TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1202
miRNA Sequence: GUGCCAGCUGCAGUGGGGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5------1345
NM_000037chr832271 1654 189 --12289 --
NM_000038chr51755 ------
NM_000061chrX--1364 ----
NM_000068chr1921199 38 ------
NM_000069chr1----136 --
NM_000070chr152543 464 ------
NM_000084chrX76888 6299 5022 4558 4307 2626 2259 35725 4488 1001 2769 681 --
NM_000085chr13385 123 44 ------
NM_000090chr22792 639 ------
NM_000109chrX11700 ------
NM_000129chr631356 1014 30 1517 ----
NM_000138chr1522515 277 --12174 --
NM_000141chr1031253 1047 1041 ------
NM_000142chr4157 --11165 --
NM_000163chr542331 1709 956 653 ------
NM_000165chr611284 ------
NM_000176chr553886 3854 3261 841 367 1171 --1982
NM_000178chr201118 ------
NM_000189chr221876 109 --11482 --
NM_000192chr1221268 1200 ------
NM_000202chrX271 49 11466 --13092
NM_000208chr1943901 1075 1037 361 --11313 14582
NM_000214chr202164 132 31608 1476 144 --1542
NM_000217chr1225353 2055 ------
NM_000232chr422490 1171 ------
NM_000259chr1535623 5602 4242 1517 34300 4293 309 --
NM_000262chr223714 615 62 --1722 --
NM_000264chr942059 1233 767 757 12161 12197 --
NM_000266chrX1212 174 ----
NM_000271chr181122 1258 ----
NM_000278chr1032155 1558 849 --1373 --
NM_000286chr172238 60 ------
NM_000314chr1022997 446 ------
NM_000330chrX2886 40 ------
NM_000332chr645938 4917 2165 861 --11438 --
NM_000335chr352037 1968 1603 817 183 11491 ----
NM_000368chr994289 3319 1280 1217 779 603 482 399 173 --41714 758 669 41 11209
NM_000369chr141435 1673 ----
NM_000378chr11----1850 --
NM_000408chr222844 764 1344 ----
NM_000430chr1723311 598 13790 22690 240 --
NM_000434chr61397 1126 ----
NM_000435chr191770 1873 ----
NM_000445chr82202 188 --1944 --
NM_000451chrX31730 1469 399 --11575 --
NM_000452chr1311474 1771 188 --
NM_000460chr31320 1121 ----
NM_000461chr344293 1645 1435 134 ------
NM_000462chr1511510 ------
NM_000480chr1121204 413 11260 ----
NM_000484chr211749 ------
NM_000489chrX1803 1751 1867 --
NM_000522chr72905 127 ------
NM_000533chrX1216 ------
NM_000555chrX67578 6234 5124 3103 2480 409 16480 --12235
NM_000609chr10--21253 216 ----
NM_000611chr1165798 5413 4276 816 782 533 36407 4567 2254 15642 --
NM_000615chr1121141 395 ------
NM_000627chr21332 ------
NM_000633chr1875160 4244 3301 3282 1347 447 387 ------
NM_000635chr1931661 537 417 11646 ----
NM_000682chr271793 1574 1478 1264 747 531 374 ------
NM_000684chr1011213 ------
NM_000701chr11105 ------
NM_000719chr1222662 2130 11058 11450 --
NM_000721chr12628 346 1810 12450 --
NM_000723chr1721069 507 --1589 --
NM_000724chr1021772 210 ------
NM_000725chr124252 83 44 26 --194 --
NM_000767chr1931233 1224 432 ------
NM_000793chr1444750 4417 1066 413 14946 11901 --
NM_000801chr201920 ------
NM_000809chr488180 5783 5724 3161 2808 2117 1678 593 38849 7881 489 --17910
NM_000812chr4--1388 ----
NM_000813chr535601 636 125 23555 1219 ----
NM_000814chr1523473 631 ------
NM_000818chr102193 184 ------
NM_000826chr41133 1818 ----
NM_000827chr522502 987 12264 ----
NM_000828chrX22005 513 --11336 --
NM_000829chr1142316 1914 1524 139 ------
NM_000839chr3180 ------
NM_000849chr132134 1034 196 23063 2935 --11001
NM_000859chr51526 ------
NM_000868chrX1653 12270 ----
NM_000875chr15136438 5226 5016 4770 4741 4576 4271 2358 2146 2028 1999 916 668 12710 14642 1695
NM_000876chr631349 1218 1203 ------
NM_000899chr1253017 1243 789 706 196 1553 --145
NM_000901chr441677 669 576 339 ------
NM_000919chr51154 ------
NM_000926chr1169387 9184 8684 7954 2622 1706 18905 --18695
NM_000935chr321025 50 ------
NM_000944chr422296 1613 12155 ----
NM_000945chr22373 264 --11886 --
NM_000956chr1411035 ------
NM_000958chr52833 334 ------
NM_000959chr122857 550 42827 1090 875 57 ----
NM_000960chr193537 510 158 --1703 --
NM_000961chr2053722 3640 3425 413 89 ----13829
NM_000964chr1741295 1025 878 508 ------
NM_000965chr31919 11292 ----
NM_001001323chr1221955 688 ------
NM_001001331chr312641 12050 ----
NM_001001396chr144122 3388 2874 581 --23571 3171 11038
NM_001001481chr82662 174 13348 ----
NM_001001484chr1021873 1670 ------
NM_001001523chr14469 171 146 42 --1202 --
NM_001001556chr1521113 51 ------
NM_001001557chr8--2727 585 2803 98 --
NM_001001664chr21586 ------
NM_001001668chr1953983 3891 3703 403 268 ------
NM_001001701chr4--11468 ----
NM_001001711chr11--176 ----
NM_001001890chr2134041 3998 472 --1213 --
NM_001001933chr11153 ------
NM_001002031chr12298 44 ------
NM_001002032chr172660 483 ------
NM_001002033chr172760 583 ------
NM_001002233chr831986 1807 800 ------
NM_001002258chr221704 792 --125 --
NM_001002269chr91172 1107 ----
NM_001002295chr101867 ------
NM_001002762chr1042053 676 411 69 --2814 589 --
NM_001002838chrX11439 ------
NM_001002843chr152940 465 ----1505
NM_001002860chr1454374 2866 1454 1448 656 13998 24698 258 --
NM_001002876chr222138 49 --1380 1316
NM_001002909chr1721746 619 ------
NM_001003406chr2243249 3084 2814 959 --13240 --
NM_001003652chr1868456 8025 6244 5385 3474 3043 35413 5301 2033 36972 6926 820 --
NM_001003676chr112357 275 ------
NM_001003682chr1--1335 ----
NM_001003688chr42853 349 ------
NM_001003792chr3169 ------
NM_001003793chr3169 ------
NM_001003794chr312641 --12336 --
NM_001003796chr221864 --2787 749 --
NM_001003800chr941498 730 618 489 --23065 1454 --
NM_001003940chr1583483 3366 3123 2972 2527 2467 771 529 --22427 837 --
NM_001003942chr1583483 3366 3123 2972 2527 2467 771 529 --22427 837 --
NM_001003943chr1583487 3370 3127 2976 2531 2471 775 533 --22431 841 --
NM_001004065chr932527 1399 396 ------
NM_001004105chr5126 ------
NM_001004127chr132684 207 ------
NM_001004304chr1252710 2615 975 744 477 --1332 --
NM_001004317chr644142 4125 3569 998 --14545 --
NM_001004329chr121247 11146 ----
NM_001004342chr185167 5040 4687 4380 1463 991 432 122 14292 15675 15722
NM_001004419chr1232801 1411 737 1813 ----
NM_001004439chr1531213 174 109 ------
NM_001004441chr511401 21055 629 ----
NM_001004722chr2193 ------
NM_001005271chr171222 --1253 --
NM_001005273chr171222 --1253 --
NM_001005290chr11103 ------
NM_001005335chr191298 ------
NM_001005360chr193855 599 137 ------
NM_001005361chr193855 599 137 ------
NM_001005362chr193855 599 137 ------
NM_001005375chrY2126 71 ------
NM_001005386chr221837 676 ----12012
NM_001005463chr1011931 ------
NM_001005473chr546658 6437 6166 6065 1752 21214 119 --
NM_001005474chr331022 447 189 192 21349 1109 --
NM_001005505chr331426 192 122 --1740 --
NM_001005609chrX2544 505 12755 22975 2959 --
NM_001005739chr21710 ------
NM_001005753chr22746 599 32274 2034 1719 ----
NM_001005782chr2198 1124 ----
NM_001005849chr171172 ------
NM_001005861chr32963 708 1937 ----
NM_001006115chr352402 1978 1819 379 278 --2656 641 --
NM_001006600chr552289 2037 528 475 415 ------
NM_001006617chr92210 121 ------
NM_001006618chr91202 ------
NM_001006619chr92210 121 ------
NM_001006620chr92210 121 ------
NM_001006621chr92210 121 ------
NM_001006623chr231817 917 719 175 1390 --
NM_001006634chr162559 210 142 ----
NM_001006665chr13774 576 207 ----1699
NM_001006681chrX121 ------
NM_001006682chrX121 ------
NM_001006683chrX121 ------
NM_001006932chr652702 2674 1346 469 79 --1507 --
NM_001006933chrX263 47 ------
NM_001007023chr1444750 4417 1066 413 14946 11901 --
NM_001007024chr17----13207 --
NM_001007025chr17----13207 --
NM_001007027chr11--1236 ----
NM_001007102chr621032 332 --11260 --
NM_001007156chr152563 184 11450 ----
NM_001007237chr162221 2183 1091 911 904 27 ------
NM_001007246chr2121633 1231 11757 11315 --
NM_001007257chr141194 520 319 286 ------
NM_001007271chr104912 173 73 59 --2794 716 --
NM_001007277chr1121113 933 ------
NM_001007466chr634957 4777 3803 --11670 --
NM_001007553chr11340 2398 284 ----
NM_001007559chr1821830 1821 ------
NM_001008220chr583709 3429 2865 2698 2598 1054 632 108 --13515 --
NM_001008222chrX2248 146 ------
NM_001008223chr123546 503 102 ------
NM_001008225chr72507 214 ------
NM_001008239chr1843566 925 469 420 12993 ----
NM_001008408chr745550 5113 4125 755 12298 14649 --
NM_001008495chr821756 1634 ------
NM_001008528chr1741549 1162 485 233 ------
NM_001008540chr21433 ------
NM_001008564chr1311873 ------
NM_001008701chr1992377 2160 2044 1186 1048 1042 579 98 26 ------
NM_001008738chr532810 2754 2014 1619 ----
NM_001009552chr81125 ------
NM_001009555chr4128 ------
NM_001009571chr711211 ------
NM_001009880chr2254854 4730 4273 3844 3342 --2822 204 --
NM_001009881chr1126 ------
NM_001009882chr1126 ------
NM_001009899chr345551 4713 2187 430 ------
NM_001009955chr1196 ------
NM_001009955chr1196 ------
NM_001009959chr292398 2333 2223 2109 1957 538 424 373 288 1470 12440 --
NM_001009960chr722303 875 12111 ----
NM_001009993chr2104218 4095 3705 3398 3352 1695 1336 646 573 62 1224 32914 1675 1393 --
NM_001010846chr131017 356 33 ----14387
NM_001010867chr1115465 5362 2422 2183 2018 1646 1559 1000 733 363 330 36497 6110 4770 ----
NM_001010891chr556781 5663 4981 2712 179 ------
NM_001010922chr154254 1430 1410 1384 987 ------
NM_001010924chr10----1429 --
NM_001010980chr173432 3219 2536 2246 1191 530 77 ------
NM_001010984chr131002 764 46 ------
NM_001010986chrX21547 361 ------
NM_001010989chr16----1371 --
NM_001010990chr16----1371 --
NM_001011513chr443241 3065 2914 191 ------
NM_001011537chr331793 1610 226 ------
NM_001011551chrX1125 ------
NM_001011553chr71697 ------
NM_001011666chr731814 1552 246 ------
NM_001011713chr141161 ------
NM_001012264chr141717 --1289 --
NM_001012329chr152204 1987 1856 1596 434 --21674 163 1921
NM_001012337chr31102 ------
NM_001012393chr1174682 3835 2052 1586 1390 1153 1052 ------
NM_001012418chr621585 111 ----23136 2665
NM_001012419chr921302 877 --1168 --
NM_001012420chr1562916 2156 1102 660 333 205 --1977 --
NM_001012423chr1562916 2156 1102 660 333 205 --1977 --
NM_001012426chr631039 736 398 ------
NM_001012427chr631039 736 398 ------
NM_001012614chr42544 97 ------
NM_001012751chr102401 395 ------
NM_001012755chrX33446 1885 1394 23253 301 ----
NM_001012756chr1932674 2547 2538 ------
NM_001012990chrX--1295 ----
NM_001013415chr421201 125 ------
NM_001013438chr32731 406 154 ----
NM_001013439chr32577 252 ------
NM_001013615chr12963 437 --1778 --
NM_001013620chr1255963 3393 3247 3037 265 27166 2745 ----
NM_001013622chr47449 388 326 264 202 141 79 ------
NM_001013690chr1242356 1871 1853 450 12291 2284 90 --
NM_001013693chr172360 1127 909 728 579 140 33 1409 21988 470 --
NM_001013693chr172360 1127 909 728 579 140 33 1409 21988 470 --
NM_001013699chr121487 ------
NM_001014283chr1341910 1781 1770 1596 1395 11401 --
NM_001014336chr12126 ------
NM_001014434chr1--1165 ----
NM_001014765chr121894 1399 2405 39 ----
NM_001014797chr1068122 6180 3167 2685 2263 840 22694 2677 38056 7643 6799 15103
NM_001015053chr1731618 1504 596 ------
NM_001015508chr81136 ------
NM_001015877chrX22020 1114 3729 690 601 ----
NM_001015881chrX1120 1298 ----
NM_001015887chr311279 ------
NM_001017368chr1732253 2159 67 ----1187
NM_001017371chr221221 368 ------
NM_001017395chr332885 2876 543 138 ----
NM_001017424chr1--1325 173 --
NM_001017425chr1--1325 173 --
NM_001017440chr7107904 6263 6035 3099 2399 2288 1976 954 575 186 26889 1707 16358 --
NM_001017523chr1221243 89 1468 ----
NM_001017916chr1751595 684 473 333 96 --11801 --
NM_001017917chr1751595 684 473 333 96 --11801 --
NM_001017926chr811424 ------
NM_001017995chr574689 3762 3612 1852 1090 43 33 14682 --13689
NM_001018004chr151557 1658 ----
NM_001018006chr151557 1658 ----
NM_001018007chr151557 1658 ----
NM_001018020chr151557 1658 ----
NM_001018041chr6--1371 ----
NM_001018050chr2232898 2805 2258 ------
NM_001018052chr2232898 2805 2258 ------
NM_001018064chr942106 1625 715 200 ------
NM_001018067chr144706 1985 1662 1056 13341 ----
NM_001018068chr144706 1985 1662 1056 13341 ----
NM_001018069chr144706 1985 1662 1056 13341 ----
NM_001018072chr1221243 89 1468 ----
NM_001018074chr553886 3854 3261 841 367 1171 --1982
NM_001018075chr553886 3854 3261 841 367 1171 --1982
NM_001018076chr553886 3854 3261 841 367 1171 --1982
NM_001018077chr553886 3854 3261 841 367 1171 --1982
NM_001018108chr1541909 1746 625 543 ------
NM_001020658chr11524 155 ----
NM_001020658chr11524 155 ----
NM_001023567chr1582443 2308 1772 980 856 663 333 205 --1985 --
NM_001023587chr31395 1349 ----
NM_001024094chr553886 3854 3261 841 367 1171 --1982
NM_001024226chr12826 209 ------
NM_001024227chr12826 209 ------
NM_001024228chr12826 209 ------
NM_001024401chr1682837 2570 2275 1106 1020 751 413 162 ------
NM_001024455chrX32397 677 235 ------
NM_001024463chr151208 1469 ----
NM_001024649chr522146 76 ------
NM_001024666chrX1625 --1205 --
NM_001024808chr1272369 2306 2150 1878 968 814 448 --12596 --
NM_001024809chr1741295 1025 878 508 ------
NM_001024959chr31209 ------
NM_001024960chr31209 ------
NM_001025076chr1055409 5132 4970 974 386 25097 406 15747 --
NM_001025077chr1056767 6490 6328 2332 1744 26455 1764 17105 --
NM_001025079chr312770 ------
NM_001025081chr181375 --31268 1173 968 --
NM_001025090chr181375 --31268 1173 968 --
NM_001025092chr181375 --31268 1173 968 --
NM_001025101chr181375 --31268 1173 968 --
NM_001025108chr243378 2936 2616 1241 ------
NM_001025201chr21679 1266 ----
NM_001025266chr363277 1919 1549 875 473 401 14772 ----
NM_001025366chr62686 562 11567 ----
NM_001025366chr62686 562 11567 ----
NM_001025367chr62686 562 11567 ----
NM_001025367chr62686 562 11567 ----
NM_001025368chr62686 562 11567 ----
NM_001025368chr62686 562 11567 ----
NM_001025369chr62702 578 11583 ----
NM_001025369chr62702 578 11583 ----
NM_001025370chr62686 562 11567 ----
NM_001025370chr62686 562 11567 ----
NM_001025389chr1121204 413 11260 ----
NM_001025390chr1121204 413 11260 ----
NM_001025579chr171906 --1205 --
NM_001025580chrX1717 --23808 1337 --
NM_001025595chr411477 ------
NM_001025616chr43628 377 85 137 ----
NM_001025780chr911125 --11045 --
NM_001029858chr621147 1129 ------
NM_001029863chr62895 508 ------
NM_001029882chr1197 --1628 --
NM_001029882chr1197 --1628 --
NM_001029998chr431375 1009 930 ----11029
NM_001030006chr1722495 282 --12448 --
NM_001030007chr1671149 1094 712 577 485 321 203 ----175
NM_001030055chr1421786 441 11796 24239 1539 --
NM_001030272chr11--122 ----
NM_001030273chr11--122 ----
NM_001031680chr162033 1826 1019 792 652 139 --1583 22447 2243
NM_001031684chr251437 1243 1089 974 213 ------
NM_001031694chr12278 212 ------
NM_001031694chr12278 212 ------
NM_001031695chr2295379 4667 4389 4288 4192 4072 3482 1036 523 14434 24293 667 --
NM_001031702chr33825 797 186 --2665 162 --
NM_001031710chr73827 296 189 ------
NM_001031711chr521537 1139 ------
NM_001031717chr3270 42 1832 ----
NM_001031738chr2121 ------
NM_001031804chr1623964 3096 11266 --13942
NM_001031812chr5--12183 ----
NM_001032279chr11181 ------
NM_001032280chr621430 1238 21483 641 11302 --
NM_001032289chrX155 ------
NM_001032296chr1372769 2632 2445 2354 2213 2123 889 12809 12599 --
NM_001032380chr1021949 1588 ----1641
NM_001032393chrX1550 ------
NM_001032999chr2084969 3941 1780 1723 1565 978 813 681 --13538 --
NM_001033026chr192218 35 ------
NM_001033047chr431625 801 784 22365 979 ----
NM_001033049chr2131957 830 228 ------
NM_001033057chr31251 ------
NM_001033059chr61392 ------
NM_001033081chr131708 1427 230 ------
NM_001033082chr131708 1427 230 ------
NM_001033087chr2053140 2444 2076 657 364 ----12704
NM_001033117chr384880 4751 4670 4140 1263 1190 865 157 14636 ----
NM_001033503chr5197 ------
NM_001033557chr211177 ------
NM_001033564chr611450 21830 72 ----
NM_001033578chr822219 729 ------
NM_001033756chr62620 496 11501 ----
NM_001033756chr62620 496 11501 ----
NM_001033925chr1011589 11571 ----
NM_001034025chr124955 707 671 132 --1899 --
NM_001034845chr42234 110 ------
NM_001035260chr10--11435 1408 --
NM_001035511chr12326 47 11543 ----
NM_001035512chr131406 433 154 11650 ----
NM_001035513chr131406 433 154 11650 ----
NM_001037132chr742046 1956 1813 885 ------
NM_001037133chr742046 1956 1813 885 ------
NM_001037174chr232288 2003 572 12306 ----
NM_001037290chr112864 762 ------
NM_001037332chr552259 1972 1783 885 189 ------
NM_001037333chr552259 1972 1783 885 189 ------
NM_001037954chr112177 168 ------
NM_001038493chr2134 ----1593
NM_001038633chr131346 919 450 ------
NM_001038640chr154730 401 273 95 --11050 --
NM_001038707chr152036 1859 846 498 415 ------
NM_001038707chr152036 1859 846 498 415 ------
NM_001039457chr1147 ------
NM_001039459chr71967 1151 1171 --
NM_001039465chr14--187 ----
NM_001039479chr1492358 2022 1815 1561 826 785 433 206 24 ------
NM_001039538chr233624 2407 52 ------
NM_001039547chr376043 6027 2825 2816 2096 1316 36 17359 27429 794 --
NM_001039583chr221104 ------
NM_001039584chr221104 ------
NM_001039585chr123114 807 43084 1347 1132 314 ----
NM_001039590chrX11107 ----1527
NM_001039591chrX11107 ----1527
NM_001039618chr1135978 1397 455 25334 291 ----
NM_001039690chr1662228 1625 1497 608 315 263 ------
NM_001039709chr2084969 3941 1780 1723 1565 978 813 681 --13538 --
NM_001039711chr1----11033 --
NM_001039712chr1----11033 --
NM_001039802chr1133 ------
NM_001039840chrX24413 2289 ------
NM_001039847chr19124 ------
NM_001039877chr192273 35 ------
NM_001039916chr121387 ------
NM_001039917chr121387 ------
NM_001039918chr121387 ------
NM_001039919chr121387 ------
NM_001039920chr121387 ------
NM_001039937chr132722 103 12641 ----
NM_001040001chr611659 --1455 --
NM_001040057chr721133 600 --11451 --
NM_001040100chr311182 ------
NM_001040102chr1021826 32 --1920 --
NM_001040103chr1021826 32 --1920 --
NM_001040108chr1423155 2544 13118 --11086
NM_001040110chr71705 ------
NM_001040142chr221867 922 ------
NM_001040143chr221867 922 ------
NM_001040144chr1662228 1625 1497 608 315 263 ------
NM_001040146chr1662228 1625 1497 608 315 263 ------
NM_001040152chr773866 3688 3529 1311 1057 985 366 44017 1990 894 148 ----
NM_001040153chr13166 ------
NM_001040157chr42896 422 --1300 --
NM_001040158chr5----1199 --
NM_001040167chr72973 39 ------
NM_001040202chr41518 12190 --1233
NM_001040272chr922317 924 --22203 2182 --
NM_001040273chr1061996 1604 1443 1380 386 163 ------
NM_001040284chr1611057 14719 ----
NM_001040402chr421050 893 ------
NM_001040424chr2122951 196 ------
NM_001040427chr16166 ------
NM_001040429chr13127 ----12887
NM_001040440chr52470 207 ------
NM_001040441chr12660 225 1466 21334 27 --
NM_001040446chr5188 ------
NM_001040455chr1131023 833 236 ------
NM_001040624chr832740 2010 1765 ------
NM_001040625chr832740 2010 1765 ------
NM_001040626chr832740 2010 1765 ------
NM_001040627chr832740 2010 1765 ------
NM_001040628chr832740 2010 1765 ------
NM_001040629chr832740 2010 1765 ------
NM_001040630chr832740 2010 1765 ------
NM_001040712chr91382 12555 ----
NM_001040715chr161870 1216 1880 --
NM_001042353chr202491 485 ------
NM_001042368chr9126 --131 --
NM_001042371chr1672012 1956 1556 1542 1527 1368 1337 --1259 --
NM_001042388chr182675 298 ------
NM_001042403chr121696 1926 ----
NM_001042404chr11774 ------
NM_001042410chr2--1202 1165 --
NM_001042424chr462767 2584 2462 1209 594 322 ------
NM_001042425chr621430 1238 21483 641 11302 --
NM_001042440chr5251 26 187 ----
NM_001042441chr5251 26 187 ----
NM_001042442chr5251 26 187 ----
NM_001042443chr5251 26 187 ----
NM_001042444chr5251 26 187 ----
NM_001042445chr5251 26 187 ----
NM_001042446chr5251 26 187 ----
NM_001042465chr103918 182 24 --1297 --
NM_001042466chr103918 182 24 --1297 --
NM_001042486chr2041374 1007 990 256 --11398 --
NM_001042498chrX1192 ------
NM_001042537chrX12248 12275 11626 --
NM_001042555chr1253642 3325 1655 332 273 14072 ----
NM_001042599chr246724 6644 5499 1061 ----17111
NM_001042601chr31784 ------
NM_001042604chr313689 --11362 --
NM_001042632chr2061976 1936 538 403 337 317 --1503 1961
NM_001042633chr2061976 1936 538 403 337 317 --1503 1961
NM_001042669chr43628 377 85 137 ----
NM_001042681chr152163 1761 1614 806 23 ------
NM_001042682chr152163 1761 1614 806 23 ------
NM_001042682chr152163 1761 1614 806 23 ------
NM_001042749chrX1256 ------
NM_001042750chrX1256 ------
NM_001042751chrX1256 ------
NM_001043318chr1473461 2825 535 477 177 116 41 13652 33138 2880 1112 --
NM_001043351chr132087 1607 1598 ------
NM_001044305chr611376 ------
NM_001044385chr212943 23628 1299 11309 11236
NM_001044722chr5--12183 ----
NM_001044723chr5--12183 ----
NM_001045478chr1----2319 37 --
NM_001065chr121411 ------
NM_001071775chr1331576 1536 239 ------
NM_001077628chr11521 ------
NM_001078chr11617 ------
NM_001079874chr1----2840 175 --
NM_001083620chr41133 1817 ----
NM_001094chr172868 824 ------
NM_001096chr17----176 --
NM_001099678chr324766 1500 21386 580 ----
NM_001106chr3147635 6942 6881 6636 6139 3738 3626 3292 2689 2293 2104 1668 1544 838 17504 ----
NM_001113490chrX22308 2294 --13525 --
NM_001121chr1031827 1503 498 1714 11462 --
NM_001126chr11172 ------
NM_001128chr1671149 1094 712 577 485 321 203 ----175
NM_001144chr16--11225 ----
NM_001148chr441887 1857 826 820 ------
NM_001167chrX56721 5816 5682 2057 452 11544 12067 1149
NM_001173chr1421786 441 11796 24239 1539 --
NM_001174chrX3329 230 161 ------
NM_001177chr1272463 1926 1900 1676 1664 714 109 12157 ----
NM_001178chr11--122 ----
NM_001191chr2031361 1304 1274 --1257 --
NM_001200chr2011157 ------
NM_001204chr222034 409 12892 ----
NM_001206chr91867 ------
NM_001219chr732154 1771 661 ------
NM_001222chr1031719 1589 343 ----1309
NM_001237chr42988 791 ------
NM_001237chr42988 791 ------
NM_001241chr22949 377 ------
NM_001241chr22949 377 ------
NM_001249chr14----1179 --
NM_001256chr1722065 2002 21834 629 194 --
NM_001259chr736265 2517 1678 25768 4107 12531 11104
NM_001260chr13177 ------
NM_001265chr132600 272 ------
NM_001273chr12----3444 232 213 --
NM_001282chr1722495 282 --12448 --
NM_001290chr42284 238 ------
NM_001304chr1733518 609 156 13039 ----
NM_001315chr631733 1454 280 ------
NM_001328chr42544 97 ------
NM_001331chr112770 550 21772 565 --1993
NM_001343chr5147 ------
NM_001349chr21483 ------
NM_001351chr32273 38 ------
NM_001356chrX52255 2212 1894 427 353 --12010 --
NM_001364chr1163851 3817 3544 2959 1699 551 ------
NM_001386chr822126 1612 ----1593
NM_001396chr2132740 2326 1770 --11715 --
NM_001399chrX2544 505 12755 22975 2959 --
NM_001400chr131145 924 49 ------
NM_001402chr611399 11555 12014 --
NM_001406chr1721564 1413 --1353 --
NM_001412chrX23508 3187 11183 ----
NM_001415chrX41457 491 234 205 ------
NM_001419chr1932997 1471 1373 13763 ----
NM_001420chr1942450 2065 885 707 ------
NM_001421chrX2227 183 --11752 --
NM_001427chr721721 462 ------
NM_001429chr221216 ------
NM_001430chr242013 1833 1351 126 --11804 --
NM_001431chr6--1116 11088 1370
NM_001438chr122574 960 ------
NM_001440chr852577 1079 509 302 95 11730 ----
NM_001451chr16--1141 1179 11041
NM_001455chr643755 3221 2995 858 14398 ----
NM_001458chr72759 524 ----1284
NM_001463chr2--1713 ----
NM_001482chr15127 ------
NM_001483chr71876 ------
NM_001494chr101192 148 ----
NM_001495chr86815 786 471 373 228 211 --1438 --
NM_001497chr962574 2494 1823 1014 834 78 --1969 --
NM_001508chr21615 ------
NM_001533chr191298 ------
NM_001542chr162221 2183 1091 911 904 27 ------
NM_001543chr544454 4399 844 270 --14156 14427
NM_001552chr1741080 700 429 256 --1705 --
NM_001554chr11174 ------
NM_001616chr21770 ------
NM_001634chr61392 ------
NM_001642chr112970 27 11174 ----
NM_001655chr1161753 1707 1371 833 564 238 ------
NM_001656chr5--11300 1445 --
NM_001658chr12826 209 ------
NM_001659chr1242518 2420 347 326 ------
NM_001660chr31594 ------
NM_001668chr111828 --11847 1911
NM_001670chr223645 336 105 --1118 --
NM_001677chr12854 458 ------
NM_001678chr1711302 --1648 --
NM_001681chr12------1734
NM_001682chr121402 --11083 --
NM_001683chr312641 12050 ----
NM_001684chr153839 3105 2591 1607 298 --23288 2888 1755
NM_001689chr221704 792 --125 --
NM_001701chr921350 583 1289 ----
NM_001707chr72240 179 --2323 139 --
NM_001709chr1112799 ------
NM_001722chr81562 1123 ----
NM_001723chr6144 ------
NM_001730chr131409 1465 1364 --
NM_001730chr131409 1465 1364 --
NM_001731chr122949 121 ------
NM_001742chr731634 1263 588 ------
NM_001743chr21467 ------
NM_001746chr522146 76 ------
NM_001750chr5251 26 187 ----
NM_001753chr731581 1384 191 ------
NM_001754chr2134041 3998 472 --1213 --
NM_001755chr162753 738 --32080 301 105 --
NM_001759chr1284840 4265 1892 1293 1103 1096 920 879 13973 ----
NM_001777chr312770 ------
NM_001788chr71697 ------
NM_001791chr1133 ------
NM_001792chr182725 125 ------
NM_001797chr162248 41 ------
NM_001810chr202704 38 ------
NM_001822chr21679 1266 ----
NM_001825chr5----141 --
NM_001826chr1------1145
NM_001842chr91187 ------
NM_001855chr9--1761 ----
NM_001858chr664842 4346 1625 1292 706 366 131 ----
NM_001880chr21304 ------
NM_001904chr3----1387 --
NM_001915chr1751595 684 473 333 96 --11801 --
NM_001924chr11545 ------
NM_001927chr21661 --1240 --
NM_001933chr142879 113 --1328 --
NM_001937chr11828 1897 1865 1129
NM_001938chr111712 ------
NM_001944chr1831777 362 102 11923 ----
NM_001946chr12159 ------
NM_001949chr612481 --11279 --
NM_001954chr61249 ------
NM_001955chr62383 107 1120 ----
NM_001957chr422010 701 12189 12296 --
NM_001962chr52405 106 ------
NM_001964chr5------1359
NM_001968chr41346 ------
NM_001969chr1442649 1584 1392 533 1541 ----
NM_001981chr122409 243 123 ----
NM_001991chr1742175 1462 868 507 ------
NM_001999chr52940 175 ------
NM_002006chr444431 4305 593 469 1669 --15468
NM_002009chr1532545 2235 436 12616 ----
NM_002010chr132514 458 ------
NM_002015chr1363082 3054 3043 2470 2084 164 ------
NM_002017chr1121115 1031 ------
NM_002024chrX1565 ------
NM_002025chrX59242 9058 6373 2946 963 27321 1526 46278 3572 1539 723 --
NM_002031chr61130 1224 ----
NM_002040chr21--1593 12628 --
NM_002044chr1521113 51 ------
NM_002048chr92918 23 ------
NM_002051chr101867 ------
NM_002052chr81965 1103 ----
NM_002054chr21374 ------
NM_002063chrX2390 140 ------
NM_002077chr92337 223 ----1726
NM_002086chr1722090 1894 --1368 --
NM_002104chr51178 ------
NM_002107chr11170 ------
NM_002126chr1723140 22 44033 3788 3102 418 ----
NM_002136chr12----1588 --
NM_002137chr741898 1707 1626 620 ------
NM_002139chrX1554 ------
NM_002140chr931175 876 417 ------
NM_002141chr73232 212 175 ------
NM_002156chr21114 ------
NM_002158chr211192 1340 ----
NM_002167chr11339 --141 --
NM_002181chr2172 --1261 1215
NM_002193chr21378 ------
NM_002202chr511104 ------
NM_002203chr543792 877 264 123 1920 ----
NM_002204chr171457 --31282 292 165 --
NM_002205chr122953 673 ------
NM_002210chr243543 3052 615 121 --12793 --
NM_002214chr723495 117 31640 882 429 14104 --
NM_002222chr321305 435 --1192 --
NM_002226chr141655 --1633 --
NM_002229chr191314 ------
NM_002233chr11----1375 --
NM_002247chr10----11594 --
NM_002264chr343834 3163 1453 1033 34425 3191 1669 1815 --
NM_002265chr1721030 922 ------
NM_002268chr3--11727 ----
NM_002270chr521829 1713 14469 24997 1324 --
NM_002271chr1342310 1926 618 609 ------
NM_002285chr243378 2936 2616 1241 ------
NM_002293chr132738 2585 915 11943 ----
NM_002296chr131570 572 365 21749 1657 ----
NM_002298chr1321451 625 ------
NM_002309chr2262854 2610 2277 1054 610 582 --1121 --
NM_002334chr1111619 --1602 --
NM_002356chr632784 2412 751 ------
NM_002359chr1763944 3520 3189 1296 1202 625 13898 12693 --
NM_002373chr151397 --21204 290 --
NM_002374chr233624 2407 52 ------
NM_002376chr141155 ------
NM_002382chr1431191 1009 271 ------
NM_002384chr182684 202 ------
NM_002385chr181375 --31268 1173 968 --
NM_002387chr553393 1876 1867 1598 313 --1110 --
NM_002390chr1741947 798 170 29 11932 21602 1307 --
NM_002398chr22983 406 --11303 --
NM_002399chr151294 ------
NM_002401chr1762223 2102 1928 1632 540 323 ------
NM_002429chr1231078 573 561 ------
NM_002430chr221326 22333 2160 ----
NM_002442chr1211160 --11241 --
NM_002469chr121483 ------
NM_002479chr1145 ------
NM_002480chr1221403 64 ------
NM_002486chr922520 441 ------
NM_002499chr1562388 1893 920 535 367 150 ------
NM_002500chr2----11213 --
NM_002505chr631501 1242 1217 1171 ----
NM_002515chr1421423 645 ------
NM_002522chr1753891 2831 2653 2643 1155 --13250 --
NM_002537chr154894 389 351 239 ------
NM_002545chr1174682 3835 2052 1586 1390 1153 1052 ------
NM_002547chrX33875 2700 1363 12672 23169 2952 --
NM_002553chr72126 75 ------
NM_002556chr111175 ------
NM_002569chr1541510 1441 1373 402 --1623 --
NM_002581chr925150 2020 35402 4564 2110 ----
NM_002582chr16129 --159 --
NM_002586chr611083 ------
NM_002588chr521498 110 ------
NM_002595chr12--1564 ----
NM_002609chr53594 496 167 --11701 --
NM_002613chr16125109 5099 4780 4290 4024 3990 3701 1398 1250 1005 822 391 --24086 636 24854 4814
NM_002632chr141796 --180 --
NM_002646chr141994 1594 879 36 ------
NM_002648chr611244 ------
NM_002655chr834029 895 702 14044 ----
NM_002657chr2033619 3374 2926 12407 22574 701 --
NM_002662chr332182 1974 1689 1630 ----
NM_002670chr321598 162 11125 ----
NM_002687chr1421037 852 ------
NM_002698chr1912739 12853 ----
NM_002705chr163731 649 39 ------
NM_002706chr21460 ------
NM_002709chr221067 865 22309 883 --12773
NM_002710chr121156 ------
NM_002714chr64995 712 334 254 1345 ----
NM_002715chr51247 21146 820 ----
NM_002716chr1123055 2630 --12329 --
NM_002717chr82665 638 ------
NM_002718chr31338 22389 643 1343 1633
NM_002719chr1422265 1507 22083 1544 2561 194 --
NM_002729chr101115 ------
NM_002734chr1722089 102 ------
NM_002736chr71509 1398 1601 --
NM_002745chr2264422 3358 923 410 203 147 ------
NM_002746chr161106 ------
NM_002747chr1811842 --2110 63 --
NM_002748chr152765 187 ------
NM_002763chr11368 ----1133
NM_002778chr103918 182 24 --1297 --
NM_002787chr71583 ------
NM_002806chr14141 ------
NM_002810chr1--1112 ----
NM_002819chr1931446 939 592 134 ----
NM_002822chr12----11737 --
NM_002825chr71592 ------
NM_002833chr15128 --11450 --
NM_002834chr1232869 2774 586 --11035 --
NM_002837chr1244342 4254 3255 3246 1323 ----
NM_002839chr91382 12555 ----
NM_002840chr131175 1146 113 ------
NM_002842chr19----1129 --
NM_002843chr1112853 --22806 1015 1779
NM_002845chr18------1271
NM_002851chr71617 ------
NM_002857chr12865 441 ------
NM_002868chr121877 ------
NM_002880chr32321 210 ------
NM_002885chr11873 --1219 --
NM_002886chr323701 134 11833 1952 --
NM_002890chr51155 ------
NM_002892chr1411119 ------
NM_002897chr21691 ------
NM_002906chr1121846 601 ------
NM_002920chr12------1361
NM_002953chr13774 576 207 ----1699
NM_002956chr1221318 950 ------
NM_002958chr32963 708 1937 ----
NM_002959chr143278 3272 3191 3150 24408 656 1481 23141 437
NM_002970chrX1305 ------
NM_002971chr331130 200 38 ------
NM_002972chr221273 ------
NM_002994chr41773 1279 ----
NM_002996chr1641715 1439 556 253 ------
NM_002998chr81113 12152 11695 --
NM_003001chr131406 433 154 11650 ----
NM_003010chr1721547 207 ------
NM_003011chr921372 593 --11281 --
NM_003016chr1711630 ------
NM_003026chr91876 166 ----
NM_003027chr151452 ------
NM_003030chr31463 ------
NM_003034chr1286567 6005 3205 2553 1209 845 242 162 37830 2621 1836 28071 1785 --
NM_003039chr13242 208 28 ------
NM_003042chr341624 220 213 206 11860 ----
NM_003043chr333900 3842 1260 --3844 564 437 --
NM_003045chr1373833 3460 1895 1569 971 660 239 --13725 --
NM_003047chr161189 1046 1007 998 236 219 ------
NM_003051chr131879 794 555 1608 ----
NM_003059chr5--1275 ----
NM_003060chr51916 1977 ----
NM_003071chr311574 21811 1670 ----
NM_003072chr19----1286 --
NM_003074chr32746 676 12244 ----
NM_003075chr121266 ------
NM_003101chr111021 ------
NM_003107chr621820 135 --1866 --
NM_003108chr275662 2655 2177 2050 1921 1891 503 --12912 --
NM_003111chr221221 368 ------
NM_003112chr7173 ------
NM_003113chr22236 212 ------
NM_003128chr232711 2364 554 ------
NM_003133chr111065 1284 ----
NM_003144chr621786 1500 1623 ----
NM_003155chr822649 464 ------
NM_003156chr1121290 115 ------
NM_003161chr1722236 1440 ------
NM_003164chr111508 ------
NM_003178chr321461 643 ----11607
NM_003185chr201891 ----1431
NM_003189chr162743 2700 2539 888 410 166 12866 --1854
NM_003192chr6----1381 --
NM_003199chr1844982 3749 3581 1741 ------
NM_003200chr1952314 1964 1793 1617 1454 ------
NM_003203chr251534 627 262 165 72 ----12158
NM_003204chr172458 171 ------
NM_003216chr2223290 1280 --13149 --
NM_003220chr621430 1238 21483 641 11302 --
NM_003221chr651634 1509 750 571 404 12730 ----
NM_003234chr33866 476 343 ------
NM_003238chr11186 ------
NM_003246chr1531727 743 585 --146 --
NM_003250chr172448 114 ------
NM_003253chr212582 121 ------
NM_003255chr1732325 878 300 1500 ----
NM_003262chr334612 170 58 14055 ----
NM_003274chr2142217 331 223 146 ------
NM_003291chr131808 --1225 --
NM_003292chr132057 1624 97 ------
NM_003309chr611737 11652 ----
NM_003320chr1144425 3095 1212 651 ------
NM_003322chr61164 --167 --
NM_003336chrX2400 27 ------
NM_003342chr1732780 1139 869 ----1117
NM_003344chr711111 ------
NM_003345chr161380 146 ----
NM_003347chr2272023 2010 2004 865 463 387 109 --21721 830 12132
NM_003348chr1211698 11692 ----
NM_003350chr811005 ----1112
NM_003352chr2198 1124 ----
NM_003356chr11123 ------
NM_003360chr41222 ------
NM_003375chr101166 ------
NM_003376chr62686 562 11567 ----
NM_003376chr62686 562 11567 ----
NM_003387chr262207 1955 1088 761 491 237 11946 12782 --
NM_003390chr1111127 1793 ----
NM_003392chr343572 2755 1070 833 1190 ----
NM_003404chr2041843 1344 473 318 --1164 --
NM_003405chr221108 ------
NM_003406chr831295 361 264 ------
NM_003410chrX11948 22148 218 ----
NM_003411chrY21705 32 ------
NM_003412chr322802 1168 2833 218 11924 --
NM_003413chrX22011 204 ------
NM_003418chr3----184 --
NM_003427chr61477 ------
NM_003439chr723165 529 ------
NM_003442chr113751 600 51 ------
NM_003453chr131633 ------
NM_003463chr6179 32840 200 156 ----
NM_003467chr21433 ------
NM_003468chr254049 1201 827 763 333 1290 ----
NM_003470chr1641837 1296 718 116 ------
NM_003473chr101765 ------
NM_003478chr1123031 488 --12351 11249
NM_003482chr1222676 1735 --1223 --
NM_003483chr1222438 2246 12475 ----
NM_003488chr174363 234 224 55 ------
NM_003489chr2112314 13018 ----
NM_003507chr222006 1862 ------
NM_003557chr121260 347 --1414 --
NM_003559chr1733606 3440 3009 --23152 2717 --
NM_003567chr11272 ------
NM_003568chr1--1311 ----
NM_003576chr1372769 2632 2445 2354 2213 2123 889 12809 12599 --
NM_003583chr1222672 2575 23446 1303 --124
NM_003590chr222834 882 --1876 --
NM_003591chr101105 ------
NM_003592chr71143 --1337 --
NM_003597chr21133 --12103 --
NM_003603chr42457 192 ------
NM_003607chr123933 817 --1113 --
NM_003612chr152458 77 ------
NM_003613chr152603 164 1244 ----
NM_003615chr31524 13441 ----
NM_003618chr21985 ----1434
NM_003622chr1222639 622 ------
NM_003629chr152696 2582 2250 426 33 ------
NM_003630chr61158 ------
NM_003632chr17197 ------
NM_003633chr552363 2319 2282 498 489 ------
NM_003637chr141481 456 161 35 --1199 --
NM_003644chr1785230 4790 4284 2314 2082 1767 363 126 14195 ----
NM_003651chr121437 ------
NM_003655chr171119 ------
NM_003663chr352613 2297 1073 1048 809 ----12909
NM_003664chr5399 51 31 ------
NM_003670chr33968 572 227 ------
NM_003671chr953247 2659 342 290 276 ------
NM_003673chr17181 ------
NM_003677chr1241807 645 636 290 --1698 --
NM_003679chr122950 2493 --12471 --
NM_003680chr12529 259 ----1495
NM_003692chr91122 ------
NM_003701chr131794 ------
NM_003704chr41119 --177 --
NM_003705chr22324 236 ------
NM_003711chr5130 ------
NM_003713chr11307 ------
NM_003714chr523004 2033 11063 ----
NM_003732chr5295 21 ------
NM_003735chr521498 110 ------
NM_003736chr521498 110 ------
NM_003743chr21539 ------
NM_003749chr131420 1354 ----
NM_003758chr151124 ------
NM_003758chr151124 ------
NM_003759chr431317 1221 547 --13983 --
NM_003760chr11529 ------
NM_003773chr3132 ------
NM_003787chr18--1394 11690 --
NM_003791chr163172 84 55 ------
NM_003793chr11----196 --
NM_003795chr62149 94 ------
NM_003796chr191484 1119 ----
NM_003800chr622082 714 ------
NM_003806chr12192 ------
NM_003818chr20171 ------
NM_003829chr92837 313 1441 ----
NM_003860chr111320 ------
NM_003861chr1472774 2725 2485 2335 1918 1044 184 ------
NM_003872chr242555 2110 2093 1872 ----12263
NM_003873chr1052322 810 724 673 241 1922 1361 11701
NM_003884chr311842 --11615 --
NM_003885chr172929 697 --21836 1670 --
NM_003887chr232040 1812 1428 ------
NM_003893chr10------1432
NM_003895chr21139 11917 ----
NM_003902chr11637 ------
NM_003907chr31321 ------
NM_003913chr61663 ----11333
NM_003927chr181860 ------
NM_003930chr7--21753 700 ----
NM_003939chr1034008 3161 1456 22928 1111 13731 --
NM_003941chr712335 ----1983
NM_003947chr32114 106 ------
NM_003951chrX1404 ------
NM_003955chr172589 414 ----1478
NM_003972chr1041203 978 972 134 ------
NM_003987chr1032155 1558 849 --1373 --
NM_003988chr1032232 1635 926 --1450 --
NM_003989chr1032091 1494 785 --1309 --
NM_003990chr1032091 1494 785 --1309 --
NM_003992chr151244 ------
NM_003994chr1253017 1243 789 706 196 1553 --145
NM_004006chrX11700 ------
NM_004007chrX11700 ------
NM_004009chrX11700 ------
NM_004010chrX11700 ------
NM_004011chrX11700 ------
NM_004012chrX11700 ------
NM_004013chrX11700 ------
NM_004014chrX11700 ------
NM_004015chrX11700 ------
NM_004017chrX11700 ------
NM_004020chrX11700 ------
NM_004037chr13800 329 241 ------
NM_004047chr1147 ------
NM_004050chr1431770 735 489 3702 512 210 ----
NM_004055chr1112030 ------
NM_004075chr12--1204 ----
NM_004077chr121206 1531 ----
NM_004081chrY2126 71 ------
NM_004089chrX1120 1298 ----
NM_004093chr1332510 746 359 11060 --1610
NM_004094chr1433005 1905 303 12242 --13018
NM_004097chr22179 48 ------
NM_004098chr101412 ------
NM_004100chr662623 2461 2348 2206 2073 1737 2625 312 1252 --
NM_004114chrX21092 944 ------
NM_004134chr52626 470 ------
NM_004152chr191233 ------
NM_004156chr81125 ------
NM_004161chr231329 322 225 11000 --11423
NM_004170chr91408 --21781 1246 1628
NM_004180chr21555 ------
NM_004202chrY----1194 --
NM_004205chr111530 ------
NM_004208chrX--122 ----
NM_004209chr162944 791 ------
NM_004215chr81516 ------
NM_004227chr732669 2036 1927 ------
NM_004229chrX--21678 130 ----
NM_004232chr1833076 2635 786 ------
NM_004242chr6----1112 --
NM_004263chr221641 1386 ------
NM_004272chr51632 ------
NM_004274chr144979 373 211 94 12573 ----
NM_004290chr511137 ------
NM_004295chr17--11286 ----
NM_004296chr1463229 2865 2781 1533 905 455 1397 44025 2919 1498 966 --
NM_004302chr1262535 891 821 715 302 32 ------
NM_004308chr1181898 1683 1277 689 461 158 63 35 --1365 --
NM_004311chr1042846 1948 892 460 ----11069
NM_004321chr242751 2506 2235 1207 ------
NM_004326chr12853 819 ------
NM_004331chr811642 11773 ----
NM_004350chr162033 1826 1019 792 652 139 --1583 22447 2243
NM_004378chr151204 ------
NM_004380chr1632096 1868 305 ------
NM_004384chr5--12183 ----
NM_004385chr51169 ------
NM_004389chr22359 104 --1853 --
NM_004392chr1332299 2039 745 ------
NM_004393chr332256 2148 276 --11766 --
NM_004395chr52315 103 ------
NM_004397chr1144178 3841 3155 244 --11722 --
NM_004414chr213399 307 71 11254 ----
NM_004416chr122181 77 --1801 --
NM_004417chr5198 ------
NM_004418chr23209 167 100 --2505 39 --
NM_004420chr1162241 2009 947 616 512 206 2165 154 ----
NM_004423chr362311 1848 1670 702 645 90 ------
NM_004426chr1241971 1481 165 65 --1585 --
NM_004429chrX21245 954 ------
NM_004430chr822199 1091 ------
NM_004432chr91882 --12297 --
NM_004436chr1168 ------
NM_004437chr163518 3398 3093 2946 2833 2686 42579 2450 2430 1283 ----
NM_004440chr61650 ------
NM_004447chr12137 1876 ----
NM_004451chr11132 --1108 --
NM_004454chr321883 148 --11492 --
NM_004459chr171359 ------
NM_004481chr122681 2464 11045 ----
NM_004482chr2--1601 ----
NM_004483chr161481 ------
NM_004491chr19104127 3902 3713 3105 2681 1666 1258 558 210 192 1672 1495 1407
NM_004496chr14128 --142 --
NM_004497chr194644 545 520 288 ------
NM_004499chr5--188 ----
NM_004503chr12190 ------
NM_004504chr222964 200 12937 ----
NM_004505chr17--169 ----
NM_004514chr172626 138 1858 ----
NM_004528chr1198 ------
NM_004530chr163474 411 90 1141 ----
NM_004540chr211237 ------
NM_004560chr92292 218 ------
NM_004575chr421380 1220 11613 ----
NM_004578chr12836 733 ------
NM_004583chr171500 ------
NM_004586chrX55247 4341 4273 4049 910 159 1112 --
NM_004588chr1153282 3158 666 444 364 14058 13666 13485
NM_004599chr221624 --1669 --
NM_004602chr2041246 380 277 222 ------
NM_004612chr923452 288 ------
NM_004614chr1642137 1525 865 771 11608 32274 588 462 --
NM_004615chrX1361 ------
NM_004622chr232427 2368 1887 ------
NM_004626chr112266 235 --1714 --
NM_004637chr321224 479 --1328 --
NM_004654chrY2536 496 ------
NM_004656chr31828 --1923 11178
NM_004660chrY42133 1825 425 351 11936 12304 --
NM_004673chr12984 87 ------
NM_004687chr1721624 600 1703 ----
NM_004689chr142440 432 ------
NM_004694chr17134 1336 ----
NM_004709chrX21409 191 ------
NM_004718chr2134 ------
NM_004725chr101403 ------
NM_004726chrX33591 2032 529 21514 680 ----
NM_004733chr3----1448 --
NM_004745chr885924 5573 5069 4677 2219 2068 1820 1632 16800 11610 --
NM_004747chr103646 612 33 ------
NM_004760chr732092 1985 774 1449 1241 --
NM_004772chr511013 ------
NM_004776chr2041293 1176 845 665 ----22618 715
NM_004779chr5--11189 11282 --
NM_004781chr12528 330 --11582 --
NM_004781chr12528 330 --11582 --
NM_004783chr162435 158 --1646 --
NM_004784chr4----1136 --
NM_004788chr1122724 2279 22024 1899 ----
NM_004796chr1431894 894 832 --11606 --
NM_004801chr21546 ------
NM_004824chr62991 478 ------
NM_004830chr63880 585 296 ------
NM_004834chr232524 396 232 ------
NM_004836chr21248 ------
NM_004840chrX2425 404 ------
NM_004846chr2166 --140 --
NM_004849chr631620 1183 167 ------
NM_004850chr2--21246 1085 ----
NM_004859chr1732758 2606 452 ------
NM_004861chr22275 69 ------
NM_004863chr1455321 5014 1410 1172 379 ------
NM_004871chr17----13207 --
NM_004879chr112991 811 ------
NM_004893chr5----1199 --
NM_004896chr10--11350 1323 --
NM_004898chr4--12349 1144 --
NM_004902chr201653 ------
NM_004904chr731814 1552 246 ------
NM_004922chr101646 1312 ----
NM_004924chr191177 1235 ----
NM_004926chr1421755 1712 1499 ----
NM_004938chr911188 ------
NM_004945chr193855 599 137 ------
NM_004952chr11296 1235 ----
NM_004956chr71687 13533 11409 --
NM_004958chr11820 --1647 --
NM_004959chr941178 220 199 79 ------
NM_004961chrX2593 469 11088 11316 --
NM_004965chr212617 194 ------
NM_004966chr101624 ------
NM_004969chr102530 489 ------
NM_004972chr92437 403 1270 ----
NM_004975chr201194 1686 ----
NM_004976chr1174682 4171 3797 1656 1426 1282 1269 35018 3268 1687 ----
NM_004979chrX21148 1103 1874 ----
NM_004985chr1212871 ------
NM_004992chrX68161 5661 3158 2668 816 652 32844 1515 602 17645 --
NM_004992chrX68161 5661 3158 2668 816 652 32844 1515 602 17645 --
NM_004993chr141387 ------
NM_004995chr1431187 464 143 --11474 1345
NM_004998chr153675 637 128 ------
NM_005000chr71897 ----11043
NM_005006chr21288 ------
NM_005008chr221864 --2787 749 --
NM_005010chr742046 1956 1813 885 ------
NM_005011chr71705 ------
NM_005023chr531474 1340 1272 ------
NM_005025chr3160 ------
NM_005032chrX11073 ------
NM_005056chr1254000 1736 720 538 383 ------
NM_005060chr14469 171 146 42 --1202 --
NM_005066chr12564 546 ------
NM_005067chr32882 190 ------
NM_005076chr174200 4146 3840 3687 1510 1037 108 14079 ----
NM_005078chr1531372 1300 684 --1247 11691
NM_005080chr221752 ------
NM_005087chr32577 252 ------
NM_005093chr2084969 3941 1780 1723 1565 978 813 681 --13538 --
NM_005095chr11204 1396 ----
NM_005096chrX2335 220 11062 ----
NM_005099chr141120 984 975 155 ------
NM_005103chr111228 ------
NM_005104chr61134 ------
NM_005105chr122066 1428 ------
NM_005109chr332144 1791 664 ------
NM_005116chr2071701 1652 1582 783 768 336 235 11801 --13574
NM_005121chr1711291 ------
NM_005124chr62694 41 ------
NM_005133chr11181 ------
NM_005134chr182675 298 ------
NM_005137chr2242147 2089 440 125 --11956 --
NM_005153chr161516 ------
NM_005154chr152573 91 ------
NM_005168chr221349 448 ----11606
NM_005173chr17--11158 1307 --
NM_005176chr12298 44 ------
NM_005194chr202121 106 ------
NM_005197chr1435845 4053 1649 ------
NM_005206chr17--1350 ----
NM_005215chr18--1634 ----
NM_005225chr201490 ------
NM_005230chr121204 ------
NM_005233chr3--32482 2418 1792 ----
NM_005234chr193338 318 308 ------
NM_005235chr246724 6644 5499 1061 ----17111
NM_005238chr11--12207 13501 --
NM_005243chr22194 ------
NM_005249chr14------1598
NM_005252chr142498 55 --1259 --
NM_005254chr1511169 ------
NM_005259chr2----1170 --
NM_005276chr1231453 654 187 --1677 --
NM_005276chr1231453 654 187 --1677 --
NM_005277chr411806 ------
NM_005281chr13856 174 109 ------
NM_005284chr6----1173 --
NM_005312chr941770 646 624 122 ------
NM_005324chr171488 --11915 --
NM_005326chr16166 ------
NM_005329chr1621886 1805 11795 ----
NM_005339chr422989 99 1936 22936 2767 --
NM_005342chrX22154 321 --1633 --
NM_005359chr1876065 4517 2290 2281 2204 1928 1193 --11283 16188
NM_005382chr8161 ------
NM_005385chr352057 2036 1917 945 843 145 11971 --
NM_005386chr20--1128 ----
NM_005387chr11--1102 ----
NM_005392chr92638 399 11766 2567 411 --
NM_005399chr112994 1849 12889 --
NM_005400chr262498 2479 2415 2061 1925 305 22378 274 ----
NM_005402chr72705 482 ------
NM_005406chr181150 ------
NM_005407chr142434 350 --21071 377 --
NM_005415chr22684 526 ----1655
NM_005418chr11----1479 --
NM_005424chr1133 ------
NM_005431chr731584 434 425 ------
NM_005433chr1812093 --22081 1109 12557
NM_005435chr72564 59 ------
NM_005436chr1042854 1007 976 82 24011 3754 ----
NM_005438chr112204 75 ------
NM_005458chr951640 926 788 175 115 1671 ----
NM_005461chr2031688 1347 450 21421 1359 11680 --
NM_005474chr1731618 1504 596 ------
NM_005475chr1252864 1295 1166 1012 724 13209 1322 --
NM_005476chr92120 97 ------
NM_005477chr1532223 2006 326 11827 --12057
NM_005477chr1532223 2006 326 11827 --12057
NM_005479chr1031239 426 82 ------
NM_005494chr7------2591 522
NM_005497chr1745776 4826 1831 116 13835 ----
NM_005499chr191545 ------
NM_005502chr9--1797 --1478
NM_005504chr121637 14008 --16559
NM_005506chr442519 2181 1943 178 --1285 1127
NM_005507chr112435 34 ------
NM_005509chr5------11435
NM_005512chr1141509 750 454 357 ------
NM_005520chr51546 ------
NM_005522chr71511 --11196 --
NM_005529chr13837 396 193 ------
NM_005530chr15--1232 ----
NM_005544chr21295 ------
NM_005550chr162573 219 --1517 --
NM_005557chr172120 42 ------
NM_005561chr13--191 2791 729 --
NM_005563chr1----1543 --
NM_005581chr192345 310 ------
NM_005596chr926041 4935 12383 14692 --
NM_005604chr6--22089 342 1427 --
NM_005626chr12534 170 ------
NM_005631chr731039 404 391 --1266 --
NM_005637chr1821830 1821 ------
NM_005638chrX21595 1173 ------
NM_005650chr22----1999 --
NM_005654chr51226 ------
NM_005656chr2151260 244 230 140 53 --11399 --
NM_005663chr4122 ------
NM_005665chr144000 708 699 221 ------
NM_005668chr5--33444 3271 1693 ----
NM_005669chr51581 --11998 --
NM_005678chr152771 276 ----1202
NM_005688chr341157 1113 870 492 --11211 --
NM_005717chr12442 311 --147 --
NM_005718chr31209 ------
NM_005720chr71246 ------
NM_005721chr22757 81 ------
NM_005722chr221837 676 ----12012
NM_005724chr152606 75 ------
NM_005730chr1233152 992 986 23004 1248 --13307
NM_005731chr2--1318 --132
NM_005737chr242733 2200 2091 680 ------
NM_005742chr21663 ------
NM_005746chr71251 ------
NM_005749chr171278 ------
NM_005754chr511047 1831 ----
NM_005766chr132882 204 179 ----
NM_005778chr3--1400 ----
NM_005779chr523022 2488 22934 324 13171 --
NM_005786chr1831107 376 102 ------
NM_005819chr163446 3035 2676 1342 728 362 13051 ----
NM_005839chr1----1282 --
NM_005840chrX67352 7154 5971 5395 5002 2801 15461 ----
NM_005842chr13192 ------
NM_005852chr171222 --1253 --
NM_005853chr16155 ------
NM_005859chr511437 ------
NM_005860chr1931356 1096 191 ----21338 368
NM_005871chr101124 ------
NM_005880chr1621181 279 ------
NM_005896chr21742 ------
NM_005898chr113683 556 455 ------
NM_005900chr42853 349 ------
NM_005901chr1868456 8025 6244 5385 3474 3043 35413 5301 2033 36972 6926 820 --
NM_005902chr1534197 3027 3014 11623 23123 1029 --
NM_005909chr533805 2796 620 11519 ----
NM_005911chr261345 1320 1311 1284 1006 33 1418 ----
NM_005916chr7145 ------
NM_005920chr132637 906 667 ------
NM_005922chr61191 ----1427
NM_005934chr1952323 2182 1961 711 259 ------
NM_005937chr1743265 3160 1350 1118 11585 ----
NM_005941chr821510 148 23100 1236 ----
NM_005943chr621386 473 ------
NM_005955chr144050 3775 2054 987 ------
NM_005964chr17--183 ----
NM_005966chr21136 1495 ----
NM_005968chr19177 ------
NM_005969chr1121065 94 1396 ----
NM_005985chr203733 266 237 ------
NM_005990chr562514 2339 880 722 509 187 --31063 827 25 --
NM_006007chr954425 4263 4035 3159 419 11150 ----
NM_006010chr31191 ------
NM_006022chr133917 829 256 ------
NM_006030chr331426 192 122 --1740 --
NM_006038chr2031726 449 137 ------
NM_006047chr2063496 3403 1108 1061 392 233 ------
NM_006062chr23845 224 206 ----1480
NM_006064chrX--1270 ----
NM_006079chr61597 1333 ----
NM_006089chrX31443 265 251 ------
NM_006094chr83709 520 479 ------
NM_006095chr41255 ------
NM_006106chr1142570 1075 743 201 ------
NM_006113chr1----2840 175 --
NM_006121chr12--165 ----
NM_006133chr1161623 986 745 472 363 308 ------
NM_006135chr121108 407 11166 ----
NM_006145chr192748 253 --1359 --
NM_006156chr141181 ------
NM_006164chr2--1424 1449 --
NM_006177chr142757 182 ------
NM_006180chr942106 1625 715 200 ------
NM_006190chr21881 --1174 --
NM_006194chr1421123 121 ------
NM_006195chr91567 ------
NM_006203chr525512 1741 --11905 --
NM_006224chr1732116 954 883 --11683 --
NM_006237chr1342294 1897 1569 825 ------
NM_006251chr523127 706 --1109 --
NM_006252chr136886 5852 1101 2337 308 15424 --
NM_006264chr41420 ------
NM_006266chr9126 --131 --
NM_006268chr111142 ----11006
NM_006275chr201438 --1336 --
NM_006285chr91276 ------
NM_006293chr152201 57 --1266 --
NM_006306chrX45118 5093 3878 2203 32195 1202 1158 ----
NM_006307chrX--123 ----
NM_006310chr1721328 522 --1469 --
NM_006313chr1241575 1561 1259 42 ------
NM_006321chr341826 1805 1607 397 1134 ----
NM_006322chr131218 ------
NM_006329chr142541 39 ------
NM_006330chr8--11232 ----
NM_006333chr22644 554 ------
NM_006335chr12736 374 ------
NM_006359chrX12248 12275 11626 --
NM_006364chr142878 226 ------
NM_006367chr13897 764 420 ------
NM_006371chr3105046 5024 4990 4354 3875 3421 3386 953 422 413 ------
NM_006378chr94910 450 325 24 ------
NM_006379chr72787 600 12333 ----
NM_006386chr2222328 2126 ------
NM_006387chr193989 390 68 --1859 --
NM_006390chr1221535 127 ------
NM_006393chr1031405 1155 593 ------
NM_006403chr62447 402 ------
NM_006420chr2042774 2619 941 64 11160 1100 --
NM_006421chr841216 1008 293 175 1119 125 --
NM_006454chr44903 644 483 143 1774 11065 --
NM_006457chr443241 3065 2914 191 ------
NM_006459chr1011922 11949 ----
NM_006469chr121422 1249 ------
NM_006482chr1222672 2575 23446 1303 --124
NM_006489chr1421423 645 ------
NM_006517chrX21763 1715 12217 ----
NM_006520chrX41574 1528 1246 170 1631 ----
NM_006526chr20----21543 666 --
NM_006527chr4158 ------
NM_006532chr193658 544 152 ------
NM_006544chr1425271 1310 --13765 --
NM_006546chr17116565 6063 5389 5233 5093 4328 4165 2580 2129 1051 732 11163 24789 2036 --
NM_006547chr732016 1925 724 --1531 --
NM_006548chr311251 ------
NM_006561chr1055409 5132 4970 974 386 25097 406 15747 --
NM_006572chr1722956 1344 ------
NM_006589chr1150 --191 --
NM_006599chr1666876 6575 2022 1442 1332 488 26479 2937 2837 256 17346
NM_006601chr12--1440 ----
NM_006603chrX1256 ------
NM_006608chr1----135 --
NM_006609chr2--11164 ----
NM_006618chr12532 92 ----11124
NM_006624chr1032085 1588 449 ------
NM_006625chr1--1410 1470 --
NM_006625chr1--1410 1470 --
NM_006625chr1--1410 1470 --
NM_006628chr1534391 3646 3637 --14618 --
NM_006629chr1822394 899 ------
NM_006650chr583709 3429 2865 2698 2598 1054 632 108 --13515 --
NM_006654chr1253642 3325 1655 332 273 14072 ----
NM_006677chr3131 ------
NM_006690chr2052085 1893 1461 452 204 --1547 --
NM_006698chr201252 ----11241
NM_006699chr122652 2249 2972 598 --12033
NM_006705chr92116 66 ------
NM_006706chr51656 ------
NM_006711chr161109 1673 ----
NM_006717chr922423 490 ------
NM_006724chr61191 ----1427
NM_006727chr51459 ------
NM_006729chrX33509 1980 1492 24522 1499 14771 --
NM_006734chr621060 216 ------
NM_006738chr1573927 2970 1532 1339 1133 1058 243 11185 ----
NM_006742chr1641288 685 503 245 ------
NM_006743chrX1726 1319 ----
NM_006749chr82230 49 ------
NM_006751chr21707 ------
NM_006756chr821387 398 1267 ----
NM_006761chr17------1581
NM_006772chr631194 1123 701 ------
NM_006775chr622434 952 178 ----
NM_006788chr1831844 1324 440 --11856 21732 1503
NM_006801chr191629 1588 ----
NM_006805chr521372 1102 ------
NM_006807chr17----11024 --
NM_006815chr122978 195 ------
NM_006816chr51230 ------
NM_006826chr21287 ------
NM_006832chr141429 ------
NM_006833chr71127 ------
NM_006838chr1221670 559 11876 ----
NM_006851chr1222070 947 ------
NM_006852chr1711127 ------
NM_006854chr711780 1455 ----
NM_006856chr121333 1788 ----
NM_006861chr1241893 1783 1720 1539 1246 1804 --
NM_006874chr43928 859 811 ------
NM_006875chrX1350 ------
NM_006884chr31463 ------
NM_006885chr1613804 ------
NM_006888chr1483512 3136 2640 2532 2454 536 440 303 12690 13184 --
NM_006898chr22784 638 1277 ----
NM_006906chr11--2864 634 ----
NM_006920chr211731 ------
NM_006922chr2----12061 --
NM_006924chr1734183 1397 522 23699 645 11173 --
NM_006925chr14--187 ----
NM_006927chr1642233 1397 409 156 ------
NM_006937chr171172 ------
NM_006943chr2032701 2290 569 --190 12978
NM_006950chrX1791 ------
NM_006988chr213996 352 53 ------
NM_006999chr531855 777 635 ------
NM_007005chr9139 1401 ----
NM_007006chr1623445 1049 ------
NM_007008chr2--1322 ----
NM_007011chr1532201 1948 1859 15145 26512 2337 --
NM_007017chr51879 ------
NM_007030chr561651 1450 1250 571 551 327 --24363 4194 --
NM_007033chr162059 1896 1743 1588 541 169 11482 1731 --
NM_007034chr1159 ------
NM_007050chr2097215 5141 2817 2784 2582 2308 1857 1340 496 32260 1017 334 12977 --
NM_007052chrX1127 ------
NM_007054chr533852 2857 2848 ------
NM_007067chr172489 172 195 ----
NM_007084chr1341380 1213 352 279 11110 1498 --
NM_007099chr22829 173 ------
NM_007106chr1342532 1954 567 376 12015 ----
NM_007111chr131697 ------
NM_007114chr31977 --13011 --
NM_007125chrY1372 ------
NM_007126chr9130 ------
NM_007146chr1722683 2088 --12151 1259
NM_007150chrX31946 1804 447 --1612 --
NM_007158chr11340 2398 284 ----
NM_007159chr311397 --146 --
NM_007162chr63211 162 133 ------
NM_007170chr12862 692 --1315 --
NM_007174chr1221948 562 11787 --11490
NM_007191chr12----1276 --
NM_007200chr1573927 2970 1532 1339 1133 1058 243 11185 ----
NM_007203chr932527 1399 396 ------
NM_007214chr6----1544 --
NM_007221chr12376 304 ------
NM_007222chr811424 ------
NM_007236chr1572365 1941 1677 579 558 519 469 11801 ----
NM_007238chr2034568 3895 372 ------
NM_007246chr41843 ------
NM_007249chr1383383 2319 2261 1667 1450 909 753 743 ----28871 2343
NM_007275chr32881 122 ------
NM_007282chr31155 ------
NM_007283chr312641 --12336 --
NM_007286chr521474 578 1504 11479 --
NM_007294chr1741075 1038 381 334 ------
NM_007295chr1741075 1038 381 334 ------
NM_007296chr1741075 1038 381 334 ------
NM_007297chr1741075 1038 381 334 ------
NM_007298chr1741075 1038 381 334 ------
NM_007299chr1741075 1038 381 334 ------
NM_007300chr1741075 1038 381 334 ------
NM_007302chr1741075 1038 381 334 ------
NM_007303chr1741075 1038 381 334 ------
NM_007304chr1741075 1038 381 334 ------
NM_007305chr1741075 1038 381 334 ------
NM_007325chrX22005 513 --11336 --
NM_007327chr95973 818 466 166 158 --1859 --
NM_007331chr422728 507 12548 ----
NM_007345chr1811482 ----1702
NM_007358chr111577 ------
NM_007359chr1741524 1419 236 81 --1619 --
NM_007365chr121406 577 ------
NM_007373chr1011598 1632 ----
NM_007375chr1--12743 ----
NM_012069chrX32033 2024 61 22142 613 --1267
NM_012074chr142806 63 2830 374 ----
NM_012081chr523516 3315 ------
NM_012090chr1--1201 ----
NM_012092chr22122 37 ------
NM_012095chr102562 269 ----12749
NM_012096chr32678 404 ------
NM_012097chr232288 2003 572 12306 ----
NM_012098chr931309 574 61 ------
NM_012102chr152163 1761 1614 806 23 ------
NM_012104chr1153610 1481 439 408 363 --1226 1162
NM_012104chr1153610 1481 439 408 363 --1226 1162
NM_012124chr111221 ------
NM_012141chr132722 103 12641 ----
NM_012154chr8----1668 --
NM_012156chr2072290 2284 2154 1286 1107 233 22 11218 1222 1989
NM_012164chr952418 2409 721 625 611 --21851 1399 --
NM_012180chr42593 87 1753 ----
NM_012186chr11746 ------
NM_012193chr1144137 4128 3409 3339 54640 4395 3504 1277 988 ----
NM_012197chr91599 ------
NM_012199chr183773 3749 3263 3231 2988 1768 763 381 --13082 --
NM_012215chr1021799 1288 --11251 --
NM_012223chr22467 457 1121 ----
NM_012224chr411073 --11078 --
NM_012234chr333668 3059 537 ------
NM_012236chr12278 212 ------
NM_012238chr1021668 515 ------
NM_012244chr1411597 --21725 1301 --
NM_012249chr2--23258 718 ----
NM_012250chr1121050 135 ------
NM_012252chr7148 --14897 --
NM_012257chr7--1904 ----
NM_012261chr20----1507 --
NM_012262chr143729 3528 1486 448 --23548 165 14705
NM_012264chr2211370 --31425 94 30 --
NM_012264chr2211370 --31425 94 30 --
NM_012282chrX2332 23 ------
NM_012285chr172117 108 ------
NM_012288chr665482 2279 1065 958 715 267 14257 2472 299 --
NM_012290chr21470 ------
NM_012293chr21131 1521 ----
NM_012294chr722705 258 23836 1058 --11104
NM_012297chr432183 788 27 1876 --1931
NM_012300chr522157 1772 ------
NM_012301chr741925 1860 578 231 ------
NM_012307chr181162 ------
NM_012308chr1121738 1705 ------
NM_012309chr1154206 4079 1746 651 125 44341 3942 3172 1368 ----
NM_012320chr1641310 534 514 49 11378 ----
NM_012324chr22--186 ----
NM_012325chr2011302 11025 ----
NM_012326chr22630 195 ------
NM_012329chr171455 ----11495
NM_012330chr10----1121 11413
NM_012333chr131471 1393 1253 ------
NM_012334chr584674 4086 1688 1679 1355 925 913 62 11907 ----
NM_012384chr2062454 2199 2075 1588 89 40 --1544 --
NM_012398chr1951932 1163 815 687 262 --1757 --
NM_012399chr2211253 --21828 441 --
NM_012405chr162858 2357 1183 1142 746 71 13613 22387 2348 --
NM_012407chr221104 ------
NM_012412chr72859 728 ------
NM_012425chr10123 11771 1793 --
NM_012428chr15--1341 ----
NM_012464chr42226 81 --11182 --
NM_012470chr71371 ------
NM_012471chrX1344 11775 ----
NM_012479chr721102 227 --21005 202 --
NM_012482chr12669 601 ------
NM_013233chr2--1361 ----
NM_013236chr222414 332 ------
NM_013240chr2134105 2662 933 23800 277 ----
NM_013255chr768557 6599 6485 6169 3397 1918 --28548 3067 --
NM_013257chr822219 729 ------
NM_013262chr631146 388 27 ------
NM_013267chr12146 ------
NM_013269chr1221338 664 1740 ----
NM_013277chr123822 688 209 ------
NM_013281chr2011542 ------
NM_013283chr5----1783 --
NM_013304chr16147 ------
NM_013336chr351789 1764 1297 406 184 1191 21478 466 --
NM_013368chr191435 ------
NM_013372chr1542592 1317 620 125 --12201 --
NM_013374chr332990 2365 539 2882 828 13072 --
NM_013376chr19381 48 28 ------
NM_013377chr121175 1147 ----
NM_013390chr921192 221 11363 1437 --
NM_013399chr1631532 1325 689 1172 ----
NM_013403chr192273 35 ------
NM_013436chr2----1655 --
NM_013437chr811019 ------
NM_013438chr91415 21734 1172 ----
NM_013441chr11440 ------
NM_013444chrX2838 794 ------
NM_013448chr141498 ------
NM_013943chr1----13293 --
NM_013952chr222359 794 ------
NM_013953chr222359 794 ------
NM_013958chr81163 ------
NM_013959chr81163 ------
NM_013961chr81163 ------
NM_013962chr81163 ------
NM_013986chr22194 ------
NM_013989chr1444750 4417 1066 413 14946 11901 --
NM_013992chr222359 794 ------
NM_013993chr61249 ------
NM_013994chr61249 ------
NM_014043chr3----1651 --
NM_014089chr1311873 ------
NM_014106chr1542869 2325 2069 772 ------
NM_014112chr835342 4002 881 ------
NM_014149chr72297 212 1131 1606 --
NM_014154chr32496 161 11574 ----
NM_014155chr1156997 6786 6582 5132 1462 12811 1167 --
NM_014157chr16103941 3806 2580 2571 2446 2437 1521 1416 1084 399 21549 1395 1956 --
NM_014159chr31664 --1205 --
NM_014181chr232804 2794 1170 ------
NM_014182chr12--1158 ----
NM_014212chr122257 123 ------
NM_014217chr1--1325 173 --
NM_014230chr17--2447 203 ----
NM_014233chr1721988 1622 ------
NM_014240chr333556 1290 1068 11416 ----
NM_014243chr41143 ------
NM_014246chr2242020 1662 612 306 --1397 --
NM_014253chrX2929 700 11816 1372 --
NM_014263chr102487 29 ------
NM_014268chr181386 ------
NM_014278chr4170 ------
NM_014279chr91307 ------
NM_014286chr953487 2733 2691 2267 549 ------
NM_014288chr11123 ------
NM_014294chr811434 ------
NM_014299chr1931986 1826 884 --21939 1619 --
NM_014305chr131179 ------
NM_014309chr2295369 4657 4379 4278 4182 4062 3472 1026 513 14424 24283 657 --
NM_014319chr121593 ------
NM_014325chr1231627 604 60 ------
NM_014331chr457554 7254 6682 6514 6144 22308 25 17023 11502
NM_014333chr1122233 1941 ------
NM_014368chr9----22168 1523 --
NM_014372chr12571 460 11914 1415 --
NM_014376chr552259 1972 1783 885 189 ------
NM_014381chr1423155 2544 13118 --11086
NM_014382chr321504 700 --1159 --
NM_014391chr10140 ------
NM_014400chr193524 150 96 ------
NM_014415chr31387 ------
NM_014417chr192710 336 ------
NM_014423chr534289 1305 170 14812 ----
NM_014426chr201470 ------
NM_014447chr411476 ------
NM_014454chr621073 185 --1165 1731
NM_014456chr101413 ------
NM_014458chr1--21302 1124 ----
NM_014460chr2251234 692 526 202 26 11749 ----
NM_014462chr8123 ------
NM_014470chr121299 --1728 --
NM_014489chr113809 574 162 --1243 --
NM_014504chr731997 1672 282 ------
NM_014507chr2271014 898 891 786 293 201 189 ------
NM_014515chr121853 1129 ----
NM_014516chr191282 ------
NM_014517chr321913 272 ------
NM_014552chr221426 1372 165 ----
NM_014574chr1411541 ------
NM_014583chr31487 ------
NM_014584chr1411636 1605 ----
NM_014588chr20153 ------
NM_014604chr172552 122 ------
NM_014612chr92383 337 ------
NM_014615chr1632270 1057 986 ------
NM_014636chr92822 544 12785 --12680
NM_014637chr8----2500 482 --
NM_014646chr1852787 2111 460 124 64 --12841 12912
NM_014649chr19152 ------
NM_014659chr151208 1469 ----
NM_014660chr7--1383 ----
NM_014661chr1083451 2594 2481 1436 1372 1052 990 726 23659 3493 138 --
NM_014663chr11291 --1369 --
NM_014665chr833351 3006 2700 --13573 --
NM_014667chr342426 1729 1591 842 --22171 950 --
NM_014671chr71328 ------
NM_014676chr11524 155 ----
NM_014677chr81867 179 ----
NM_014678chr222637 602 --2544 134 --
NM_014682chr8------1845
NM_014685chr16----1371 --
NM_014686chr1922404 915 12383 1156 --
NM_014700chr1641456 599 500 310 ------
NM_014701chr1512448 22564 2140 13343 --
NM_014703chr351228 1162 846 441 33 --1283 --
NM_014705chr722011 1414 ------
NM_014707chr711550 1185 ----
NM_014711chr1611432 ------
NM_014717chr191138 1714 ----
NM_014721chr657306 6962 5051 2250 1691 24862 944 ----
NM_014729chr81805 1529 ----
NM_014730chr12115184 5153 4738 4533 3768 3757 2013 1397 1163 632 223 --34518 4484 4408 --
NM_014730chr12115184 5153 4738 4533 3768 3757 2013 1397 1163 632 223 --34518 4484 4408 --
NM_014731chr2041189 1149 515 368 11583 --11402
NM_014739chr624054 1059 ------
NM_014742chr2041427 1243 411 117 ------
NM_014743chr4--12856 --12216
NM_014747chr165014 4798 1537 532 120 51 --34370 1791 143 --
NM_014751chr821480 680 ------
NM_014754chr81876 ------
NM_014755chr251114 950 876 435 231 1464 ----
NM_014757chr562335 1859 1783 926 762 201 --1220 --
NM_014759chr831052 141 77 --1232 --
NM_014761chr162780 239 ------
NM_014765chr132400 2159 1809 ------
NM_014767chr1032902 2460 266 --23255 3148 --
NM_014770chr121407 ------
NM_014772chr1883466 3287 3078 1343 1308 479 363 93 11048 ----
NM_014774chr172887 2812 2540 2219 1302 904 629 ------
NM_014800chr71967 1151 1171 --
NM_014802chr121899 ------
NM_014806chr9----1130 --
NM_014807chr11----1536 --
NM_014810chr12727 163 23418 2264 ----
NM_014811chr9--1173 ----
NM_014812chr11774 ------
NM_014813chr11529 1504 ----
NM_014820chr3----1326 --
NM_014824chr113495 454 145 ------
NM_014826chr123933 817 --1113 --
NM_014827chr111259 ------
NM_014828chr1421922 88 ------
NM_014829chr52137 33 ------
NM_014832chr13173 ------
NM_014836chr1021949 1588 ----1641
NM_014839chr132231 1895 566 21777 1743 ----
NM_014840chr1273057 2134 2113 226 117 88 73 --22472 523 1458
NM_014841chr611169 ------
NM_014849chr121098 28 ------
NM_014850chr384880 4751 4670 4140 1263 1190 865 157 14636 ----
NM_014859chr175927 312 176 139 100 11344 ----
NM_014871chr12180 ------
NM_014873chr194869 4750 3581 3572 1413 1404 939 599 448 13319 21622 453 --
NM_014877chr1726107 1591 16198 1687 --
NM_014892chr61237 ------
NM_014897chr1742674 2641 2316 474 ------
NM_014899chr552689 2630 2402 1164 632 22094 599 --1967
NM_014901chr53539 528 130 --1299 --
NM_014902chr2041374 1007 990 256 --11398 --
NM_014903chr121450 ------
NM_014904chr101370 --1267 --
NM_014905chr22799 84 --1741 --
NM_014906chr1731557 216 188 14137 ----
NM_014909chr1493408 2993 2814 1073 565 483 353 344 92 --11164 --
NM_014912chr10----13113 --
NM_014915chr101955 21039 892 ----
NM_014917chr1----2893 214 --
NM_014921chr1992377 2160 2044 1186 1048 1042 579 98 26 ------
NM_014923chr1331774 924 102 --21434 165 --
NM_014924chr1442075 2066 354 248 --12826 --
NM_014926chr311142 ------
NM_014927chrX----138 --
NM_014932chr32722 539 ------
NM_014934chr1312903 ------
NM_014945chr51669 ----11427
NM_014947chr142739 2069 2011 1124 12406 ----
NM_014949chr13993 859 806 ------
NM_014952chr151112 --21893 1689 --
NM_014961chr412168 11409 ----
NM_014962chr2012202 11917 22560 2300 --
NM_014964chr1742395 2232 1984 236 --1749 --
NM_014974chr1021529 169 --1593 11169
NM_014978chr1041618 1133 627 325 ------
NM_014982chr1424461 1997 25376 5110 ----
NM_014989chr61220 ------
NM_014990chr14--11242 ----
NM_014991chr422386 2380 ------
NM_014999chr121193 ------
NM_015000chr1232170 1006 185 --1173 --
NM_015002chr122519 131 ------
NM_015008chr332885 2876 543 138 ----
NM_015017chr11424 ------
NM_015018chr61189 ------
NM_015020chr1673402 2982 1240 496 480 319 310 ------
NM_015023chr131379 691 169 --1371 --
NM_015025chr21732 ------
NM_015027chr162717 127 1700 ----
NM_015033chr931168 612 341 ------
NM_015037chr102242 231 ------
NM_015039chr123163 2670 --14176 --
NM_015042chr1554116 3599 3154 762 516 --1217 --
NM_015044chr1633207 2695 2535 --23189 42 --
NM_015045chr101271 11832 ----
NM_015051chr933171 2655 603 --12206 --
NM_015061chr91623 --194 --
NM_015068chr742718 2540 982 163 22869 842 ----
NM_015071chr565022 4981 4387 4089 1372 589 14893 25874 4643 --
NM_015073chr1922088 1399 ------
NM_015074chr144566 3544 942 701 ------
NM_015075chrX31548 1435 890 ------
NM_015076chr623387 2948 ------
NM_015087chr1342601 2558 998 379 ------
NM_015090chr134084 1097 680 --14004 35049 4419 1909
NM_015092chr1643608 3585 1511 1221 1491 ----
NM_015097chr322031 342 11606 ----
NM_015100chr11215 ------
NM_015101chr132705 2606 2257 ------
NM_015107chrX32477 854 742 ------
NM_015115chr421050 893 ------
NM_015129chrX21762 185 ----11232
NM_015132chr741422 733 433 22 ------
NM_015138chr1522749 878 11038 ----
NM_015143chr411368 ------
NM_015144chr1623566 234 ------
NM_015149chr11623 1773 12218 --
NM_015150chr3278 66 1878 1757 --
NM_015155chr1063188 2995 989 488 454 87 ----13118
NM_015156chr1442508 616 439 184 1867 22920 1026 --
NM_015161chr1631096 397 210 ------
NM_015163chr142365 128 11632 197 --
NM_015170chr811666 134 ----
NM_015172chr1----21514 73 --
NM_015176chr11715 1597 ----
NM_015184chr31213 ------
NM_015185chrX22406 2146 12102 12252 --
NM_015187chr41738 --153 --
NM_015196chr41104 ------
NM_015198chr7----1265 --
NM_015200chr432186 1630 927 ------
NM_015202chr1641204 534 225 23 ------
NM_015208chr182436 262 --1254 --
NM_015213chr112254 233 --1610 --
NM_015215chr112976 ------
NM_015221chr1031468 268 62 ------
NM_015226chr1643051 2823 2603 459 23473 69 143 12345
NM_015236chr4--11100 ----
NM_015246chr164783 734 318 209 ------
NM_015250chr9----11367 --
NM_015254chr892216 2171 1160 1143 1132 870 677 580 142 ------
NM_015264chr2254854 4730 4273 3844 3342 --2822 204 --
NM_015265chr21674 1235 ----
NM_015269chr1126 ------
NM_015270chr1221501 723 --11608 --
NM_015271chr4--12726 ----
NM_015272chr1611769 ------
NM_015277chr1821858 1184 --21720 1422 --
NM_015285chr1822344 1761 ------
NM_015288chr563316 3193 3177 2427 1040 184 11303 --13881
NM_015291chr152508 2462 2250 594 364 23423 2451 1737 --
NM_015292chr123747 650 234 ------
NM_015293chr6----133 --
NM_015296chr131834 1327 ----
NM_015299chr1463519 3380 2851 1442 458 300 --13636 1963
NM_015310chr867755 7390 6627 5858 2974 28 26771 67 17927 --
NM_015313chr1133480 3108 917 --14129 --
NM_015317chr21388 1671 22621 2393 1241
NM_015321chr19164881 4755 4622 4384 3618 3526 3471 3363 1914 1680 1522 1507 1434 1372 1144 608 --13114 --
NM_015326chr172769 2451 2051 1030 931 527 366 1294 ----
NM_015327chr131240 1003 59 --11319 --
NM_015328chr752601 2518 1950 824 176 --22048 1197 --
NM_015329chr1942842 2777 2467 907 ------
NM_015336chr1211780 ------
NM_015339chr203761 234 85 ------
NM_015347chr1222674 461 --22709 1972 --
NM_015349chr631141 578 225 22734 81 ----
NM_015358chr2111266 --1200 --
NM_015365chrX1717 --23808 1337 --
NM_015374chr221330 --11084 --
NM_015382chr141528 1311 ----
NM_015393chr41176 13638 1852 --
NM_015401chr121430 2901 65 ----
NM_015404chr9166 ------
NM_015435chr821149 53 ------
NM_015443chr174356 266 254 41 --1558 1225
NM_015455chr523622 3423 ------
NM_015470chr2----132 --
NM_015475chr21123 ------
NM_015477chr152158 147 ------
NM_015481chr12--1390 ----
NM_015483chr721125 1018 ------
NM_015488chr21610 11535 ----
NM_015497chr1541016 1009 930 142 ----1738
NM_015503chr163470 180 162 ------
NM_015508chr321421 344 11248 ----
NM_015511chr2011107 ------
NM_015520chr31949 ------
NM_015537chr92937 854 --1901 --
NM_015548chr61903 ------
NM_015550chr723204 510 11109 12666 --
NM_015553chr644230 3533 1555 878 12048 23634 3458 --
NM_015557chr143183 3118 966 449 --23026 2443 13455
NM_015559chr184804 439 362 301 ------
NM_015567chr1321159 117 ------
NM_015569chr134720 4310 854 13837 ----
NM_015570chr711175 ------
NM_015576chr31467 --1542 --
NM_015578chr1931819 1533 1440 1348 ----
NM_015589chr14129 ------
NM_015609chr142898 2047 1166 210 12765 12740 --
NM_015627chr151761 1709 1650 1192 610 ------
NM_015640chr144706 1985 1662 1056 13341 ----
NM_015642chr31250 ------
NM_015651chr941749 1562 1507 124 --11774 --
NM_015657chr231044 796 250 ------
NM_015678chr1321366 551 ------
NM_015686chrX21914 1672 ------
NM_015726chr141794 1728 1187 483 ------
NM_015833chr2131957 830 228 ------
NM_015844chr182684 202 ------
NM_015846chr182684 202 ------
NM_015847chr182684 202 ------
NM_015850chr852102 2088 1895 545 197 --1106 --
NM_015866chr141194 520 319 286 ------
NM_015872chr11475 --1112 --
NM_015878chr811495 1111 ----
NM_015879chr18118256 7342 7325 6753 6624 5831 3189 2639 2015 1337 400 26709 2954 ----
NM_015886chr845397 4524 4337 3768 14267 ----
NM_015891chr6--21428 245 ----
NM_015904chr21563 1776 ----
NM_015906chr124682 1002 1917 ----
NM_015913chr12742 169 ------
NM_015981chr563020 2291 1972 1947 342 71 ------
NM_015982chr17142 ------
NM_015984chr1--1111 ----
NM_015986chr171249 ------
NM_016022chr12913 826 ------
NM_016025chr161512 1372 ----
NM_016032chrX2248 146 ------
NM_016037chr12426 417 ------
NM_016061chr21499 ------
NM_016062chr16135 ------
NM_016076chr131030 733 38 --1505 --
NM_016078chr172805 101 --1206 --
NM_016079chr22746 599 32274 2034 1719 ----
NM_016083chr623075 3052 13781 --13713
NM_016103chr5197 ------
NM_016107chr521256 51 ------
NM_016120chrX21155 1113 ------
NM_016131chr212330 ------
NM_016132chr1512284 --13050 --
NM_016147chr112925 397 ------
NM_016152chr31919 11292 ----
NM_016166chr15151 ------
NM_016185chr172760 583 ------
NM_016206chr327589 5600 1522 27873 825 --
NM_016235chr161355 ------
NM_016250chr142714 562 ------
NM_016257chr152505 1380 650 268 74 --12929 --
NM_016260chr256844 4809 1042 738 719 22884 1204 12332 --
NM_016263chr1993177 3086 2830 2719 2624 2531 2256 1320 541 --12965 --
NM_016272chr223955 600 459 ------
NM_016275chr322334 126 --1181 12623
NM_016277chr62551 490 ------
NM_016281chr121211 1783 ----
NM_016289chr252331 1958 1717 395 360 ------
NM_016300chr31166 --1123 --
NM_016308chr11649 ----11882
NM_016315chr211772 ------
NM_016320chr114977 278 99 75 ------
NM_016322chr91732 1330 21268 865 --
NM_016339chr1761256 1233 1209 374 217 46 21134 534 ----
NM_016340chr511093 ------
NM_016374chr131203 1126 139 31309 548 235 11287 --
NM_016374chr131203 1126 139 31309 548 235 11287 --
NM_016376chr1743620 3604 433 417 13411 194 --
NM_016396chr15----11017 --
NM_016406chr11364 ------
NM_016418chr2263242 3040 2579 660 515 155 --23641 654 --
NM_016424chr171413 ------
NM_016427chr181150 151 ----
NM_016431chr22--186 ----
NM_016436chr202623 423 ------
NM_016441chr222407 2091 1368 ----
NM_016467chr25953 897 548 195 130 ------
NM_016470chr202546 140 ------
NM_016485chr622203 34 --11796 --
NM_016488chr1241713 1360 692 356 --1450 --
NM_016506chr112186 98 ------
NM_016507chr1722589 1951 --1185 --
NM_016516chr21710 ------
NM_016519chr41449 ------
NM_016522chr111375 11166 ----
NM_016529chr1331013 509 86 ------
NM_016530chr1562947 1509 1346 1340 1117 940 ------
NM_016531chr41114 ----11363
NM_016538chr17----128 --
NM_016559chr31620 ----1566
NM_016577chr353259 2990 2791 1642 776 13403 24241 3275 1815
NM_016596chr121430 2901 65 ----
NM_016603chr542220 1595 1476 608 --22105 76 1771
NM_016605chr542528 2477 789 199 11989 ----
NM_016613chr422059 549 11927 ----
NM_016621chr1184060 3568 3513 3203 3007 1823 1667 602 13351 13582 --
NM_016626chr181394 --21103 640 --
NM_016639chr162448 431 ------
NM_016644chr5--1142 ----
NM_016654chr1511169 ------
NM_016656chrX--1270 ----
NM_016824chr1031827 1503 498 1714 11462 --
NM_016836chr21691 ------
NM_016839chr21691 ------
NM_017409chr121258 ------
NM_017412chr81371 1259 ----
NM_017413chrX32374 2345 503 ------
NM_017415chr563411 1691 1522 1168 1160 138 ------
NM_017420chr1432949 2895 30 ------
NM_017424chr2241552 1543 535 140 --1545 --
NM_017440chr12138 ------
NM_017447chr2111410 13075 ----
NM_017450chr1731127 1057 88 --11220 --
NM_017451chr171931 21123 117 2917 285 --
NM_017452chr2041246 380 277 222 ------
NM_017453chr2041246 380 277 222 ------
NM_017454chr2041246 380 277 222 ------
NM_017455chr15--1341 ----
NM_017488chr241598 1357 1343 1176 11517 ----
NM_017544chrX1857 ------
NM_017548chr322164 1439 11570 ----
NM_017549chr731165 349 271 --1479 --
NM_017551chr1042504 747 513 451 ------
NM_017563chr374707 4147 1533 1247 890 852 130 --11494 --
NM_017578chr31104 ------
NM_017589chr11134 ------
NM_017602chrX3940 880 323 ------
NM_017610chr152119 51 ------
NM_017628chr444800 4284 1436 783 14356 14197 --
NM_017629chr131693 597 33 ------
NM_017632chr4135 ------
NM_017633chr663713 3063 2726 2498 2402 1356 1147 ----
NM_017635chr112512 351 ------
NM_017637chr9108832 8790 7932 7136 6672 3771 3496 1709 1063 647 --1753 --
NM_017643chr17--12132 1548 --
NM_017649chr10--1786 1201 --
NM_017650chr71952 45445 2022 1978 840 14284 --
NM_017655chr1--11304 ----
NM_017658chr1423775 3579 ------
NM_017661chr152940 465 ----1505
NM_017664chr13144 1361 ----
NM_017670chr111151 ------
NM_017672chr1531014 501 365 --1198 --
NM_017680chr911020 ------
NM_017686chr12154 125 1948 ----
NM_017694chr21177 ------
NM_017704chr111281 ------
NM_017709chr183408 3141 3074 2952 2889 2695 1324 401 13746 ----
NM_017712chr1995513 5439 5141 5108 3888 2382 2277 1976 493 11522 55025 4909 2252 2137 1398 --
NM_017719chr312491 22337 1822 --1900
NM_017724chr31318 ------
NM_017730chr32595 253 ------
NM_017736chr1632388 1281 253 ------
NM_017737chr12796 640 ------
NM_017739chr12406 51 --193 --
NM_017744chr141669 1530 914 838 11829 22139 2093 --
NM_017749chr112673 95 ------
NM_017753chr921012 683 ------
NM_017778chr82441 126 ------
NM_017779chr122255 937 ------
NM_017780chr8--1680 ----
NM_017784chr32476 430 --183 --
NM_017787chr1062822 2672 2049 828 674 663 133 12268 --
NM_017790chr91213 133 ----
NM_017799chr1411507 21777 639 ----
NM_017801chr332178 2034 64 --1905 --
NM_017811chr942811 2434 2400 2190 12790 ----
NM_017813chr875643 5076 5052 4355 4090 2154 1977 34493 4464 1858 1598 --
NM_017831chr1874179 3525 3004 2966 2957 1870 685 11594 ----
NM_017848chrX33830 3775 3156 ------
NM_017849chr242609 2489 2480 98 --11019 --
NM_017873chr942915 2133 548 364 11056 21212 620 --
NM_017880chr21410 ------
NM_017893chr1021076 144 ------
NM_017895chr20172 ------
NM_017902chr1075330 5022 4424 4344 4225 2056 1107 15748 1168 --
NM_017910chr2188 ------
NM_017919chr935157 1133 1041 25285 3980 ----
NM_017933chr21440 11353 1563 --
NM_017938chrX31738 1427 356 ------
NM_017945chr321211 876 11379 ----
NM_017953chr12491 73 --1414 --
NM_017954chr711211 ------
NM_017964chr22665 656 ------
NM_017974chr231265 1101 77 ------
NM_018014chr211364 ------
NM_018024chr8193 ------
NM_018028chr192160 97 ----11332
NM_018046chr521514 691 ------
NM_018054chr162559 210 142 ----
NM_018061chr121601 294 ------
NM_018064chr6----1291 --
NM_018070chr1196 ------
NM_018084chr21520 13191 ----
NM_018086chr211868 11709 139 --
NM_018089chr2--1202 1165 --
NM_018095chr112186 98 ------
NM_018110chr1641334 479 169 55 --21005 465 --
NM_018116chr12546 500 --1514 --
NM_018121chr1032085 894 636 22362 2327 --1148
NM_018124chr1631798 650 35 ------
NM_018126chr42364 156 --153 --
NM_018128chr1721003 353 ------
NM_018131chr103773 656 173 ------
NM_018133chr321378 31 1271 12157 12047
NM_018171chr121814 ------
NM_018176chr431447 1374 564 --11236 --
NM_018178chr1136 ------
NM_018181chr181770 ----11891
NM_018182chr1731698 1630 674 ----11505
NM_018184chr3--12043 ----
NM_018193chr152185 159 --199 --
NM_018195chr111197 ------
NM_018210chr131561 21445 991 ----
NM_018214chr61437 ------
NM_018227chr421202 435 12429 ----
NM_018229chr14--1872 ----
NM_018241chr4152 ------
NM_018243chr444006 3246 3126 675 22938 1126 ----
NM_018244chr202453 34 ------
NM_018245chr101155 ------
NM_018246chr8----22733 1762 --
NM_018275chr72234 120 ------
NM_018293chr332554 384 174 ------
NM_018297chr3------129
NM_018299chr82662 174 13348 ----
NM_018302chr452106 1810 699 319 32 11937 ----
NM_018315chr421201 125 ------
NM_018325chr951567 1170 1120 392 359 ----148
NM_018327chr201652 ------
NM_018351chr1244270 3992 1764 605 ------
NM_018362chr1133444 2853 1364 13940 13210 --
NM_018364chr173903 3826 3024 2565 926 788 478 ------
NM_018367chr112313 49 ------
NM_018375chr1441720 1216 726 646 21773 1402 ----
NM_018381chr192376 199 ------
NM_018383chr241814 1523 1434 189 ------
NM_018388chrX11006 ------
NM_018398chr3145 ------
NM_018409chr422646 2027 ------
NM_018427chr161565 --1600 11481
NM_018433chr21466 ------
NM_018440chr867674 5788 5568 5558 3321 683 ------
NM_018448chr12--1521 1471 --
NM_018469chr17--1221 ----
NM_018482chr831809 307 236 ------
NM_018486chrX2484 156 ------
NM_018489chr12448 290 ------
NM_018557chr221163 87 ------
NM_018566chr154577 3642 3537 3129 813 11856 ----
NM_018569chr411528 ------
NM_018584chr11139 160 1416 --
NM_018602chr151437 --21726 58 --
NM_018638chr1221430 667 --15467 --
NM_018644chr1121831 274 ----12100
NM_018650chr111794 171 1629 11848
NM_018652chr153730 401 273 --11052 --
NM_018657chr3--156 ----
NM_018660chr832276 2270 128 --21883 1148 --
NM_018674chr23515 473 203 ------
NM_018679chr6124 ------
NM_018689chr1562586 996 386 346 217 55 ------
NM_018695chr552289 2037 528 475 415 ------
NM_018696chr182679 389 1344 ----
NM_018711chr1251025 1016 556 506 24 1285 31545 628 55 --
NM_018717chr43830 737 128 12399 1782 --
NM_018834chr51749 ------
NM_018841chr113513 ------
NM_018846chr73827 296 189 ------
NM_018897chr22218 39 ------
NM_018898chr51655 ----11717
NM_018899chr51655 ----11717
NM_018900chr51655 ----11717
NM_018901chr51655 ----11717
NM_018902chr51655 ----11717
NM_018903chr51655 ----11717
NM_018904chr51655 ----11717
NM_018905chr51655 ----11717
NM_018906chr51655 ----11717
NM_018907chr51655 ----11717
NM_018908chr51655 ----11717
NM_018909chr51655 ----11717
NM_018910chr51655 ----11717
NM_018911chr51655 ----11717
NM_018912chr521498 110 ------
NM_018913chr521498 110 ------
NM_018914chr521498 110 ------
NM_018915chr521498 110 ------
NM_018916chr521498 110 ------
NM_018917chr521498 110 ------
NM_018918chr521498 110 ------
NM_018919chr521498 110 ------
NM_018920chr521498 110 ------
NM_018921chr521498 110 ------
NM_018922chr521498 110 ------
NM_018923chr521498 110 ------
NM_018924chr521498 110 ------
NM_018925chr521498 110 ------
NM_018926chr521498 110 ------
NM_018927chr521498 110 ------
NM_018928chr521498 110 ------
NM_018929chr521498 110 ------
NM_018931chr52660 347 --1268 --
NM_018945chr633687 2774 657 13030 ----
NM_018951chr75400 346 197 155 44 1856 ----
NM_018957chr22------1334
NM_018970chr733106 2497 1240 12572 ----
NM_018976chr121123 11925 --12847
NM_018999chr1023046 1056 1203 14941 11565
NM_019001chr313689 --11362 --
NM_019003chrX121 ------
NM_019004chr7--12228 ----
NM_019027chr41856 1818 1561 --
NM_019042chr731113 998 891 ------
NM_019057chr51269 ------
NM_019058chr101619 --1667 --
NM_019063chr2------12130
NM_019071chr7----1571 --
NM_019072chr521058 431 ------
NM_019074chr154866 371 212 201 ------
NM_019084chr1021732 352 ------
NM_019088chr19123 ------
NM_019096chr651029 776 715 345 245 1261 ----
NM_019098chr821645 384 1642 ----
NM_019106chr2233236 2110 109 ------
NM_019114chr932538 2505 435 ------
NM_019555chr321747 120 ------
NM_019557chr11350 ------
NM_019592chr93743 599 29 1186 ----
NM_019593chr2023058 2618 ------
NM_019594chr951353 1288 1221 1066 177 ------
NM_019597chrX1550 ------
NM_019606chr73446 197 178 ------
NM_019610chr121752 563 ------
NM_019613chr173908 234 59 ------
NM_019845chr22751 184 ------
NM_019885chr242840 2312 2198 2053 31895 860 141 12537 --
NM_019891chr11411 ------
NM_019903chr1031827 1503 498 1714 11462 --
NM_020117chr52885 745 ------
NM_020119chr71466 21236 627 1553 11015
NM_020122chr255375 5146 5116 2419 1077 15620 ----
NM_020130chr811195 1922 ----
NM_020142chr121449 ------
NM_020148chr1842395 866 409 71 --13039 --
NM_020150chr102209 111 --1242 --
NM_020152chr21152 ------
NM_020154chr15----121 --
NM_020182chr2043420 2240 1153 1077 ------
NM_020185chr6149 ------
NM_020193chr111521 ------
NM_020204chr1--1165 ----
NM_020205chr112312 ----1166
NM_020211chr1551390 1062 993 542 91 ------
NM_020239chr152036 1859 846 498 415 ------
NM_020243chr22199 ------
NM_020245chr634863 4683 3709 --11576 --
NM_020248chr152204 1987 1856 1596 434 --21674 163 1921
NM_020336chr2023692 3568 --13148 --
NM_020337chr42965 590 ------
NM_020341chr2012033 1359 ----
NM_020342chr23992 962 150 ------
NM_020343chr20------1490
NM_020345chr3--1874 ----
NM_020381chr621816 506 ------
NM_020420chrY2126 71 ------
NM_020423chr11174 ------
NM_020429chr732044 1132 962 --184 --
NM_020432chr7--2294 273 ----
NM_020440chr123033 2117 --12360 --
NM_020443chr196967 5937 5780 5285 4265 2347 1331 1042 1013 22621 1505 144 --
NM_020444chr511430 126 ----
NM_020452chr151854 846 133 86 50 21486 523 1595 --
NM_020456chr1331842 681 485 1471 ----
NM_020457chr162145 136 2667 480 ----
NM_020463chr21415 ------
NM_020465chr1631913 557 408 --11499 --
NM_020474chr181420 ----11467
NM_020475chr832208 1591 126 --12226 --
NM_020476chr832208 1591 126 --12226 --
NM_020477chr832208 1591 126 --12226 --
NM_020478chr832271 1654 189 --12289 --
NM_020480chr832208 1591 126 --12226 --
NM_020532chr2--1322 ----
NM_020640chr3178 1542 1367 --
NM_020647chr821905 319 ------
NM_020649chr172101 58 ------
NM_020651chr2----11135 --
NM_020654chr311350 ------
NM_020673chr2076178 5932 5654 5248 1459 672 234 --15085 --
NM_020689chr2011530 ------
NM_020690chr52120 46 ------
NM_020692chr14151 ------
NM_020699chr123864 3747 ------
NM_020703chr1184 ------
NM_020706chr211113 ------
NM_020708chr20----21700 1635 12009
NM_020711chr292398 2333 2223 2109 1957 538 424 373 288 1470 12440 --
NM_020713chr2092736 2697 2477 2404 2018 948 838 440 417 ------
NM_020714chr1984653 4325 4169 3955 3376 1133 1124 576 --22853 1053 --
NM_020717chrX54196 1916 1594 471 447 ------
NM_020724chr462344 2093 872 693 357 210 2379 107 12587 --
NM_020726chr5--1426 ----
NM_020728chr732603 473 380 ------
NM_020734chr1243251 3027 2935 627 ------
NM_020747chr5--1952 ----
NM_020748chr171185 ------
NM_020755chr641322 1211 395 119 ------
NM_020760chr21372 ----11714
NM_020765chr1139 ------
NM_020766chrX34088 3485 2790 12987 14098 13989
NM_020772chr1737565 7345 6418 ------
NM_020773chr42687 133 ----12311
NM_020774chr1834307 4247 1603 14784 ----
NM_020791chr1721365 497 ------
NM_020794chr1----1452 --
NM_020795chr172606 361 22021 76 11623 --
NM_020796chr552844 2737 2569 1849 1217 ------
NM_020801chr542257 2077 927 229 ------
NM_020805chr181624 1504 ----
NM_020807chr1641570 1551 589 187 ------
NM_020814chr241214 962 157 118 --1485 --
NM_020815chr41350 1305 ----
NM_020818chr14--1406 ----
NM_020820chr2051385 1313 277 188 73 ------
NM_020824chr101114 --1288 --
NM_020830chr21506 1934 ----
NM_020839chr311108 ------
NM_020850chr1663215 2810 1282 363 236 28 ------
NM_020856chr1941475 1412 986 90 1192 1360 --
NM_020858chr1521610 217 1142 ----
NM_020859chr453463 3399 3114 1280 365 --11164 --
NM_020870chr412041 11535 11855 --
NM_020873chr3125 ------
NM_020888chr151687 788 301 222 21 11344 1273 --
NM_020895chr19----172 --
NM_020917chr1942874 774 611 604 23301 3276 13050 --
NM_020918chr1033400 2853 1026 11092 --2707 23
NM_020920chr144391 321 307 254 ------
NM_020922chrX11439 ------
NM_020925chr11206 ------
NM_020935chr234461 4161 461 11024 122 --
NM_020948chr123189 1187 --11210 --
NM_020951chr1921832 250 ------
NM_020956chr19104740 4357 3822 3510 3411 1484 997 915 828 244 --14713 --
NM_020962chr1542120 1898 1525 499 ------
NM_020977chr441887 1857 826 820 ------
NM_020983chr1221501 723 --11608 --
NM_020989chr2164 ------
NM_020993chr1272369 2306 2150 1878 968 814 448 --12596 --
NM_021005chr151783 --1992 --
NM_021007chr221867 922 ------
NM_021012chr1783005 2779 2200 2049 1988 540 371 348 --22125 987 --
NM_021020chr852871 2344 925 524 36 ------
NM_021033chr1333035 2444 949 --12535 12467
NM_021038chr323177 2120 ------
NM_021047chr191447 ------
NM_021069chr42457 192 ------
NM_021072chr521951 1702 11709 ----
NM_021079chr1722845 289 32201 1160 105 23204 467 --
NM_021096chr2243249 3084 2814 959 --13240 --
NM_021097chr222101 685 21167 783 --12515
NM_021106chr93674 614 240 ------
NM_021109chrX1293 ------
NM_021109chrX1293 ------
NM_021120chrX22614 691 ------
NM_021132chr101977 --1503 --
NM_021133chr12696 136 156 ----
NM_021135chr652702 2674 1346 469 79 --1507 --
NM_021140chrX2388 99 1258 ----
NM_021145chr71845 ------
NM_021159chr4--2605 350 ----
NM_021161chr142467 432 ------
NM_021198chr221428 1219 ------
NM_021200chr1121206 1125 --1771 --
NM_021215chr2032422 2044 456 ------
NM_021222chr131308 979 111 1909 ----
NM_021224chr92149 63 ------
NM_021238chr1241777 642 288 279 ------
NM_021239chr141229 ------
NM_021249chr1421466 1398 1466 11083 11504
NM_021255chr1443161 1327 1318 1263 11488 ----
NM_021569chr95973 818 466 166 158 --1859 --
NM_021625chr122420 331 ------
NM_021627chr331245 899 32 ------
NM_021629chr313531 13089 ----
NM_021639chr1----1294 --
NM_021643chr231426 417 364 ----1462
NM_021649chr5126 ------
NM_021705chr631501 1242 1217 1171 ----
NM_021722chr71212 ------
NM_021728chr141992 ------
NM_021783chrX22398 29 --21501 361 --
NM_021809chr2011592 --22342 154 --
NM_021825chr11131 ------
NM_021911chr535601 636 125 23555 1219 ----
NM_021912chr1523473 631 ------
NM_021914chr1442479 2260 1971 1575 1457 1402 --
NM_021931chr2031070 391 249 --286 37 --
NM_021935chr32880 696 ------
NM_021940chr611376 ------
NM_021943chr651943 794 371 190 144 ------
NM_021947chr172390 294 ------
NM_021961chr11127176 7144 7098 5880 5675 5620 5339 2651 2008 1836 987 212 --12346 --
NM_021964chr324583 31 25008 1037 ----
NM_021969chr1----143 --
NM_021984chrX2593 469 11088 11316 --
NM_021987chrX2593 469 11088 11316 --
NM_021990chrX2593 469 11088 11316 --
NM_021998chrX11151 ------
NM_022039chr102570 422 ------
NM_022047chr6160 ------
NM_022048chr1596327 5877 5527 2109 1878 1404 659 562 513 --13921 1976
NM_022114chr153491 3245 2986 1479 328 --14330 --
NM_022130chr51222 --1169 --
NM_022138chr641091 978 468 180 --1985 --
NM_022143chr72282 120 ------
NM_022144chrX------137
NM_022166chr1655406 4560 4160 3872 1397 1189 15255 11549
NM_022337chr112575 25 ------
NM_022340chr363534 3383 2327 2272 785 41 11178 --12301
NM_022343chr931243 983 136 ------
NM_022346chr421414 1193 ------
NM_022362chr10----1326 --
NM_022454chr8----1129 --
NM_022458chr723042 2746 12253 ----
NM_022459chr1366208 5871 1429 674 438 171 16191 ----
NM_022465chr1232701 1920 549 ------
NM_022483chr521798 679 1570 ----
NM_022497chr373470 2518 1520 779 770 363 210 --1445 13596
NM_022550chr51195 ------
NM_022572chr21610 11535 ----
NM_022650chr51155 ------
NM_022652chr12159 ------
NM_022658chr121381 ------
NM_022716chr143040 2738 2712 2086 ------
NM_022719chr22113050 3044 2816 2487 1453 1340 1269 736 601 414 162 ------
NM_022728chr7185 ------
NM_022730chr21341 1968 121 --
NM_022733chr12239 140 --1263 --
NM_022735chr11434 ------
NM_022744chr1631021 949 497 11174 ----
NM_022748chr71338 --22402 1918 --
NM_022749chr841395 1067 907 66 ------
NM_022753chr152723 2428 2186 1958 363 ----1526
NM_022758chr672935 2644 2496 2135 933 845 488 12305 12037 --
NM_022763chr322893 2744 --12870 --
NM_022781chr922739 2046 12364 ----
NM_022810chrX1404 ------
NM_022823chr22492 131 ------
NM_022826chr2--1230 ----
NM_022828chr51241 ------
NM_022831chr111627 ------
NM_022832chr43616 605 599 11026 1610 1893
NM_022841chr15----1380 --
NM_022843chr1321320 400 ------
NM_022845chr162707 692 --32034 255 59 --
NM_022893chr233139 2405 1137 ------
NM_022894chr21591 ------
NM_022897chr531109 883 80 ------
NM_022898chr1454281 3408 3297 1529 257 14492 ----
NM_022901chr931680 1183 1174 --195 --
NM_022910chr1631913 557 408 --11499 --
NM_022917chr931020 871 118 ------
NM_022918chr1152160 1857 1515 1472 673 11555 ----
NM_022965chr4157 --11165 --
NM_022970chr1031253 1047 1041 ------
NM_023000chr1411119 ------
NM_023001chr1411119 ------
NM_023003chr15154 ------
NM_023010chrX2331 116 ------
NM_023011chr131848 ------
NM_023012chr12--1541 ----
NM_023015chr11752 --1636 --
NM_023016chr222794 904 ------
NM_023037chr13137 1353 ----
NM_023074chr191865 ------
NM_023079chr1741919 1772 1197 190 1281 ----
NM_023105chr852102 2088 1895 545 197 --1106 --
NM_023106chr852102 2088 1895 545 197 --1106 --
NM_023110chr852102 2088 1895 545 197 --1106 --
NM_023111chr852102 2088 1895 545 197 --1106 --
NM_023927chr531135 974 92 ------
NM_023929chr832771 1836 865 12189 ----
NM_024007chr512558 ------
NM_024015chr171833 ------
NM_024046chr32421 89 11307 1517 --
NM_024052chr1762761 973 698 488 425 170 142 ----
NM_024060chr11--1281 ----
NM_024094chr81593 ------
NM_024117chr92210 121 ------
NM_024293chr21112 ------
NM_024294chr672935 2644 2496 2135 933 845 488 12305 12037 --
NM_024306chr163953 183 90 ------
NM_024344chr152543 464 ------
NM_024345chr936109 459 388 ------
NM_024424chr11----1850 --
NM_024425chr11----1850 --
NM_024426chr11----1850 --
NM_024430chr1811511 --11789 --
NM_024491chr31440 1427 ----
NM_024496chr141225 ------
NM_024513chr342859 2480 1496 316 ------
NM_024519chr16283 65 ------
NM_024522chr111682 ----11602
NM_024523chr721037 332 ------
NM_024524chr3----1736 --
NM_024529chr11986 ------
NM_024536chr22119 97 ------
NM_024551chr1262386 2304 1643 955 347 69 1288 --1887
NM_024551chr1262386 2304 1643 955 347 69 1288 --1887
NM_024554chr131207 1089 624 ------
NM_024558chr1421001 813 ------
NM_024563chr531641 724 706 ------
NM_024612chr172291 280 ------
NM_024613chr8----11782 --
NM_024617chr91810 ------
NM_024646chr131416 715 520 --1539 --
NM_024670chr101529 ------
NM_024674chr122296 933 --2494 98 --
NM_024713chr1521240 625 ------
NM_024721chr822101 1635 1469 --1155
NM_024742chr1651645 1522 1400 343 141 11759 ----
NM_024749chr111402 1641 ----
NM_024757chr93975 953 276 ------
NM_024780chr16--1372 --1759
NM_024783chr111378 ------
NM_024798chr1542324 1998 671 662 ----11127
NM_024811chr1131436 739 173 ------
NM_024828chr9------11387
NM_024837chr1521947 64 ----1657
NM_024885chrX1704 ------
NM_024887chr141603 1580 1465 149 11559 11846 --
NM_024899chr18--1145 ----
NM_024900chr43830 616 439 11525 1852 1134
NM_024900chr43830 616 439 11525 1852 1134
NM_024911chr12288 229 ------
NM_024939chr1651276 1028 377 268 88 ------
NM_024948chr102528 93 166 ----
NM_024949chr42777 237 --13055 1439
NM_024954chr102511 113 ------
NM_024989chr296908 6513 4982 2875 2744 2389 2380 774 522 ------
NM_025054chr83966 190 58 12623 ----
NM_025057chr14--1191 136 --
NM_025061chr195914 279 272 213 163 ------
NM_025074chr462789 1138 1049 705 259 64 ------
NM_025099chr172893 372 21278 171 ----
NM_025133chr21290 ------
NM_025134chr161772 1686 ----
NM_025138chr132363 85 ------
NM_025146chr352312 1711 742 673 592 11818 ----
NM_025147chr221128 265 ------
NM_025151chr831986 1807 800 ------
NM_025160chr123993 320 ------
NM_025164chr1161726 1490 830 721 698 576 --11686 --
NM_025179chr174566 4345 3514 3304 3196 977 893 33930 3150 1137 ----
NM_025187chr162495 205 ------
NM_025191chr132954 1308 136 ------
NM_025195chr8142 11682 11811 --
NM_025201chr1531957 1703 157 12095 ----
NM_025244chr2--1101 ----
NM_025248chr1772765 2667 2485 783 725 291 280 11085 22368 1236 --
NM_025250chr762279 1927 1919 1031 725 439 12981 2856 430 --
NM_030594chr1531368 520 95 182 144 --
NM_030621chr14----1598 --
NM_030625chr1022597 497 ------
NM_030627chr513511 --189 --
NM_030640chr121644 1822 ----
NM_030647chr745778 5771 1293 1050 ----14316
NM_030648chr412096 14683 ----
NM_030650chr242762 844 592 529 23798 3346 21143 586 --
NM_030660chr141387 ------
NM_030661chr721603 516 11102 ----
NM_030664chr1021873 1670 ------
NM_030674chr1243967 1563 1368 595 2771 665 35214 1682 629 --
NM_030751chr1021314 354 ------
NM_030751chr1021314 354 ------
NM_030758chr221293 1487 ----
NM_030759chr101220 --1766 --
NM_030763chrX--1881 ----
NM_030766chr121286 ------
NM_030786chr121269 178 1115 ----
NM_030791chr14------11594
NM_030798chr7256 46 ------
NM_030802chr171353 --1645 --
NM_030803chr231265 1101 77 ------
NM_030806chr1168883 8838 8237 7994 7322 6573 6424 5793 5754 3236 2970 2835 2754 2616 1176 487 29202 6735 23567 2913 --
NM_030808chr171820 --1119 --
NM_030816chr112380 ------
NM_030817chr1252569 2560 2317 1361 927 ------
NM_030881chr2222328 2126 ------
NM_030906chr111221 ------
NM_030912chr102606 220 ------
NM_030927chr1041165 1129 367 159 ------
NM_030939chr62890 354 ------
NM_030948chr61204 --169 --
NM_030949chr621078 965 11452 ----
NM_030958chr81376 ------
NM_030964chr533290 2833 1116 32852 2605 2322 ----
NM_031157chr12----1588 --
NM_031203chr19177 ------
NM_031216chr1821700 1460 ------
NM_031243chr741898 1707 1626 620 ------
NM_031262chr931118 819 360 ------
NM_031263chr931175 876 417 ------
NM_031266chr5--188 ----
NM_031268chr16125109 5099 4780 4290 4024 3990 3701 1398 1250 1005 822 391 --24086 636 24854 4814
NM_031283chr2------1127
NM_031305chr43628 377 85 137 ----
NM_031371chr131203 1126 139 31309 548 235 11287 --
NM_031371chr131203 1126 139 31309 548 235 11287 --
NM_031372chr421503 1282 11342 ----
NM_031411chr51655 ----11717
NM_031417chr1932770 2750 103 12721 32281 754 480 --
NM_031419chr331022 447 189 192 21349 1109 --
NM_031424chr202491 485 ------
NM_031433chr11----159 --
NM_031434chr73394 158 21 ------
NM_031435chr1222746 445 --1349 --
NM_031438chr5----1446 --
NM_031442chrX--22836 584 1354 --
NM_031445chr262913 2328 974 690 414 299 --1861 --
NM_031459chr12500 364 ------
NM_031461chr812231 21577 766 ----
NM_031468chr7107904 6263 6035 3099 2399 2288 1976 954 575 186 26889 1707 16358 --
NM_031469chr633327 458 49 ------
NM_031476chr1662620 2263 2254 675 597 532 --1613 --
NM_031483chr2023411 525 ------
NM_031845chr233624 2407 52 ------
NM_031847chr233624 2407 52 ------
NM_031849chr51655 ----11717
NM_031857chr51655 ----11717
NM_031860chr51655 ----11717
NM_031866chr102269 189 ------
NM_031890chr2232510 2331 2103 --22976 259 --
NM_031892chrX1625 --1205 --
NM_031935chr11100 ------
NM_031938chr112864 762 ------
NM_031966chr5146 ------
NM_031990chr1931446 939 592 134 ----
NM_031991chr1931446 939 592 134 ----
NM_032041chr832740 2010 1765 ------
NM_032047chr31740 1491 ----
NM_032088chr521498 110 ------
NM_032092chr521498 110 ------
NM_032102chr111611 ------
NM_032105chr136519 5340 3239 --17565 --
NM_032108chr193936 625 26 ------
NM_032120chr71365 --194 --
NM_032121chrX1853 22730 1740 ----
NM_032128chr41324 ------
NM_032144chr211166 ------
NM_032147chr121696 1926 ----
NM_032153chr312274 12082 ----
NM_032160chr1823822 3413 13904 23367 701 --
NM_032182chr1011444 1256 ----
NM_032192chr172577 141 ------
NM_032199chr1053480 2847 1061 200 70 32995 1495 392 11174 --
NM_032208chr223092 781 --12234 1128
NM_032217chr41290 ------
NM_032256chr121787 ------
NM_032268chr1683236 3128 2462 2423 2336 2107 1985 551 12188 12931 12234
NM_032281chr1942450 2065 885 707 ------
NM_032283chr151793 1498 544 422 29 ------
NM_032288chr331793 1610 226 ------
NM_032316chr372338 1986 1898 1854 588 186 27 1299 ----
NM_032320chr111310 ------
NM_032352chr141986 ------
NM_032353chr172479 392 ------
NM_032364chr121328 1992 ----
NM_032373chr1033979 2092 898 --1724 --
NM_032376chr173668 206 70 ------
NM_032403chr521498 110 ------
NM_032408chr7199 --11071 --
NM_032420chr52627 149 ------
NM_032430chr191284 ------
NM_032434chr211502 21604 1135 ----
NM_032438chr621032 332 --11260 --
NM_032445chr151894 11963 ----
NM_032446chr521080 268 12645 ----
NM_032449chr152413 1918 1834 466 365 ------
NM_032452chr1411234 ------
NM_032457chr421171 430 12972 12519 --
NM_032458chrX12350 31059 1020 931 ----
NM_032466chr81158 --1367 --
NM_032468chr81158 --1367 --
NM_032491chr12------1320
NM_032499chr1511642 184 ----
NM_032505chr33719 229 31 ------
NM_032523chr21490 ------
NM_032560chr14----1769 --
NM_032575chr1671746 1670 1507 1370 680 319 160 ----1773
NM_032582chr171258 169 ----
NM_032583chr16----130 --
NM_032595chr1721379 275 --11084 --
NM_032596chr9----1105 --
NM_032622chr411428 ------
NM_032632chr141342 ------
NM_032682chr342639 2604 2410 2280 ------
NM_032689chr1911074 ------
NM_032711chr1763944 3520 3189 1296 1202 625 13898 12693 --
NM_032737chr1931057 601 157 --12608 11657
NM_032777chr821427 32 --1481 --
NM_032781chr11--2864 634 ----
NM_032786chr12126 ------
NM_032801chr1132532 2086 1707 ------
NM_032804chr102525 210 ------
NM_032808chr151622 ------
NM_032833chr121800 75 ------
NM_032837chr171110 --21982 1822 --
NM_032842chr72592 583 ----11165
NM_032859chr13--1576 ----
NM_032873chr1162917 1573 633 605 565 336 ------
NM_032905chr102873 461 1813 ----
NM_032926chrX263 47 ------
NM_032940chr162227 120 1869 ----
NM_032961chr4--11200 ----
NM_032983chr753182 3021 725 678 612 --128 --
NM_032995chr241393 1235 617 507 11606 31613 636 585 --
NM_032998chr1----11033 --
NM_033012chr131794 ------
NM_033020chr124682 1002 1917 ----
NM_033025chr192750 310 ------
NM_033027chr33962 308 99 ------
NM_033036chr1131594 680 243 ------
NM_033044chr1--1201 ----
NM_033055chr1----1786 --
NM_033071chr6----133 --
NM_033102chr1188 ------
NM_033102chr1188 ------
NM_033117chr91254 ------
NM_033133chr1783296 2877 1473 1443 1412 1369 993 803 ----11032
NM_033151chr16----130 --
NM_033158chr3132 ------
NM_033161chr971702 1467 1286 743 728 229 199 11891 1756 --
NM_033181chr623075 3052 13781 --13713
NM_033182chr121894 1399 2405 39 ----
NM_033207chr1021826 32 --1920 --
NM_033211chr531984 1552 1302 ------
NM_033222chr911141 ------
NM_033224chr768013 6806 6797 6345 1028 412 13189 --22804 1285
NM_033225chr81132 --12817 --
NM_033266chr164440 380 66 38 ------
NM_033326chr1122506 642 ------
NM_033331chr953247 2659 342 290 276 ------
NM_033394chr211067 ------
NM_033425chr112177 168 ------
NM_033426chr1432649 2066 2052 21144 805 12662 --
NM_033449chr521385 725 --1804 --
NM_033495chrX--1107 ----
NM_033503chr1583483 3366 3123 2972 2527 2467 771 529 --22427 837 --
NM_033540chr321102 324 1141 ----
NM_033624chr122519 131 ------
NM_033626chrX41770 1587 572 179 ------
NM_033631chr183886 3868 2999 2919 2813 2693 1496 1240 22966 1358 1774 12686
NM_033632chr421201 125 ------
NM_033637chr1034008 3161 1456 22928 1111 13731 --
NM_033642chrX21092 944 ------
NM_033644chr522157 1772 ------
NM_033645chr522157 1772 ------
NM_052818chr1321839 1515 12151 11738 --
NM_052834chr1822344 1761 ------
NM_052845chr1242696 1144 840 252 22425 1069 12690 11171
NM_052851chr1312048 ------
NM_052876chr1921750 315 11924 1752 12680
NM_052879chr1213375 ----13388
NM_052885chr12--14726 ----
NM_052886chr81439 12121 ----
NM_052900chr811574 ------
NM_052904chr621368 1073 ------
NM_052905chr2--1505 11791 --
NM_052907chr1232732 1193 252 ------
NM_052910chr1321653 432 --11671 --
NM_052911chr181766 1112 ----
NM_052918chr1023280 2536 ------
NM_052934chr191560 1518 1443 830 783 526 387 315 41 --1817 --
NM_052961chr6------139
NM_052968chr112542 530 ------
NM_052978chr1421378 468 11545 ----
NM_053002chr31888 ------
NM_053016chr977601 6901 2818 2319 2101 467 341 --15901 --
NM_053023chr1121046 506 --1493 --
NM_053025chr311173 11118 1201 --
NM_053026chr311173 11118 1201 --
NM_053027chr311173 11118 1201 --
NM_053028chr311173 11118 1201 --
NM_053031chr311173 11118 1201 --
NM_053032chr311173 11118 1201 --
NM_053043chr745550 5113 4125 755 12298 14649 --
NM_053046chr19168 ----1374
NM_053056chr1133000 2797 914 13185 12308 --
NM_053064chr14--12912 ----
NM_054025chr1121831 274 ----12100
NM_057178chr1732253 2159 67 ----1187
NM_057749chr82157 54 ------
NM_058170chr11565 11129 ----
NM_058175chr214733 639 553 285 ------
NM_058241chr22849 277 ------
NM_058241chr22849 277 ------
NM_078625chr61380 --1280 --
NM_079834chr1921619 667 --31434 383 295 --
NM_080391chr12570 399 ------
NM_080392chr12619 448 ------
NM_080422chr181319 ------
NM_080423chr181319 ------
NM_080594chr161109 1673 ----
NM_080616chr201581 ------
NM_080617chr20--1342 ----
NM_080618chr201834 1348 ----
NM_080621chr2071386 1107 956 945 454 122 73 --1273 --
NM_080632chrX2331 116 ------
NM_080664chr142500 36 21832 1759 ----
NM_080676chr2053140 2444 2076 657 364 ----12704
NM_080679chr62676 627 ----1801
NM_080680chr62676 627 ----1801
NM_080681chr62676 627 ----1801
NM_080682chr11617 ------
NM_080683chr41420 ------
NM_080684chr41420 ------
NM_080685chr41420 ------
NM_080717chr1221268 1200 ------
NM_080732chr19168 ----1374
NM_080737chrX21213 175 135 ----
NM_080738chr131594 1429 642 --1137 --
NM_080759chr1332299 2039 745 ------
NM_080760chr1332299 2039 745 ------
NM_080872chr853901 1589 1396 426 395 13556 ----
NM_080881chr52315 103 ------
NM_130391chr91382 12555 ----
NM_130392chr91382 12555 ----
NM_130393chr91382 12555 ----
NM_130436chr2132740 2326 1770 --11715 --
NM_130438chr2153317 2903 2347 425 232 1306 12292 --
NM_130440chr131175 1146 113 ------
NM_130442chr71967 1151 1171 --
NM_130459chr921046 409 ------
NM_130795chr93674 614 240 ------
NM_130830chr332896 2587 1287 --11552 13757
NM_130838chr1511510 ------
NM_130839chr1511510 ------
NM_133170chr2097215 5141 2817 2784 2582 2308 1857 1340 496 32260 1017 334 12977 --
NM_133264chr1753345 2834 1308 1059 391 --1425 --
NM_133265chrX22308 2294 --13525 --
NM_133330chr462767 2584 2462 1209 594 322 ------
NM_133331chr462767 2584 2462 1209 594 322 ------
NM_133334chr4105578 4534 4305 4167 4086 3904 1622 1200 1079 114 12281 ----
NM_133335chr462767 2584 2462 1209 594 322 ------
NM_133372chr532810 2754 2014 1619 ----
NM_133468chr722406 610 ------
NM_133476chr121387 ------
NM_133477chr432974 2822 223 --1280 --
NM_133496chr154177 4119 3104 878 48 12843 ----
NM_133499chrX1861 ------
NM_133507chr12--2613 213 ----
NM_133638chr5--136 ----
NM_133646chr245127 4311 913 479 --1533 --
NM_133650chr6----133 --
NM_134268chr172184 29 --1282 --
NM_134269chr22129 ------
NM_134325chr13365 318 61 1568 1352 --
NM_134427chr93674 614 240 ------
NM_134447chr191484 1119 ----
NM_138270chrX1803 1751 1867 --
NM_138288chr1411429 ------
NM_138316chr102470 328 ------
NM_138317chr142467 432 ------
NM_138318chr142467 432 ------
NM_138338chr2232898 2805 2258 ------
NM_138357chr1021523 27 1691 ----
NM_138395chr21325 ------
NM_138396chr123896 667 650 --1209 --
NM_138426chr71147 ------
NM_138444chr1333659 1186 886 1811 ----
NM_138453chr51222 ------
NM_138457chr631039 736 398 ------
NM_138459chr652481 703 662 654 632 ------
NM_138468chr245093 4538 1020 367 1887 14250 --
NM_138473chr1243160 1643 1569 469 14851 ----
NM_138492chr52462 326 --1130 --
NM_138494chr722303 875 12111 ----
NM_138559chr211354 ------
NM_138569chr62293 53 ------
NM_138576chr1454281 3408 3297 1529 257 14492 ----
NM_138578chr2031361 1304 1274 --1257 --
NM_138609chr5----1199 --
NM_138610chr5----1199 --
NM_138638chr1442479 2260 1971 1575 1457 1402 --
NM_138713chr1666876 6575 2022 1442 1332 488 26479 2937 2837 256 17346
NM_138714chr1666876 6575 2022 1442 1332 488 26479 2937 2837 256 17346
NM_138727chr141669 1530 914 838 11829 22139 2093 --
NM_138728chr141669 1530 914 838 11829 22139 2093 --
NM_138730chr6----1137 --
NM_138731chr1413755 --14163 --
NM_138735chr21546 ------
NM_138766chr51154 ------
NM_138771chr7176 ------
NM_138775chr112595 54 ------
NM_138782chr512203 ------
NM_138795chr121082 606 --31101 630 523 --
NM_138799chr211827 ------
NM_138819chrX--133 ----
NM_138821chr51154 ------
NM_138822chr51154 ------
NM_138927chr21--2897 234 ----
NM_138959chr1135574 5562 4775 4725 2671 2457 2101 1356 1148 956 654 284 117 --22502 731 11061
NM_138966chr181204 ------
NM_138967chr1532046 1953 199 --22436 1647 --
NM_138970chr1431894 894 832 --11606 --
NM_138971chr1153610 1481 439 408 363 --1226 1162
NM_138971chr1153610 1481 439 408 363 --1226 1162
NM_138972chr1153610 1481 439 408 363 --1226 1162
NM_138972chr1153610 1481 439 408 363 --1226 1162
NM_138973chr1153610 1481 439 408 363 --1226 1162
NM_138973chr1153610 1481 439 408 363 --1226 1162
NM_138983chr2121281 353 ------
NM_139012chr631733 1454 280 ------
NM_139015chr123135 85 79 11445 21490 634 --
NM_139057chr1542842 1063 280 191 12026 11114 --
NM_139067chr121266 ------
NM_139068chr5173 ------
NM_139069chr5173 ------
NM_139126chr61751 ------
NM_139131chr11--1102 ----
NM_139132chr114977 278 99 75 ------
NM_139156chr13800 329 241 ------
NM_139157chr11----1479 --
NM_139168chr511842 ----11848
NM_139177chr17156 ------
NM_139244chr61871 ------
NM_139273chr111223 ------
NM_139283chr1231730 933 689 12139 173 --
NM_139312chr102487 29 ------
NM_139321chr2073827 3314 2833 2677 1609 1553 640 1896 ----
NM_139323chr2041843 1344 473 318 --1164 --
NM_144488chr93674 614 240 ------
NM_144489chr93674 614 240 ------
NM_144499chr331028 770 42 11182 ----
NM_144563chr2------1336
NM_144563chr2------1336
NM_144571chr476192 5193 2792 1311 645 634 172 --14891 --
NM_144578chr1441384 1373 1000 82 1359 15349 --
NM_144579chr2112811 2713 2696 2532 2025 1822 1808 914 811 640 449 --22051 515 1468
NM_144586chr221154 487 --1276 --
NM_144595chr13166 ------
NM_144610chr17128 ------
NM_144631chr2166 ------
NM_144633chr32508 403 11376 ----
NM_144635chr331169 1077 479 ------
NM_144641chr331060 301 45 --139 --
NM_144657chrX2583 86 ------
NM_144660chr101397 ------
NM_144703chr204832 447 441 425 --1387 --
NM_144767chr1573927 2970 1532 1339 1133 1058 243 11185 ----
NM_144778chr13--12623 ----
NM_144963chr8--12303 11787 --
NM_144967chrX11060 1891 --1200
NM_145055chr1843566 925 469 420 12993 ----
NM_145071chr35894 834 382 127 121 ------
NM_145112chr1431191 1009 271 ------
NM_145113chr1431463 1281 543 ------
NM_145159chr141655 --1633 --
NM_145166chr3102257 2055 2012 1929 1913 1074 828 493 398 189 --2879 174 22733 2156
NM_145173chr1962461 2260 2214 1783 1776 1607 --12171 1297
NM_145176chr61260 ------
NM_145259chr255923 5076 4919 4883 721 ------
NM_145261chr32776 621 1349 ----
NM_145274chr171761 1360 ----
NM_145279chr151745 1596 474 303 239 --159 --
NM_145307chr1024017 854 11532 11840 --
NM_145313chr103655 531 162 ------
NM_145320chr723204 510 11109 12666 --
NM_145321chr723204 510 11109 12666 --
NM_145322chr723204 510 11109 12666 --
NM_145341chr101413 ------
NM_145349chr1731547 1533 153 ------
NM_145350chr17----2603 338 --
NM_145686chr232524 396 232 ------
NM_145687chr232524 396 232 ------
NM_145690chr831295 361 264 ------
NM_145695chr71593 1174 ----
NM_145716chr1196 ------
NM_145733chr2211025 ------
NM_145739chr21490 ------
NM_145798chr171145 ------
NM_145799chrX23093 212 ----12563
NM_145808chr752861 2381 2312 2022 496 --1799 --
NM_145861chr131594 1429 642 --1137 --
NM_145891chr161230 ------
NM_145892chr161230 ------
NM_145893chr161352 ------
NM_146388chr193966 918 495 ------
NM_147150chr932527 1399 396 ------
NM_147156chr1011472 ------
NM_147161chr131065 413 138 ------
NM_147164chr91187 ------
NM_147168chr9----1105 --
NM_147204chr122420 331 ------
NM_147223chr22722 66 ------
NM_147233chr21539 ------
NM_148174chr811495 1111 ----
NM_148571chr1731883 1475 243 --1485 --
NM_148894chr4--1344 ----
NM_148921chr1742395 2232 1984 236 --1749 --
NM_148977chr102470 328 ------
NM_148978chr102470 328 ------
NM_152227chr201470 ------
NM_152233chr1421466 1398 1466 11083 11504
NM_152253chr2263683 3370 1332 1242 1076 101 23307 1562 33263 2786 1308 --
NM_152261chr1232420 2122 777 1217 --1494
NM_152263chr195469 5440 4789 3861 2347 2338 1868 1517 102 ------
NM_152264chr111974 ------
NM_152265chr1--11221 124 --
NM_152271chr8189 ------
NM_152272chr82891 293 31374 1136 468 ----
NM_152275chr2177 ------
NM_152278chrX--1608 ----
NM_152284chr8--1948 ----
NM_152343chr17133 ------
NM_152344chr1731288 107 50 ------
NM_152350chr172455 124 1202 127 --
NM_152380chr111087 133 ----
NM_152385chr2153 ------
NM_152388chr212943 23628 1299 11309 11236
NM_152407chr5--22412 1035 ----
NM_152409chr543331 2280 1356 507 ------
NM_152424chrX74277 3761 1844 1813 1389 732 623 --23613 1882 --
NM_152442chr1211108 11261 ----
NM_152447chr141266 ------
NM_152470chr1834110 2582 980 13190 1243 12537
NM_152487chr12303 68 11445 11334 --
NM_152493chr121458 37 ------
NM_152520chr21427 ------
NM_152523chr2--1550 ----
NM_152538chr311279 ------
NM_152545chr44624 617 75 60 ------
NM_152549chr52470 207 ------
NM_152553chr6171 140 ----
NM_152556chr712395 --22187 1961 --
NM_152594chr1532115 298 102 2736 79 ----
NM_152608chr1--22017 410 ----
NM_152622chr522742 788 ----22259 1085
NM_152624chr545709 5543 5044 1801 11766 16673 --
NM_152641chr1262141 2061 1963 919 436 291 --12759 --
NM_152665chr11971 --1841 --
NM_152678chr311703 --1316 --
NM_152682chr431141 711 81 --1500 --
NM_152688chr61172 ------
NM_152692chrX1125 ------
NM_152695chrX--1529 ----
NM_152699chr363680 2894 2643 2632 2309 2300 ------
NM_152707chr102237 121 ------
NM_152724chr10123 11771 1793 --
NM_152737chr61433 ----11396
NM_152739chr71176 ------
NM_152749chr73970 238 55 ------
NM_152756chr522649 136 --1494 --
NM_152765chr852282 2086 545 104 31 ------
NM_152773chr3------123
NM_152787chrX53096 2676 2612 2485 1122 22735 722 ----
NM_152789chr721133 600 --11451 --
NM_152832chr112385 176 --1181 --
NM_152835chr152703 1071 523 245 164 21114 672 --1371
NM_152838chr2063496 3403 1108 1061 392 233 ------
NM_152862chr2--1318 --132
NM_152874chr103653 434 203 ------
NM_152890chr1135 ------
NM_152902chr121491 800 ------
NM_152903chr1322912 2294 11821 ----
NM_152924chr1532201 1948 1859 15145 26512 2337 --
NM_153029chr1664026 3620 3562 3214 1345 38 ------
NM_153040chr15----1137 --
NM_153042chr611825 21473 659 ----
NM_153181chr181204 ------
NM_153183chrX21258 211 ------
NM_153188chr521829 1713 14469 24997 1324 --
NM_153207chr12--1270 --12671
NM_153228chr17--198 ----
NM_153260chr15--21420 329 1465 --
NM_153262chr142961 2860 2844 2285 ------
NM_153273chr352402 1978 1819 379 278 --2656 641 --
NM_153338chr173779 729 22 --11001 --
NM_153342chr2121 ------
NM_153350chr16------11199
NM_153354chr51247 ------
NM_153367chr1031172 1026 589 --11391 --
NM_153371chr13----1108 --
NM_153453chr61701 ------
NM_153456chr1355826 5629 5329 4706 505 12527 ----
NM_153464chr192575 226 ------
NM_153499chr1252844 2043 1929 618 308 1871 ----
NM_153500chr1252844 2043 1929 618 308 1871 ----
NM_153607chr532757 2715 215 22307 633 ----
NM_153616chr1521610 217 1142 ----
NM_153617chr1521610 217 1142 ----
NM_153618chr1521610 217 1142 ----
NM_153619chr1532848 1455 322 11380 ----
NM_153620chr7----11587 --
NM_153631chr721603 516 11102 ----
NM_153632chr721603 516 11102 ----
NM_153649chr132087 1607 1598 ------
NM_153693chr12190 ------
NM_153715chr75400 346 197 155 44 1856 ----
NM_153756chr131658 602 163 --11269 --
NM_153810chr1065146 4488 3707 1998 876 387 11722 ----
NM_153813chr161158 ------
NM_153819chr111149 ------
NM_153825chr411580 --11363 --
NM_153828chr2--1322 ----
NM_153836chr22524 281 1719 ----
NM_170606chr721515 451 11359 --11805
NM_170607chr1731032 443 114 ------
NM_170665chr1273687 2779 1507 1073 1067 341 107 ----14569
NM_170674chr151294 ------
NM_170677chr151294 ------
NM_170706chr123163 2670 --14176 --
NM_170707chr1--1896 1838 --
NM_170708chr1--1896 1838 --
NM_170709chr822219 729 ------
NM_170719chr132363 85 ------
NM_170731chr1112799 ------
NM_170732chr1112799 ------
NM_170733chr1112799 ------
NM_170734chr1112799 ------
NM_170735chr1112799 ------
NM_170750chrX140 ------
NM_170751chr62991 478 ------
NM_170752chr62991 478 ------
NM_171825chr563020 2291 1972 1947 342 71 ------
NM_171998chrX42164 2154 1905 777 ------
NM_172020chr72709 55 ------
NM_172069chr232163 912 82 21922 339 ----
NM_172071chr136109 5765 1690 16984 ----
NM_172103chr662623 2461 2348 2206 2073 1737 2625 312 1252 --
NM_172105chr662623 2461 2348 2206 2073 1737 2625 312 1252 --
NM_172127chr4------1268
NM_172128chr41831 ----1224
NM_172169chr1031719 1589 343 ----1309
NM_172170chr1031719 1589 343 ----1309
NM_172171chr1031719 1589 343 ----1309
NM_172173chr1031719 1589 343 ----1309
NM_172226chr1252844 2043 1929 618 308 1871 ----
NM_172315chr151294 ------
NM_172316chr151294 ------
NM_172337chr141992 ------
NM_173060chr5251 26 187 ----
NM_173061chr5251 26 187 ----
NM_173063chr5251 26 187 ----
NM_173065chr153123 3114 2789 1210 223 ------
NM_173074chr2181 ------
NM_173076chr231044 796 250 ------
NM_173078chrX1354 ------
NM_173087chr152543 464 ------
NM_173088chr152543 464 ------
NM_173089chr152543 464 ------
NM_173090chr152543 464 ------
NM_173165chr16--1167 ----
NM_173177chr22644 554 ------
NM_173214chr1666876 6575 2022 1442 1332 488 26479 2937 2837 256 17346
NM_173354chr2131585 1541 21 ------
NM_173359chr31101 ------
NM_173460chr201171 ------
NM_173468chr443679 2258 1766 390 ------
NM_173469chr1521482 1303 11529 ----
NM_173470chrX--22317 1913 ----
NM_173475chr1621588 1109 11088 ----
NM_173476chr1661919 1831 1505 543 510 219 --12154 --
NM_173489chr5124 ------
NM_173495chrX41855 888 839 171 --2970 363 --
NM_173508chr12903 131 ------
NM_173511chr223441 1177 ------
NM_173515chr61200 ------
NM_173547chr1731167 98 26 ------
NM_173552chr31750 ------
NM_173576chr1021898 1835 ------
NM_173587chr114223 171 102 48 ------
NM_173595chr1295037 4731 4592 4430 2082 1787 691 473 175 --13494 --
NM_173624chr17175 ------
NM_173642chr1118642 8597 7093 6777 6472 6331 3232 2995 2450 2396 2312 27439 7056 48798 8775 6102 6052 1618
NM_173647chr2--1360 ----
NM_173666chr531215 1146 937 ------
NM_173681chr752018 1587 773 457 115 ------
NM_173683chr811309 ------
NM_173698chrX21534 1425 ----1122
NM_173794chrX--1166 ----
NM_173808chr1167 14006 ----
NM_173825chr322724 2391 1680 ----
NM_173829chr545123 5096 1497 803 1153 22191 1847 16040
NM_174911chr883046 2892 1159 953 703 552 409 288 ------
NM_174934chr1162589 1325 1207 875 646 270 12195 23260 860 --
NM_174953chr17--11158 1307 --
NM_174957chr17--11158 1307 --
NM_175061chr7----1352 --
NM_175630chr21321 1247 ----
NM_175709chr2252687 886 461 377 308 13065 12064 --
NM_175733chr1122140 873 11901 ----
NM_175747chr62945 374 ------
NM_175748chr1442081 1607 1592 719 ------
NM_175767chr5--1340 11604 1150
NM_175847chr1931446 939 592 134 ----
NM_175852chr153000 1197 609 533 126 --31960 327 119 --
NM_175854chr1321017 866 ------
NM_175856chr5------1767
NM_175857chr211331 ------
NM_175866chr11171 --1439 --
NM_175873chr51298 ------
NM_175895chr1231051 803 231 21093 891 ----
NM_175898chr1541546 1446 1382 495 --11058 --
NM_175907chr1811093 11919 ----
NM_175913chr2051002 899 882 394 67 --1820 --
NM_176792chr102934 548 ----1940
NM_176814chr7--1423 ----
NM_176871chr8103318 3297 3084 2905 2760 2033 716 688 505 105 13005 23073 884 --
NM_176895chr5130 ------
NM_177405chr2241552 1543 535 140 --1545 --
NM_177414chr11307 ------
NM_177424chr13585 513 396 ------
NM_177438chr14----1598 --
NM_177549chr20--1385 1434 --
NM_177925chr1222669 27 ------
NM_177951chr142743 271 ------
NM_177969chr21460 ------
NM_177972chr1144425 3095 1212 651 ------
NM_177985chr232288 2003 572 12306 ----
NM_177990chr2012033 1359 ----
NM_177996chr2072290 2284 2154 1286 1107 233 22 11218 1222 1989
NM_178006chr1312048 ------
NM_178007chr1312048 ------
NM_178011chr101348 ------
NM_178013chr1441182 1164 910 25 1321 ----
NM_178126chr172649 640 ----12159
NM_178140chr532598 1751 96 11784 ----
NM_178151chrX67578 6234 5124 3103 2480 409 16480 --12235
NM_178152chrX67578 6234 5124 3103 2480 409 16480 --12235
NM_178153chrX67578 6234 5124 3103 2480 409 16480 --12235
NM_178190chr1164 ------
NM_178191chr121405 521 ------
NM_178313chr2----22179 760 --
NM_178424chr51616 ------
NM_178426chr111928 --11947 --
NM_178427chr111828 --11847 1911
NM_178496chr331312 1113 479 ------
NM_178509chr171788 --1508 --
NM_178517chr17--180 ----
NM_178539chr122480 273 ----1609
NM_178554chr343618 1375 1254 926 13442 ----
NM_178566chr911519 ----142
NM_178585chr422386 2380 ------
NM_178586chr1422265 1507 22083 1544 2561 194 --
NM_178812chr811173 ------
NM_178815chr1022246 2018 ------
NM_178830chr192260 192 ------
NM_178860chr173929 883 375 ------
NM_178863chr16193 ------
NM_180989chr13----11006 --
NM_181093chr12341 174 ------
NM_181291chr141538 ------
NM_181349chr732044 1132 962 --184 --
NM_181351chr1121141 395 ------
NM_181356chr62864 117 ------
NM_181442chr203761 234 85 ------
NM_181443chr2012202 11917 22560 2300 --
NM_181486chr1221268 1200 ------
NM_181492chr22----1937 --
NM_181504chr543640 3456 3392 3285 11227 ----
NM_181505chr172577 141 ------
NM_181523chr543640 3456 3392 3285 11227 ----
NM_181524chr543640 3456 3392 3285 11227 ----
NM_181571chr101930 ----170
NM_181672chrX21870 520 ------
NM_181673chrX21870 520 ------
NM_181689chr20--1128 ----
NM_181701chr931966 1859 219 --11592 --
NM_181704chr2121136 1094 ----1304
NM_181706chr1171949 1710 966 957 835 826 469 --12135 --
NM_181762chrX2400 27 ------
NM_181777chrX2400 27 ------
NM_181782chr622014 65 ------
NM_181784chr21131 ------
NM_181828chr2263242 3040 2579 660 515 155 --23641 654 --
NM_181829chr2263242 3040 2579 660 515 155 --23641 654 --
NM_181830chr2263242 3040 2579 660 515 155 --23641 654 --
NM_181843chr112237 82 --1230 --
NM_181844chr172700 193 11283 21489 462 --
NM_181847chr1211724 ------
NM_181897chr31338 22389 643 1343 1633
NM_182484chr2121136 1094 ----1304
NM_182485chr4--13667 ----
NM_182501chr242421 2322 752 670 11286 1619 --
NM_182509chr14----11246 --
NM_182511chr1811295 11212 ----
NM_182515chr1946443 4432 1926 1917 22010 437 ----
NM_182526chr1482558 2541 2220 1257 855 528 414 65 12291 ----
NM_182557chr1131698 605 549 --1163 --
NM_182580chr152245 1989 836 276 115 ------
NM_182620chr1731687 545 104 1837 ----
NM_182641chr171359 ------
NM_182643chr83709 520 479 ------
NM_182645chr61701 ------
NM_182646chr4--13667 ----
NM_182648chr141498 ------
NM_182663chr131515 607 96 --12178 --
NM_182664chr131645 737 226 --12308 --
NM_182665chr131515 607 96 --12178 --
NM_182688chr21----190 --
NM_182691chr72325 100 1446 ----
NM_182692chr72325 100 1446 ----
NM_182697chr711111 ------
NM_182700chr72627 398 --11663 --
NM_182717chr1011335 ----1475
NM_182718chr101930 ----170
NM_182719chr101930 ----170
NM_182720chr1011335 ----1475
NM_182721chr1011335 ----1475
NM_182722chr1011335 ----1475
NM_182723chr1011335 ----1475
NM_182724chr101930 ----170
NM_182725chr101930 ----170
NM_182728chr1411597 --21725 1301 --
NM_182763chr111777 ------
NM_182765chr1021839 754 ------
NM_182769chr101930 ----170
NM_182770chr101930 ----170
NM_182771chr101930 ----170
NM_182772chr101930 ----170
NM_182776chr7145 ------
NM_182796chr5----1783 --
NM_182830chr142365 44 --1459 --
NM_182847chr23515 473 203 ------
NM_182850chr101930 ----170
NM_182853chr1011335 ----1475
NM_182898chr731814 1552 246 ------
NM_182899chr731814 1552 246 ------
NM_182904chr11123 ------
NM_182911chr2--1101 ----
NM_182920chr331342 1046 461 ------
NM_182943chr321025 50 ------
NM_182961chr6----133 --
NM_182972chr122301 425 1309 ----
NM_182975chr11176 ------
NM_182978chr182705 541 ------
NM_183004chr1442649 1584 1392 533 1541 ----
NM_183006chr2041374 1007 990 256 --11398 --
NM_183011chr1011335 ----1475
NM_183012chr1011335 ----1475
NM_183013chr1011335 ----1475
NM_183049chr41289 ------
NM_183060chr101930 ----170
NM_183227chr62551 490 ------
NM_183353chrX21155 1113 ------
NM_183373chr6168 ------
NM_183377chr172868 824 ------
NM_183380chr61903 ------
NM_183381chr31155 ------
NM_183383chr31155 ------
NM_183384chr31155 ------
NM_183398chr511137 ------
NM_183399chr511137 ------
NM_183400chr511137 ------
NM_183401chr511137 ------
NM_183416chr121937 707 1150 ----
NM_183419chr821149 53 ------
NM_183422chr133917 829 256 ------
NM_184234chr201653 ------
NM_194248chr22979 937 --1120 --
NM_194259chr161380 146 ----
NM_194260chr161380 146 ----
NM_194261chr161380 146 ----
NM_194272chr152917 364 2284 37 ----
NM_194278chr1473461 2825 535 477 177 116 41 13652 33138 2880 1112 --
NM_194282chr423073 851 12854 ----
NM_194286chr1264940 3916 2361 1197 1043 977 --1877 --
NM_194301chr14--11070 ----
NM_194313chr921481 113 ------
NM_194314chr144080 4028 3952 187 11914 ----
NM_194322chr22979 937 --1120 --
NM_194328chr922739 2046 12364 ----
NM_194329chr922739 2046 12364 ----
NM_194330chr922739 2046 12364 ----
NM_194332chr922739 2046 12364 ----
NM_194442chr131570 572 365 21749 1657 ----
NM_197941chr512656 ------
NM_197968chr131633 ------
NM_198056chr352037 1968 1603 817 183 11491 ----
NM_198057chrX1120 1298 ----
NM_198081chr632534 2038 259 --1920 --
NM_198097chr71202 ------
NM_198098chr721139 100 ------
NM_198120chr81516 ------
NM_198123chr811574 ------
NM_198124chr811574 ------
NM_198181chr1582808 2307 1900 1121 993 673 419 296 ------
NM_198182chr221426 1372 165 ----
NM_198204chr1731032 443 114 ------
NM_198205chr1731032 443 114 ------
NM_198225chr1021949 1588 ----1641
NM_198240chr1221318 950 ------
NM_198261chr12--1541 ----
NM_198262chr12--1541 ----
NM_198264chr1150 --191 --
NM_198270chrX13235 126 ----
NM_198273chr512618 ------
NM_198275chr11293 62 ------
NM_198324chr121206 1531 ----
NM_198334chr111847 ------
NM_198335chr111847 ------
NM_198391chr2011542 ------
NM_198395chr511047 1831 ----
NM_198402chr31274 ------
NM_198404chr131814 ------
NM_198485chr321826 1736 11764 ----
NM_198503chr11174 --167 --
NM_198504chr3----1193 --
NM_198513chr81197 ------
NM_198560chr372724 1505 1471 1400 1363 1336 742 12683 ----
NM_198563chr33509 204 47 ------
NM_198576chr12107 91 ------
NM_198581chr277096 6998 6676 6613 5678 5669 5341 27439 549 11022 11266
NM_198597chr101646 1312 ----
NM_198679chr941770 646 624 122 ------
NM_198686chr1432481 138 77 --171 --
NM_198718chr1------1302
NM_198793chr312766 ------
NM_198830chr17----176 --
NM_198859chr324663 180 12024 ----
NM_198880chr32595 253 ------
NM_198889chr41290 ------
NM_198902chr152606 75 ------
NM_198904chr5--22027 133 --11929
NM_198935chr201176 12008 165 1932
NM_198947chr11--2100 46 ----
NM_198956chr72627 398 --11663 --
NM_198963chr21100 ------
NM_198968chr1312903 ------
NM_199050chr2143393 1247 1131 502 --13525 --
NM_199076chr10--1786 1201 --
NM_199129chr2031165 263 86 --1336 --
NM_199131chr1053498 3354 3071 1139 21 ------
NM_199169chr2043420 2240 1153 1077 ------
NM_199170chr2043420 2240 1153 1077 ------
NM_199171chr2043420 2240 1153 1077 ------
NM_199188chr1213375 ----13388
NM_199189chr51749 ------
NM_199190chr1213375 ----13388
NM_199245chr1222273 813 1312 1633 --
NM_199262chr1752138 1968 549 381 303 --1308 1704
NM_199324chr422712 188 12813 12726 --
NM_199334chr17134 ------
NM_199440chr21114 ------
NM_199454chr153491 3245 2986 1479 328 --14330 --
NM_199461chr1023268 868 1437 1547 --
NM_199478chrX1216 ------
NM_199487chr202453 34 ------
NM_199511chr33733 676 293 ------
NM_199512chr33733 676 293 ------
NM_201266chr242555 2110 2093 1872 ----12263
NM_201279chr242555 2110 2093 1872 ----12263
NM_201280chr62563 149 ------
NM_201378chr82202 188 --1944 --
NM_201379chr82202 188 --1944 --
NM_201380chr82202 188 --1944 --
NM_201381chr82202 188 --1944 --
NM_201382chr82202 188 --1944 --
NM_201383chr82202 188 --1944 --
NM_201384chr82202 188 --1944 --
NM_201403chr151745 1596 474 303 239 --159 --
NM_201413chr211749 ------
NM_201414chr211749 ------
NM_201432chr1785230 4790 4284 2314 2082 1767 363 126 14195 ----
NM_201433chr1785230 4790 4284 2314 2082 1767 363 126 14195 ----
NM_201434chr171500 ------
NM_201436chr72859 728 ------
NM_201437chr821387 398 1267 ----
NM_201516chr72915 784 ------
NM_201517chr72859 728 ------
NM_201521chr62318 291 ------
NM_201522chr62318 291 ------
NM_201523chr62318 291 ------
NM_201535chr142714 562 ------
NM_201536chr142714 562 ------
NM_201537chr142714 562 ------
NM_201538chr142714 562 ------
NM_201539chr142714 562 ------
NM_201540chr142714 562 ------
NM_201541chr142714 562 ------
NM_201559chr643755 3221 2995 858 14398 ----
NM_201570chr1021772 210 ------
NM_201571chr1021772 210 ------
NM_201572chr1021772 210 ------
NM_201590chr1021772 210 ------
NM_201591chr411806 ------
NM_201592chr411806 ------
NM_201593chr1021772 210 ------
NM_201596chr1021772 210 ------
NM_201597chr1021772 210 ------
NM_201599chrX2335 220 11062 ----
NM_201624chr11424 ------
NM_201995chr112246 34 ------
NM_201998chr112311 99 ------
NM_201999chr43928 859 811 ------
NM_203301chr1431586 393 270 ------
NM_203327chr2071701 1652 1582 783 768 336 235 11801 --13574
NM_203329chr1165798 5413 4276 816 782 533 36407 4567 2254 15642 --
NM_203330chr1165798 5413 4276 816 782 533 36407 4567 2254 15642 --
NM_203331chr1165798 5413 4276 816 782 533 36407 4567 2254 15642 --
NM_203341chr1--1737 --1248
NM_203342chr163518 3398 3093 2946 2833 2686 42579 2450 2430 1283 ----
NM_203343chr163518 3398 3093 2946 2833 2686 42579 2450 2430 1283 ----
NM_203344chr191435 ------
NM_203349chr151640 ------
NM_203351chr1762223 2102 1928 1632 540 323 ------
NM_203394chr1212411 ------
NM_203399chr1----1543 --
NM_203401chr1----1543 --
NM_203404chr13800 329 241 ------
NM_203417chr213399 307 71 11254 ----
NM_203418chr213399 307 71 11254 ----
NM_203446chr211849 12727 ----
NM_203458chr132670 1324 718 1812 ----
NM_203459chr112599 --1852 --
NM_203504chr432183 788 27 1876 --1931
NM_203505chr432183 788 27 1876 --1931
NM_203506chr1722090 1894 --1368 --
NM_205842chr2----1655 --
NM_205846chr52462 326 --1130 --
NM_205848chr142552 1928 1863 744 --1632 1369
NM_205852chr122872 428 ------
NM_205861chr141603 1580 1465 149 11559 11846 --
NM_206594chr122574 960 ------
NM_206595chr122574 960 ------
NM_206853chr634017 2967 2941 ------
NM_206854chr645278 4228 4202 912 1877 ----
NM_206855chr656243 5193 5167 1877 526 11842 ----
NM_206862chr10--1486 ----
NM_206876chr221067 865 22309 883 --12773
NM_206907chr523127 706 --1109 --
NM_206909chr867755 7390 6627 5858 2974 28 26771 67 17927 --
NM_206914chr1232067 579 303 ------
NM_206943chr21332 ------
NM_206967chr16124 ------
NM_207012chr102562 269 ----12749
NM_207032chr2021529 631 2996 371 11323 --
NM_207042chr1168 ------
NM_207043chr11358 ------
NM_207044chr11358 ------
NM_207045chr1168 ------
NM_207046chr1168 ------
NM_207047chr11358 ------
NM_207111chr782712 2506 2234 2136 2123 728 123 79 --11818 --
NM_207116chr782712 2506 2234 2136 2123 728 123 79 --11818 --
NM_207121chr202491 485 ------
NM_207171chr11215 ------
NM_207292chr323177 2120 ------
NM_207293chr323177 2120 ------
NM_207294chr323177 2120 ------
NM_207295chr323177 2120 ------
NM_207296chr323177 2120 ------
NM_207297chr323202 2145 ------
NM_207299chr921012 683 ------
NM_207304chr13--12510 ----
NM_207317chr5--1385 ----
NM_207334chr12809 687 ------
NM_207371chr1021515 1080 ------
NM_207380chr1573178 2969 2954 2739 1202 268 256 --23165 556 --
NM_207396chr13607 303 294 ------
NM_207406chr444383 2115 898 31 24424 1183 ----
NM_207445chr152529 133 ------
NM_207520chr2--1322 ----
NM_207521chr2--1322 ----
NM_207577chr1161906 1791 796 683 259 242 22568 2371 ----
NM_212465chr152543 464 ------
NM_212471chr1722089 102 ------
NM_212472chr1722089 102 ------
NM_212535chr16----199 --
NM_212554chr10--21438 1264 ----
NM_212558chr953697 2850 880 137 111 13128 --13648
NM_213589chr254523 4443 4105 534 95 ------
NM_213594chr12------1320
NM_213609chr33925 806 388 1189 ----
NM_213618chr11----1479 --
NM_213654chr32496 161 11574 ----
NM_213662chr1741915 1759 1684 539 11845 ----