TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1203
miRNA Sequence: CCCGGAGCCAGGAUGCAGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr161169 ------
NM_000037chr842466 1713 1570 140 --32305 2283 1953 --
NM_000052chrX33322 808 176 ------
NM_000055chr31317 ------
NM_000068chr192452 260 ------
NM_000084chrX56712 4932 4425 1745 1367 1163 16247 --
NM_000092chr254479 3663 3313 2958 151 12827 11840 --
NM_000103chr15--127 ----
NM_000109chrX------12323
NM_000110chr11788 ------
NM_000125chr663660 1633 699 691 684 98 ------
NM_000129chr6----11282 --
NM_000142chr411250 1591 1361 --
NM_000208chr1941586 1327 1035 54 170 ----
NM_000214chr2011628 ------
NM_000216chrX23242 56 ------
NM_000244chr113667 187 42 ------
NM_000248chr31658 ------
NM_000259chr1555715 4439 4145 3909 1703 12533 ----
NM_000264chr943173 2050 711 306 --11329 --
NM_000266chrX2210 176 1755 ----
NM_000278chr1031544 593 469 --142 --
NM_000281chr10130 ------
NM_000288chr61263 ------
NM_000304chr172175 29 ------
NM_000314chr1013137 1551 ----
NM_000340chr31270 ------
NM_000411chr2142733 2561 2021 820 --1184 --
NM_000430chr1721299 79 140 ----
NM_000445chr82820 25 ------
NM_000448chr112201 49 ------
NM_000450chr131613 567 89 ----11299
NM_000461chr343278 1635 218 197 ------
NM_000474chr7--192 ----
NM_000484chr211744 ------
NM_000503chr8136 ------
NM_000555chrX27826 180 1449 ----
NM_000572chr11961 --173 --
NM_000598chr711529 ------
NM_000599chr243973 3760 3140 2792 23125 1348 23666 1558 --
NM_000602chr711236 ------
NM_000609chr1052775 2573 2391 2316 46 ------
NM_000612chr1143797 3420 3156 2963 ------
NM_000615chr1132890 2370 2039 ------
NM_000618chr12155 ------
NM_000618chr12155 ------
NM_000621chr131936 ------
NM_000633chr1844237 3299 846 327 1873 13477 --
NM_000678chr202252 126 ------
NM_000684chr1021279 26 ------
NM_000794chr5----159 --
NM_000809chr418051 19242 --11554
NM_000813chr515486 ------
NM_000814chr1523731 562 ------
NM_000818chr101188 ------
NM_000826chr412016 12593 ----
NM_000831chr196074 5842 5784 5772 4157 3880 1823 527 430 25673 4306 25954 1980 --
NM_000838chr632739 704 240 ------
NM_000868chrX1467 ------
NM_000875chr1576670 5968 4667 4574 4472 2772 1526 26955 5382 ----
NM_000876chr621286 523 ------
NM_000891chr171639 12984 23550 3543 --
NM_000899chr12--13229 ----
NM_000908chr5--1608 ----
NM_000912chr822718 34 ------
NM_000914chr62155 142 ------
NM_000922chr111150 ------
NM_000941chr74346 245 132 35 1236 ----
NM_000942chr15165 ------
NM_000944chr4----1123 --
NM_000945chr221778 1525 11710 ----
NM_000964chr1711299 ------
NM_000965chr321211 352 ------
NM_000966chr12196 ------
NM_001001132chr2111476 ------
NM_001001323chr1212162 ------
NM_001001331chr351815 1045 939 168 60 ------
NM_001001502chr51118 ------
NM_001001522chr111122 ------
NM_001001549chr712481 ------
NM_001001550chr712481 ------
NM_001001555chr712481 ------
NM_001001557chr82695 522 ------
NM_001001852chr222775 188 --1208 --
NM_001001974chr1012063 ------
NM_001001994chrX133 1565 ----
NM_001001995chrX265 41 ------
NM_001001996chrX133 1565 ----
NM_001002814chr833429 2804 100 --1933 23135 2827
NM_001002860chr14--1863 --14177
NM_001002909chr1732101 1828 379 ------
NM_001003407chr10105015 2012 1690 1626 1452 1144 976 563 505 216 ------
NM_001003408chr10105015 2012 1690 1626 1452 1144 976 563 505 216 ------
NM_001003652chr1847541 5711 5465 1403 18309 18023 --
NM_001003681chr2221466 90 ------
NM_001003682chr13448 123 24 --11221 --
NM_001003694chr31500 ------
NM_001003940chr1563743 3386 3340 1306 339 272 --23619 486 11210
NM_001003942chr1563743 3386 3340 1306 339 272 --23619 486 11210
NM_001003943chr1563747 3390 3344 1310 343 276 --23623 490 11214
NM_001004065chr922818 340 22934 190 13106 --
NM_001004106chr52711 399 1797 ----
NM_001004127chr132910 174 ------
NM_001004304chr1232998 174 64 --12837 --
NM_001004317chr614441 1607 ----
NM_001004329chr121262 ------
NM_001004342chr175751 5443 4905 4685 2300 1196 1169 11298 23975 2034 --
NM_001004419chr1211409 1524 ----
NM_001005158chr3----197 --
NM_001005159chr3----197 --
NM_001005366chr12--1112 ----
NM_001005386chr21699 ------
NM_001005473chr524114 1332 ------
NM_001005505chr321479 1361 --1488 --
NM_001005526chr2--150 ----
NM_001005732chr21133 ------
NM_001005733chr21133 ------
NM_001005739chr21326 1248 ----
NM_001005861chr3--1793 ----
NM_001005910chr31560 ------
NM_001005911chr31560 ------
NM_001006115chr342359 774 548 223 --2783 434 --
NM_001006617chr921046 28 ------
NM_001006619chr921046 28 ------
NM_001006620chr921046 28 ------
NM_001006621chr921046 28 ------
NM_001006636chr21345 ------
NM_001006938chrX1790 ------
NM_001007098chr11357 ------
NM_001007226chr1711111 1302 ----
NM_001007227chr1711111 1302 ----
NM_001007228chr1711111 1302 ----
NM_001007229chr1711111 1302 ----
NM_001007230chr1711111 1302 ----
NM_001007237chr12919 90 12596 ----
NM_001007271chr105977 854 744 398 40 1339 190 --
NM_001007277chr112279 223 ------
NM_001007471chr91330 ------
NM_001008220chr543814 3675 1037 448 --22863 509 --
NM_001008222chrX31254 1140 427 ------
NM_001008225chr7133 ------
NM_001008270chr7135 ------
NM_001008391chr111582 1286 ----
NM_001008408chr796179 5854 5768 5673 5327 979 869 764 103 --26102 5481 --
NM_001008410chr242157 1947 485 460 ----22188 22
NM_001008528chr172259 218 ------
NM_001008541chr101577 ------
NM_001008541chr101577 ------
NM_001008564chr13--1130 ----
NM_001008701chr1942310 2148 1896 1204 22806 1023 164 --
NM_001008738chr522762 2129 ------
NM_001008777chr172234 225 1213 ----
NM_001009185chr51648 ------
NM_001009554chr421766 1316 ------
NM_001009554chr421766 1316 ------
NM_001009566chr131348 578 226 ------
NM_001009571chr731682 1497 272 ------
NM_001009812chr23113 66 59 --131 --
NM_001009959chr242396 1970 1019 467 ------
NM_001010000chr1821191 528 ------
NM_001010846chr143143 3049 3028 31 --23059 554 1830
NM_001010867chr165951 2013 1717 1269 338 318 14717 36652 6131 887 --
NM_001010926chr11687 1119 1128 --
NM_001010935chr12188 23 ------
NM_001010942chr12124 ------
NM_001010980chr143217 2262 742 75 ----12234
NM_001011553chr7--1347 ----
NM_001011666chr724794 4269 ------
NM_001011722chr1----1453 --
NM_001011722chr1----1453 --
NM_001012329chr1----31854 718 352 --
NM_001012398chr16146 ------
NM_001012420chr151203 --2753 658 --
NM_001012423chr151203 --2753 658 --
NM_001012642chr1562025 1991 754 631 468 405 --1619 --
NM_001012753chr19--1338 ----
NM_001012755chrX34366 3135 1023 11999 1350 --
NM_001012979chrX1161 ------
NM_001013031chr101505 ------
NM_001013398chr711529 ------
NM_001013415chr411257 ------
NM_001013625chr1137 ------
NM_001013635chr121482 1259 2983 236 --
NM_001013693chr162674 2548 2258 2233 2187 389 ------
NM_001013693chr162674 2548 2258 2233 2187 389 ------
NM_001013843chr152792 335 ------
NM_001014435chr161439 ------
NM_001014797chr1068128 2900 2261 1428 1027 937 11544 ----
NM_001014839chr12428 185 ------
NM_001014841chr12428 185 ------
NM_001015045chr412342 ----22447 74
NM_001015877chrX1318 ------
NM_001015881chrX11282 1196 ----
NM_001017368chr1742819 1004 689 446 11775 ----
NM_001017395chr331052 524 35 ------
NM_001017405chr41694 ------
NM_001017424chr111871 ------
NM_001017425chr111871 ------
NM_001017523chr1211247 ------
NM_001018005chr15166 ------
NM_001018064chr911922 --11522 --
NM_001018072chr1211247 ------
NM_001018108chr15--1449 11461 --
NM_001020825chr5----1529 --
NM_001023567chr151203 --3756 700 661 --
NM_001023587chr3--1963 ----
NM_001024401chr1622835 2542 ------
NM_001024808chr1232454 894 446 12132 ----
NM_001024809chr1711299 ------
NM_001024858chr1452597 1995 838 241 210 --3570 556 433 --
NM_001025076chr1045227 5049 4946 2218 ------
NM_001025077chr1036585 6407 6304 --14872 --
NM_001025108chr222750 1259 --132 --
NM_001025205chr3------1319
NM_001025233chr1212510 1460 ----
NM_001025266chr333795 1528 608 --21547 804 --
NM_001025366chr641480 759 560 206 ------
NM_001025366chr641480 759 560 206 ------
NM_001025367chr641480 759 560 206 ------
NM_001025367chr641480 759 560 206 ------
NM_001025368chr641480 759 560 206 ------
NM_001025368chr641480 759 560 206 ------
NM_001025369chr631496 576 222 ------
NM_001025369chr631496 576 222 ------
NM_001025370chr641480 759 560 206 ------
NM_001025370chr641480 759 560 206 ------
NM_001025579chr1711132 --1933 --
NM_001025580chrX1134 ------
NM_001025780chr911524 ------
NM_001029835chr71403 ------
NM_001029871chr2061837 1508 1439 1314 710 24 1571 1527 --
NM_001030002chr173350 119 77 ----1248
NM_001030007chr16151 ------
NM_001030055chr1411450 ------
NM_001031680chr142022 1630 151 73 --182 --
NM_001031690chr732414 1948 452 --32012 847 731 --
NM_001031695chr2234044 3480 1978 1765 14016 --
NM_001031711chr521463 362 ------
NM_001032280chr63638 165 61 --177 --
NM_001032283chr12------1237
NM_001032284chr12------1237
NM_001032296chr1332806 2568 394 --1414 --
NM_001032363chr121543 1509 1184 --1669
NM_001032363chr121543 1509 1184 --1669
NM_001033026chr192244 94 ------
NM_001033044chr12556 387 ------
NM_001033049chr2121955 1676 ------
NM_001033056chr12556 387 ------
NM_001033081chr14686 419 294 228 --11432 11484
NM_001033082chr14686 419 294 228 --11432 11484
NM_001033087chr2021120 154 --136 --
NM_001033117chr344439 4292 3512 1447 ------
NM_001033507chr111749 ------
NM_001033602chr1352246 2178 1891 1783 44 1883 129 --
NM_001033756chr641414 693 494 140 ------
NM_001033756chr641414 693 494 140 ------
NM_001033925chr10142 ------
NM_001034025chr122217 65 ------
NM_001034845chr421240 388 ------
NM_001034954chr1032672 2628 962 ----1751
NM_001034955chr1032672 2628 962 ----1751
NM_001034956chr1032672 2628 962 ----1751
NM_001034957chr1032672 2628 962 ----1751
NM_001035chr121322 138 ------
NM_001035511chr11247 ------
NM_001035512chr11354 ------
NM_001035513chr11354 ------
NM_001035534chr921363 1075 150 171 --
NM_001037331chr181797 1224 ----
NM_001037334chr1811522 --1707 --
NM_001037582chr42590 540 ------
NM_001038493chr221067 578 ------
NM_001038640chr15----2823 728 --
NM_001038707chr152172 2156 2043 1774 176 11449 ----
NM_001038707chr152172 2156 2043 1774 176 11449 ----
NM_001039350chr721529 1119 --11725 --
NM_001039479chr1421842 633 140 ----
NM_001039538chr242812 2719 248 65 12917 ----
NM_001039570chr2244095 3633 3257 123 --34218 3683 3234 --
NM_001039571chr2244095 3633 3257 123 --34218 3683 3234 --
NM_001039574chr1--165 ----
NM_001039590chrX1860 ------
NM_001039591chrX1860 ------
NM_001039618chr1145081 654 324 246 14110 ----
NM_001039690chr1642017 577 404 53 ------
NM_001039762chr1011679 1498 ----
NM_001039802chr1--1382 ----
NM_001039840chrX24574 381 ------
NM_001039937chr1333468 1013 935 ------
NM_001040057chr71224 ------
NM_001040101chr42623 212 ------
NM_001040102chr101995 12237 --1126
NM_001040103chr101995 12237 --1126
NM_001040144chr1642017 577 404 53 ------
NM_001040146chr1642017 577 404 53 ------
NM_001040152chr731926 1071 96 11305 ----
NM_001040153chr131260 ------
NM_001040272chr91760 11945 ----
NM_001040284chr1621554 845 ------
NM_001040402chr423079 156 ------
NM_001040424chr2142601 2557 934 194 12716 ----
NM_001040439chr1641467 1385 1143 544 ------
NM_001040624chr852210 2128 2046 476 172 ------
NM_001040625chr852210 2128 2046 476 172 ------
NM_001040626chr852210 2128 2046 476 172 ------
NM_001040627chr852210 2128 2046 476 172 ------
NM_001040628chr852210 2128 2046 476 172 ------
NM_001040629chr852210 2128 2046 476 172 ------
NM_001040630chr852210 2128 2046 476 172 ------
NM_001040633chr72971 50 ------
NM_001040694chr1121062 258 ------
NM_001040709chr14552 432 340 56 ------
NM_001040712chr9------13092
NM_001040876chr4--1105 ----
NM_001042355chr1655320 4222 3603 1613 1529 ------
NM_001042388chr181747 ------
NM_001042406chr6185 1439 ----
NM_001042412chr1655320 4222 3603 1613 1529 ------
NM_001042413chr92936 203 ------
NM_001042425chr63638 165 61 --177 --
NM_001042430chr14157 ------
NM_001042537chrX1499 12330 ----
NM_001042539chr16------11124
NM_001042599chr234808 666 70 15369 ----
NM_001042601chr31633 12510 ----
NM_001042681chr122027 839 12390 ----
NM_001042682chr122027 839 12390 ----
NM_001042682chr122027 839 12390 ----
NM_001042728chr12196 ------
NM_001046chr51177 --12886 --
NM_001077628chr11165 ------
NM_001083620chr412014 12591 ----
NM_001095chr1251939 1607 1198 393 105 --11922 --
NM_001106chr398027 7928 6613 3263 2806 2665 2206 1376 1135 19079 --13808
NM_001113490chrX----12313 1689
NM_001116chr1682770 2358 2319 2117 585 410 218 32 ------
NM_001117chr183802 601 560 ------
NM_001119chr4274 45 ------
NM_001121chr1031507 711 231 ------
NM_001122631chr111493 ------
NM_001128chr16151 ------
NM_001135chr151803 ------
NM_001148chr421723 130 ------
NM_001149chr10--1230 ----
NM_001173chr1411450 ------
NM_001177chr1232400 2288 1992 ------
NM_001189chr4----2968 41 148
NM_001200chr2021155 467 ------
NM_001204chr2--17350 ----
NM_001218chr152947 61 42222 627 458 70 ----
NM_001219chr731949 1890 276 ------
NM_001222chr101394 ----166
NM_001241chr211910 ------
NM_001241chr211910 ------
NM_001256chr1722526 757 ------
NM_001259chr736233 5025 137 ------
NM_001265chr132705 360 1266 ----
NM_001270chr5------1928
NM_001277chr112823 76 ------
NM_001280chr19163 ------
NM_001293chr11--171 ----
NM_001310chr1222061 1088 ------
NM_001345chr12173 ------
NM_001362chr14----1692 --
NM_001364chr1153676 3643 3079 2963 1637 --13828 --
NM_001365chr171244 ------
NM_001387chr522054 1257 --12216 13098
NM_001406chr1741625 1173 668 620 ------
NM_001419chr1984075 3685 3135 3019 1945 881 535 147 1282 ----
NM_001420chr1922358 163 ------
NM_001423chr1221958 548 ------
NM_001426chr22536 498 1651 ----
NM_001429chr221845 ------
NM_001431chr61763 --1177 --
NM_001438chr112304 ------
NM_001454chr171257 127 ----
NM_001457chr321485 543 ------
NM_001458chr71626 ------
NM_001489chr9------163
NM_001493chrX1253 ------
NM_001495chr83418 355 241 2305 160 11199 --
NM_001497chr932622 1004 205 ------
NM_001498chr6--1277 ----
NM_001542chr12919 90 12596 ----
NM_001611chr192227 23 --1255 --
NM_001659chr1242516 2038 819 287 22633 916 ----
NM_001662chr7----1347 --
NM_001663chr141236 1117 ----
NM_001664chr31382 ------
NM_001668chr122165 155 1504 11767 --
NM_001678chr1761735 1566 1363 1269 670 177 --21244 465 --
NM_001681chr121279 ------
NM_001682chr1211876 ------
NM_001683chr351815 1045 939 168 60 ------
NM_001699chr1921816 733 11343 ----
NM_001704chr61542 ------
NM_001707chr71124 1309 ----
NM_001743chr2--1228 ----
NM_001773chr131328 1062 580 11106 ----
NM_001788chr7--1347 ----
NM_001789chr341744 1392 642 269 ------
NM_001791chr1--1382 ----
NM_001839chr11696 ------
NM_001855chr91889 ------
NM_001896chr161101 ------
NM_001908chr822154 1813 ------
NM_001927chr2------1716
NM_001936chr721529 1119 --11725 --
NM_001939chrX21498 447 11161 2131 48 1796
NM_001946chr122444 234 ------
NM_001955chr61752 1294 ----
NM_001964chr5----1916 --
NM_001965chr22175 116 --155 --
NM_001969chr141322 12869 ----
NM_001981chr112076 ------
NM_001999chr51173 ------
NM_002006chr455248 5088 4093 3754 467 ------
NM_002015chr1333186 2596 2468 ------
NM_002017chr11----11217 --
NM_002025chrX68512 6954 6174 5800 3057 2375 --26960 1763 12441
NM_002026chr22729 227 ----1119
NM_002045chr31389 ------
NM_002065chr12556 387 ------
NM_002074chr131167 1145 233 ------
NM_002076chr1233199 614 215 ------
NM_002077chr921554 27 ------
NM_002078chr3144 ------
NM_002082chr52674 362 1760 ----
NM_002088chr19--1377 --1170
NM_002092chr424181 408 11728 ----
NM_002103chr192850 207 ------
NM_002106chr41343 ------
NM_002130chr51247 ----1613
NM_002131chr651301 401 353 118 67 1970 ----
NM_002146chr17----160 --
NM_002147chr17176 ------
NM_002148chr2--1701 ----
NM_002149chr21763 ------
NM_002196chr201984 ------
NM_002196chr201984 ------
NM_002212chr202275 192 ----139
NM_002223chr1273680 3651 1425 1296 669 652 146 ------
NM_002232chr1----1415 --
NM_002247chr102667 528 ------
NM_002254chr231466 871 205 ----12262
NM_002264chr364393 4090 3149 3084 1666 173 --11870 --
NM_002265chr171920 ------
NM_002267chr1311995 ------
NM_002285chr222750 1259 --132 --
NM_002298chr133623 567 532 ----11437
NM_002309chr22122971 2803 2670 2567 2431 2401 2301 969 852 521 234 158 --12852 --
NM_002313chr10105015 2012 1690 1626 1452 1144 976 563 505 216 ------
NM_002359chr1743617 1618 1530 485 13327 13402 --
NM_002361chr191249 ------
NM_002374chr242812 2719 248 65 12917 ----
NM_002375chr331609 629 405 11518 1120 --
NM_002384chr181171 ------
NM_002397chr51793 ------
NM_002398chr2--1417 ----
NM_002429chr1211076 1320 ----
NM_002445chr821656 460 164 ----
NM_002448chr4----1543 --
NM_002449chr531190 244 96 ------
NM_002479chr1----1117 --
NM_002494chr4130 157 ----
NM_002500chr2126 ------
NM_002501chr1944122 3263 1520 972 11252 33720 3489 2959 --
NM_002508chr12500 88 ------
NM_002509chr203781 279 204 ------
NM_002523chr72876 769 ------
NM_002537chr152954 930 ------
NM_002553chr71330 ------
NM_002570chr15----1276 --
NM_002586chr6--1534 --1422
NM_002588chr521569 208 ------
NM_002601chr21153 ------
NM_002613chr1643647 1322 755 239 12122 21813 603 1722
NM_002636chr61183 ------
NM_002648chr641211 1122 1028 462 ------
NM_002653chr53932 798 155 1181 ----
NM_002655chr825110 1355 ------
NM_002657chr2033397 1165 36 13469 ----
NM_002660chr20199 ----1203
NM_002693chr151344 ------
NM_002699chr131242 539 160 ------
NM_002710chr121386 ------
NM_002716chr1143215 2318 866 462 13628 ----
NM_002717chr81163 ------
NM_002719chr143740 713 119 147 11505 --
NM_002729chr101113 ------
NM_002737chr17115858 5817 5807 5664 5218 4621 4139 4076 2194 2142 804 ------
NM_002738chr1621034 392 ------
NM_002739chr192672 125 --1503 --
NM_002809chr171341 ------
NM_002822chr122688 479 ------
NM_002824chr12138 --1100 --
NM_002827chr2011758 ----11114
NM_002830chr21391 ------
NM_002839chr9------13092
NM_002840chr111382 ----145
NM_002855chr1133168 1167 689 --13581 --
NM_002859chr1251685 1445 1323 675 191 ------
NM_002861chr173514 410 37 ----1106
NM_002863chr141113 ------
NM_002868chr1262274 918 842 719 213 139 ------
NM_002869chr111768 ------
NM_002871chr12299 85 ------
NM_002884chr12188 23 ------
NM_002886chr32207 29 ------
NM_002895chr202776 62 ------
NM_002896chr113426 100 84 ------
NM_002900chr10145 --1123 --
NM_002918chr1921001 74 ------
NM_002940chr4--1105 ----
NM_002942chr32326 31 ------
NM_002958chr3--1793 ----
NM_002959chr163358 3095 3081 430 205 111 12863 ----
NM_002971chr3--1323 ----
NM_003001chr11354 ------
NM_003010chr17----12218 --
NM_003011chr931427 318 284 ------
NM_003013chr4122 --163 --
NM_003028chr962440 902 869 776 310 24 --23376 2403 1849
NM_003036chr151139 1083 816 82 72 ------
NM_003043chr333199 2996 421 --13462 --
NM_003045chr1384017 3853 3642 1784 623 557 185 170 ----11249
NM_003063chr11------142
NM_003069chrX------1117
NM_003071chr31200 ------
NM_003077chr17155 --1608 --
NM_003081chr201405 ------
NM_003085chr51118 ------
NM_003088chr731071 999 312 1329 ----
NM_003106chr31980 ------
NM_003107chr642429 2022 1936 139 1386 1567 --
NM_003108chr257185 6707 6667 2860 2454 --22880 2561 1438
NM_003131chr61466 --12124 --
NM_003133chr11281 ------
NM_003139chr111705 ------
NM_003140chrY1110 ------
NM_003144chr61620 ----1771
NM_003153chr121248 ----163
NM_003155chr812468 ------
NM_003174chr102737 594 1640 ----
NM_003179chrX21395 403 --11020 --
NM_003185chr2011099 ------
NM_003186chr111122 ------
NM_003189chr142409 2065 989 94 ------
NM_003199chr1824896 1496 ------
NM_003200chr191595 12140 150 --
NM_003204chr1711471 --1463 11602
NM_003215chr411086 --11479 11446
NM_003220chr63638 165 61 --177 --
NM_003221chr633284 1229 255 1961 --13957
NM_003239chr143712 177 116 --1122 --
NM_003247chr6122 ------
NM_003253chr2121682 1561 ------
NM_003255chr1742569 2490 241 69 ------
NM_003291chr131806 ------
NM_003317chr143555 96 34 ------
NM_003320chr1143496 3074 2795 1288 11001 13742 --
NM_003325chr221251 ------
NM_003344chr721498 311 ------
NM_003376chr641480 759 560 206 ------
NM_003376chr641480 759 560 206 ------
NM_003392chr331510 1142 461 13159 ----
NM_003394chr122161 70 ------
NM_003399chrX11064 --1986 --
NM_003400chr21791 ------
NM_003403chr141210 ------
NM_003410chrX12382 12605 ----
NM_003412chr321949 327 --1335 --
NM_003427chr61117 --1685 --
NM_003455chr11------1464
NM_003458chr383971 3083 3033 2743 2567 1024 587 518 164 12474 190
NM_003466chr242458 2362 1973 1533 --1537 --
NM_003468chr214133 1961 ----
NM_003470chr1641656 1566 1502 316 ------
NM_003477chr111254 ------
NM_003481chr122186 93 1512 ----
NM_003483chr1222472 1184 ------
NM_003498chr1642117 1777 854 129 12493 ----
NM_003563chr1711111 1302 ----
NM_003576chr1332806 2568 394 --1414 --
NM_003583chr1222688 2555 11102 ----
NM_003603chr421372 716 ------
NM_003607chr123793 1362 --13975 --
NM_003629chr12401 31 ------
NM_003632chr172727 101 ------
NM_003633chr511974 177 ----
NM_003637chr131490 1142 502 1104 21350 1032 --
NM_003655chr171277 ------
NM_003660chr191643 --1649 --
NM_003671chr932691 2247 274 ------
NM_003684chr13945 433 102 ------
NM_003704chr41217 ------
NM_003735chr521569 208 ------
NM_003736chr521569 208 ------
NM_003766chr171532 ------
NM_003768chr111473 1659 1160 --
NM_003791chr161221 ------
NM_003822chr121977 22 ------
NM_003825chr1521362 185 ------
NM_003873chr105910 894 839 606 564 ------
NM_003884chr311183 ------
NM_003885chr172345 160 11936 ----
NM_003887chr22437 127 --11523 --
NM_003893chr103401 144 30 --1451 --
NM_003913chr623021 557 13414 ----
NM_003924chr42275 238 ------
NM_003934chr9----1230 --
NM_003955chr1731211 609 324 1229 2548 112 --
NM_003980chr611021 ------
NM_003983chr162916 458 13895 11433 --
NM_003987chr1031544 593 469 --142 --
NM_003988chr1041621 670 546 39 --1119 --
NM_003989chr1031480 529 405 ------
NM_003990chr1031480 529 405 ------
NM_003994chr12--13229 ----
NM_004006chrX------12323
NM_004007chrX------12323
NM_004009chrX------12323
NM_004010chrX------12323
NM_004011chrX------12323
NM_004012chrX------12323
NM_004013chrX------12323
NM_004014chrX------12323
NM_004015chrX------12323
NM_004016chrX------12237
NM_004017chrX------12323
NM_004018chrX------12237
NM_004020chrX------12323
NM_004021chrX------12237
NM_004022chrX------12237
NM_004023chrX------12237
NM_004036chr21155 ------
NM_004050chr1442132 913 798 674 ------
NM_004061chr51132 ------
NM_004068chr3------1319
NM_004089chrX11282 1196 ----
NM_004093chr1331077 958 524 ------
NM_004100chr62333 76 ------
NM_004114chrX126 ------
NM_004116chr23478 155 61 ------
NM_004171chr1158596 3704 2493 1968 1291 16195 13084 --
NM_004172chr511983 ------
NM_004186chr31751 --2953 854 --
NM_004187chrX----1922 --
NM_004188chr91534 --1482 --
NM_004200chr1122957 2829 --32377 212 198 --
NM_004206chr3135 ------
NM_004227chr752566 2405 2227 2068 1942 --12013 --
NM_004232chr1813415 ------
NM_004240chr19----2248 100 --
NM_004272chr54640 630 618 71 ------
NM_004302chr1242580 2483 462 392 12722 ----
NM_004308chr1121728 33 1217 ----
NM_004311chr1012991 12794 12169 --
NM_004329chr10----1309 --
NM_004342chr7169 ------
NM_004350chr142022 1630 151 73 --182 --
NM_004356chr11199 ------
NM_004380chr1632155 1664 551 --11630 --
NM_004392chr1312030 ------
NM_004393chr352096 1535 665 280 159 11880 ----
NM_004395chr53120 96 58 1114 1498 --
NM_004397chr1144208 2701 1389 1339 ------
NM_004409chr193581 102 25 --1591 --
NM_004416chr122967 927 1672 ----
NM_004417chr52132 77 ------
NM_004420chr1162214 2104 1570 910 614 477 --1697 --
NM_004423chr342403 268 202 180 ------
NM_004426chr122714 198 ------
NM_004430chr821095 706 --1770 --
NM_004431chr1--1287 --1852
NM_004438chr221104 908 ----12155
NM_004440chr621634 685 ------
NM_004442chr141453 1321 542 371 ------
NM_004444chr7147 ------
NM_004451chr11----1208 --
NM_004454chr321486 395 1142 ----
NM_004472chr51181 ------
NM_004474chr14974 722 319 277 ------
NM_004494chr131290 1250 371 ------
NM_004501chr123652 1404 --12687 --
NM_004503chr121813 ----1160
NM_004506chr61684 ------
NM_004519chr81235 ------
NM_004580chr151727 ------
NM_004586chrX1726 ----1205
NM_004588chr1123153 828 --1207 --
NM_004626chr11194 ----1250
NM_004634chr31500 ------
NM_004642chr121136 ------
NM_004643chr142604 238 ------
NM_004655chr1721173 149 ------
NM_004656chr311197 11070 1491 --
NM_004660chrY12318 ------
NM_004663chr1511544 ------
NM_004685chr1311179 ------
NM_004687chr1721966 477 ------
NM_004689chr141375 ------
NM_004690chr61114 ------
NM_004703chr1722492 2425 ------
NM_004707chr5161 ------
NM_004730chr522007 1746 ------
NM_004732chr171142 ----183
NM_004736chr1--1132 ----
NM_004742chr321797 441 ------
NM_004744chr423667 2690 11580 ----
NM_004745chr845040 1740 529 247 1315 15499 --
NM_004758chr17----2199 97 --
NM_004768chr12880 108 ------
NM_004774chr1712536 ------
NM_004775chr182829 186 ------
NM_004776chr2041039 1025 1001 486 12749 --1899
NM_004779chr52247 195 ------
NM_004788chr11----12277 --
NM_004796chr141132 21818 337 --1285
NM_004798chr2043325 2565 882 191 ------
NM_004801chr211544 ------
NM_004821chr5----295 88 --
NM_004838chr19131 --1161 --
NM_004863chr1455198 971 838 389 310 ------
NM_004879chr112157 101 ------
NM_004897chr102775 148 ------
NM_004898chr41733 ------
NM_004902chr202746 737 ------
NM_004904chr724794 4269 ------
NM_004906chr61643 ------
NM_004921chr1149 --1529 --
NM_004922chr101112 ----1990
NM_004924chr1951061 928 903 354 114 ------
NM_004926chr141307 ------
NM_004932chr511614 ------
NM_004952chr1----1232 --
NM_004973chr631666 1336 553 ------
NM_004976chr1163783 3254 1570 736 282 63 24210 4059 21629 1070 --
NM_004992chrX97615 7434 6471 5879 2532 1433 1164 1025 80 16446 26495 650 --
NM_004992chrX97615 7434 6471 5879 2532 1433 1164 1025 80 16446 26495 650 --
NM_004995chr141310 --1424 --
NM_005017chr31224 ------
NM_005020chr72522 223 ------
NM_005028chr101305 --155 --
NM_005045chr71934 ------
NM_005076chr164198 3703 3538 2967 1685 345 13202 11199 --
NM_005078chr1541745 1370 52 32 --2286 134 --
NM_005094chr93235 209 55 ------
NM_005104chr62138 32 ------
NM_005109chr31213 ------
NM_005121chr171948 ------
NM_005134chr181747 ------
NM_005151chr1811522 --1707 --
NM_005153chr162725 39 ------
NM_005154chr151148 ------
NM_005155chr62528 243 ------
NM_005156chr924672 4547 ------
NM_005157chr941379 252 213 122 21587 375 ----
NM_005159chr1531999 1604 880 11494 ----
NM_005168chr211390 ------
NM_005173chr174454 433 249 27 --1258 --
NM_005182chr161439 ------
NM_005184chr1931424 1234 1135 ------
NM_005187chr1631570 1364 325 ------
NM_005197chr1424144 2454 14749 11647 --
NM_005207chr2233401 2830 2732 ----11466
NM_005219chr551350 1124 415 135 94 ------
NM_005220chr174988 964 526 460 --11337 --
NM_005225chr2031008 963 460 --2410 146 --
NM_005229chrX1106 ------
NM_005235chr234808 666 70 15369 ----
NM_005238chr1112984 --1270 --
NM_005252chr14--1201 ----
NM_005254chr1521335 143 ------
NM_005276chr1241307 618 525 265 --11465 --
NM_005276chr1241307 618 525 265 --11465 --
NM_005277chr411722 ------
NM_005278chrX133 1565 ----
NM_005310chr173350 119 77 ----1248
NM_005311chr712481 ------
NM_005316chr11--163 ----
NM_005324chr1711394 ----11725
NM_005329chr1642040 1686 898 172 ------
NM_005339chr422759 161 ------
NM_005358chr1321780 417 ------
NM_005359chr1845657 5298 5238 4460 --15152 --
NM_005370chr1931271 1072 328 ------
NM_005381chr22436 48 ------
NM_005392chr92330 30 ------
NM_005398chr101388 ------
NM_005400chr232493 2108 374 ----1573
NM_005417chr2041941 1576 1274 272 1284 31923 1394 1328 --
NM_005418chr113642 628 78 ------
NM_005424chr1128 ------
NM_005435chr71216 ------
NM_005436chr1022796 80 ------
NM_005437chr1011365 ------
NM_005458chr93747 668 471 --22328 86 --
NM_005461chr2031280 780 448 ------
NM_005476chr911217 ------
NM_005477chr1572462 2304 963 897 807 597 293 ------
NM_005477chr1572462 2304 963 897 807 597 293 ------
NM_005487chr2221466 90 ------
NM_005488chr222221 78 ------
NM_005493chr6166 ------
NM_005497chr1724638 3832 1144 193 --
NM_005512chr1121417 102 --1297 1728
NM_005573chr5--1560 ----
NM_005575chr5159 ------
NM_005613chr121810 1373 ----149
NM_005618chr61530 ------
NM_005619chr19153 1284 ----
NM_005639chr1221832 1450 ------
NM_005647chrX83163 1337 1223 1201 1179 692 312 133 --12137 --
NM_005668chr531738 739 689 1779 ----
NM_005688chr3------1129
NM_005698chr1170 --1257 --
NM_005707chr151151 ------
NM_005722chr21699 ------
NM_005730chr1263066 3001 1283 1245 1111 619 ------
NM_005737chr21136 --1604 --
NM_005776chr141246 ------
NM_005779chr51321 ----13453
NM_005797chr1111665 1154 ----
NM_005822chr632086 1792 636 12058 ----
NM_005828chr1764663 3292 1826 1513 1017 695 ------
NM_005840chrX52992 2408 2395 1508 355 ----15529
NM_005845chr13128 ------
NM_005876chr23693 652 616 --1102 --
NM_005877chr2232158 2013 749 1216 --12115
NM_005882chr41694 ------
NM_005901chr1847541 5711 5465 1403 18309 18023 --
NM_005906chr641251 1233 489 35 ------
NM_005910chr1754011 2821 2784 400 349 11079 13062 --
NM_005911chr2162 ------
NM_005920chr121223 115 1741 ----
NM_005933chr1122216 565 ------
NM_005934chr1962186 2132 1717 1696 1041 236 32099 1837 1684 32294 2169 276 --
NM_005937chr1743503 2855 1116 948 --21468 668 --
NM_005943chr631400 1255 1095 ------
NM_005955chr133407 668 25 11057 ----
NM_005962chr101577 ------
NM_005962chr101577 ------
NM_005964chr1721525 371 ------
NM_005986chr1332505 2175 234 1393 11042 --
NM_005990chr51962 12754 ----
NM_005994chr171274 ----1907
NM_005996chr1211003 ------
NM_006007chr923709 3659 13749 ----
NM_006015chr11265 ------
NM_006030chr321479 1361 --1488 --
NM_006037chr234378 858 276 --23354 693 --
NM_006047chr2011330 12377 ----
NM_006051chr5----134 --
NM_006094chr81826 ------
NM_006095chr42608 27 ------
NM_006139chr2------165
NM_006141chr1652724 2586 999 935 222 ------
NM_006148chr1741145 522 251 186 1227 ----
NM_006154chr15173 11907 ----
NM_006160chr1721346 272 ------
NM_006164chr2----1421 --
NM_006180chr911922 --11522 --
NM_006191chr122921 182 1697 ----
NM_006212chr175277 5204 3663 1725 1010 807 25 1510 ----
NM_006224chr1751760 847 726 546 287 --12316 --
NM_006237chr1331798 876 518 ------
NM_006241chr321724 663 12180 ----
NM_006242chr2031662 1596 282 ------
NM_006243chr12908 350 ------
NM_006245chr61302 ------
NM_006246chr1411031 1474 ----
NM_006251chr521153 1038 ------
NM_006258chr101292 ------
NM_006268chr113374 178 167 ------
NM_006277chr22240 133 ------
NM_006285chr9----1281 --
NM_006302chr2143 ------
NM_006306chrX25010 598 24797 61 1814 --
NM_006321chr331899 686 80 ------
NM_006323chr41272 ------
NM_006325chr12------1154
NM_006336chr9------134
NM_006353chr6123 ------
NM_006356chr17----125 --
NM_006359chrX1499 12330 ----
NM_006367chr12677 117 ------
NM_006379chr7144 ------
NM_006380chr1722811 684 ------
NM_006386chr2221945 1754 ------
NM_006389chr112526 384 ------
NM_006393chr1023256 163 ------
NM_006421chr811064 195 ----
NM_006434chr1032672 2628 962 ----1751
NM_006449chr2--177 ----
NM_006454chr442964 2800 1946 1044 --1642 --
NM_006464chr233985 1805 400 24047 22 ----
NM_006482chr1222688 2555 11102 ----
NM_006496chr11568 ------
NM_006497chr173312 162 24 ------
NM_006504chr1022852 1911 ------
NM_006520chrX11697 ------
NM_006544chr1435452 5352 1648 --11210 --
NM_006547chr71267 ------
NM_006549chr1242273 391 126 45 --21927 770 --
NM_006557chr91617 ------
NM_006561chr1045227 5049 4946 2218 ------
NM_006587chr41292 ------
NM_006599chr1638154 1876 673 16290 ----
NM_006602chr202284 81 ------
NM_006608chr11125 1152 ----
NM_006618chr121007 338 ------
NM_006621chr121875 1275 ------
NM_006624chr1012102 ------
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006633chr5--1779 ----
NM_006650chr543814 3675 1037 448 --22863 509 --
NM_006651chr441352 1203 462 446 21511 568 ----
NM_006693chr72590 21 ------
NM_006711chr164608 239 208 107 ------
NM_006720chr10105015 2012 1690 1626 1452 1144 976 563 505 216 ------
NM_006722chr31658 ------
NM_006729chrX55325 5224 3415 1637 891 11346 ----
NM_006734chr61464 ------
NM_006738chr1524585 1041 --1202 --
NM_006762chr141276 1242 859 262 ------
NM_006766chr811809 ------
NM_006775chr622438 474 13097 ----
NM_006777chrX42422 2128 778 693 11795 ----
NM_006788chr182438 429 --11963 --
NM_006823chr831344 401 292 ------
NM_006833chr71134 ------
NM_006836chr12----1497 --
NM_006837chr81106 ------
NM_006838chr1221243 378 1193 ----
NM_006852chr1721841 263 1501 1195 --
NM_006854chr721824 135 11791 ----
NM_006874chr411141 --1816 --
NM_006876chr111542 ------
NM_006893chr1----149 --
NM_006896chr72835 819 --1289 --
NM_006897chr121409 ------
NM_006906chr112798 27 ------
NM_006920chr211796 ------
NM_006930chr52757 419 ------
NM_006950chrX2913 46 ------
NM_006990chr162535 2420 2203 1900 1720 1624 ------
NM_006999chr51825 ------
NM_007005chr921065 52 ------
NM_007011chr1556354 4289 2429 940 463 141 24223 906 --
NM_007030chr531726 1511 633 --24669 1380 --
NM_007050chr2086813 2301 2010 592 494 461 155 92 15422 16352 12593
NM_007067chr1731342 1163 145 ------
NM_007073chr631556 1163 1056 13260 13909 --
NM_007084chr132548 236 1298 ----
NM_007118chr53676 613 567 ------
NM_007126chr9--1147 ----
NM_007137chrX24343 2207 11991 ----
NM_007146chr1732141 2117 583 ------
NM_007174chr1232216 956 111 1186 ----
NM_007185chr11124 --1275 --
NM_007192chr1411053 ------
NM_007200chr1524585 1041 --1202 --
NM_007203chr922818 340 22934 190 13106 --
NM_007214chr61462 ------
NM_007236chr155927 798 693 615 467 ------
NM_007238chr2074716 3893 3801 3321 1299 319 120 14635 ----
NM_007245chr162717 117 --1294 --
NM_007249chr1347161 2985 1852 1271 ------
NM_007260chr12191 134 ------
NM_007275chr311109 ------
NM_007286chr521898 486 1698 22096 127 --
NM_007313chr941379 252 213 122 21587 375 ----
NM_007331chr422602 1092 ------
NM_007350chr1234330 4280 1152 ------
NM_007351chr4180 ------
NM_007358chr121970 543 ------
NM_007373chr101529 ------
NM_012064chr1211064 ------
NM_012082chr81684 ------
NM_012099chr193477 427 222 ------
NM_012102chr122027 839 12390 ----
NM_012137chr112224 ------
NM_012141chr1333468 1013 935 ------
NM_012156chr2053386 2563 2553 2332 1095 13165 ----
NM_012158chr1321627 686 ------
NM_012164chr955498 2766 2098 1364 793 11929 ----
NM_012180chr41750 ------
NM_012183chr11415 ------
NM_012199chr124417 4146 14484 ----
NM_012210chr911053 ------
NM_012224chr41484 ------
NM_012234chr323488 2959 ------
NM_012245chr141414 ------
NM_012257chr71923 ------
NM_012288chr684933 4646 2043 1208 747 434 316 102 ------
NM_012294chr722712 578 12560 ----
NM_012300chr521703 181 22213 555 ----
NM_012301chr7158 ------
NM_012304chr552485 2099 1999 614 111 --1655 --
NM_012308chr112980 88 ------
NM_012316chr164422 1909 1764 518 144 65 25244 174 11004 11363
NM_012320chr1621352 55 11393 ----
NM_012325chr2021449 1022 ------
NM_012328chr7--11095 ----
NM_012330chr1011786 ------
NM_012334chr523656 51 ----14146
NM_012343chr52852 379 ------
NM_012405chr133664 2669 66 ------
NM_012430chr31104 1556 ----
NM_012458chr1921243 420 1312 ----
NM_012461chr142667 286 1494 ----
NM_012465chr1042657 2305 1085 278 12339 ----
NM_012479chr732655 1717 433 --12042 --
NM_012482chr11164 ------
NM_013227chr151803 ------
NM_013236chr221412 ------
NM_013247chr22142 33 --1387 --
NM_013255chr758677 8636 8039 6042 891 18539 ----
NM_013269chr1211336 1451 ----
NM_013279chr1131818 1550 105 ------
NM_013305chr182189 133 ------
NM_013316chr7----1869 --
NM_013323chr1711125 --1935 --
NM_013397chr61975 2695 440 ----
NM_013400chr73345 302 242 11031 1439 --
NM_013401chr11130 ------
NM_013433chr191281 11580 --1345
NM_013438chr911405 ------
NM_013446chr711290 ------
NM_013449chr1211981 11189 ----
NM_013951chr242458 2362 1973 1533 --1537 --
NM_013952chr242535 2439 2050 1610 --1614 --
NM_013953chr242535 2439 2050 1610 --1614 --
NM_013958chr81167 ------
NM_013959chr81167 ------
NM_013961chr81167 ------
NM_013962chr81167 ------
NM_013992chr242535 2439 2050 1610 --1614 --
NM_014011chr21287 ------
NM_014016chr31591 ----11074
NM_014056chr342004 1738 1675 437 ------
NM_014089chr13--1130 ----
NM_014117chr1612019 ------
NM_014141chr733850 999 587 11094 ----
NM_014155chr1124595 1328 14871 ----
NM_014181chr221861 1174 --12484 --
NM_014189chr4274 45 ------
NM_014190chr43426 397 306 ------
NM_014191chr1211007 ------
NM_014216chr1451432 1341 1172 660 598 ------
NM_014217chr111871 ------
NM_014232chr1731174 534 220 ------
NM_014232chr1731174 534 220 ------
NM_014233chr171622 --1300 --
NM_014250chr2221466 90 ------
NM_014284chr12428 185 ------
NM_014289chrX2270 261 1570 ----
NM_014309chr2234034 3470 1968 1755 14006 --
NM_014325chr12----11450 --
NM_014333chr11----1968 --
NM_014351chr22--198 ----
NM_014374chr73345 302 242 11031 1439 --
NM_014392chr42623 212 ------
NM_014393chr831951 1553 307 ------
NM_014399chr71954 ------
NM_014415chr311222 ------
NM_014417chr191641 ------
NM_014423chr532172 1309 1027 14693 11072 --
NM_014494chr162868 628 ------
NM_014507chr2231006 764 122 ------
NM_014515chr121970 ------
NM_014517chr3----1270 1235
NM_014577chr221703 ------
NM_014585chr2199 ------
NM_014603chr1731619 1446 226 ------
NM_014604chr172520 180 ------
NM_014615chr1623505 680 ----12668
NM_014630chr1552533 486 476 202 86 ------
NM_014653chr1242005 1654 1547 298 ------
NM_014661chr1083479 3332 2622 1308 1277 785 350 57 --1867 --
NM_014667chr332342 2301 2150 ------
NM_014671chr721219 979 ------
NM_014674chr323812 2637 ------
NM_014686chr1912372 ------
NM_014690chr732414 1948 452 --32012 847 731 --
NM_014701chr151596 ------
NM_014706chr12141 11065 1341 --
NM_014712chr162427 392 ------
NM_014726chr172473 425 --21168 179 --
NM_014729chr81866 1153 ----
NM_014730chr1254200 3766 3657 1692 1403 ------
NM_014730chr1254200 3766 3657 1692 1403 ------
NM_014735chrX2723 282 11711 ----
NM_014739chr624086 310 ------
NM_014746chr263194 3098 2884 1003 915 36 14284 --14013
NM_014752chr111188 11589 ----
NM_014757chr512333 ------
NM_014762chr142121 922 813 251 11805 ----
NM_014767chr1082458 2379 1474 1408 956 918 293 48 --1515 --
NM_014770chr1211193 --1252 --
NM_014798chr17124 --21870 1241 --
NM_014807chr112675 103 --1110 --
NM_014810chr133441 2786 2555 ------
NM_014826chr123793 1362 --13975 --
NM_014827chr121649 606 ------
NM_014828chr1442395 2064 1624 944 ------
NM_014839chr121740 615 ------
NM_014849chr11524 1916 1413 --
NM_014850chr344439 4292 3512 1447 ------
NM_014858chr14459 413 359 32 ----11052
NM_014860chr212472 ------
NM_014862chr1594230 3581 2608 1592 1454 1274 851 780 533 --21187 433 --
NM_014868chr121366 --1117 --
NM_014869chr32550 162 --11219 --
NM_014877chr1756615 5935 5918 4704 2422 15490 16868 --
NM_014883chr412342 ----22447 74
NM_014884chr19277 59 ------
NM_014899chr521139 706 ------
NM_014901chr52532 401 ----146
NM_014909chr1483266 2800 2690 2468 2418 747 696 378 13733 12806 13840
NM_014912chr1021168 1054 --1839 --
NM_014921chr1942310 2148 1896 1204 22806 1023 164 --
NM_014924chr1463150 1063 1002 900 580 312 ------
NM_014926chr311140 ------
NM_014931chr19--1130 1573 --
NM_014935chr183400 3271 3214 3058 2897 2837 2790 2711 22517 447 ----
NM_014944chr131348 578 226 ------
NM_014949chr121015 78 ------
NM_014961chr42316 88 ------
NM_014974chr1021404 1391 --11457 --
NM_014982chr1455119 4769 3636 913 888 ----15215
NM_014988chr422401 721 --12703 --
NM_014991chr412378 12506 ----
NM_014994chr1522085 391 --21907 754 --
NM_015001chr1144 1410 1829 --
NM_015008chr331052 524 35 ------
NM_015009chr31145 ------
NM_015012chr111357 1351 ----
NM_015018chr6166 ------
NM_015020chr1623634 2618 ----1486
NM_015023chr141810 1780 670 182 1663 2631 289 --
NM_015025chr212019 ------
NM_015035chr2086493 4421 4293 2174 1515 1457 1405 449 --25011 4977 12562
NM_015039chr163980 3346 3123 1645 911 206 --6425 411 386 347 333 308 --
NM_015042chr1554084 3904 3409 1617 335 21516 175 ----
NM_015044chr1653015 2923 2573 2495 157 --23075 123 --
NM_015054chr12------137
NM_015071chr554890 4658 4546 2476 1152 --21849 150 --
NM_015074chr11172 ------
NM_015075chrX41625 1408 1382 879 ------
NM_015077chr1774535 3641 3066 3028 914 597 523 14507 13379 13601
NM_015080chr111232 ------
NM_015090chr195583 4439 4356 3927 2426 1781 1744 716 552 1776 11453 --
NM_015092chr1643566 3530 3476 838 ------
NM_015097chr311940 ------
NM_015106chr31153 ------
NM_015107chrX21874 934 ------
NM_015115chr423079 156 ------
NM_015132chr7----11729 --
NM_015133chr1641467 1385 1143 544 ------
NM_015144chr162898 479 11166 ----
NM_015155chr1062482 2471 890 862 828 320 ------
NM_015156chr1421055 271 1100 ----
NM_015161chr1621102 159 ------
NM_015197chr1453114 3017 2953 269 187 13249 ----
NM_015205chr1344048 1126 1112 349 13909 21602 1364 --
NM_015206chr1543369 2811 1317 866 12446 ----
NM_015213chr11153 ------
NM_015233chr1352246 2178 1891 1783 44 1883 129 --
NM_015247chr1655320 4222 3603 1613 1529 ------
NM_015254chr831238 851 511 2562 162 1578 --
NM_015256chr51648 ------
NM_015265chr21845 11941 ----
NM_015270chr1211692 --1566 --
NM_015272chr1631773 1764 84 11685 ----
NM_015277chr1811149 ------
NM_015284chr13775 475 400 ------
NM_015288chr552775 2631 1185 864 653 --2684 216 --
NM_015299chr1443829 3732 3319 1038 --12836 2390 284
NM_015313chr11------1978
NM_015315chr532713 1187 491 21038 1000 1479 --
NM_015317chr222141 668 ------
NM_015326chr132585 2307 525 --12280 --
NM_015327chr111182 ----1540
NM_015328chr712772 12030 ----
NM_015332chr71445 --21205 494 --
NM_015346chr1451613 1404 1316 1308 102 ------
NM_015347chr1242933 2183 1997 465 ----1820
NM_015349chr622761 1097 1685 ----
NM_015365chrX1134 ------
NM_015374chr222435 87 --11285 11370
NM_015385chr1032672 2628 962 ----1751
NM_015393chr42713 151 ----13245
NM_015397chr931517 301 156 ------
NM_015401chr122812 360 --3898 676 321 --
NM_015443chr171452 ----1414
NM_015444chr33226 178 82 ------
NM_015483chr7----11016 --
NM_015534chr11153 ------
NM_015537chr9----3734 160 98 --
NM_015564chr5--12958 ----
NM_015565chr211557 1123 ----
NM_015567chr13----1136 --
NM_015568chr2053955 3522 1665 1623 111 1313 ----
NM_015575chr222430 1429 12949 ----
NM_015576chr332335 683 77 ------
NM_015577chr521753 1402 11728 ----
NM_015609chr162788 2702 2105 789 692 142 ------
NM_015645chr11--1317 1266 --
NM_015646chr12124 ------
NM_015658chr11364 ------
NM_015670chr17----1457 --
NM_015713chr813128 ----1793
NM_015726chr111713 11831 ----
NM_015831chr73940 775 380 ------
NM_015833chr2121955 1676 ------
NM_015844chr181171 ------
NM_015845chr181215 --1266 --
NM_015846chr181171 ------
NM_015847chr181171 ------
NM_015850chr841696 622 451 400 ------
NM_015872chr131371 705 326 ------
NM_015879chr1878538 7169 6508 2977 1969 371 339 12096 --15691
NM_015886chr824345 3624 ------
NM_015898chr1932069 1927 499 ------
NM_015906chr1----11401 14765
NM_015981chr522461 1280 --11022 --
NM_015995chr15115176 5045 4971 4663 4299 3661 2070 2045 1863 928 521 35245 4325 328 ----
NM_016032chrX31254 1140 427 ------
NM_016037chr13861 804 96 ------
NM_016048chr51200 ------
NM_016057chr1211293 ------
NM_016063chr61559 ------
NM_016075chr1321221 944 ------
NM_016076chr132647 262 36 ------
NM_016084chr171421 --1568 1177
NM_016089chr31392 ------
NM_016107chr53364 227 203 --11254 --
NM_016147chr11137 ------
NM_016152chr321211 352 ------
NM_016166chr15175 ------
NM_016169chr1072681 2491 2286 2179 978 540 456 2430 304 ----
NM_016179chr13----155 --
NM_016201chr34690 458 233 95 ------
NM_016203chr72971 50 ------
NM_016205chr421342 908 ------
NM_016206chr378074 7419 7084 2974 2388 2346 567 38346 2657 2161 ----
NM_016219chr92113 30 --2454 125 --
NM_016248chr1313499 ------
NM_016252chr23886 859 38 ------
NM_016257chr152503 1310 1077 111 69 1578 ----
NM_016260chr221556 164 12683 ----
NM_016277chr62175 141 ------
NM_016329chr3----197 --
NM_016339chr1721671 1131 ----11354
NM_016374chr111599 ------
NM_016374chr111599 ------
NM_016403chr111608 ------
NM_016436chr20159 --12533 --
NM_016441chr22417 147 ------
NM_016497chr12--123 ----
NM_016516chr21326 1248 ----
NM_016522chr1121298 425 ------
NM_016525chr91860 2277 94 ----
NM_016529chr132972 269 ------
NM_016569chr1211003 ------
NM_016580chr51285 122 ----
NM_016596chr122812 360 --3898 676 321 --
NM_016605chr521728 116 ----1602
NM_016620chr121354 354 ------
NM_016621chr1164353 4019 3462 3178 1771 600 ------
NM_016654chr1521335 143 ------
NM_016824chr1031507 711 231 ------
NM_016834chr1754011 2821 2784 400 349 11079 13062 --
NM_016835chr1754011 2821 2784 400 349 11079 13062 --
NM_016841chr1754011 2821 2784 400 349 11079 13062 --
NM_017413chrX--176 1568 --
NM_017423chr41279 ------
NM_017447chr2124374 4216 ------
NM_017449chr141453 1321 542 371 ------
NM_017450chr1741329 1083 468 30 --1926 --
NM_017519chr611288 ------
NM_017544chrX----172 --
NM_017558chr162359 161 ------
NM_017563chr351556 1531 1479 356 212 ------
NM_017582chr11125 1654 11313 --
NM_017594chr933044 1340 689 23104 183 12742 --
NM_017610chr152780 123 ------
NM_017612chr12143 ------
NM_017617chr931386 63 45 ------
NM_017626chr1021658 254 11750 ----
NM_017633chr633704 2428 1505 ------
NM_017634chr8--1705 ----
NM_017637chr947828 7785 2701 132 18254 ----
NM_017643chr1732198 973 873 1643 ----
NM_017666chrX21897 1383 12055 ----
NM_017670chr113316 201 181 ------
NM_017700chr42226 120 ------
NM_017709chr143551 1192 310 113 ------
NM_017714chr201708 ------
NM_017715chr71566 ------
NM_017719chr34806 617 417 402 ------
NM_017730chr3----1215 --
NM_017737chr11358 ------
NM_017742chr183520 466 186 ------
NM_017772chr611617 2546 169 ----
NM_017780chr81265 ------
NM_017789chr22150 100 ------
NM_017813chr815022 15394 ----
NM_017845chr41680 ------
NM_017848chrX21683 283 ------
NM_017849chr262768 2622 2305 1979 1276 853 --2504 443 --
NM_017873chr93832 614 489 --2572 183 --
NM_017893chr101369 ------
NM_017905chr13--1186 ----
NM_017923chr41683 ------
NM_017938chrX11375 ----1682
NM_017954chr731682 1497 272 ------
NM_017957chr1741563 1316 1099 46 162 --1137
NM_017964chr21379 ------
NM_017982chr121264 38 1422 ----
NM_017994chr721202 83 ------
NM_018011chr131145 ------
NM_018027chr10--12804 1288 --
NM_018045chr162773 2756 2615 2228 1117 119 12802 12831 --
NM_018047chr5126 ------
NM_018092chr161353 ------
NM_018121chr1012083 ------
NM_018125chr1----1453 --
NM_018150chr11248 1169 ----
NM_018159chrX----1176 --
NM_018191chr13----136 --
NM_018195chr1111942 1808 ----
NM_018198chr111272 --1272 1959
NM_018208chr151203 793 295 216 155 --11138 --
NM_018218chr25713 647 355 175 40 --1531 1213
NM_018223chr12----1135 --
NM_018227chr412587 1286 ----
NM_018234chr242157 1947 485 460 ----22188 22
NM_018240chr12219 176 ------
NM_018243chr423615 204 1227 ----
NM_018244chr20138 ------
NM_018265chr161844 1600 788 530 476 355 --1363 --
NM_018293chr321099 776 ------
NM_018314chr111469 ------
NM_018315chr411257 ------
NM_018361chr82540 245 --11017 --
NM_018364chr11552 1293 ----
NM_018383chr221268 653 134 ----
NM_018388chrX----11407 --
NM_018403chr31469 --1681 13952
NM_018419chr20180 ------
NM_018425chr1032478 1955 961 12093 1986 --
NM_018440chr837558 6549 5729 28327 7158 ----
NM_018462chr31152 ------
NM_018489chr121944 71 ------
NM_018509chr1731463 657 535 ------
NM_018557chr211178 --11161 --
NM_018566chr111025 --155 --
NM_018584chr11983 --1195 --
NM_018638chr1221401 1338 --23837 2160 --
NM_018660chr842346 872 834 123 ------
NM_018667chr165999 790 339 166 157 --21094 771 --
NM_018688chr81313 ------
NM_018710chr8--163 ----
NM_018713chr11117 ------
NM_018717chr442396 1118 663 512 ------
NM_018898chr522090 217 --1328 --
NM_018899chr522090 217 --1328 --
NM_018900chr522090 217 --1328 --
NM_018901chr522090 217 --1328 --
NM_018902chr522090 217 --1328 --
NM_018903chr522090 217 --1328 --
NM_018904chr522090 217 --1328 --
NM_018905chr522090 217 --1328 --
NM_018906chr522090 217 --1328 --
NM_018907chr522090 217 --1328 --
NM_018908chr522090 217 --1328 --
NM_018909chr522090 217 --1328 --
NM_018910chr522090 217 --1328 --
NM_018911chr522090 217 --1328 --
NM_018912chr521569 208 ------
NM_018913chr521569 208 ------
NM_018914chr521569 208 ------
NM_018915chr521569 208 ------
NM_018916chr521569 208 ------
NM_018917chr521569 208 ------
NM_018918chr521569 208 ------
NM_018919chr521569 208 ------
NM_018920chr521569 208 ------
NM_018921chr521569 208 ------
NM_018922chr521569 208 ------
NM_018923chr521569 208 ------
NM_018924chr521569 208 ------
NM_018925chr521569 208 ------
NM_018926chr521569 208 ------
NM_018927chr521569 208 ------
NM_018928chr521569 208 ------
NM_018929chr521569 208 ------
NM_018948chr111165 ------
NM_018951chr72336 69 ------
NM_018952chr172183 116 ----1568
NM_018953chr123815 326 255 ------
NM_018959chr191523 ------
NM_018963chr21----1177 --
NM_018970chr71305 ------
NM_018976chr1212117 --1961 --
NM_018979chr1222559 766 11747 ----
NM_018994chr11532 ------
NM_018999chr1024179 525 ------
NM_019009chr1172362 1818 1651 770 679 613 566 --11723 12424
NM_019036chr6185 1439 ----
NM_019053chr10--21092 900 ----
NM_019063chr212069 ------
NM_019074chr152647 298 --2832 306 --
NM_019096chr62221 86 ------
NM_019114chr932059 104 60 --12411 --
NM_019116chr1643636 2876 2434 2294 12649 ----
NM_019595chr22240 133 ------
NM_019613chr172858 286 ------
NM_019845chr21125 --1337 --
NM_019850chr23628 560 498 --174 --
NM_019885chr22893 265 --22307 942 --
NM_019903chr1031507 711 231 ------
NM_020039chr1251939 1607 1198 393 105 --11922 --
NM_020116chr411802 ------
NM_020122chr235959 1498 572 ------
NM_020134chr21169 ------
NM_020144chr71164 ------
NM_020147chr15122 ------
NM_020178chr171456 ------
NM_020184chr222069 178 1482 ----
NM_020198chr172192 44 ------
NM_020211chr152980 32 ------
NM_020228chr11165 ------
NM_020229chr114175 121 101 31 ------
NM_020238chr1121062 258 ------
NM_020239chr152172 2156 2043 1774 176 11449 ----
NM_020248chr1----31854 718 352 --
NM_020310chr171521 1415 11855 1731
NM_020338chr1062865 2459 2450 2368 1387 562 22633 2509 12518 --
NM_020341chr20--11374 11516 --
NM_020348chr1031771 1082 310 ----1761
NM_020383chr10------140
NM_020390chr31394 14413 ----
NM_020438chr941429 908 429 324 ------
NM_020443chr146332 2618 1702 766 1670 ----
NM_020475chr842403 1650 1507 77 --32242 2220 1890 --
NM_020476chr842403 1650 1507 77 --32242 2220 1890 --
NM_020477chr842403 1650 1507 77 --32242 2220 1890 --
NM_020478chr842466 1713 1570 140 --32305 2283 1953 --
NM_020480chr842403 1650 1507 77 --32242 2220 1890 --
NM_020526chr12395 140 ----11692
NM_020530chr22145 ------
NM_020630chr10186 ------
NM_020644chr111863 ------
NM_020651chr2----195 --
NM_020699chr153843 2022 1811 1566 224 1748 ----
NM_020702chr911161 --11534 --
NM_020704chr72683 59 ------
NM_020708chr202401 390 ----151
NM_020711chr242396 1970 1019 467 ------
NM_020717chrX13770 --24680 1819 --
NM_020728chr722514 1276 ------
NM_020732chr611288 ------
NM_020734chr122778 460 ------
NM_020766chrX11162 ----1389
NM_020772chr1747148 5416 619 252 --1741 --
NM_020773chr411922 --2670 595 --
NM_020777chr461922 654 643 555 537 318 ----1859
NM_020792chr321893 487 12310 --1359
NM_020794chr121510 217 ------
NM_020795chr1721999 252 1192 ----
NM_020796chr52982 143 ------
NM_020800chr3--11339 ----
NM_020801chr542582 1666 54 37 --11786 --
NM_020804chr642546 1734 1695 267 --11856 --
NM_020808chr11760 --1294 --
NM_020818chr14134 ------
NM_020820chr205631 506 365 290 150 137 21251 117 1578
NM_020845chr1232499 2424 1013 ------
NM_020850chr1623093 1098 1344 123 --
NM_020856chr192461 125 ------
NM_020871chrX12142 ------
NM_020888chr131864 1453 220 ------
NM_020895chr19----1271 --
NM_020899chr171330 1639 ----
NM_020918chr1053474 2755 2594 957 175 ------
NM_020920chr142319 55 ------
NM_020948chr111341 ------
NM_020951chr1911666 ------
NM_020952chr91330 ------
NM_020962chr1521867 488 --12191 --
NM_020977chr421723 130 ------
NM_020987chr10--1230 ----
NM_020993chr1232454 894 446 12132 ----
NM_021033chr1311278 ------
NM_021064chr641236 1186 587 318 ------
NM_021069chr421372 716 ------
NM_021079chr1742124 1281 206 194 22677 2114 ----
NM_021120chrX42933 1207 904 451 1358 ----
NM_021136chr141293 1708 ----
NM_021155chr1922204 67 12556 32135 1000 985 11945
NM_021161chr142476 162 ------
NM_021163chr71420 ------
NM_021165chr11743 ------
NM_021174chr8----1651 --
NM_021183chrX12376 ------
NM_021192chr22393 362 ------
NM_021195chr162183 23 2474 412 ----
NM_021202chr2062740 1944 1134 500 323 270 ------
NM_021237chr31125 ------
NM_021240chr91196 ------
NM_021245chr102239 40 ------
NM_021249chr1411597 1674 ----
NM_021619chr931044 496 248 ----1422
NM_021622chr1012063 ------
NM_021627chr311066 ------
NM_021631chr8123 ------
NM_021637chrX1209 ------
NM_021638chr43879 132 81 --14435 23590 967
NM_021643chr221864 68 ------
NM_021647chr421766 1316 ------
NM_021728chr142892 126 1795 ----
NM_021738chr102737 594 1640 ----
NM_021784chr202183 33 ------
NM_021813chr665144 4842 2319 2223 908 145 --11761 --
NM_021818chr1421040 79 ------
NM_021911chr515486 ------
NM_021912chr1523731 562 ------
NM_021913chr1921816 733 11343 ----
NM_021946chrX21245 574 --21429 1105 --
NM_021964chr311652 ------
NM_022003chr1141124 1070 963 934 129 1838 --
NM_022075chr11667 --187 --
NM_022130chr511009 ------
NM_022157chr1125 ------
NM_022166chr1684746 2353 2090 1163 678 612 510 453 14123 24887 406 --
NM_022169chr111386 1512 1172 --
NM_022336chr2------159
NM_022346chr421412 1197 ------
NM_022361chr6--1413 ----
NM_022455chr5--1298 ----
NM_022459chr1332477 1427 855 ------
NM_022462chr19153759 3612 3077 2736 2672 2491 1483 1451 1385 1327 1210 915 618 215 189 13681 2637 554 --
NM_022465chr1232307 532 510 ----12464
NM_022476chr16146 ------
NM_022479chr73981 916 233 ----11101
NM_022494chr10191 ------
NM_022497chr342883 774 380 205 2393 109 --1809
NM_022574chr751413 787 759 701 650 ------
NM_022652chr122444 234 ------
NM_022658chr121379 --1155 --
NM_022659chr81173 ------
NM_022716chr12205 65 --11263 --
NM_022742chr7162 ------
NM_022749chr831240 552 381 ------
NM_022750chr7136 --1508 --
NM_022758chr622622 112 179 1912 --
NM_022831chr1165 ------
NM_022833chr921363 1075 150 171 --
NM_022836chr121248 574 ------
NM_022893chr21441 ------
NM_022897chr52812 264 ------
NM_022898chr1424613 837 ------
NM_022965chr411250 1591 1361 --
NM_023067chr32521 108 2295 121 ----
NM_023076chr1682787 2686 2422 2336 2276 2188 765 297 ------
NM_023079chr172210 140 ------
NM_023105chr841696 622 451 400 ------
NM_023106chr841696 622 451 400 ------
NM_023110chr841696 622 451 400 ------
NM_023111chr841696 622 451 400 ------
NM_023112chr1452709 1052 478 352 66 1283 12039 12505
NM_023929chr812769 ------
NM_024016chr171578 --193 --
NM_024019chr41199 ------
NM_024046chr3----11261 --
NM_024050chr192605 487 ------
NM_024085chr2----1841 --
NM_024090chr411867 ----11405
NM_024117chr921046 28 ------
NM_024294chr622622 112 179 1912 --
NM_024336chr16175 ------
NM_024348chr91255 ------
NM_024429chr72971 50 ------
NM_024430chr1821233 27 ------
NM_024490chr15----1529 --
NM_024536chr22303 138 ----1162
NM_024551chr1252348 2074 2005 273 142 ----11029
NM_024551chr1252348 2074 2005 273 142 ----11029
NM_024554chr111130 1136 11472 --
NM_024556chr111324 ------
NM_024581chr6124 ------
NM_024607chr844211 3793 1576 52 ------
NM_024628chr311099 ------
NM_024643chr14129 ------
NM_024645chr8--21555 993 ----
NM_024659chr21345 ------
NM_024665chr344260 3909 1321 744 14165 ----
NM_024704chr202186 57 ------
NM_024742chr1631501 1205 730 11937 ----
NM_024744chr2133 ------
NM_024755chr152792 335 ------
NM_024757chr941119 439 372 102 ------
NM_024761chr944027 3312 550 512 25042 452 ----
NM_024779chr1221420 1297 1397 ----
NM_024792chr17----1285 --
NM_024830chr551591 418 339 83 77 --11413 --
NM_024834chr10------1390
NM_024854chr1211315 ------
NM_024909chr621056 530 ------
NM_024911chr12715 227 ------
NM_024915chr821967 1828 --1516 --
NM_024927chr17157 ------
NM_024933chr22590 74 ------
NM_024949chr434534 1898 1280 ------
NM_024953chr121700 ------
NM_024971chr91330 ------
NM_024991chr1032672 2628 962 ----1751
NM_025004chr111270 ------
NM_025054chr822830 194 ------
NM_025080chr111774 11071 ----
NM_025083chr1511322 --1195 --
NM_025181chr22751 61 ------
NM_025222chr342501 2052 355 253 ------
NM_025224chr2042011 796 570 38 --21801 194 --
NM_025251chr831079 276 210 ------
NM_030576chr1731913 237 145 12079 11950 --
NM_030629chr1661750 1727 1440 1286 414 203 ------
NM_030647chr724874 647 --25776 3976 --
NM_030648chr432122 1304 649 11954 --14728
NM_030651chr62687 227 ------
NM_030661chr731408 1398 1370 --11099 --
NM_030665chr1741149 1138 505 321 1366 --1207
NM_030674chr1275865 4326 2226 1554 792 662 584 --13622 --
NM_030761chr122035 1749 1429 --12623
NM_030799chr512087 ------
NM_030808chr1711046 --1847 --
NM_030809chr12--1725 11962 --
NM_030816chr123712 3153 ------
NM_030881chr2221945 1754 ------
NM_030884chr331609 629 405 11518 1120 --
NM_030885chr32198 146 ------
NM_030913chr1----1485 --
NM_030916chr13736 667 657 ------
NM_030918chr121473 608 2988 59 1470 --
NM_030949chr621397 1137 ------
NM_030962chr112533 498 ------
NM_030964chr52751 28 1907 22925 2689 1140
NM_030981chr1131141 980 900 1857 ----
NM_031226chr15--127 ----
NM_031268chr1643647 1322 755 239 12122 21813 603 1722
NM_031283chr2--1104 ----
NM_031286chr11329 ------
NM_031371chr111599 ------
NM_031371chr111599 ------
NM_031411chr522090 217 --1328 --
NM_031417chr1942793 429 271 44 ------
NM_031443chr71403 ------
NM_031445chr242854 2666 732 235 ------
NM_031459chr131487 393 189 ------
NM_031492chr11166 ----1407
NM_031844chr123652 1404 --12687 --
NM_031845chr242812 2719 248 65 12917 ----
NM_031847chr242812 2719 248 65 12917 ----
NM_031849chr522090 217 --1328 --
NM_031857chr522090 217 --1328 --
NM_031860chr522090 217 --1328 --
NM_031891chr18156 1141 1349 --
NM_031948chr16137 ------
NM_031958chr17124 ------
NM_032041chr852210 2128 2046 476 172 ------
NM_032088chr521569 208 ------
NM_032092chr521569 208 ------
NM_032109chr541151 428 66 25 11495 ----
NM_032128chr41835 ------
NM_032144chr22620 85 ------
NM_032153chr331067 304 36 --11799 --
NM_032174chr111066 --1967 --
NM_032181chr22331 91 ------
NM_032186chr121354 354 ------
NM_032199chr1013637 ------
NM_032205chr8133 ------
NM_032233chr141741 ------
NM_032236chr12754 421 ------
NM_032242chr362818 2284 1085 765 664 615 --12631 --
NM_032271chr1651505 1345 503 493 206 --1123 --
NM_032281chr1922358 163 ------
NM_032283chr131717 1383 156 1251 11337 1414
NM_032329chr2113100 1570 1524 1385 1058 737 728 584 500 488 401 1640 ----
NM_032339chr17128 ------
NM_032345chr122134 52 ------
NM_032403chr521569 208 ------
NM_032413chr15------1140
NM_032429chr104465 138 33 21 ----1403
NM_032431chr112930 118 ------
NM_032458chrX1648 ------
NM_032466chr811083 11560 ----
NM_032468chr811083 11560 ----
NM_032499chr15--1290 ----
NM_032509chr8--11866 ----
NM_032510chr1812087 1135 1914 --
NM_032538chr621861 758 31807 1053 576 ----
NM_032539chrX2770 45 ------
NM_032560chr14--1304 ----
NM_032564chr11158 ------
NM_032575chr1651683 1630 1513 1505 626 ------
NM_032595chr17--1348 11454 --
NM_032682chr322408 1207 ------
NM_032711chr1743617 1618 1530 485 13327 13402 --
NM_032731chr1721517 1485 ------
NM_032781chr112798 27 ------
NM_032784chr61110 ------
NM_032808chr153885 839 828 1746 1616 --
NM_032829chr1211031 ----11040
NM_032842chr7--21330 260 ----
NM_032859chr13----1625 --
NM_032876chr142827 117 1746 ----
NM_032884chr1155 ------
NM_032900chr1041529 1382 1195 859 12516 --23020 962
NM_032932chr1786266 5852 4804 2572 1042 353 326 112 12149 11011 12091
NM_032961chr41424 ------
NM_033020chr1----11401 14765
NM_033027chr3--2300 150 11104 --
NM_033089chr201599 ------
NM_033116chr141267 ------
NM_033129chr2041661 1451 533 224 ------
NM_033132chr131576 ------
NM_033133chr1772910 2636 971 862 482 463 344 1962 12470 --
NM_033138chr7169 ------
NM_033139chr7169 ------
NM_033140chr7169 ------
NM_033157chr7169 ------
NM_033207chr101995 12237 --1126
NM_033222chr91577 ------
NM_033224chr715125 16585 ----
NM_033225chr8196 ------
NM_033259chr33826 570 348 1154 128 --
NM_033274chr573296 3034 2306 1340 1301 1139 873 2738 41 ----
NM_033285chr833891 2728 1151 ------
NM_033290chrX42625 1386 953 506 ------
NM_033326chr1131845 1698 1658 --11675 --
NM_033331chr932691 2247 274 ------
NM_033334chr9------163
NM_033386chr2281112 1075 972 912 715 450 129 60 --2356 170 --
NM_033389chr1764700 3381 827 612 564 538 ------
NM_033394chr211175 ------
NM_033420chr192942 780 ------
NM_033449chr532007 1682 269 1353 ----
NM_033495chrX1104 ------
NM_033503chr1563743 3386 3340 1306 339 272 --23619 486 11210
NM_033505chr225573 763 --16403 --
NM_033515chr61265 ------
NM_033551chr532713 1187 491 21038 1000 1479 --
NM_033626chrX11417 1410 ----
NM_033632chr411257 ------
NM_033642chrX126 ------
NM_033644chr521703 181 22213 555 ----
NM_033645chr521703 181 22213 555 ----
NM_048368chr183597 531 66 ------
NM_052818chr131346 --11905 --
NM_052837chr1170 --1257 --
NM_052840chr1511269 ------
NM_052849chr151300 ------
NM_052855chr172105 52 ------
NM_052864chr4145 ------
NM_052868chr13185 65 42 ------
NM_052872chr6161 ------
NM_052875chr1121742 253 2609 156 ----
NM_052880chr2211457 ------
NM_052898chr81459 ------
NM_052905chr221400 603 ------
NM_052906chr2254873 1835 1587 1180 980 --11423 --
NM_052907chr1223674 568 1516 ----
NM_052937chr81500 ------
NM_052954chr211534 ------
NM_052968chr114704 660 534 55 ------
NM_052971chr5150 ------
NM_052978chr14170 ------
NM_053001chr81282 ------
NM_053002chr3----1957 --
NM_053023chr1121300 756 1485 --1352
NM_053025chr31650 ------
NM_053026chr31650 ------
NM_053027chr31650 ------
NM_053028chr31650 ------
NM_053031chr31650 ------
NM_053032chr31650 ------
NM_053043chr796179 5854 5768 5673 5327 979 869 764 103 --26102 5481 --
NM_054033chr22607 190 ------
NM_054035chr17--1594 ----
NM_057175chr412318 1993 ----
NM_057178chr1742819 1004 689 446 11775 ----
NM_058164chr192435 41 ------
NM_058175chr211183 1254 1704 --
NM_058241chr211810 ------
NM_058241chr211810 ------
NM_080415chr171899 --135 --
NM_080552chr201120 1447 ----
NM_080594chr164608 239 208 107 ------
NM_080616chr201217 ----1252
NM_080669chr1731951 1939 1677 1513 11584 --
NM_080676chr2021120 154 --136 --
NM_080738chr121888 1563 133 ----
NM_080759chr1312030 ------
NM_080760chr1312030 ------
NM_080829chr202139 77 ----1775
NM_080881chr53120 96 58 1114 1498 --
NM_080927chr322918 349 ------
NM_130385chr1122371 32 1748 1733 --
NM_130391chr9------13092
NM_130392chr9------13092
NM_130393chr9------13092
NM_130435chr1022852 1911 ------
NM_130439chr101577 ------
NM_130439chr101577 ------
NM_130440chr111382 ----145
NM_130468chr152585 85 --191 --
NM_130797chr721529 1119 --11725 --
NM_130798chr1521362 185 ------
NM_130799chr113667 187 42 ------
NM_130800chr113667 187 42 ------
NM_130801chr113667 187 42 ------
NM_130802chr113667 187 42 ------
NM_130803chr113667 187 42 ------
NM_130804chr113667 187 42 ------
NM_130811chr201405 ------
NM_130848chr531842 607 97 --1821 --
NM_133170chr2086813 2301 2010 592 494 461 155 92 15422 16352 12593
NM_133171chr201209 ------
NM_133172chr5----134 --
NM_133173chr5----134 --
NM_133174chr5----134 --
NM_133264chr1743158 1339 884 745 23657 176 13594 --
NM_133265chrX----12313 1689
NM_133372chr522762 2129 ------
NM_133444chr195574 463 435 208 60 11676 ----
NM_133445chr943660 2810 1029 239 --1744 --
NM_133452chr1941138 1047 475 199 1302 ----
NM_133468chr711905 1438 ----
NM_133499chrX2983 116 ------
NM_133625chr341298 1282 1215 126 ------
NM_134325chr1367 59 24 ------
NM_134421chr21763 ------
NM_138300chr121598 1458 --21415 488 --
NM_138317chr142476 162 ------
NM_138318chr142476 162 ------
NM_138319chr15----1276 --
NM_138415chr2251498 1202 714 323 289 --11195 --
NM_138426chr712018 ------
NM_138444chr132197 188 ------
NM_138468chr246010 5159 4695 1038 11531 ----
NM_138473chr1274810 4685 4548 4194 1692 951 621 14783 ----
NM_138576chr1424613 837 ------
NM_138693chr73371 157 125 ------
NM_138694chr6--1345 --11090
NM_138713chr1638154 1876 673 16290 ----
NM_138714chr1638154 1876 673 16290 ----
NM_138717chr62528 243 ------
NM_138732chr111232 ------
NM_138734chr111232 ------
NM_138735chr211526 ------
NM_138774chr192223 63 --1933 --
NM_138775chr111697 ------
NM_138795chr141508 1332 641 125 ------
NM_138799chr221744 810 ------
NM_138969chr81468 11213 --1441
NM_138970chr141132 21818 337 --1285
NM_138992chr212780 177 --1125 --
NM_139014chr622223 2116 ----12182
NM_139035chrX------1117
NM_139135chr11265 ------
NM_139136chr121252 ------
NM_139157chr113642 628 78 ------
NM_139273chr111227 ------
NM_139280chr172205 125 195 ----
NM_139283chr12----1561 --
NM_139286chr91179 ------
NM_139321chr2021607 1543 --12850 13937
NM_144568chr141499 --1433 --
NM_144571chr435684 2559 1628 15936 --12172
NM_144579chr262769 2605 1826 1069 842 644 ------
NM_144582chr272515 2299 2196 831 734 469 359 1129 --1544
NM_144595chr131260 ------
NM_144635chr321075 241 --1827 --
NM_144660chr101289 ------
NM_144691chr194255 155 122 94 1485 ----
NM_144726chr5--137 ----
NM_144767chr1524585 1041 --1202 --
NM_144949chr21287 ------
NM_144967chrX11058 --1888 --
NM_144973chr1225095 686 1731 ----
NM_145058chr12131 ------
NM_145074chr22142 33 --1387 --
NM_145113chr14------1258
NM_145203chr131157 ------
NM_145206chr10--1310 12850 --
NM_145234chrX1698 ------
NM_145239chr163908 766 246 2391 296 ----
NM_145260chr22284 74 --1587 --
NM_145274chr171759 ------
NM_145307chr1023660 3363 ------
NM_145313chr1021318 448 ------
NM_145332chr62672 156 ------
NM_145333chr62672 156 ------
NM_145349chr1751832 1633 846 742 130 12122 1151 --
NM_145798chr171308 --128 --
NM_145805chr153391 205 81 ------
NM_145861chr121888 1563 133 ----
NM_145891chr161214 ------
NM_145892chr161214 ------
NM_145893chr161336 ------
NM_145899chr651301 401 353 118 67 1970 ----
NM_145901chr651301 401 353 118 67 1970 ----
NM_145902chr651301 401 353 118 67 1970 ----
NM_145903chr651301 401 353 118 67 1970 ----
NM_145904chr651301 401 353 118 67 1970 ----
NM_145905chr651301 401 353 118 67 1970 ----
NM_146388chr19----1964 --
NM_147147chr631556 1163 1056 13260 13909 --
NM_147150chr922818 340 22934 190 13106 --
NM_147223chr221574 553 ------
NM_147780chr822154 1813 ------
NM_147781chr822154 1813 ------
NM_147782chr822154 1813 ------
NM_147783chr822154 1813 ------
NM_152233chr1411597 1674 ----
NM_152237chr2241657 1199 507 226 11422 ----
NM_152244chr1711125 --1935 --
NM_152253chr2254288 3380 3095 1706 678 --44073 3429 1330 460 22849 995
NM_152265chr111144 1543 ----
NM_152272chr81324 --11133 --
NM_152287chr1631856 842 435 12015 2532 163 1416
NM_152310chr101309 ------
NM_152341chr1651334 1087 1049 323 306 --11210 --
NM_152342chr162404 37 ------
NM_152349chr17--1698 ----
NM_152375chr132607 128 69 12000 --1399
NM_152420chr91539 ------
NM_152437chr1221680 829 ------
NM_152441chr124209 77 69 60 --1147 --
NM_152453chr151181 ------
NM_152493chr121160 77 ------
NM_152520chr21425 ------
NM_152545chr41263 ------
NM_152608chr132014 569 561 ------
NM_152622chr51247 ------
NM_152629chr92936 203 ------
NM_152641chr1222753 144 ------
NM_152666chr1130 ------
NM_152682chr411514 ------
NM_152695chrX12028 ------
NM_152699chr323504 2714 12596 ----
NM_152733chr6106336 6319 5070 4639 4570 2219 1636 1290 1116 846 16109 34889 2104 1207 1514
NM_152744chr732872 1017 278 23196 48 12827 --
NM_152749chr72769 150 ------
NM_152756chr51124 ------
NM_152758chr8--21927 52 ----
NM_152787chrX13906 1427 ----
NM_152789chr71224 ------
NM_152838chr2011330 12377 ----
NM_152860chr1241399 273 258 107 ------
NM_152912chr13125 ------
NM_152924chr1556354 4289 2429 940 463 141 24223 906 --
NM_152996chr11423 ------
NM_153013chr522142 1728 ------
NM_153029chr1654021 3855 3544 3025 2786 ----1839
NM_153035chr122739 678 --1437 --
NM_153207chr1223024 188 ------
NM_153234chr51943 --12437 --
NM_153260chr1521319 1172 ------
NM_153273chr342359 774 548 223 --2783 434 --
NM_153321chr172175 29 ------
NM_153322chr172175 29 ------
NM_153334chr223307 267 39 --1181 --
NM_153335chr172572 435 --2980 111 --
NM_153350chr1641159 1148 416 165 ------
NM_153360chr2051057 910 541 425 99 ----133
NM_153367chr1043892 1004 782 432 ------
NM_153464chr191607 --1188 --
NM_153499chr1242371 489 224 143 --22025 868 --
NM_153500chr1242371 489 224 143 --22025 868 --
NM_153607chr522411 338 ------
NM_153619chr15--23152 892 ----
NM_153631chr731408 1398 1370 --11099 --
NM_153632chr731408 1398 1370 --11099 --
NM_153675chr202183 33 ------
NM_153693chr121813 ----1160
NM_153715chr72336 69 ------
NM_153748chr121252 ------
NM_153756chr141752 1380 161 142 --11360 --
NM_153810chr1021389 102 14511 14573 --
NM_170606chr711356 ------
NM_170607chr1721559 1246 --21220 635 1281
NM_170665chr1254222 4114 1843 1752 979 ------
NM_170706chr163980 3346 3123 1645 911 206 --6425 411 386 347 333 308 --
NM_170711chr191699 ----132
NM_171825chr522461 1280 --11022 --
NM_172020chr741861 1683 481 117 ------
NM_172037chr811093 ------
NM_172058chr8136 ------
NM_172059chr8136 ------
NM_172060chr8136 ------
NM_172071chr127180 1494 15470 ----
NM_172103chr62333 76 ------
NM_172105chr62333 76 ------
NM_172169chr101394 ----166
NM_172170chr101394 ----166
NM_172171chr101394 ----166
NM_172173chr101394 ----166
NM_172216chr1242273 391 126 45 --21927 770 --
NM_172226chr1242371 489 224 143 --22025 868 --
NM_172230chr112930 118 ------
NM_172337chr142892 126 1795 ----
NM_172349chr5--1298 ----
NM_173054chr71934 ------
NM_173074chr21238 1103 ----
NM_173156chr121894 674 1223 1659 --
NM_173214chr1638154 1876 673 16290 ----
NM_173354chr2131622 1402 309 ------
NM_173478chr17------11056
NM_173505chr181153 ------
NM_173525chr11121 ------
NM_173535chr23435 423 191 1409 ----
NM_173546chr3195 ------
NM_173564chr71693 --1249 --
NM_173576chr10140 ------
NM_173584chr112356 52 --1126 --
NM_173595chr1275250 4227 2086 1581 1381 1182 490 --15230 --
NM_173602chr1252626 1478 1320 940 61 12861 ----
NM_173618chr16----2348 113 --
NM_173642chr136335 2743 2407 --18595 --
NM_173653chr331362 537 152 ------
NM_173681chr7181 1571 21585 771 11387
NM_173683chr81527 ----11527
NM_173822chr211476 ------
NM_173833chr831179 199 185 ------
NM_173851chr853448 2884 2854 2685 1265 ------
NM_174902chr1121694 41 ------
NM_174909chr51669 ------
NM_174953chr174454 433 249 27 --1258 --
NM_174957chr174454 433 249 27 --1258 --
NM_175056chr3171 21560 25 ----
NM_175061chr711831 ------
NM_175575chr1721196 1156 ------
NM_175709chr2232877 602 435 --1214 --
NM_175736chr1277000 4806 2529 2231 1857 1403 1015 --1395 --
NM_175748chr1421625 1512 1861 ----
NM_175863chr611288 ------
NM_175920chr5159 ------
NM_175931chr1631570 1364 325 ------
NM_176801chr43426 397 306 ------
NM_177398chr111749 ------
NM_177399chr111749 ------
NM_177968chr222208 457 ------
NM_177972chr1143496 3074 2795 1288 11001 13742 --
NM_177990chr20--11374 11516 --
NM_177996chr2053386 2563 2553 2332 1095 13165 ----
NM_177999chr962454 1395 1177 1052 546 220 --21135 746 --
NM_178014chr61206 1790 ----
NM_178120chr22889 400 1515 ----
NM_178140chr522173 1937 ------
NM_178151chrX27826 180 1449 ----
NM_178152chrX27826 180 1449 ----
NM_178153chrX27826 180 1449 ----
NM_178313chr221938 45 12051 ----
NM_178426chr122265 255 1604 11867 --
NM_178427chr122165 155 1504 11767 --
NM_178496chr31157 ------
NM_178557chr461184 675 656 636 445 176 --3681 378 151 --
NM_178565chr81102 ----1506
NM_178568chr1761651 1352 360 341 259 122 ------
NM_178582chr203443 412 114 --1363 --
NM_178585chr412378 12506 ----
NM_178586chr143740 713 119 147 11505 --
NM_178818chr1611578 --21729 1678 --
NM_178835chr41585 ------
NM_178839chr2198 ------
NM_178863chr162195 88 ------
NM_180976chr61302 ------
NM_180977chr61302 ------
NM_181351chr1132890 2370 2039 ------
NM_181358chr133394 3352 155 ------
NM_181425chr91197 138 ----
NM_181458chr2174 ------
NM_181461chr2170 ------
NM_181504chr5--2384 54 ----
NM_181523chr5--2384 54 ----
NM_181524chr5--2384 54 ----
NM_181645chr11----159 --
NM_181656chr17180 ------
NM_181670chr121107 ------
NM_181672chrX----11889 --
NM_181673chrX----11889 --
NM_181714chr6------1429
NM_181715chr1--1308 ----
NM_181746chr11667 --187 --
NM_181803chr20------124
NM_181839chr831344 401 292 ------
NM_181844chr172698 456 --1656 --
NM_182488chr132901 47 ------
NM_182507chr1231554 865 340 1734 ----
NM_182509chr1431660 1354 137 ------
NM_182527chr2231675 868 206 ------
NM_182546chr7--1164 ----
NM_182557chr1131787 765 490 --12204 --
NM_182643chr81826 ------
NM_182663chr12374 94 --1654 --
NM_182664chr12504 224 --1784 --
NM_182665chr12374 94 --1654 --
NM_182697chr721498 311 ------
NM_182700chr7--11921 --1551
NM_182760chr32778 307 ------
NM_182764chr201209 ------
NM_182765chr1022036 1650 ------
NM_182767chr1221479 110 ------
NM_182811chr20199 ----1203
NM_182895chr223307 267 39 --1181 --
NM_182898chr724794 4269 ------
NM_182899chr724794 4269 ------
NM_182915chr242157 1947 485 460 ----22188 22
NM_182970chr2043920 3507 3180 2638 24087 3800 1773 --
NM_182972chr11843 ------
NM_182977chr52852 379 ------
NM_183004chr141322 12869 ----
NM_183227chr62175 141 ------
NM_183234chr151727 ------
NM_183235chr151727 ------
NM_183236chr151727 ------
NM_183238chr1233771 3082 2422 11141 --12984
NM_183373chr62729 48 ----1101
NM_183397chr2084940 4117 4025 3545 3202 1523 543 344 14859 ----
NM_183425chr2031396 1075 186 11637 ----
NM_184041chr161169 ------
NM_184043chr161169 ------
NM_184234chr202746 737 ------
NM_194281chr18--151 ----
NM_194282chr413001 --1689 --
NM_194285chr1122498 39 ------
NM_194286chr1235814 1762 972 25989 1419 --15624
NM_197955chr15------1140
NM_198057chrX11282 1196 ----
NM_198074chr11320 ----1461
NM_198081chr612026 --12401 1462
NM_198086chr142827 117 1746 ----
NM_198098chr721817 1643 ------
NM_198158chr31658 ------
NM_198159chr31658 ------
NM_198177chr31658 ------
NM_198178chr31658 ------
NM_198181chr1521186 294 1573 1710 --
NM_198204chr1721559 1246 --21220 635 1281
NM_198205chr1721559 1246 --21220 635 1281
NM_198213chr123545 520 162 ------
NM_198268chr133394 3352 155 ------
NM_198269chr133394 3352 155 ------
NM_198270chrX--1384 11297 --
NM_198291chr2041941 1576 1274 272 1284 31923 1394 1328 --
NM_198390chr1661750 1727 1440 1286 414 203 ------
NM_198392chr662003 1501 917 237 137 65 --1355 --
NM_198400chr15173 11907 ----
NM_198490chr372941 2471 1192 1084 424 322 131 --13050 1125
NM_198560chr353637 3096 1485 561 82 ----1678
NM_198581chr246457 6129 5555 5498 ----11641
NM_198595chr43879 132 81 --14435 23590 967
NM_198597chr101112 ----1990
NM_198686chr1432476 557 303 148 ----
NM_198715chr136292 5887 80 ------
NM_198859chr385069 4879 4320 4166 3503 1113 690 327 11975 ----
NM_198880chr3----1215 --
NM_198896chr111768 ------
NM_198900chr1277000 4806 2529 2231 1857 1403 1015 --1395 --
NM_198956chr7--11921 --1551
NM_198995chr18----1228 --
NM_199000chr712080 ------
NM_199051chr11272 ------
NM_199192chr22376 300 ------
NM_199193chr22376 300 ------
NM_199205chr8----1651 --
NM_199245chr1242450 2110 1775 83 ------
NM_199247chr17----133 --
NM_199248chr17----133 --
NM_199320chr442312 909 520 63 --11999 --
NM_199320chr442312 909 520 63 --11999 --
NM_199355chr161136 ------
NM_199437chr11165 ------
NM_199438chr11165 ------
NM_199439chr11165 ------
NM_199487chr20138 ------
NM_201269chr121354 354 ------
NM_201378chr82820 25 ------
NM_201379chr82820 25 ------
NM_201380chr82820 25 ------
NM_201381chr82820 25 ------
NM_201382chr82820 25 ------
NM_201383chr82820 25 ------
NM_201384chr82820 25 ------
NM_201413chr211744 ------
NM_201414chr211744 ------
NM_201444chr12173 ------
NM_201445chr12173 ------
NM_201554chr12173 ------
NM_201567chr341744 1392 642 269 ------
NM_201568chr121894 674 1223 1659 --
NM_201569chr121894 674 1223 1659 --
NM_201591chr411722 ------
NM_201592chr411722 ------
NM_201613chr121355 ------
NM_201999chr411141 --1816 --
NM_203364chr111117 ------
NM_203394chr1222618 198 ------
NM_203434chr931117 989 458 ------
NM_203459chr11123 ------
NM_205848chr132687 2561 76 ------
NM_205860chr121977 22 ------
NM_206594chr112304 ------
NM_206595chr112304 ------
NM_206852chr141293 1708 ----
NM_206854chr633355 1335 303 ------
NM_206855chr634320 2300 1268 ------
NM_206857chr141293 1708 ----
NM_206900chr19153 1284 ----
NM_206901chr19153 1284 ----
NM_206907chr521153 1038 ------
NM_206925chr152947 61 42222 627 458 70 ----
NM_206944chr91330 ------
NM_206945chr91330 ------
NM_206946chr91330 ------
NM_206947chr91330 ------
NM_207043chr11928 1781 1579 --
NM_207044chr11928 1781 1579 --
NM_207047chr11928 1781 1579 --
NM_207113chr7158 ------
NM_207306chr133332 211 103 1194 13726 --
NM_207344chr121438 --1504 --
NM_207396chr13743 460 122 ------
NM_207422chrX21054 23 --11409 --
NM_207445chr1521580 212 ------
NM_212464chr1531826 1457 832 ----1397
NM_212467chr1572403 2034 1023 956 651 350 305 21839 1641 --11805
NM_212469chr112823 76 ------
NM_212474chr22729 227 ----1119
NM_212475chr22729 227 ----1119
NM_212476chr22729 227 ----1119
NM_212478chr22729 227 ----1119
NM_212482chr22729 227 ----1119
NM_212558chr932988 135 73 ------
NM_213609chr31804 141 ----
NM_213618chr113642 628 78 ------