247 4235 1757 970 851 535 147 11729 13873 --
NM_194328chr942832 2445 1142 35 --22528 1136 --
NM_194329chr942832 2445 1142 35 --22528 1136 --
NM_194330chr942832 2445 1142 35 --22528 1136 --
NM_194332chr942832 2445 1142 35 --22528 1136 --
NM_194356chr1231930 1852 787 22414 122 ----
NM_194434chr1885094 3939 3813 1985 1675 939 629 278 32074 1933 1232 34992 3491 2049 --
NM_194439chr421387 97 --21488 1260 --
NM_194442chr141304 1288 1249 700 11138 ----
NM_197941chr522192 91 12966 1283 --
NM_197970chr211511 1193 1319 --
NM_198057chrX2812 785 1136 --11087
NM_198066chr1453021 2880 2772 2696 665 ------
NM_198123chr82456 427 ------
NM_198124chr82456 427 ------
NM_198129chr181289 ------
NM_198158chr343053 2106 950 774 ------
NM_198159chr343053 2106 950 774 ------
NM_198177chr343053 2106 950 774 ------
NM_198178chr343053 2106 950 774 ------
NM_198181chr1552106 1866 1134 502 412 --12755 --
NM_198182chr211494 ------
NM_198195chr31106 ------
NM_198212chr731997 722 39 160 ----
NM_198217chr1321117 953 1895 ----
NM_198218chr1321117 953 1895 ----
NM_198219chr1321117 953 1895 ----
NM_198268chr194190 3555 3155 2889 2808 1590 1564 304 120 ------
NM_198269chr194190 3555 3155 2889 2808 1590 1564 304 120 ------
NM_198270chrX22955 1348 12852 1910 --
NM_198273chr532401 2389 2035 1668 12720 --
NM_198279chrX21150 373 --2962 390 --
NM_198281chr443452 3099 1322 1303 --1879 --
NM_198336chr711379 --11836 --
NM_198337chr721514 24 --11971 --
NM_198381chr1121056 41 11007 21042 247 --
NM_198391chr20--176 --1302
NM_198392chr632366 2196 1568 --1387 --
NM_198395chr531124 922 337 ------
NM_198399chr311669 1158 ----
NM_198400chr1552578 2276 1806 319 216 ------
NM_198401chr851730 1167 158 112 60 ------
NM_198404chr135305 288 277 186 171 ------
NM_198465chrX2610 221 ------
NM_198468chr653998 3284 1509 949 95 13090 ----
NM_198484chr366282 5644 5471 2523 1482 884 --13907 --
NM_198503chr121617 859 ------
NM_198504chr32260 230 ------
NM_198513chr822015 511 ------
NM_198560chr333513 1019 47 --23729 2447 --
NM_198581chr287055 3005 2859 2421 1069 827 772 301 ----22109 1559
NM_198595chr444213 3828 1465 680 --1511 --
NM_198686chr1472602 2517 2449 2239 2139 501 235 --1603 --
NM_198700chr111387 ------
NM_198793chr362519 1195 851 836 726 488 13146 ----
NM_198794chr1411453 21201 371 ----
NM_198829chr741353 1207 936 523 1197 ----
NM_198830chr173724 710 560 ----1718
NM_198844chr171945 ------
NM_198859chr375083 4746 3882 3678 1378 1053 966 14622 25009 4006 --
NM_198889chr41281 ----11372
NM_198896chr1132186 2065 1979 --1188 --
NM_198900chr12116296 5330 5297 1895 1884 1878 1707 1657 1105 580 349 25625 2189 12075 --
NM_198903chr51632 164 1646 --
NM_198904chr521408 632 164 21973 646 --
NM_198935chr2033150 2034 41 12355 22126 1045 --
NM_198968chr1353186 3081 2959 2433 532 23969 1233 12925 --
NM_199000chr722220 363 11420 1638 --
NM_199003chr831422 1380 953 ------
NM_199039chr42878 840 ------
NM_199051chr1195 1111 ----
NM_199053chr41960 1201 ----
NM_199169chr2023175 672 --33083 2636 244 --
NM_199170chr2023175 672 --33083 2636 244 --
NM_199171chr2023175 672 --33083 2636 244 --
NM_199181chr20------1242
NM_199188chr122887 644 23043 988 13904 --
NM_199190chr122887 644 23043 988 13904 --
NM_199191chr22378 94 ------
NM_199192chr22471 187 ------
NM_199193chr22471 187 ------
NM_199194chr22378 94 ------
NM_199229chr221334 22 11168 --1299
NM_199245chr12112507 2488 2342 2281 2175 2165 1638 1043 456 387 216 --11015 --
NM_199261chr212133 41 ------
NM_199321chr171945 ------
NM_199324chr473656 3076 2808 2426 1211 588 526 23369 1012 --1630
NM_199344chr1--188 1598 --
NM_199355chr1611212 --31691 1271 574 --
NM_199436chr221141 386 1444 1613 --
NM_199437chr1171941 1676 931 879 680 337 46 1997 ----
NM_199438chr1171941 1676 931 879 680 337 46 1997 ----
NM_199439chr1171941 1676 931 879 680 337 46 1997 ----
NM_199454chr154422 4371 3905 3807 2993 13665 11093 11705
NM_199462chr1114707 4700 3278 3200 1807 1534 1203 1115 1036 310 236 --33828 3792 269 --
NM_199478chrX32014 1605 402 ------
NM_201266chr262793 2250 1021 887 818 536 --31984 466 240 --
NM_201269chr11236 --11178 --
NM_201278chr1142168 2146 804 796 ------
NM_201279chr262793 2250 1021 887 818 536 --31984 466 240 --
NM_201281chr1142168 2146 804 796 ------
NM_201428chr1121584 1408 11349 11247 --
NM_201429chr1121584 1408 11349 11247 --
NM_201430chr1121510 1334 11275 11173 --
NM_201524chr1621344 1319 ------
NM_201525chr1621344 1319 ------
NM_201570chr1031706 1526 111 ------
NM_201571chr1031706 1526 111 ------
NM_201572chr1031706 1526 111 ------
NM_201590chr1031706 1526 111 ------
NM_201591chr421759 648 --11327 11729
NM_201592chr421759 648 --11327 11729
NM_201593chr1031706 1526 111 ------
NM_201596chr1031706 1526 111 ------
NM_201597chr1031706 1526 111 ------
NM_201628chr153030 2782 1134 258 196 11001 ----
NM_201629chr91602 --1133 --
NM_201632chr541832 1162 491 419 ------
NM_201634chr541931 1261 590 518 ------
NM_203282chr1931183 669 437 --11388 --
NM_203305chr9102401 2391 2384 2106 1828 1814 1776 1682 659 403 --1564 --
NM_203327chr2074286 4147 2845 1730 1663 226 176 ------
NM_203346chr262167 1885 1827 893 802 749 11985 ----
NM_203349chr1531844 1514 1366 22158 416 ----
NM_203350chr12548 207 11421 --173
NM_203364chr1141197 926 194 29 ------
NM_203372chr23521 318 179 --1604 --
NM_203382chr531279 1255 1212 11647 --1498
NM_203391chrX21864 1563 --1556 --
NM_203417chr214499 298 261 156 1166 ----
NM_203418chr214499 298 261 156 1166 ----
NM_203434chr9----11045 --
NM_203437chr22641 273 2727 691 1297 --
NM_203446chr2113039 --22874 1883 --
NM_203458chr163692 3087 2845 1462 1096 438 2861 682 --1368
NM_203459chr132013 797 393 ------
NM_203463chr254879 4597 4531 3772 844 1246 2851 153 --
NM_203487chr1351811 1590 1468 702 627 ------
NM_203499chr17268 34 --1724 --
NM_203504chr442347 2179 869 852 ------
NM_203505chr442347 2179 869 852 ------
NM_205768chr131502 829 318 21955 611 ----
NM_205836chr5----1424 --
NM_205848chr162284 1044 941 897 319 165 1306 22786 1883 --
NM_205860chr152618 703 680 609 554 --11139 1617
NM_206852chr14190 --1299 --
NM_206853chr643699 873 791 729 13303 22963 1628 13979
NM_206854chr674960 2134 2052 1990 826 539 452 24564 3517 24224 3393 15240
NM_206855chr645925 1791 1504 1417 25529 4482 35189 4358 3854 16205
NM_206857chr14190 --1299 --
NM_206907chr522739 963 12121 13119 --
NM_206909chr866474 3118 2992 1983 1646 165 --57247 5657 5630 1029 961 --
NM_206914chr1282081 1961 1776 1681 622 388 108 86 ------
NM_206927chr112842 322 ------
NM_206928chr112842 322 ------
NM_206929chr112842 322 ------
NM_206930chr112842 322 ------
NM_207012chr1083462 3274 2700 2545 1402 1050 1017 112 12391 ----
NM_207015chr331941 961 444 1755 ----
NM_207171chr141977 1889 731 427 ------
NM_207292chr333307 3041 269 ------
NM_207293chr333307 3041 269 ------
NM_207294chr333307 3041 269 ------
NM_207295chr333307 3041 269 ------
NM_207296chr333307 3041 269 ------
NM_207297chr333332 3066 294 ------
NM_207303chr1034102 1103 544 165 --13579
NM_207304chr1321941 453 2209 195 ----
NM_207325chr1961264 633 287 217 197 22 --1476 --
NM_207337chr1211000 31104 360 121 ----
NM_207352chr442675 2494 1780 222 --12083 --
NM_207356chr12235 22 1104 1554 --
NM_207372chr1082399 1717 1676 957 843 834 719 399 ------
NM_207397chr16934 882 718 693 349 88 --2889 245 --
NM_207406chr4125271 5026 4473 4109 1960 1849 1759 1445 1031 894 437 61 11855 26538 5793 16486
NM_207481chr231432 1426 1003 ------
NM_207520chr22184 169 ------
NM_207521chr22184 169 ------
NM_207577chr1162721 2658 2274 553 337 130 --1410 --
NM_207645chr1121237 1215 --11324 --
NM_207647chr932141 1772 381 --1107 11950
NM_207660chr1431666 1491 149 ------
NM_207661chr1431666 1491 149 ------
NM_207662chr1431666 1491 149 ------
NM_212471chr171889 22273 2101 ----
NM_212472chr171889 22273 2101 ----
NM_212535chr16--1124 ----
NM_213589chr275454 4539 938 923 393 117 81 1717 21307 276 --
NM_213594chr1231251 1205 458 --2498 410 --
NM_213609chr31902 2885 864 ----
NM_213648chr541832 1162 491 419 ------
NM_213654chr32545 351 11498 1220 --
NM_213662chr1752439 2367 1524 449 387 --1325 --