TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1200
miRNA Sequence: CUCCUGAGCCAUUCUGAGCCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX46654 5977 5686 183 1221 --12542
NM_000109chrX12499 ------
NM_000134chr441691 430 356 171 ------
NM_000176chr532680 999 422 13442 12924 --
NM_000202chrX33503 3316 911 --13245 --
NM_000208chr1964020 3602 3594 1638 1272 824 34493 4233 3315 23427 80 --
NM_000217chr1295114 4783 4663 4608 4495 4464 4294 2125 2034 --34733 4403 1502 11280
NM_000222chr421825 1567 ------
NM_000248chr342609 2508 1221 317 ------
NM_000252chrX11072 ------
NM_000259chr15106082 5710 4849 2477 1662 1376 1114 1108 927 873 1387 22033 1217 11639
NM_000266chrX1243 ------
NM_000332chr652704 1035 543 337 235 2880 531 12445 --
NM_000353chr163954 459 78 --1339 172
NM_000390chrX32485 2353 1313 --1321 1263
NM_000408chr222663 2484 ------
NM_000489chrX23250 760 2356 62 ----
NM_000555chrX87234 3049 2361 2143 993 978 903 293 21880 1724 22034 610 --
NM_000680chr82410 38 ------
NM_000719chr1286620 5942 5889 5249 4234 2384 1586 1000 25651 4405 15276 12180
NM_000725chr123770 303 138 ----1345
NM_000726chr211168 ------
NM_000739chr72205 128 ------
NM_000782chr202231 130 ----2383 47
NM_000813chr524627 989 12216 22238 1210 1572
NM_000829chr1131541 1515 645 1209 --11865
NM_000831chr196084 5744 5052 4973 2278 1922 268 170 25 35439 1897 1491 ----
NM_000838chr632454 594 109 1725 --1605
NM_000856chr41114 ------
NM_000872chr10----1618 1606
NM_000875chr1555793 2271 1741 1640 1324 --12048 --
NM_000876chr62923 409 ------
NM_000879chr51135 ------
NM_000885chr231772 1641 40 ------
NM_000902chr321079 658 ------
NM_000908chr51538 ----1154
NM_000917chr10178 1749 1844 --
NM_000926chr1138025 3791 61 37046 6487 2670 --32198 1777 634
NM_000949chr53932 721 47 ------
NM_001001331chr342433 2361 991 412 12489 --11957
NM_001001396chr174335 3925 3132 3126 2741 1485 513 23058 3027 11798 --
NM_001001556chr1521214 34 ----145
NM_001001664chr253181 3053 1622 563 147 ------
NM_001001890chr2134229 3610 3190 ----12612
NM_001001928chr22118325 8220 6929 5853 5187 3059 2801 2648 1885 1788 1171 27603 5877 33317 2938 224 22319 764
NM_001002255chr61318 ------
NM_001002257chr233208 2853 434 12431 --22472 649
NM_001002838chrX41724 1506 513 51 ------
NM_001003652chr1847616 5526 3048 1929 1983 37344 3459 2911 --
NM_001003676chr112674 270 ------
NM_001003712chr1221563 1179 11292 ----
NM_001003800chr983679 3045 2923 2535 1016 694 436 231 23171 553 1203 12404
NM_001004065chr952446 1551 1405 1174 720 11079 ----
NM_001004304chr1273241 2870 2744 1075 775 204 147 22809 576 12525 1949
NM_001004354chr91425 ------
NM_001004419chr121901 --1731 14574
NM_001004720chr22882 127 ------
NM_001005375chrY11206 ------
NM_001005386chr241875 762 529 419 11851 --12169
NM_001005404chr1784374 4001 3639 2924 1246 1059 475 349 --12904 --
NM_001005463chr1031910 799 52 ------
NM_001005473chr546505 4951 2463 2386 21285 232 14171 14020
NM_001005502chr1274062 4033 3651 1871 1353 576 482 145 ----
NM_001005743chr142446 380 ------
NM_001005744chr142446 380 ------
NM_001005745chr142446 380 ------
NM_001005746chr211168 ------
NM_001005747chr211168 ------
NM_001005782chr22276 260 ------
NM_001006626chr72205 128 ------
NM_001006627chr72205 128 ------
NM_001006628chr72205 128 ------
NM_001006629chr72205 128 ------
NM_001006630chr72205 128 ------
NM_001006631chr72205 128 ------
NM_001006632chr72205 128 ------
NM_001007024chr1743866 3590 3013 2840 --11583 --
NM_001007025chr1743866 3590 3013 2840 --11583 --
NM_001007094chr1021385 976 14230 23295 3194 13405
NM_001007097chr974629 3725 3492 3341 1367 648 220 --14205 --
NM_001007464chr61107 ------
NM_001007527chr5------1149
NM_001008220chr593418 3231 2978 2738 2657 724 464 422 248 13331 --23136 262
NM_001008237chr21153 ------
NM_001008239chr1822604 433 21151 1142 --2287 181
NM_001008392chr311212 1733 154 13502
NM_001008408chr766294 5356 5176 4015 2482 27 1344 ----
NM_001008540chr21448 ------
NM_001008541chr1021899 725 ------
NM_001008541chr1021899 725 ------
NM_001008567chr9137 ------
NM_001008723chr101491 ------
NM_001008897chr6------1521
NM_001009909chr1133712 2811 2612 --13834 --
NM_001009955chr11367 ------
NM_001009955chr11367 ------
NM_001009960chr742314 2128 626 37 12819 11849 --
NM_001010853chr631197 1050 740 12375 ----
NM_001010891chr535313 4912 2707 42082 690 474 159 25652 866 --
NM_001010898chr162508 2330 1319 1253 376 214 --22489 555 13079
NM_001011546chr202677 572 --1260 --
NM_001011657chrX2127 118 1420 ----
NM_001011658chrX1348 ----2832 53
NM_001011666chr724183 631 14360 15778 --
NM_001011713chr1421055 204 11534 ----
NM_001012393chr1165154 4448 3804 3164 1972 1759 33386 1599 1378 ----
NM_001012751chr1021902 544 --11327 --
NM_001013615chr131128 1004 346 ------
NM_001013642chr11923 1224 --21152 751
NM_001013674chr11294 1200 ----
NM_001013843chr151651 ------
NM_001014797chr1087274 6833 6127 5449 2471 2019 1029 232 --27620 7184 --
NM_001015045chr451830 649 636 585 201 12115 1417 --
NM_001017395chr312902 11254 --12508
NM_001017424chr13760 363 23 ------
NM_001017425chr13760 363 23 ------
NM_001017440chr7107585 6947 6563 6021 3281 2739 2295 1446 1203 464 16138 36416 5197 2000 13040
NM_001017962chr10178 1749 1844 --
NM_001018041chr62282 92 ------
NM_001018050chr2283309 3208 3055 2791 1375 1285 802 754 22855 877 11243 --
NM_001018052chr2283309 3208 3055 2791 1375 1285 802 754 22855 877 11243 --
NM_001018054chr111037 ------
NM_001018067chr155219 4033 3961 3565 3280 23641 1622 ----
NM_001018068chr155219 4033 3961 3565 3280 23641 1622 ----
NM_001018069chr155219 4033 3961 3565 3280 23641 1622 ----
NM_001018074chr532680 999 422 13442 12924 --
NM_001018075chr532680 999 422 13442 12924 --
NM_001018076chr532680 999 422 13442 12924 --
NM_001018077chr532680 999 422 13442 12924 --
NM_001018090chr1532496 2157 776 2593 404 --1566
NM_001018091chr1532606 2267 886 3703 514 57 --1676
NM_001018102chr1532496 2157 776 2593 404 --1566
NM_001018111chr733792 3411 778 --21460 837 11150
NM_001018115chr31630 --1502 --
NM_001020658chr11337 ------
NM_001020658chr11337 ------
NM_001024094chr532680 999 422 13442 12924 --
NM_001024372chr832259 1709 518 11828 1868 --
NM_001024660chr32496 153 ------
NM_001024680chr231621 60 26 1350 2635 574 --
NM_001024847chr312504 ----1233
NM_001025076chr1045016 4953 2276 534 26032 5845 145 14851
NM_001025077chr1046374 6311 1892 44 27390 7203 --16209
NM_001025079chr343015 439 353 307 ------
NM_001025266chr331515 1212 1062 14906 --1944
NM_001025580chrX2521 445 1845 ----
NM_001029864chr204426 415 402 377 11855 11805 1355
NM_001029870chr4164 ------
NM_001029875chr532618 2265 1847 1753 12576 --
NM_001030007chr1621492 467 --13420 11017
NM_001030055chr1454057 3769 2923 489 65 13405 13842 --
NM_001031695chr2234351 907 362 31580 900 741 13303 14254
NM_001031717chr33914 775 682 --2804 268 1614
NM_001031732chr423114 2265 53056 2698 1311 872 863 13286 --
NM_001032288chr2031343 655 464 ------
NM_001032363chr131910 1448 381 --12177 158
NM_001032363chr131910 1448 381 --12177 158
NM_001032380chr103254 158 109 --11617 --
NM_001033045chr254456 3127 2828 1263 418 --23231 523 1208
NM_001033117chr344027 3937 3683 1696 --11681 --
NM_001033503chr5137 ------
NM_001033566chr171265 ------
NM_001033568chr171265 ------
NM_001033602chr1331791 1090 287 12030 --1179
NM_001033659chr1741424 661 115 41 21563 447 1621 --
NM_001033925chr1011464 ------
NM_001034850chr521213 625 ----1549
NM_001034954chr1032387 2259 811 1735 ----
NM_001034955chr1032387 2259 811 1735 ----
NM_001034956chr1032387 2259 811 1735 ----
NM_001034957chr1032387 2259 811 1735 ----
NM_001037172chr311076 1973 ----
NM_001037332chr532327 2140 734 1782 --1590
NM_001037333chr532327 2140 734 1782 --1590
NM_001038707chr151983 1703 676 548 274 31845 1739 736 --11597
NM_001038707chr151983 1703 676 548 274 31845 1739 736 --11597
NM_001039457chr11103 ------
NM_001039459chr71217 ------
NM_001039547chr357445 5550 2752 2128 1309 16260 57549 7288 5408 2226 1061 170
NM_001039569chr262960 2595 2432 2100 1203 90 --13063 --
NM_001039580chr474026 3996 3421 1819 1532 1157 409 14177 ----
NM_001039590chrX23518 1601 ------
NM_001039591chrX23518 1601 ------
NM_001039619chr14142 ------
NM_001039840chrX45316 4881 4361 750 11852 26063 4097 --
NM_001039937chr1322686 292 1544 13710 13880
NM_001040108chr1423047 858 12289 --12116
NM_001040142chr221621 629 ------
NM_001040143chr221621 629 ------
NM_001040152chr731833 1250 1169 ------
NM_001040202chr4------1325
NM_001040284chr1684845 4350 3836 2280 2192 1626 1514 85 --2607 52 --
NM_001040429chr1322830 219 1324 --1928
NM_001040653chr31879 12184 1583 22692 1794
NM_001040708chr811076 ------
NM_001040712chr932650 1307 317 ------
NM_001042481chr1411627 ------
NM_001042494chr1563217 2747 1429 1355 746 546 ------
NM_001042495chr1563217 2747 1429 1355 746 546 ------
NM_001042496chr1563217 2747 1429 1355 746 546 ------
NM_001042497chr1563217 2747 1429 1355 746 546 ------
NM_001042510chr831742 1443 58 ------
NM_001042511chr831742 1443 58 ------
NM_001042537chrX2746 551 22367 226 ----
NM_001042555chr1231701 1410 722 ----12934
NM_001042599chr252497 2473 1477 995 241 45420 1720 1241 976 26488 2520 --
NM_001042681chr132338 1950 1753 ------
NM_001042682chr132338 1950 1753 ------
NM_001042682chr132338 1950 1753 ------
NM_001078chr12557 483 ------
NM_001099678chr356389 5335 4806 1916 1610 25104 4467 14909 --
NM_001100108chr197023 6123 5880 5481 2700 2678 2383 1455 474 11344 23272 2543 11635
NM_001106chr3108362 6948 6422 3258 2950 2887 2525 2052 732 688 21031 943 38962 3721 3691 1396
NM_001113490chrX63410 2221 779 501 477 191 ----12732
NM_001116chr1672531 2505 2337 804 748 259 159 --2937 285 12525
NM_001117chr1822027 1727 ------
NM_001121chr101290 ------
NM_001128chr1621492 467 --13420 11017
NM_001167chrX106084 5937 5836 4090 2622 1399 930 498 179 82 ------
NM_001173chr1454057 3769 2923 489 65 13405 13842 --
NM_001204chr257243 6926 5312 4892 2146 15187 26332 4996 --
NM_001219chr731689 1621 423 ------
NM_001237chr43294 245 72 1379 ----
NM_001237chr43294 245 72 1379 ----
NM_001332chr51434 --11180 --
NM_001419chr1954461 4212 3899 3694 3102 21284 692 11458 11889
NM_001427chr72534 271 ----11886
NM_001431chr61828 ------
NM_001527chr654706 4150 3529 3447 3290 21496 1042 13899 13920
NM_001609chr1054231 3706 187 173 137 23145 696 12841 --
NM_001616chr221412 1089 33171 2900 1285 --11101
NM_001621chr72721 684 1298 12147 --
NM_001621chr72721 684 1298 12147 --
NM_001635chr72750 438 ------
NM_001650chr1843943 3852 2807 2533 ------
NM_001663chr1421935 229 ------
NM_001664chr31399 ------
NM_001681chr121764 ------
NM_001683chr342433 2361 991 412 12489 --11957
NM_001684chr164052 3642 2849 2843 1202 230 22775 2744 11515 --
NM_001729chr4------2324 83
NM_001753chr7------11691
NM_001754chr2134229 3610 3190 ----12612
NM_001759chr1275091 4640 4567 3888 1991 1320 574 15147 13789 --
NM_001777chr343015 439 353 307 ------
NM_001792chr181790 ------
NM_001798chr123938 864 88 ------
NM_001800chr191396 ------
NM_001830chrX63601 2817 1429 1255 984 634 ------
NM_001844chr121326 ------
NM_001874chr1274062 4033 3651 1871 1353 576 482 145 ----
NM_001918chr139100 2428 1685 11466 23195 2530 28610 1967
NM_001938chr111829 ------
NM_001949chr622988 2613 12884 11207 21192 536
NM_001964chr521013 100 ------
NM_001987chr1243208 3189 2670 495 23713 469 24278 3771 --
NM_001999chr511002 ------
NM_002006chr455243 3864 3655 3637 1477 25504 4864 1769 13685
NM_002015chr1333118 1090 1031 13337 --12311
NM_002025chrX67867 7288 3256 3210 2200 492 18720 --12488
NM_002044chr1521214 34 ----145
NM_002063chrX2953 523 ------
NM_002074chr121360 1091 ------
NM_002130chr5128 ------
NM_002139chrX1438 ------
NM_002145chr171114 ------
NM_002193chr211680 ------
NM_002223chr1232573 1186 963 43295 3004 1003 242 ----
NM_002228chr11997 ------
NM_002239chr21396 ------
NM_002264chr344556 3935 1078 958 1657 --14757
NM_002265chr1711162 ------
NM_002267chr1322438 966 ------
NM_002270chr545362 3785 1118 871 11129 ----
NM_002309chr2261007 1000 647 616 441 429 --142 11016
NM_002310chr534548 1370 108 35516 4688 4577 1631 --
NM_002336chr1264479 4269 4201 1813 1605 1224 ------
NM_002350chr8------1145
NM_002444chrX31936 1901 396 12031 ----
NM_002460chr6--22693 2470 22490 2463 1599
NM_002478chr112596 432 ------
NM_002481chr166623 6224 5892 2954 2117 2086 37056 5971 2668 12221 55951 5009 2892 2515 565
NM_002509chr201593 ------
NM_002514chr8----1210 1223
NM_002545chr1165154 4448 3804 3164 1972 1759 33386 1599 1378 ----
NM_002556chr1142064 760 495 386 11366 ----
NM_002577chr384058 2895 2719 2527 815 553 263 238 11046 ----
NM_002581chr911241 21903 901 1729 --
NM_002588chr5188 ------
NM_002594chr2032477 2030 70 ------
NM_002613chr1674938 4036 3953 3841 1936 564 212 11924 12022 --
NM_002618chr21115 ------
NM_002655chr834249 3529 1611 14799 ----
NM_002657chr2053363 2931 267 231 159 11210 --11573
NM_002667chr61429 ------
NM_002697chr11239 ------
NM_002709chr222960 2409 23492 3052 12345 --
NM_002715chr521037 850 1482 ----
NM_002736chr71104 ------
NM_002740chr352413 2185 663 483 392 --1766 --
NM_002758chr17----1225 --
NM_002835chr72747 45 ----1166
NM_002839chr932650 1307 317 ------
NM_002868chr1241915 1901 762 651 ------
NM_002886chr354176 3612 3403 1286 1016 33972 3382 3176 ----
NM_002938chr411355 ----1754
NM_002945chr173595 263 183 ------
NM_002956chr123558 542 86 ------
NM_002971chr31943 ------
NM_003012chr852861 2177 889 452 35 1227 1920 --
NM_003016chr1721519 110 ------
NM_003099chr1566291 5814 2420 1728 424 301 22047 315 75412 5344 4228 4188 1046 985 789 --
NM_003101chr1------1384
NM_003107chr612280 ------
NM_003108chr265244 4724 2691 2063 1027 966 25295 5231 47240 5546 2792 1915 --
NM_003112chr72808 689 11104 --1716
NM_003133chr1--1320 --137
NM_003174chr101213 ------
NM_003178chr342134 2079 2066 1990 ------
NM_003189chr152559 2361 559 65 42 23400 624 ----
NM_003215chr441406 1108 301 241 1468 11164 --
NM_003217chr1241932 1482 312 259 ----1644
NM_003242chr312504 ----1233
NM_003246chr152543 368 21822 435 ----
NM_003262chr324234 3303 ------
NM_003340chr411401 ------
NM_003342chr1753319 2631 1204 460 37 32704 1195 242 --12345
NM_003349chr2031343 655 464 ------
NM_003350chr831017 263 172 ------
NM_003352chr22276 260 ------
NM_003380chr101103 ------
NM_003392chr341167 1136 870 767 ------
NM_003406chr81795 ----11318
NM_003413chrX1523 --1185 --
NM_003421chr1021385 976 14230 23295 3194 13405
NM_003445chr191337 ----1583
NM_003467chr21448 ------
NM_003468chr252864 2844 2794 2760 361 22924 1682 1589 --
NM_003474chr1052135 497 476 182 87 1523 --12330
NM_003507chr22614 216 ------
NM_003538chr6152 ------
NM_003542chr6170 ------
NM_003545chr6157 ------
NM_003547chr6162 ------
NM_003574chr1834589 3843 1223 25629 418 --14304
NM_003581chr22882 127 ------
NM_003583chr1253556 2979 2569 1510 1024 ------
NM_003590chr233115 2844 184 --13800 1233
NM_003607chr164230 3551 3390 2741 1381 137 ------
NM_003644chr17165984 5863 5843 5783 5706 4872 4537 2288 2077 1446 1167 754 627 575 430 395 46616 6166 2264 861 26056 5573 --
NM_003679chr12489 221 13460 --1300
NM_003685chr191934 ------
NM_003709chr2179 ------
NM_003735chr5188 ------
NM_003736chr5188 ------
NM_003744chr142446 380 ------
NM_003750chr101293 ------
NM_003769chr12------197
NM_003772chr111463 ------
NM_003872chr222901 935 ------
NM_003901chr1042028 1945 720 390 --1144 11849
NM_003913chr621542 1456 --13643 --
NM_003932chr2211636 ------
NM_003939chr1093914 3610 3508 3405 3263 1651 1444 1273 1202 --1539 --
NM_003983chr1654058 1566 1400 962 793 --2170 129 11267
NM_004006chrX12499 ------
NM_004007chrX12499 ------
NM_004009chrX12499 ------
NM_004010chrX12499 ------
NM_004011chrX12499 ------
NM_004012chrX12499 ------
NM_004013chrX12499 ------
NM_004014chrX12499 ------
NM_004015chrX12499 ------
NM_004016chrX12413 ------
NM_004017chrX12499 ------
NM_004018chrX12413 ------
NM_004020chrX12499 ------
NM_004021chrX12413 ------
NM_004022chrX12413 ------
NM_004023chrX12413 ------
NM_004028chr1843943 3852 2807 2533 ------
NM_004047chr11103 ------
NM_004050chr1451905 880 842 421 411 12295 21803 1736 --
NM_004077chr1221342 72 ------
NM_004081chrY11206 ------
NM_004086chr14------1240
NM_004124chr1443408 2749 2465 589 12545 ----
NM_004162chr321326 450 11285 ----
NM_004171chr11149236 9128 8673 8467 7746 7539 3627 3351 3141 3078 2310 1977 1888 534 23125 733 12716 17490
NM_004229chrX31586 582 141 1882 ----
NM_004274chr1442909 2729 2705 1292 --165 --
NM_004293chr942635 1426 1153 1137 ----1732
NM_004301chr31357 ----168
NM_004319chr113128 --12694 1464
NM_004323chr952260 1884 1657 337 88 2733 447 1801 --
NM_004329chr1021202 164 ------
NM_004374chr8127 ------
NM_004397chr111585 ------
NM_004408chr91146 ------
NM_004416chr123815 130 90 ------
NM_004437chr153074 2757 2348 1102 212 1366 1809 22865 2733
NM_004449chr211992 ------
NM_004454chr33703 312 52 ------
NM_004482chr21305 ------
NM_004504chr222720 2679 22705 792 ----
NM_004505chr171208 ------
NM_004506chr61175 ------
NM_004516chr1911081 ------
NM_004535chr2011502 1544 --21731 315
NM_004537chr121204 11367 ----
NM_004554chr1441734 1346 358 177 --21402 599 --
NM_004575chr41433 ------
NM_004586chrX33768 3537 1553 11254 11657 13783
NM_004593chr31890 ------
NM_004603chr72809 454 ------
NM_004612chr934562 3178 482 11739 ----
NM_004631chr111037 ------
NM_004637chr321136 1119 ------
NM_004640chr6141 ------
NM_004663chr1511313 ------
NM_004696chr12851 808 ------
NM_004726chrX41369 901 400 375 15159 ----
NM_004734chr1342367 1288 482 244 ----1881
NM_004744chr453256 3237 2967 1316 192 23501 134 ----
NM_004748chr1531443 1155 822 14201 ----
NM_004774chr1772998 2691 2556 2188 2060 853 814 12749 1551 --
NM_004788chr1121757 1057 ------
NM_004789chr91113 ----1316
NM_004805chr21348 ------
NM_004815chr123550 1096 23714 3086 13291 1912
NM_004841chr11155 ------
NM_004845chrX63836 3653 3632 3534 3195 3004 --12717 --
NM_004871chr1743866 3590 3013 2840 --11583 --
NM_004904chr724183 631 14360 15778 --
NM_004911chr71494 ------
NM_004915chr211592 ------
NM_004925chr95768 611 187 152 104 ------
NM_004937chr1752386 1735 938 287 255 ------
NM_004939chr2------1149
NM_004956chr754242 3291 3004 1198 275 ----13386
NM_004973chr611729 ------
NM_004976chr1184582 3876 3474 2055 1767 1609 415 322 1671 13721 --
NM_004985chr1253429 2891 1792 1547 1524 13189 ----
NM_005023chr521041 378 ------
NM_005028chr1041697 713 689 131 ------
NM_005036chr22118325 8220 6929 5853 5187 3059 2801 2648 1885 1788 1171 27603 5877 33317 2938 224 22319 764
NM_005057chr141653 1482 1367 636 ----1224
NM_005114chr41597 ------
NM_005119chr11971 ------
NM_005121chr1753479 2761 1096 938 199 12340 ----
NM_005135chr1563217 2747 1429 1355 746 546 ------
NM_005156chr924845 904 44144 756 250 235 11401 --
NM_005188chr1177229 6718 5883 5777 5664 5571 5409 21074 468 ----
NM_005197chr1475825 4485 1431 1178 428 415 56 11590 12290 --
NM_005207chr2233650 2314 804 ------
NM_005219chr511356 ----11475
NM_005235chr252497 2473 1477 995 241 45420 1720 1241 976 26488 2520 --
NM_005279chr2----1561 2232 167
NM_005316chr11------1322
NM_005324chr1711650 --2189 132 --
NM_005329chr1612336 ------
NM_005339chr441338 366 324 71 --1470 --
NM_005349chr41525 ------
NM_005359chr1855504 4573 4193 226 36 14940 ----
NM_005392chr921899 288 --137 --
NM_005397chr733792 3411 778 --21460 837 11150
NM_005399chr144050 1047 837 31 --1362 --
NM_005402chr731803 1461 1143 11512 ----
NM_005406chr182247 115 ------
NM_005475chr1253033 2290 825 604 519 2817 405 1745 --
NM_005479chr103472 420 77 ------
NM_005494chr71569 ------
NM_005497chr1785877 5539 5197 5099 4293 3782 2044 2027 1106 46128 5300 4397 135 12011
NM_005499chr191590 ------
NM_005504chr1231955 1553 1511 44076 2583 915 585 15843 --
NM_005522chr721135 259 --11101 1434
NM_005574chr113174 118 78 ------
NM_005578chr324629 2005 25060 3835 --11740
NM_005596chr946185 4429 4184 1306 ----14481
NM_005639chr1221909 1357 ------
NM_005665chr144493 3797 3624 1809 13474 ----
NM_005668chr544101 3279 1832 479 ----12931
NM_005722chr241875 762 529 419 11851 --12169
NM_005731chr2192 ------
NM_005734chr111690 ------
NM_005737chr242390 1815 535 409 --1246 --
NM_005759chr221868 1432 14032 --1332
NM_005785chr1251446 506 338 276 173 124 --11709
NM_005789chr1751408 735 570 512 181 1408 --1190
NM_005802chr91722 ------
NM_005808chr311212 1733 154 13502
NM_005819chr152503 2411 2237 934 737 32123 570 439 ----
NM_005826chr11253 ------
NM_005840chrX86798 2778 2627 2557 1114 984 256 136 25338 1406 ----
NM_005868chr741876 1593 801 213 11965 --11842
NM_005898chr1122898 2057 21076 102 1266 13125
NM_005901chr1847616 5526 3048 1929 1983 37344 3459 2911 --
NM_005909chr533646 1663 527 --13554 1947
NM_005930chr141270 --1124 --
NM_005937chr1773766 3345 2663 1374 1080 1027 472 --33102 1070 713 23459 2631
NM_005941chr831691 1123 286 1908 11049 --
NM_005955chr154992 4381 3898 3441 534 11726 31646 1172 579 --
NM_005962chr1021899 725 ------
NM_005962chr1021899 725 ------
NM_006047chr2033054 1225 1125 13034 --13279
NM_006095chr454361 1639 1206 818 427 12790 --23188 2808
NM_006106chr1153183 2838 2320 605 90 ------
NM_006107chr171189 ------
NM_006109chr14142 ------
NM_006139chr251832 1777 1760 897 102 1782 ----
NM_006158chr82254 138 128 ----
NM_006216chr2------1130
NM_006277chr21272 --1691 --
NM_006282chr2033935 1724 1222 13677 11574 1128
NM_006298chr642990 2265 997 138 22757 932 ----
NM_006306chrX44868 4832 1134 501 35189 4852 1298 2483 447 --
NM_006311chr171118 ------
NM_006315chr474270 4120 3014 1542 1440 898 717 11627 --13375
NM_006359chrX2746 551 22367 226 ----
NM_006380chr1744269 3740 2836 1424 12805 --13681
NM_006386chr2242388 2193 2113 548 ------
NM_006393chr1043321 1530 686 537 14307 --1966
NM_006413chr102343 296 ------
NM_006421chr81493 --2833 366 --
NM_006434chr1032387 2259 811 1735 ----
NM_006449chr231671 447 235 ------
NM_006467chr51911 ----11510
NM_006482chr1253556 2979 2569 1510 1024 ------
NM_006494chr19------1357
NM_006532chr1931660 732 123 --11282 --
NM_006534chr201451 11359 --13267
NM_006546chr1785623 5465 4366 4158 2555 886 337 219 25289 1872 24868 1927 --
NM_006547chr731821 753 569 ------
NM_006549chr1242736 1902 944 803 22280 604 ----
NM_006559chr11471 1215 ----
NM_006561chr1045016 4953 2276 534 26032 5845 145 14851
NM_006572chr1722273 288 1378 ----
NM_006599chr1665698 2837 2617 1243 1011 831 56359 5358 4985 2319 1978 17650 11002
NM_006601chr121363 ------
NM_006618chr1141 ------
NM_006628chr1564125 3805 3666 1321 993 877 11538 23410 1777 --
NM_006646chr1342097 1989 1024 636 --22062 1936 --
NM_006650chr593418 3231 2978 2738 2657 724 464 422 248 13331 --23136 262
NM_006653chr6193 ------
NM_006654chr1231701 1410 722 ----12934
NM_006660chr152131 51 ----1282
NM_006670chr61259 ------
NM_006699chr122610 2549 ------
NM_006706chr52624 60 ------
NM_006712chr7121 ------
NM_006722chr342609 2508 1221 317 ------
NM_006727chr5180 ------
NM_006731chr945744 4238 1450 633 --13829 14046
NM_006738chr1554300 1174 1075 729 233 1311 23171 254 --
NM_006750chr1677436 7071 6385 5085 2336 1290 778 --15909 --
NM_006751chr2177 ------
NM_006754chr721155 211 ------
NM_006802chr11263 ------
NM_006815chr1221213 911 2334 163 11284 --
NM_006851chr1232778 2754 2530 12123 12615 12436
NM_006854chr7135 ------
NM_006870chr202677 572 --1260 --
NM_006874chr42908 27 11193 ----
NM_006915chrX11942 ----12138
NM_006924chr1733577 1087 435 ------
NM_006990chr152500 809 724 692 197 --21806 336 --
NM_006999chr51587 ----1272
NM_007007chr1244220 3785 3724 3589 ----1478
NM_007013chr8------1858
NM_007038chr2175969 5458 3873 2033 1625 741 270 ------
NM_007042chr342620 2021 1781 955 12219 1253 --
NM_007050chr20127018 5921 5350 3181 3072 2089 2017 1819 1797 1741 996 485 13040 56462 6274 6230 391 86 12959
NM_007064chr32496 153 ------
NM_007112chr12197 165 ------
NM_007118chr51248 ------
NM_007146chr172848 548 ----11769
NM_007175chr832323 1242 197 12980 11413 --
NM_007200chr1554300 1174 1075 729 233 1311 23171 254 --
NM_007203chr952446 1551 1405 1174 720 11079 ----
NM_007213chrX2577 272 ------
NM_007220chrX64904 4640 4621 1460 921 517 ----11024
NM_007236chr1531706 632 570 ------
NM_007249chr1388917 6748 6150 3522 2007 1875 1429 550 ----12749
NM_007271chr631839 1200 555 ------
NM_007275chr32940 733 1290 --11161
NM_007278chr171109 --1157 --
NM_007287chr321079 658 ------
NM_007288chr321079 658 ------
NM_007289chr321079 658 ------
NM_007294chr172339 323 ------
NM_007295chr172339 323 ------
NM_007296chr172339 323 ------
NM_007297chr172339 323 ------
NM_007298chr172339 323 ------
NM_007299chr172339 323 ------
NM_007300chr172339 323 ------
NM_007302chr172339 323 ------
NM_007303chr172339 323 ------
NM_007304chr172339 323 ------
NM_007305chr172339 323 ------
NM_007347chr1543122 2460 1156 816 11225 22783 191 --
NM_007363chrX2963 662 ------
NM_007373chr10------1332
NM_012096chr352696 801 706 354 164 23715 392 1577 --
NM_012102chr132338 1950 1753 ------
NM_012120chr632306 1908 1051 ------
NM_012124chr112887 118 ------
NM_012141chr1322686 292 1544 13710 13880
NM_012175chr113850 612 124 1155 ----
NM_012200chr11135 ------
NM_012215chr1041744 588 460 409 ------
NM_012218chr1951965 668 634 548 484 12185 12506 --
NM_012238chr101653 146 ----
NM_012247chr102889 119 ------
NM_012250chr1111384 ------
NM_012252chr731962 942 797 21228 705 --1735
NM_012259chr61918 ----1417
NM_012264chr223816 620 377 1192 21910 824 11323
NM_012264chr223816 620 377 1192 21910 824 11323
NM_012287chr343442 1465 589 194 ------
NM_012288chr663988 2309 2161 1429 991 233 11082 23975 1529 11975
NM_012290chr211352 ------
NM_012297chr442569 2148 1618 295 ------
NM_012307chr182791 401 153 ----
NM_012316chr174682 4295 4012 3676 3466 2014 1974 33856 1488 1064 35483 1432 1291 --
NM_012382chr564033 3941 3741 3359 3096 1414 ----11253
NM_012399chr2221853 1412 --11670 --
NM_012443chr101805 ----1871
NM_012448chr1721927 949 ----11804
NM_012470chr71480 ------
NM_012479chr731083 870 749 --11756 1947
NM_013238chr1321342 617 ------
NM_013261chr411370 ----193
NM_013269chr121828 --1658 14501
NM_013281chr2031452 363 178 ------
NM_013283chr53344 278 121 --1112 --
NM_013309chr1532443 992 814 2707 481 ----
NM_013313chr2243095 2971 1286 430 --2696 533 12180
NM_013354chr81199 ------
NM_013364chrX1543 --11885 11815
NM_013368chr191131 ------
NM_013374chr343109 2976 2175 1127 ------
NM_013392chr21122 ------
NM_013423chrX------1207
NM_013427chrX------1207
NM_013438chr941422 1357 1228 1189 ------
NM_014003chr161381 ------
NM_014028chr652770 2037 1208 1193 715 1421 ----
NM_014038chr71314 ------
NM_014048chr1653698 3409 1439 934 333 35269 4571 4390 13373 --
NM_014112chr845468 5153 4809 4302 ----21800 1241
NM_014155chr1155907 5483 2288 2031 1344 37473 3029 2420 ----
NM_014181chr252361 2267 2155 618 410 --1708 --
NM_014217chr13760 363 23 ------
NM_014240chr373745 3046 2594 1678 1295 1204 226 1422 11018 2862 237
NM_014294chr82951 404 ------
NM_014309chr2234341 897 352 31570 890 731 13293 14244
NM_014325chr1221779 909 ------
NM_014331chr497459 7131 6999 6277 6247 5454 2599 1416 264 42635 1106 755 707 16722 --
NM_014342chr1131142 211 125 11340 11024 --
NM_014376chr532327 2140 734 1782 --1590
NM_014381chr1423047 858 12289 --12116
NM_014388chr145311 4358 1135 152 1925 ----
NM_014393chr822062 463 1127 1507 --
NM_014494chr1622088 555 --2568 479 1945
NM_014500chrX157 ------
NM_014563chrX1348 ----2832 53
NM_014572chr132209 45 21143 383 --11748
NM_014614chr2256 25 ------
NM_014616chr331195 1118 567 1698 ----
NM_014647chr1641890 677 540 26 ------
NM_014653chr1241736 776 552 500 ----12021
NM_014667chr321735 697 ------
NM_014676chr11337 ------
NM_014679chr1121409 1183 ------
NM_014682chr822047 1765 ------
NM_014701chr1531030 890 361 12412 11237 1739
NM_014703chr331219 1088 436 ----1461
NM_014720chr1011812 ------
NM_014727chr191119 ------
NM_014733chr52674 310 ------
NM_014739chr633821 1619 1163 23586 2607 23578 684 --
NM_014752chr1121933 416 ------
NM_014761chr1611131 ------
NM_014774chr123209 794 1652 --12760
NM_014800chr71217 ------
NM_014810chr132822 1450 822 1927 22489 812 --
NM_014826chr164230 3551 3390 2741 1381 137 ------
NM_014828chr1421652 1585 ------
NM_014829chr51843 ------
NM_014830chr1263567 2507 1373 1199 1005 502 33223 1560 535 12902 --
NM_014836chr103254 158 109 --11617 --
NM_014838chr2252744 2145 646 632 173 --1119 --
NM_014839chr111953 11707 ----
NM_014850chr344027 3937 3683 1696 --11681 --
NM_014876chr2222039 678 ----22079 476
NM_014883chr451830 649 636 585 201 12115 1417 --
NM_014897chr1722875 845 23127 381 --11107
NM_014901chr53611 520 278 --11762 --
NM_014904chr1031055 802 259 1410 1249 1332
NM_014906chr1754089 3130 2847 754 348 ----1820
NM_014913chr183966 229 136 ------
NM_014920chr633272 2770 505 23501 2814 11011 --
NM_014923chr131697 ------
NM_014978chr1011468 11642 ----
NM_014989chr6144 ------
NM_014990chr141241 ------
NM_014991chr41191 1707 ----
NM_015000chr1242420 350 142 38 ------
NM_015008chr312902 11254 --12508
NM_015039chr153936 1690 1475 799 638 14092 13845 13947
NM_015042chr1564012 3541 2785 1715 1001 941 14028 1202 1544
NM_015044chr1682787 2155 2079 739 732 333 65 36 --22668 777 1449
NM_015045chr1041803 466 227 21 ------
NM_015051chr942880 2872 2837 335 23349 1078 12528 --
NM_015059chr1543470 2741 503 343 12992 2423 247 --
NM_015068chr741124 685 102 21 ------
NM_015071chr536391 2090 1766 22520 1316 12042 --
NM_015074chr1103771 3756 3735 3290 3248 3083 1944 1431 1143 799 21954 607 ----
NM_015077chr1764308 3877 3372 1018 959 788 --13054 2862 114
NM_015092chr1684119 2866 1859 1582 1229 320 295 68 --11688 1182
NM_015097chr311770 ------
NM_015130chr41382 1491 ----
NM_015137chr832230 2214 68 11655 122 --
NM_015155chr1053045 3030 2787 184 92 ------
NM_015199chr342947 2739 1149 145 21967 57 ----
NM_015200chr421705 958 ----12299
NM_015208chr1843872 2876 1403 355 11394 13979 --
NM_015216chr51126 ------
NM_015225chr922309 737 ------
NM_015233chr1331791 1090 287 12030 --1179
NM_015245chr642380 1919 592 503 --1427 --
NM_015250chr931981 1347 405 11473 --1706
NM_015263chr1521148 439 ------
NM_015272chr16----22022 213 1309
NM_015275chr121809 ----12049
NM_015291chr153009 2864 1321 849 69 ----13404
NM_015299chr1483078 3038 2802 2780 931 680 600 178 1128 23741 896 --
NM_015305chr1441524 1322 397 350 ------
NM_015317chr222530 2301 ------
NM_015328chr722262 939 ----1739
NM_015332chr762706 2548 1371 1174 661 411 --21091 838 --
NM_015349chr612566 13048 ----
NM_015358chr211319 --1922 --
NM_015359chr892886 2819 2113 1933 1114 1041 774 747 631 --12286 --
NM_015365chrX2521 445 1845 ----
NM_015379chr7190 ------
NM_015385chr1032387 2259 811 1735 ----
NM_015393chr443372 893 637 351 1394 --12754
NM_015397chr91311 ------
NM_015419chrX1250 ----130
NM_015435chr82972 83 ------
NM_015443chr171238 ------
NM_015455chr554044 3132 3059 889 628 11625 1709 --
NM_015461chr181269 ------
NM_015509chr1231207 563 413 181 ----
NM_015514chr143439 223 125 ------
NM_015532chr1532496 2157 776 2593 404 --1566
NM_015535chr243488 3249 1108 844 2647 260 ----
NM_015537chr93445 141 120 ------
NM_015550chr712534 ----13182
NM_015553chr634250 3890 2041 11960 13377 11189
NM_015554chr1532530 942 625 --165 --
NM_015569chr164728 3816 3319 1912 537 416 ------
NM_015622chr7193 ------
NM_015640chr155219 4033 3961 3565 3280 23641 1622 ----
NM_015872chr141799 1740 1632 1436 --11223 --
NM_015874chr41525 ------
NM_015878chr821385 577 ------
NM_015885chr111188 ------
NM_015906chr133254 1797 621 1630 ----
NM_015952chr61107 ------
NM_015995chr1564245 3904 1882 1090 690 126 1349 44743 3894 3782 1622 1254
NM_016018chr822761 861 ------
NM_016019chr731009 684 76 ------
NM_016040chr131793 690 291 12151 ----
NM_016075chr1342263 2015 1001 703 --12164 21076 720
NM_016076chr122828 921 11971 1136 --
NM_016089chr372060 1928 1848 1675 856 812 644 --21524 225 --
NM_016096chr831742 1443 58 ------
NM_016103chr5137 ------
NM_016104chr61107 ------
NM_016121chr12995 788 ------
NM_016125chr17184 ------
NM_016133chr211444 ------
NM_016141chr31819 ------
NM_016205chr43341 170 125 ------
NM_016206chr368959 7754 6515 5842 3218 1292 33252 367 328 35778 2532 1397 --
NM_016230chr6158 ----1417
NM_016252chr21970 ----1293
NM_016257chr163185 2684 2266 833 737 617 21097 323 12831 --
NM_016260chr214776 --12593 27552 5041
NM_016271chr18------12282
NM_016308chr12347 191 --1494 --
NM_016322chr922419 2150 ------
NM_016356chr632243 1955 648 22252 897 --1686
NM_016424chr1731758 1694 1358 ------
NM_016467chr2------11105
NM_016484chrX161 1249 ----
NM_016505chr11695 ------
NM_016506chr113513 445 286 1551 1457 --
NM_016513chr633272 2770 505 23501 2814 11011 --
NM_016526chr1152491 1846 929 898 380 1290 1892 --
NM_016544chr262593 2400 1481 1322 485 143 --21334 850 13065
NM_016547chr11620 ------
NM_016577chr384305 4139 4017 3876 3613 1734 1236 132 44270 3094 986 169 --1770
NM_016628chr101152 ------
NM_016818chr211592 ------
NM_016824chr101290 ------
NM_016929chr624028 1174 13882 1810 11203
NM_016936chr1642117 2043 1665 487 11872 2401 191 11898
NM_016946chr152780 1348 934 765 45 1261 1861 --
NM_017420chr1422568 711 13355 ----
NM_017443chr921185 100 1498 --21331 401
NM_017488chr231435 1087 573 --11142 --
NM_017519chr611046 ------
NM_017522chr111037 ------
NM_017583chr1141765 1604 681 264 1350 --1300
NM_017589chr111101 ------
NM_017594chr962543 2399 2347 1251 567 77 1618 ----
NM_017599chr1221463 1371 1190 ----
NM_017628chr411193 --25289 4689 --
NM_017631chr4152 ------
NM_017634chr83593 564 471 11675 ----
NM_017635chr1111508 ------
NM_017637chr931413 1239 250 13690 ----
NM_017643chr1772489 2071 1982 1115 910 734 135 ------
NM_017644chr334844 558 307 1282 1434 23446 3203
NM_017650chr724886 922 1981 --14326
NM_017658chr1434537 3029 1265 23803 651 12995 --
NM_017681chrX2830 43 ------
NM_017730chr31123 ------
NM_017737chr11484 ------
NM_017754chr611881 --23386 1985 34789 3280 1629
NM_017770chr642684 1149 688 89 ------
NM_017813chr854921 3539 2174 1763 818 35092 4781 173 ----
NM_017824chr1022294 141 ------
NM_017902chr1085300 5167 5152 4628 4595 3952 1403 1360 --45695 4318 1429 1272 14264
NM_017922chr141586 ------
NM_017988chr121224 ------
NM_018030chr18------1185
NM_018036chr1433701 3546 3177 2981 845 --1109
NM_018045chr152556 2484 1223 525 357 12891 2909 560 --
NM_018048chr1232034 1534 1474 11896 --1512
NM_018067chr11506 ------
NM_018070chr11367 ------
NM_018085chr136273 1663 1240 --42498 1766 494 355 2827 181
NM_018095chr113513 445 286 1551 1457 --
NM_018105chr81182 ------
NM_018121chr1011149 ----13102
NM_018131chr102873 295 ------
NM_018137chr111291 11086 ----
NM_018178chr121728 145 ------
NM_018184chr31770 ----1558
NM_018195chr1141975 1937 814 526 1779 --11715
NM_018206chr161164 ------
NM_018247chr642505 917 780 430 22222 701 1653 --
NM_018254chr122383 469 ----1385
NM_018263chr252289 1686 1626 551 525 32469 2332 139 ----
NM_018307chr171265 ------
NM_018362chr1133129 2790 2636 22837 1413 --12578
NM_018373chr1486392 4270 4052 1918 1912 1675 1348 1176 12367 11451 --
NM_018374chr743586 1519 1436 568 ------
NM_018403chr322595 493 21632 520 12922 11390
NM_018433chr22398 51 ------
NM_018440chr836739 6208 529 37462 2992 1661 16314 17787
NM_018444chr831465 289 175 ----11585
NM_018449chr92765 305 ------
NM_018469chr171376 ------
NM_018489chr12323 200 ------
NM_018490chr1121771 258 --1447 --
NM_018557chr221615 1169 ------
NM_018590chr1031502 687 680 ------
NM_018602chr1521173 253 --21336 463 --
NM_018638chr1244963 1321 1127 518 1546 ----
NM_018641chr73600 467 163 1656 ----
NM_018649chr101516 ------
NM_018689chr1552598 2290 574 506 308 12050 12274 2961 883
NM_018691chr54773 282 172 112 ------
NM_018708chr1941258 444 111 99 31542 481 252 21450 1274 --
NM_018719chr71296 ----1173
NM_018912chr5188 ------
NM_018913chr5188 ------
NM_018914chr5188 ------
NM_018915chr5188 ------
NM_018916chr5188 ------
NM_018917chr5188 ------
NM_018918chr5188 ------
NM_018919chr5188 ------
NM_018920chr5188 ------
NM_018921chr5188 ------
NM_018922chr5188 ------
NM_018923chr5188 ------
NM_018924chr5188 ------
NM_018925chr5188 ------
NM_018926chr5188 ------
NM_018927chr5188 ------
NM_018928chr5188 ------
NM_018929chr5188 ------
NM_018959chr192710 270 ------
NM_018994chr11464 ------
NM_018999chr1063887 1585 1571 930 537 27 ------
NM_019000chr521213 625 ----1549
NM_019053chr1021022 769 ------
NM_019057chr5128 ------
NM_019084chr1021755 117 ----1721
NM_019557chr12831 224 ------
NM_019595chr21272 --1691 --
NM_019903chr101290 ------
NM_020122chr264774 4080 1306 979 834 97 --24870 3664 --
NM_020123chr1011503 ------
NM_020133chr685958 4715 4587 4175 4134 2572 1758 1226 36145 5965 1279 --12332
NM_020231chr31659 --1594 --
NM_020239chr151983 1703 676 548 274 31845 1739 736 --11597
NM_020336chr2033184 906 389 1960 ----
NM_020341chr20154 1595 ----
NM_020348chr1032712 817 505 --11824 --
NM_020403chr1311326 --11407 --
NM_020420chrY11206 ------
NM_020439chr1138 ------
NM_020440chr152275 2105 1192 543 118 --1877 --
NM_020449chrX------1507
NM_020466chr684874 1896 1786 1236 1014 368 336 57 24916 4514 24373 3387 --
NM_020474chr1811861 ------
NM_020640chr321713 616 ------
NM_020651chr211773 31609 684 539 --11595
NM_020673chr2036461 5268 2392 15448 12784 11377
NM_020717chrX74752 3849 3398 1476 1394 631 482 24607 1909 34856 3724 1625 1578
NM_020718chr1622447 572 35608 2468 2107 15151 --
NM_020728chr743006 2676 2119 150 11021 12784 --
NM_020732chr611046 ------
NM_020739chr1531443 1155 822 14201 ----
NM_020752chr1062429 2258 2008 1928 867 822 ------
NM_020772chr1798469 7886 7738 5398 2860 2534 2273 2023 1477 12690 --15888
NM_020778chr1584525 3867 3746 3233 3094 1802 1111 858 14645 32006 581 497 1456
NM_020783chr181408 ------
NM_020792chr331872 459 325 ------
NM_020802chr1122759 1257 23202 3001 1735 23268 2834
NM_020830chr21570 1470 ----
NM_020841chr1221563 1179 11292 ----
NM_020850chr1643103 3005 2289 2252 12265 12326 11258
NM_020856chr19164 ------
NM_020859chr453805 3350 2879 2791 2689 13637 --1337
NM_020860chr41876 196 ----
NM_020871chrX1106 --1119 --
NM_020922chrX41724 1506 513 51 ------
NM_020935chr253977 1395 1174 955 345 --1122 1250
NM_020948chr133160 2575 58 1132 ----
NM_021003chr141609 ------
NM_021007chr221621 629 ------
NM_021044chr122424 144 ------
NM_021061chr853837 3556 3006 2985 1668 13720 12892 --
NM_021064chr62262 63 ------
NM_021078chr173391 159 66 ------
NM_021090chr2264914 3374 1231 805 759 623 11461 24810 947 11543
NM_021111chr9164 ------
NM_021116chr788386 7878 6309 3297 2383 2053 1855 313 26229 3356 48139 7568 6032 712 --
NM_021167chr732455 1931 390 32723 1024 369 32592 2560 798 --
NM_021202chr2062757 2347 1247 1238 620 69 --32417 997 559 --
NM_021213chr1721165 314 ----21107 984
NM_021255chr1443645 3064 1305 521 ----13030
NM_021639chr11610 ------
NM_021728chr14------1401
NM_021738chr101213 ------
NM_021813chr675597 5209 4932 4188 3725 3602 986 15181 --1350
NM_021818chr14--1230 --11422
NM_021911chr524627 989 12216 22238 1210 1572
NM_021914chr1411849 ------
NM_021931chr20----1736 1823
NM_021951chr93759 374 365 ------
NM_021960chr132726 964 537 1799 12426 22620 1849
NM_021961chr1145919 5543 2085 1393 ----1282
NM_021964chr356409 6128 5412 2302 2026 16580 25338 331 --
NM_021988chr2031343 655 464 ------
NM_022048chr1544460 969 575 25 45993 5535 5286 1826 21470 1325 25297 4397
NM_022062chr11163 ------
NM_022118chr131480 ------
NM_022171chr351557 1351 446 311 103 --2550 256 2271 84
NM_022336chr23858 643 601 --21488 127 --
NM_022442chr2031343 655 464 ------
NM_022459chr1366260 6070 4271 2372 1286 457 35227 4727 4289 --1873
NM_022473chr1533975 1721 1042 2640 632 11445 13123
NM_022552chr211182 ------
NM_022755chr972584 2102 2019 1681 897 640 634 --1572 --
NM_022757chr3------1952
NM_022760chr20144 ------
NM_022781chr952821 2540 2371 1280 723 12510 ----
NM_022841chr151459 --12026 --
NM_022893chr212113 ----1820
NM_023010chrX3725 580 80 ------
NM_023012chr121739 ------
NM_023927chr5------2266 150
NM_024076chr1921844 1697 --21955 1729 42035 1974 621 557
NM_024345chr954728 2069 2035 1611 1306 25966 3895 11487 148
NM_024430chr1831531 247 162 ----21801 1735
NM_024511chr483364 3228 3126 2787 2685 2321 2206 807 --22643 2421 --
NM_024513chr343079 473 457 207 11523 13833 --
NM_024519chr16147 ------
NM_024624chr221489 665 ------
NM_024674chr162835 2603 2316 2226 788 115 138 1430 22879 808
NM_024742chr163681 493 438 ------
NM_024744chr221692 978 ------
NM_024749chr13873 660 69 ------
NM_024755chr151651 ------
NM_024761chr943321 3248 491 343 35319 3792 642 ----
NM_024770chr265875 5792 5630 4889 1982 613 22396 1266 45259 2088 817 714 --
NM_024812chr832153 1603 412 11722 1762 --
NM_024817chr1545378 4474 4215 1957 13860 24468 4452 12268
NM_024825chr191221 ------
NM_024835chr171170 ------
NM_024837chr152352 43 ------
NM_024881chr19103669 3384 3031 2975 2688 1222 1120 990 681 368 ------
NM_024947chr367113 3648 3596 2748 2406 749 ------
NM_024953chr1231000 678 301 ----11930
NM_024989chr268139 7026 5580 1554 1250 709 36585 5199 2953 11235 --
NM_024991chr1032387 2259 811 1735 ----
NM_025054chr814085 ----23004 2712
NM_025083chr1572011 1933 1418 1308 1300 666 310 --11589 --
NM_025126chr121603 1753 ----
NM_025134chr1642398 2172 645 522 1608 ----
NM_025138chr1321064 572 ------
NM_025160chr144053 3334 3243 265 11704 --11025
NM_025191chr142694 2500 1078 262 ------
NM_025264chr22308 29 ------
NM_030594chr151201 ------
NM_030627chr543658 1425 627 27 ------
NM_030629chr1611935 ------
NM_030637chr14184 ------
NM_030647chr764747 3862 2285 1122 538 260 55511 5320 4628 3827 1844 11951 --
NM_030752chr6------1521
NM_030755chr1412299 21992 603 --11006
NM_030791chr141719 ------
NM_030795chr81373 ------
NM_030806chr1158572 8288 8249 7785 7087 6817 6741 5740 5705 5690 3732 3303 2923 1869 1377 48454 7644 6999 961 --12653
NM_030881chr2242388 2193 2113 548 ------
NM_030915chr252121 1521 810 576 311 ----12330
NM_030918chr155109 2180 2060 1920 409 13890 54517 4486 4299 2156 1745 --
NM_031216chr1821911 1610 ------
NM_031268chr1674938 4036 3953 3841 1936 564 212 11924 12022 --
NM_031422chr181498 ------
NM_031426chr942734 2563 514 369 22004 1756 ----
NM_031427chr1455469 4669 4203 1594 1267 11181 54606 4307 3780 3706 1697 15325
NM_031445chr232459 986 934 22546 1088 12468 12609
NM_031468chr7107585 6947 6563 6021 3281 2739 2295 1446 1203 464 16138 36416 5197 2000 13040
NM_031483chr2043480 3049 2944 2789 22423 607 12958 --
NM_032012chr935139 3438 798 --33541 3502 1603 13400
NM_032088chr5188 ------
NM_032092chr5188 ------
NM_032146chr31155 ------
NM_032174chr11308 ----21444 431
NM_032211chr103778 329 311 --3856 838 181 1132
NM_032229chr131188 ----1156
NM_032315chr11227 ------
NM_032352chr141216 ----11034
NM_032373chr1053962 1244 954 904 173 11405 --11385
NM_032380chr5129 ------
NM_032403chr5188 ------
NM_032441chrX2127 118 1420 ----
NM_032457chr453458 3124 2950 1094 673 21109 867 ----
NM_032471chr621119 785 ------
NM_032505chr322692 295 --12178 146
NM_032521chr2022641 1204 ------
NM_032538chr642202 1129 621 182 1936 1919 22691 1796
NM_032582chr1721276 220 ------
NM_032727chr101272 ------
NM_032873chr1134531 4370 514 11083 1726 --
NM_032918chr12----1993 --
NM_032932chr1765704 4299 3916 2052 631 287 --44761 4556 1695 32 --
NM_032968chrX14234 11146 --1969
NM_032969chrX14234 11146 --1969
NM_032973chrY14226 11146 --1969
NM_033015chr7121 ------
NM_033020chr133254 1797 621 1630 ----
NM_033055chr12901 847 ------
NM_033081chr20193 ------
NM_033103chr19124 ------
NM_033136chr521745 1389 1649 ----
NM_033137chr521745 1389 1649 ----
NM_033150chr121326 ------
NM_033224chr755153 1627 1201 547 304 ------
NM_033226chr16165 ------
NM_033285chr833977 1130 605 --1399 --
NM_033290chrX3794 259 47 21281 275 1710 --
NM_033300chr111037 ------
NM_033326chr1122532 381 ----1703
NM_033360chr1243550 3012 1668 1645 13310 ----
NM_033427chr71286 ------
NM_033637chr1093914 3610 3508 3405 3263 1651 1444 1273 1202 --1539 --
NM_052827chr123938 864 88 ------
NM_052898chr82658 434 ------
NM_052900chr8197 ------
NM_052910chr1331551 875 746 ------
NM_052927chr5160 --11430 11657
NM_053016chr957774 3056 2691 1249 804 15778 37671 7178 3164 --
NM_053025chr3--11145 --1662
NM_053026chr3--11145 --1662
NM_053027chr3--11145 --1662
NM_053028chr3--11145 --1662
NM_053031chr3--11145 --1662
NM_053032chr3--11145 --1662
NM_053043chr766294 5356 5176 4015 2482 27 1344 ----
NM_054035chr173706 586 118 ------
NM_057089chr71161 ------
NM_057175chr422217 1073 ----11847
NM_079421chr191396 ------
NM_080546chr92634 395 ------
NM_080597chr18------1185
NM_080632chrX3725 580 80 ------
NM_080682chr12557 483 ------
NM_080738chr131581 1274 93 ------
NM_080742chr6186 ------
NM_080764chr2253244 3092 2392 530 145 ------
NM_080927chr311156 ----12595
NM_100264chr101152 ------
NM_100486chr101152 ------
NM_130391chr932650 1307 317 ------
NM_130392chr932650 1307 317 ------
NM_130393chr932650 1307 317 ------
NM_130434chr1521188 1133 ------
NM_130439chr1021899 725 ------
NM_130439chr1021899 725 ------
NM_130442chr71217 ------
NM_130446chr363332 3162 590 242 115 82 23839 2773 2696 207 13897
NM_130830chr322576 1441 1201 33940 3589 2877 13553
NM_133170chr20127018 5921 5350 3181 3072 2089 2017 1819 1797 1741 996 485 13040 56462 6274 6230 391 86 12959
NM_133265chrX63410 2221 779 501 477 191 ----12732
NM_133334chr475772 4556 4213 2263 1906 962 423 16253 14803 --
NM_133370chr423114 2265 53056 2698 1311 872 863 13286 --
NM_133477chr432840 1181 1029 ------
NM_133486chrX1464 ------
NM_133640chr91107 ----130
NM_133647chr1563217 2747 1429 1355 746 546 ------
NM_134424chr1221257 1090 1307 ----
NM_138270chrX23250 760 2356 62 ----
NM_138286chr1943166 2673 1339 642 ------
NM_138328chr1752826 2655 2417 2353 2172 13022 11260 12141
NM_138338chr2283309 3208 3055 2791 1375 1285 802 754 22855 877 11243 --
NM_138395chr261136 1074 388 355 228 153 169 ----
NM_138426chr751958 835 533 507 385 ------
NM_138473chr1285005 4398 3575 1929 1290 1119 803 132 24512 3147 ----
NM_138494chr742314 2128 626 37 12819 11849 --
NM_138638chr1411849 ------
NM_138713chr1665698 2837 2617 1243 1011 831 56359 5358 4985 2319 1978 17650 11002
NM_138714chr1665698 2837 2617 1243 1011 831 56359 5358 4985 2319 1978 17650 11002
NM_138731chr1433661 1274 334 12847 ----
NM_138795chr141549 1431 1420 438 ------
NM_138927chr211134 ------
NM_138959chr155698 5252 1385 528 490 36415 5198 406 24632 1131 25770 1887
NM_139057chr1542235 1797 254 38 ------
NM_139316chr72750 438 ------
NM_144582chr271895 1748 1699 867 774 287 37 186 22232 1976 --
NM_144584chr1127 ------
NM_144600chr161451 1523 --11517
NM_144610chr17----164 1171
NM_144710chr221166 372 11019 ----
NM_144767chr1554300 1174 1075 729 233 1311 23171 254 --
NM_144778chr1312575 ------
NM_144963chr822643 2490 ------
NM_144973chr1265310 4356 3864 3595 1701 1102 ----1973
NM_145055chr1822604 433 21151 1142 --2287 181
NM_145176chr652865 2646 1018 942 508 --146 1927
NM_145207chr464160 4102 3920 1952 1078 928 14903 34654 3870 1506 14832
NM_145259chr226335 2859 14663 15638 11972
NM_145284chrX32381 1963 932 12114 ----
NM_145320chr712534 ----13182
NM_145321chr712534 ----13182
NM_145322chr712534 ----13182
NM_145690chr81795 ----11318
NM_145716chr11367 ------
NM_145753chr331139 489 27 ------
NM_145861chr131581 1274 93 ------
NM_147150chr952446 1551 1405 1174 720 11079 ----
NM_147189chr831905 1706 219 ------
NM_148174chr821385 577 ------
NM_148894chr41921 ------
NM_148955chr1566291 5814 2420 1728 424 301 22047 315 75412 5344 4228 4188 1046 985 789 --
NM_152230chr10------2217 166
NM_152253chr2244133 1717 1597 536 --12716 1882
NM_152282chr311076 1973 ----
NM_152305chr331581 1421 659 --1594 --
NM_152330chr1411627 ------
NM_152344chr1711310 ------
NM_152437chr121222 12184 --11646
NM_152450chr1531851 1398 89 ----11371
NM_152455chr1542534 2201 656 117 42682 2581 2472 1921 12664 22868 104
NM_152529chr254456 3127 2828 1263 418 --23231 523 1208
NM_152542chr41300 32169 1958 651 1776 11380
NM_152557chr72342 83 ------
NM_152594chr1522073 355 ------
NM_152621chr42335 82 ------
NM_152624chr586090 5999 5567 2763 2326 2151 1119 85 ----15736
NM_152653chr32665 464 ------
NM_152680chr422072 371 1385 --12401
NM_152744chr752329 2288 735 671 592 22614 166 22470 25 --
NM_152745chr71343 ------
NM_152756chr533051 2831 1349 13469 ----
NM_152787chrX21314 555 21156 624 170 11531
NM_152826chr1566291 5814 2420 1728 424 301 22047 315 75412 5344 4228 4188 1046 985 789 --
NM_152838chr2033054 1225 1125 13034 --13279
NM_152857chr61808 ------
NM_152858chr61808 ------
NM_152862chr2192 ------
NM_152890chr13448 280 27 ----1133
NM_152902chr121481 1314 --11558 --
NM_153006chr171433 --1301 --
NM_153050chr2264914 3374 1231 805 759 623 11461 24810 947 11543
NM_153051chr2264914 3374 1231 805 759 623 11461 24810 947 11543
NM_153188chr545362 3785 1118 871 11129 ----
NM_153260chr1561198 988 537 196 159 121 ------
NM_153262chr142535 2021 553 530 1205 12713 --
NM_153347chr1182223 1875 1727 698 681 264 182 79 --11743 32297 906 874
NM_153367chr1032795 1021 731 --13505 11136
NM_153371chr1342394 2355 372 89 ------
NM_153464chr191674 ------
NM_153759chr211182 ------
NM_153810chr1044760 3155 1798 416 --196 13446
NM_170679chr511245 ------
NM_170692chr11155 ------
NM_170706chr153936 1690 1475 799 638 14092 13845 13947
NM_170719chr1321064 572 ------
NM_172037chr82273 196 ----11037
NM_172216chr1242736 1902 944 803 22280 604 ----
NM_172242chr101812 1562 --1878
NM_172337chr14------1401
NM_173201chr16149 ------
NM_173214chr1665698 2837 2617 1243 1011 831 56359 5358 4985 2319 1978 17650 11002
NM_173468chr432149 773 453 25133 1051 ----
NM_173475chr161451 ------
NM_173517chr71353 ------
NM_173536chr424124 173 ------
NM_173552chr32685 491 12216 ----
NM_173559chr61141 ------
NM_173582chr1155166 4441 1839 1306 590 12270 35268 1409 715 1857
NM_173595chr1254713 4050 3891 952 514 --11146 --
NM_173602chr1253279 3166 2504 994 817 12999 --13015
NM_173642chr198897 8637 6128 5760 3434 2775 2745 1355 1084 39001 8189 1093 48060 7999 2039 525 --
NM_173797chr51244 ------
NM_173814chr152166 24 ------
NM_173822chr222163 1471 ------
NM_173829chr524397 1268 25780 847 --11530
NM_173834chrX1386 ------
NM_173851chr822948 2699 1441 --1351
NM_174934chr1133491 230 179 ----33294 1069 718
NM_175056chr362164 1461 716 452 258 251 ------
NM_175061chr7174 ------
NM_175624chr1246929 6598 5416 2748 36015 2649 2070 16453 15785
NM_175625chr1246929 6598 5416 2748 36015 2649 2070 16453 15785
NM_175629chr211182 ------
NM_175736chr1255786 3016 2043 915 417 --66788 1949 1931 1239 256 84 14907
NM_175852chr162679 2562 2457 2261 614 460 12200 ----
NM_175861chr1235786 1588 122 34570 2190 1639 14783 --
NM_175863chr611046 ------
NM_175907chr1812589 ----1478
NM_176863chr1751408 735 570 512 181 1408 --1190
NM_176871chr852991 2745 2590 581 154 --22544 205 12562
NM_177539chr11720 ------
NM_177951chr141207 ------
NM_177952chr141609 ------
NM_177976chr31155 ------
NM_177989chr31357 ----168
NM_177990chr20154 1595 ----
NM_178011chr101964 ------
NM_178042chr31357 ----168
NM_178151chrX87234 3049 2361 2143 993 978 903 293 21880 1724 22034 610 --
NM_178152chrX87234 3049 2361 2143 993 978 903 293 21880 1724 22034 610 --
NM_178153chrX87234 3049 2361 2143 993 978 903 293 21880 1724 22034 610 --
NM_178554chr353491 1272 1221 887 185 1673 32938 2458 1204 --
NM_178566chr93409 281 115 11171 1570 --
NM_178584chr221166 372 11019 ----
NM_178585chr41191 1707 ----
NM_178818chr1642185 1760 220 96 2938 440 2658 394 --
NM_180989chr134941 717 608 334 21978 507 ----
NM_181491chr962722 1973 1961 752 740 311 12056 12277 12645
NM_181492chr2211215 ------
NM_181521chr1696966 6541 5001 4877 1998 774 548 412 402 25719 5221 45439 5175 2184 1687 --
NM_181643chr131632 1468 1345 ------
NM_181656chr171826 ------
NM_181659chr201451 11359 --13267
NM_181659chr201451 11359 --13267
NM_181671chr171721 --1820 141
NM_181672chrX2788 407 ------
NM_181673chrX2788 407 ------
NM_181714chr611705 --1455 --
NM_181787chr832738 1152 785 ------
NM_181794chr621119 785 ------
NM_181795chr621119 785 ------
NM_181886chr411401 ------
NM_181887chr411401 ------
NM_181888chr411401 ------
NM_181889chr411401 ------
NM_181890chr411401 ------
NM_181891chr411401 ------
NM_181893chr411401 ------
NM_182493chr1662149 1817 1186 803 477 418 ------
NM_182503chr624373 3407 ------
NM_182526chr1452913 2468 2051 434 249 ------
NM_182551chr233208 2853 434 12431 --22472 649
NM_182680chrX146 ------
NM_182700chr721670 595 ------
NM_182715chr721155 211 ------
NM_182760chr32894 282 ------
NM_182763chr132715 953 526 1788 12415 22609 1838
NM_182765chr101633 ------
NM_182796chr53344 278 121 --1112 --
NM_182898chr724183 631 14360 15778 --
NM_182899chr724183 631 14360 15778 --
NM_182918chr211992 ------
NM_182970chr2064151 3704 3406 3321 3065 436 34042 3345 732 ----
NM_182975chr12726 468 1192 ----
NM_183419chr82972 83 ------
NM_194247chr232994 1208 188 23469 58 ----
NM_194271chr121603 1753 ----
NM_194277chrX151 ----1544
NM_194286chr1274293 4002 1122 823 625 491 216 --15730 11092
NM_194291chr822381 2155 176 1165 --
NM_194292chr121559 46 ------
NM_194301chr14169 ------
NM_194314chr135065 4425 4370 1493 --14416
NM_194328chr952821 2540 2371 1280 723 12510 ----
NM_194329chr952821 2540 2371 1280 723 12510 ----
NM_194330chr952821 2540 2371 1280 723 12510 ----
NM_194332chr952821 2540 2371 1280 723 12510 ----
NM_194358chr1251446 506 338 276 173 124 --11709
NM_194359chr1251446 506 338 276 173 124 --11709
NM_194434chr1834589 3843 1223 25629 418 --14304
NM_197941chr522636 215 12782 --1604
NM_198047chr21552 ------
NM_198081chr632853 1940 626 ------
NM_198089chr191337 ----1583
NM_198097chr7193 ------
NM_198123chr8197 ------
NM_198124chr8197 ------
NM_198128chr18------12282
NM_198158chr342609 2508 1221 317 ------
NM_198159chr342609 2508 1221 317 ------
NM_198177chr342609 2508 1221 317 ------
NM_198178chr342609 2508 1221 317 ------
NM_198188chr9147 ------
NM_198225chr103254 158 109 --11617 --
NM_198240chr123558 542 86 ------
NM_198261chr121739 ------
NM_198262chr121739 ------
NM_198320chr1274062 4033 3651 1871 1353 576 482 145 ----
NM_198324chr1221342 72 ------
NM_198390chr1611935 ------
NM_198391chr2031452 363 178 ------
NM_198463chr3158 ------
NM_198560chr373678 3369 3153 3103 3018 907 671 12764 23198 2624 --
NM_198686chr1432606 2321 1929 --21923 187 12261
NM_198793chr343011 435 349 303 ------
NM_198834chr1721559 140 ------
NM_198836chr1721559 140 ------
NM_198837chr1721559 140 ------
NM_198838chr1721559 140 ------
NM_198839chr1721559 140 ------
NM_198859chr384873 4148 3834 3466 3114 1851 1825 344 44562 3745 3722 1222 ----
NM_198880chr31123 ------
NM_198900chr1255786 3016 2043 915 417 --66788 1949 1931 1239 256 84 14907
NM_198956chr721670 595 ------
NM_199044chr132624 1007 258 --32360 1112 659 --
NM_199144chr2031343 655 464 ------
NM_199203chr2031343 655 464 ------
NM_199355chr162381 27 ----11509
NM_201266chr222901 935 ------
NM_201279chr222901 935 ------
NM_201432chr17165984 5863 5843 5783 5706 4872 4537 2288 2077 1446 1167 754 627 575 430 395 46616 6166 2264 861 26056 5573 --
NM_201433chr17165984 5863 5843 5783 5706 4872 4537 2288 2077 1446 1167 754 627 575 430 395 46616 6166 2264 861 26056 5573 --
NM_201521chr62377 143 ----1165
NM_201522chr62377 143 ----1165
NM_201523chr62377 143 ----1165
NM_201613chr121220 ------
NM_201999chr42908 27 11193 ----
NM_203283chr41525 ------
NM_203284chr41525 ------
NM_203301chr1411231 --1346 --
NM_203342chr153074 2757 2348 1102 212 1366 1809 22865 2733
NM_203343chr153074 2757 2348 1102 212 1366 1809 22865 2733
NM_203344chr191131 ------
NM_203354chr141270 --1124 --
NM_203355chr141270 --1124 --
NM_203356chr141270 --1124 --
NM_203390chr83570 559 414 11377 ----
NM_203394chr1241811 931 549 434 32720 2184 446 12086 --
NM_203487chr1311326 --11407 --
NM_203504chr442569 2148 1618 295 ------
NM_203505chr442569 2148 1618 295 ------
NM_206876chr222960 2409 23492 3052 12345 --
NM_206884chr7131 ------
NM_206885chr7131 ------
NM_207015chr31739 ------
NM_207174chr211592 ------
NM_207304chr1312462 ------
NM_207317chr5------1371
NM_207325chr1921562 365 --1341 --
NM_207371chr1041322 1299 1100 238 ------
NM_207627chr211592 ------
NM_207628chr211592 ------
NM_207629chr211592 ------
NM_213589chr284727 4616 3553 3424 1293 755 109 76 21493 598 ----