TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1207-5p
miRNA Sequence: UGGCAGGGAGGCUGGGAGGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511000 ------
NM_000016chr11613 ------
NM_000020chr1282170 1973 1888 954 816 198 126 27 --3422 368 186 1449
NM_000022chr202218 30 ------
NM_000024chr51134 ------
NM_000029chr1--1601 141 --
NM_000037chr862278 2182 1714 724 542 234 1175 11819 2767 81
NM_000038chr531365 1311 514 --11498 --
NM_000044chrX386 73 59 ------
NM_000053chr136672 490 428 306 138 36 32075 1351 708 31595 572 199 --
NM_000055chr31318 ------
NM_000068chr1941445 1310 362 117 ------
NM_000074chrX2844 81 1322 2786 201 --
NM_000076chr112266 38 ------
NM_000080chr171260 --4829 632 599 98 --
NM_000081chr111363 --11233 --
NM_000082chr52698 30 ------
NM_000084chrX86329 6081 5388 4928 4810 2200 2146 1319 25232 2716 36166 5374 5359 --
NM_000088chr1761232 1156 1135 510 451 324 ------
NM_000092chr284340 4306 4244 4020 3314 3033 2994 2959 24533 2936 --11636
NM_000093chr9--22118 1931 ----
NM_000097chr32489 118 ------
NM_000109chrX21068 826 1336 ----
NM_000114chr20----1209 --
NM_000118chr94862 694 672 349 1791 3809 215 93 --
NM_000125chr683337 3172 3035 2891 2700 1162 243 87 11482 2686 39 11131
NM_000134chr431092 573 424 11424 1280 --
NM_000138chr1511765 1859 --11786
NM_000151chr1751834 1724 1626 189 116 1346 21685 1366 --
NM_000165chr611043 ----1475
NM_000166chrX----5603 577 89 71 43 --
NM_000168chr733064 2739 2700 --11240 --
NM_000176chr52867 412 --1931 --
NM_000178chr201369 1265 1253 --
NM_000183chr2------1156
NM_000188chr103625 214 108 ----1220
NM_000189chr282226 1926 757 653 570 304 143 48 21973 424 --1288
NM_000192chr121345 --1391 1599
NM_000208chr19104572 3557 3221 3215 3184 3161 1335 1103 448 183 ------
NM_000214chr2041312 277 238 106 21585 311 21630 1592 --
NM_000217chr1244948 3756 3683 1267 --14723 --
NM_000220chr111705 ------
NM_000228chr1137 ------
NM_000232chr462692 2675 2526 2396 915 747 --22371 415 --
NM_000238chr71157 --177 --
NM_000245chr7--2238 96 ----
NM_000248chr332963 2658 2378 ----12369
NM_000252chrX11521 ------
NM_000258chr31235 ------
NM_000259chr15125827 5297 5007 4961 4943 4879 4154 4124 4007 1196 409 40 12022 11152 --
NM_000260chr11275 34 --1494 --
NM_000264chr93471 252 111 ----11125
NM_000267chr17----4370 168 73 67 --
NM_000278chr10112010 1881 1693 899 885 846 788 760 369 262 245 22196 871 71738 1616 1600 819 814 605 349 --
NM_000282chr13198 ------
NM_000284chrX41924 1870 1545 1527 11441 21910 287 --
NM_000285chr19270 42 ------
NM_000286chr171179 ------
NM_000296chr163916 719 65 1639 2681 379 --
NM_000314chr1032663 2340 1019 13017 ----
NM_000319chr1241095 1048 252 21 1899 ----
NM_000321chr131333 1227 ----
NM_000325chr41608 --136 --
NM_000330chrX32020 1971 614 126 ----
NM_000332chr686207 5818 1653 1568 1526 1272 363 284 16581 3791 447 437 --
NM_000333chr31138 ------
NM_000334chr1782128 2108 1857 1767 1756 1464 860 635 1802 82091 1967 1962 1851 1844 330 283 236 --
NM_000335chr331589 738 240 11917 1659 --
NM_000337chr586578 6328 5021 4238 1629 1259 1252 252 --26504 4666 --
NM_000346chr1711581 11485 1363 --
NM_000350chr1123 ------
NM_000353chr166963 832 244 204 138 59 ------
NM_000358chr51401 --1502 --
NM_000362chr2293023 2994 2958 2903 2804 2271 1366 774 748 --63492 3087 1258 1240 827 190 --
NM_000363chr19123 ------
NM_000367chr652157 1666 1465 1433 479 --21513 454 --
NM_000368chr954168 4112 4094 4055 3697 --13736 --
NM_000376chr12103057 2547 1232 872 813 776 594 440 179 159 --62648 2499 2088 996 837 286 3797 661 123
NM_000378chr111785 --2190 185 --
NM_000390chrX22948 2452 --22190 1351 --
NM_000391chr1171660 1600 1586 1491 1149 203 68 --285 36 --
NM_000398chr224331 217 113 50 --1264 --
NM_000399chr102966 93 --1290 --
NM_000403chr1145 ------
NM_000404chr32147 139 ----163
NM_000408chr232696 2596 801 ------
NM_000411chr2162957 2576 2532 2221 918 32 12230 12777 --
NM_000428chr1452472 2192 419 266 189 12260 31011 245 125 12138
NM_000430chr1742550 2473 2405 2309 --23057 2558 --
NM_000434chr62204 30 --144 --
NM_000435chr196975 952 817 689 123 51 --2721 132 --
NM_000439chr541759 759 225 52 --1420 --
NM_000445chr86990 951 761 700 302 26 2325 244 3873 362 199 --
NM_000449chr121053 240 ------
NM_000450chr12330 100 ------
NM_000459chr92929 63 ----183
NM_000461chr341713 1308 1298 1225 --11120 11211
NM_000462chr151476 ------
NM_000474chr71262 ------
NM_000476chr951414 1287 1056 434 194 --4502 384 98 93 --
NM_000484chr213745 700 436 ------
NM_000489chrX42403 949 524 313 22246 709 ----
NM_000495chrX4966 932 822 404 ------
NM_000500chr6178 ------
NM_000503chr811779 21332 260 2610 144 --
NM_000515chr17121 ------
NM_000523chr21226 ----1103
NM_000530chr13442 415 120 --3715 294 289 1221
NM_000533chrX31241 789 543 2416 224 ----
NM_000546chr1731011 875 90 ----161
NM_000552chr12238 28 ------
NM_000555chrX77334 7299 6795 5162 5022 4818 1744 27060 6111 47006 6989 5667 317 12584
NM_000557chr202422 53 ------
NM_000572chr11853 ------
NM_000594chr61727 --140 --
NM_000597chr21295 --132 --
NM_000609chr1072535 2359 1979 892 695 527 255 173 --188
NM_000612chr11143750 3733 3588 3529 3515 3482 3441 3328 3202 3056 2918 2575 2525 42 --12937 13685
NM_000618chr1295853 5401 5201 5163 4790 4084 2035 189 56 24169 1209 35586 2566 292 16352
NM_000618chr1295853 5401 5201 5163 4790 4084 2035 189 56 24169 1209 35586 2566 292 16352
NM_000621chr132569 334 --21288 1154 --
NM_000627chr2136 ------
NM_000633chr1854785 4143 987 957 289 11153 11463 --
NM_000635chr1951668 577 364 294 235 1460 1604 --
NM_000641chr192998 279 11563 21335 618 --
NM_000660chr191235 --2226 68 --
NM_000665chr71149 ------
NM_000680chr81115 ------
NM_000681chr104987 142 132 103 11121 1454 --
NM_000682chr261834 1789 759 470 62 21 11607 61445 720 194 105 67 55 --
NM_000687chr202533 149 1651 141 --
NM_000693chr1541753 437 384 216 ------
NM_000701chr1144 ------
NM_000704chr192164 28 ------
NM_000719chr12126037 5936 4768 4215 2390 2334 2007 1345 1217 424 360 245 24661 4198 44476 4424 4205 563 15623
NM_000721chr142244 1782 512 221 21763 732 1305 --
NM_000722chr7----161 145
NM_000723chr1771635 1413 1387 1194 1156 1076 205 --31298 1093 481 --
NM_000724chr101493 --11406 --
NM_000725chr123954 936 805 1814 31003 784 122 1650
NM_000726chr2--11031 ----
NM_000738chr111856 1732 4868 759 225 92 1157
NM_000739chr71675 ----189
NM_000757chr17840 824 681 631 576 124 106 3751 691 130 2728 668 --
NM_000767chr1931059 329 91 1108 11115 1958
NM_000789chr171246 --126 --
NM_000795chr115745 433 128 69 30 --41012 953 727 45 2869 180
NM_000800chr531391 432 179 ------
NM_000801chr203968 133 30 144 ----
NM_000806chr521880 35 --1154 --
NM_000813chr565276 5079 2173 1900 1402 1076 --14334 --
NM_000814chr1523022 961 --159 13129
NM_000818chr101189 ------
NM_000826chr41999 ------
NM_000827chr521844 1713 --22012 269 --
NM_000831chr1246002 5833 5779 5727 5628 5537 5523 5261 5254 5241 5027 4934 4875 4809 4617 4072 4025 937 583 327 317 283 137 115 26180 149 45897 5390 5108 78 13901
NM_000832chr9259 24 --3829 681 164 --
NM_000833chr1611091 11493 --192
NM_000837chr83574 470 372 --155 --
NM_000841chr613853 845 837 829 817 804 796 784 771 763 748 94 45 --1366 1603
NM_000844chr321042 333 ------
NM_000845chr71361 ------
NM_000849chr153069 2344 1030 323 42 13027 33127 3084 656 --
NM_000861chr362621 2093 1972 1769 633 320 --12232 --
NM_000864chr13944 343 266 ------
NM_000868chrX31938 1795 468 11666 11800 --
NM_000875chr15147033 6612 4633 2821 2802 1957 1591 1492 950 420 343 319 154 129 14658 81731 1482 870 854 849 724 310 214 --
NM_000876chr621317 320 21236 453 ----
NM_000883chr75511 291 265 258 179 1580 2532 476 --
NM_000883chr75511 291 265 258 179 1580 2532 476 --
NM_000891chr1743483 2969 1414 1187 1998 1371 --
NM_000899chr121422 24110 774 --11313
NM_000901chr452368 1974 1706 910 41 ------
NM_000908chr52176 30 --1577 --
NM_000912chr883565 3541 2650 2395 2271 1244 1216 818 ------
NM_000918chr171655 1551 ----
NM_000921chr12--1551 ----
NM_000922chr111146 --11053 --
NM_000924chr1231240 1090 942 11279 31342 1160 1149 11365
NM_000933chr2011204 ------
NM_000935chr31947 ------
NM_000939chr2159 --275 70 --
NM_000942chr15146 ------
NM_000944chr42925 98 ------
NM_000945chr231779 1562 688 11484 ----
NM_000949chr51143 ------
NM_000960chr194803 770 251 137 --4504 494 34 29 --
NM_000961chr20143963 3889 3842 3456 3323 3023 2893 2817 2691 2555 1265 1139 56 46 12640 42868 332 124 37 --
NM_000964chr1771273 1208 1190 884 465 196 100 --51301 417 309 90 54 1478
NM_000965chr311054 ------
NM_000966chr125990 919 676 212 93 --2217 98 2345 322
NM_000971chr8154 ------
NM_000983chr131127 1092 82 --11311 --
NM_000984chr17167 --1449 1172
NM_001001132chr2131194 1148 1034 ------
NM_001001323chr1212137 1461 ----
NM_001001331chr322607 21 1953 ----
NM_001001342chr1031351 1136 1124 11440 ----
NM_001001344chrX52490 882 586 561 512 1191 32394 1685 890 1984
NM_001001396chr183902 3675 3463 1790 1741 1631 1460 817 23800 1359 33890 1238 1135 --
NM_001001433chr2043215 2949 875 162 --12652 --
NM_001001436chr161128 ------
NM_001001438chr211284 --2123 74 --
NM_001001481chr832620 2610 2431 2899 397 ----
NM_001001484chr1022125 411 ------
NM_001001520chr191137 ------
NM_001001521chr21106 ------
NM_001001522chr113363 164 71 ------
NM_001001523chr151219 1086 524 235 39 --31099 530 22 --
NM_001001549chr742609 924 336 210 --42378 2154 975 553 --
NM_001001550chr742609 924 336 210 --42378 2154 975 553 --
NM_001001555chr742609 924 336 210 --42378 2154 975 553 --
NM_001001557chr83872 615 56 1189 3762 697 223 --
NM_001001560chr225736 547 525 167 138 --1185 --
NM_001001664chr222903 1138 12843 ----
NM_001001669chr552127 1749 1739 1055 341 12187 12602 --
NM_001001740chr1135 ------
NM_001001740chr1135 ------
NM_001001790chr92361 65 ------
NM_001001795chr81744 --31082 838 765 --
NM_001001890chr2153205 3181 1195 466 179 11078 11438 --
NM_001001924chr851772 1491 621 611 467 --21863 671 --
NM_001001925chr851772 1491 621 611 467 --21863 671 --
NM_001001931chr851772 1491 621 611 467 --21863 671 --
NM_001001936chr10157 1742 41061 990 469 372 --
NM_001001971chr10171 ----164
NM_001001995chrX166 ------
NM_001002233chr83796 72 52 --21452 77 --
NM_001002243chr2174 ------
NM_001002265chr102267 195 --1202 --
NM_001002266chr102267 195 --1202 --
NM_001002762chr1092738 2465 2016 1029 467 257 196 147 58 --52822 2096 1008 955 706 --
NM_001002814chr8103848 3430 3383 3317 2903 2579 913 796 72 52 --21452 77 --
NM_001002838chrX21304 695 11823 ----
NM_001002840chr71189 ------
NM_001002860chr1444291 4244 1685 744 13390 11107 --
NM_001002909chr1771835 1646 428 337 324 275 200 --11549 --
NM_001003406chr2293246 2717 2664 2533 2477 2351 1160 973 418 21239 614 22864 1248 --
NM_001003407chr10125097 5044 4937 4861 4760 1703 1453 1245 1136 1076 965 758 1185 15008 --
NM_001003408chr10125097 5044 4937 4861 4760 1703 1453 1245 1136 1076 965 758 1185 15008 --
NM_001003652chr1878292 6437 3488 2811 1826 1614 551 36187 5378 3466 22446 2322 28668 5468
NM_001003674chr18136921 6363 5947 5729 5470 5457 4900 4711 4480 2522 2201 895 69 26911 6119 12357 11726
NM_001003675chr18136921 6363 5947 5729 5470 5457 4900 4711 4480 2522 2201 895 69 26911 6119 12357 11726
NM_001003676chr114849 772 638 332 1107 1219 --
NM_001003681chr2231893 416 278 ----11453
NM_001003682chr1121 11004 ----
NM_001003688chr4142 21219 894 ----
NM_001003694chr33150 86 35 --1439 --
NM_001003698chr651653 1630 1601 1586 1366 11241 ----
NM_001003699chr651653 1630 1601 1586 1366 11241 ----
NM_001003794chr393037 2774 2464 2388 1963 1201 1098 1030 382 2689 83 62441 2361 2111 674 298 293 --
NM_001003800chr9101488 1466 1391 1239 1227 1188 1135 607 345 305 13562 21421 1313 --
NM_001003809chr18----3248 229 65 --
NM_001003810chr4--291 84 1527 --
NM_001003891chr226659 644 598 293 129 115 3814 143 59 ----
NM_001003940chr1553341 3108 2909 2564 579 23459 614 63738 3615 3153 2942 2515 1260 --
NM_001003942chr1553341 3108 2909 2564 579 23459 614 63738 3615 3153 2942 2515 1260 --
NM_001003943chr1553345 3112 2913 2568 583 23463 618 63742 3619 3157 2946 2519 1264 --
NM_001004065chr953928 3472 3325 3172 427 1446 1942 --
NM_001004105chr5131 ------
NM_001004127chr131911 ------
NM_001004303chr1164 ------
NM_001004303chr1164 ------
NM_001004317chr633421 3296 1650 23112 1656 ----
NM_001004329chr12----1259 --
NM_001004346chr431001 993 984 2349 170 ----
NM_001004354chr95344 243 182 48 31 ------
NM_001004360chr21296 ------
NM_001004419chr1264436 4256 3555 1013 550 508 --11813 --
NM_001004439chr1561294 1151 929 857 453 148 ------
NM_001004720chr22673 106 ------
NM_001004722chr23842 275 164 ------
NM_001005158chr32391 192 --162 --
NM_001005159chr32391 192 --162 --
NM_001005266chr152696 686 ------
NM_001005267chr152696 686 ------
NM_001005268chr152696 686 ------
NM_001005269chr152696 686 ------
NM_001005271chr173356 141 74 --1400 --
NM_001005273chr173356 141 74 --1400 --
NM_001005291chr17167 --2381 31 --
NM_001005353chr11223 --1180 --
NM_001005353chr11223 --1180 --
NM_001005366chr122187 90 ------
NM_001005375chrY--11345 ----
NM_001005377chr19----122 --
NM_001005386chr2----2701 105 --
NM_001005404chr1764067 3391 3363 2848 1382 1312 11281 --1113
NM_001005417chr13441 287 182 142 2630 507 --
NM_001005463chr1021871 656 12426 ----
NM_001005473chr566378 5550 5044 2343 775 355 34269 2016 1110 11547 --
NM_001005502chr1295053 4960 4923 4188 1806 1688 1610 1162 1041 --45063 4897 3420 520 --
NM_001005505chr351171 510 314 246 66 --41702 1142 381 358 --
NM_001005609chrX103578 3328 3264 3220 2413 1375 827 696 294 166 1528 13556 12929
NM_001005732chr21276 34 ------
NM_001005733chr21276 34 ------
NM_001005739chr21853 ------
NM_001005743chr142393 204 1401 ----
NM_001005744chr142393 204 1401 ----
NM_001005745chr142393 204 1401 ----
NM_001005746chr2--11031 ----
NM_001005747chr2--11031 ----
NM_001005849chr171399 ------
NM_001005861chr32614 41 163 ----
NM_001005909chr3199 ------
NM_001005910chr35561 548 182 82 23 ------
NM_001005911chr35561 548 182 82 23 ------
NM_001006115chr372715 2654 2627 2072 1718 662 68 22335 2115 42151 2131 701 352 12158
NM_001006605chr12212 195 138 ----
NM_001006605chr12212 195 138 ----
NM_001006610chr16--176 ----
NM_001006617chr941098 1065 905 336 2292 49 1299 --
NM_001006619chr941098 1065 905 336 2292 49 1299 --
NM_001006620chr941098 1065 905 336 2292 49 1299 --
NM_001006621chr941098 1065 905 336 2292 49 1299 --
NM_001006623chr22857 244 --12037 --
NM_001006626chr71675 ----189
NM_001006627chr71675 ----189
NM_001006628chr71675 ----189
NM_001006629chr71675 ----189
NM_001006630chr71675 ----189
NM_001006631chr71675 ----189
NM_001006632chr71675 ----189
NM_001006636chr2--1152 --1189
NM_001006932chr663270 2670 865 856 541 325 --23201 2256 133
NM_001006933chrX----153 --
NM_001006946chr291825 1692 1303 1229 374 190 174 136 53 ----292 32
NM_001007027chr112227 65 ------
NM_001007072chr15193 --156 --
NM_001007097chr964940 1351 1014 920 905 893 --1873 --
NM_001007098chr13823 326 130 ------
NM_001007156chr1551694 1592 722 661 472 21876 251 21737 403 --
NM_001007214chr13345 280 192 --11855 --
NM_001007226chr1751159 1133 982 312 203 11284 --11352
NM_001007227chr1751159 1133 982 312 203 11284 --11352
NM_001007228chr1751159 1133 982 312 203 11284 --11352
NM_001007229chr1751159 1133 982 312 203 11284 --11352
NM_001007230chr1751159 1133 982 312 203 11284 --11352
NM_001007233chr52698 30 ------
NM_001007237chr142738 1999 1930 679 1221 --1754
NM_001007246chr211122 ------
NM_001007257chr11356 ------
NM_001007271chr103978 834 69 1151 --3747 43 30
NM_001007277chr114431 394 238 185 41034 202 133 96 --1226
NM_001007466chr694953 3756 3185 1763 1640 844 783 423 355 1436 24127 1059 24232 3762
NM_001007471chr92632 93 1863 ----
NM_001007527chr51227 ------
NM_001007553chr11409 ------
NM_001007559chr1821727 76 ------
NM_001008216chr1145 ------
NM_001008220chr593815 3763 3676 3544 2819 2693 2582 898 474 13663 53645 3533 372 309 115 1625
NM_001008222chrX51355 1267 1255 939 321 ------
NM_001008239chr1893228 3130 2756 1481 1386 1267 561 407 25 --1295 --
NM_001008270chr7------138
NM_001008388chr42903 110 ------
NM_001008392chr393392 3225 3145 2281 1392 994 584 337 62 33580 2975 820 ----
NM_001008407chr72623 65 1603 11651 1698
NM_001008495chr8--22234 2087 ----
NM_001008541chr103715 673 578 ------
NM_001008541chr103715 673 578 ------
NM_001008657chr54873 783 625 92 1263 1291 --
NM_001008660chr1111281 ------
NM_001008701chr1982382 1909 1210 1200 652 621 508 339 12242 62834 2607 2483 661 635 524 --
NM_001008777chr17----1227 --
NM_001008860chr151662 ------
NM_001008892chr151662 ------
NM_001008894chr151662 ------
NM_001008925chr4161 --12950 --
NM_001008938chr113188 167 27 ------
NM_001009184chr83574 470 372 --155 --
NM_001009185chr52726 132 ------
NM_001009552chr82235 21 ------
NM_001009554chr473811 1374 1154 776 356 148 77 --1343 1269
NM_001009554chr473811 1374 1154 776 356 148 77 --1343 1269
NM_001009555chr421092 691 --1572 --
NM_001009566chr141338 940 909 44 --21132 180 11093
NM_001009881chr1157 ------
NM_001009882chr1157 ------
NM_001009944chr163916 719 65 1639 2681 379 --
NM_001009955chr1----2504 116 --
NM_001009955chr1----2504 116 --
NM_001009993chr2144389 4142 3750 3471 3214 3185 3083 2954 2882 1725 1656 941 792 76 23344 1308 ----
NM_001010000chr1843023 2812 2689 459 12408 ----
NM_001010854chr14126 194 149 --
NM_001010857chr11109 ------
NM_001010861chr122776 2168 ------
NM_001010867chr1186620 6100 6056 5662 5247 5175 2598 2458 2090 2048 1909 1795 1726 1655 1520 1428 712 390 --65923 4474 4093 2065 358 153 --
NM_001010888chrX64507 4213 3043 1584 479 142 11227 24098 3764 13776
NM_001010891chr555323 5190 4561 2745 2608 26340 5229 16807 --
NM_001010895chr932118 780 459 ------
NM_001010917chr10142039 1933 1814 1737 1539 1443 638 604 511 500 484 439 343 50 1364 32070 181 114 --
NM_001010924chr1021008 212 --1998 --
NM_001010927chr6------1572
NM_001010938chr37779 295 196 179 110 52 29 --2167 162 1227
NM_001010942chr121851 11283 ----
NM_001011515chr41951 ------
NM_001011516chr41951 ------
NM_001011537chr331462 419 201 ------
NM_001011538chr41783 ------
NM_001011645chrX386 73 59 ------
NM_001011658chrX31395 489 360 11702 11370 --
NM_001011666chr756027 4749 4478 1674 1033 --14441 --
NM_001011705chr131275 ------
NM_001011708chr212800 12631 22424 1177 --
NM_001011713chr141404 31167 572 119 ----
NM_001011885chr1531653 1124 104 11145 ----
NM_001012264chr143812 759 70 1961 1664 --
NM_001012329chr172337 2308 2285 1906 1518 768 706 11545 42275 128 123 92 --
NM_001012338chr15--1130 151 --
NM_001012393chr1173791 1945 1436 1128 883 286 34 1262 24188 1950 1325
NM_001012398chr161167 138 ----
NM_001012415chr93283 228 208 1748 1812 --
NM_001012426chr6133339 3179 3170 2906 2650 2500 2455 1254 1070 925 889 599 569 --43236 1234 952 514 --
NM_001012427chr6133339 3179 3170 2906 2650 2500 2455 1254 1070 925 889 599 569 --43236 1234 952 514 --
NM_001012514chr22197 158 1275 4901 147 82 27 --
NM_001012516chr22197 158 1275 4901 147 82 27 --
NM_001012614chr42696 483 --1189 --
NM_001012643chr193211 130 22 --3513 103 75 --
NM_001012644chr201336 --1123 --
NM_001012661chr113180 159 137 ------
NM_001012753chr1921145 284 2825 35 11103 --
NM_001012756chr1932580 2445 2016 --12420 --
NM_001012761chr572734 2289 2269 2236 876 504 403 --2959 247 --
NM_001012974chr6----156 --
NM_001012977chrX51176 1165 1151 990 290 ------
NM_001012979chrX152 ------
NM_001012989chrX--144 1254 --
NM_001013031chr1061079 1029 1019 755 706 688 --42981 2224 1098 938 --
NM_001013251chr113180 159 137 ------
NM_001013415chr421083 62 --151 --
NM_001013438chr3--1222 ----
NM_001013439chr3--168 ----
NM_001013615chr131075 800 422 1821 51194 1184 1084 889 164 11172
NM_001013620chr1287095 6502 6414 5978 3070 2933 2770 197 --23153 997 --
NM_001013622chr471000 953 478 355 231 108 46 --1928 --
NM_001013624chr1741188 217 116 57 ----21176 1041
NM_001013635chr124845 483 282 192 --1882 --
NM_001013642chr141132 1079 991 909 ------
NM_001013690chr1292477 2463 1569 897 466 455 388 307 136 2317 179 31773 575 436 --
NM_001013693chr1102598 2281 2234 1854 1826 901 677 599 229 174 22167 523 32140 1834 391 12333
NM_001013693chr1102598 2281 2234 1854 1826 901 677 599 229 174 22167 523 32140 1834 391 12333
NM_001013839chr1762052 1812 724 166 116 72 11016 31595 991 646 1929
NM_001014283chr1392162 1852 1820 1481 1470 734 414 141 47 ------
NM_001014336chr12----180 --
NM_001014435chr163616 525 242 ----1442
NM_001014443chr11239 --1214 --
NM_001014445chr1741007 976 263 137 --3992 741 723 3772 64 48
NM_001014794chr11--2238 196 ----
NM_001014795chr11--2238 196 ----
NM_001014797chr10177918 7861 7711 7508 7305 7023 6706 6287 5849 2844 2345 2213 1853 1809 1429 660 284 25949 5727 ----
NM_001014809chr42802 350 165 1193 --
NM_001014831chr194752 592 530 128 --3787 703 676 --
NM_001014832chr194752 592 530 128 --3787 703 676 --
NM_001014834chr194752 592 530 128 --3787 703 676 --
NM_001014835chr194752 592 530 128 --3787 703 676 --
NM_001014839chr151031 910 769 730 320 --2742 386 1896
NM_001014841chr151031 910 769 730 320 --2742 386 1896
NM_001015045chr44606 160 119 98 12084 22344 684 --
NM_001015048chr1463141 2512 2500 1154 1123 1098 ------
NM_001015049chr1463141 2512 2500 1154 1123 1098 ------
NM_001015053chr17101532 1497 639 544 501 250 192 184 155 123 --2222 115 11137
NM_001015055chr23266 117 29 --1254 --
NM_001015056chr23266 117 29 --1254 --
NM_001015056chr23266 117 29 --1254 --
NM_001015877chrX51208 1150 826 319 251 11984 ----
NM_001015881chrX1885 ------
NM_001015882chr911075 ------
NM_001015887chr351523 1369 1284 672 424 ------
NM_001017368chr1772820 2497 2186 2178 379 302 158 --1770 --
NM_001017395chr333086 1405 586 --32450 1016 394 --
NM_001017396chr281628 1435 1361 829 637 156 114 63 1556 ----
NM_001017402chr1137 ------
NM_001017405chr44690 337 88 71 --1746 --
NM_001017523chr1231803 718 48 ----11250
NM_001017535chr12103057 2547 1232 872 813 776 594 440 179 159 --62648 2499 2088 996 837 286 3797 661 123
NM_001017916chr17101721 1678 1613 1396 835 792 761 748 169 43 --153 --
NM_001017917chr17101721 1678 1613 1396 835 792 761 748 169 43 --153 --
NM_001017923chr142540 36 1642 ----
NM_001017926chr821686 524 ------
NM_001017963chr141874 ------
NM_001017977chr1--1352 ----
NM_001017979chr41286 ------
NM_001017981chr225553 503 270 248 42 1212 ----
NM_001017995chr584554 3672 3062 1813 1266 1023 133 39 24189 490 94100 3143 1686 1681 1661 1656 1651 643 258 23434 2978
NM_001017999chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_001017999chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_001018000chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_001018000chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_001018001chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_001018004chr15162 ------
NM_001018005chr15167 ------
NM_001018006chr15162 ------
NM_001018007chr15162 ------
NM_001018020chr15162 ------
NM_001018050chr2272774 2767 2142 1366 1005 334 145 --42904 2491 2369 172 11267
NM_001018052chr2272774 2767 2142 1366 1005 334 145 --42904 2491 2369 172 11267
NM_001018057chr111510 --2394 247 --
NM_001018064chr941517 1342 438 347 --1288 --
NM_001018072chr1231803 718 48 ----11250
NM_001018074chr52867 412 --1931 --
NM_001018075chr52867 412 --1931 --
NM_001018076chr52867 412 --1931 --
NM_001018077chr52867 412 --1931 --
NM_001018108chr1541925 894 638 30 ------
NM_001020658chr111053 --21354 231 --
NM_001020658chr111053 --21354 231 --
NM_001020818chr19101736 1461 671 618 512 496 391 154 112 52 --1573 --
NM_001020819chr19101736 1461 671 618 512 496 391 154 112 52 --1573 --
NM_001020820chr19101736 1461 671 618 512 496 391 154 112 52 --1573 --
NM_001020821chr19101736 1461 671 618 512 496 391 154 112 52 --1573 --
NM_001023567chr153957 935 657 ------
NM_001023587chr321103 149 ------
NM_001024094chr52867 412 --1931 --
NM_001024226chr1238 32 ------
NM_001024227chr1238 32 ------
NM_001024228chr1238 32 ------
NM_001024401chr1682803 2514 2271 1932 698 580 467 424 --32536 1973 951 2972 919
NM_001024455chrX72322 2257 2213 432 354 245 77 42190 2170 928 745 12242 31950 978 60
NM_001024460chr631135 1119 1050 ------
NM_001024465chr6156 ------
NM_001024593chr101272 ----157
NM_001024649chr572483 2271 1878 978 918 201 48 --12474 --
NM_001024666chrX3533 116 60 ----1546
NM_001024668chr123740 238 31 173 ----
NM_001024680chr231527 1450 1414 --11665 --
NM_001024808chr1262407 2293 1869 1023 480 182 --22111 544 --
NM_001024809chr1771273 1208 1190 884 465 196 100 --51301 417 309 90 54 1478
NM_001024845chr141057 759 677 373 --4998 775 323 84 2400 96
NM_001024855chr32498 157 ------
NM_001024934chr62591 527 ------
NM_001024935chr62591 527 ------
NM_001024936chr62591 527 ------
NM_001024937chr174654 216 128 50 ------
NM_001024947chr52284 258 ------
NM_001024948chr142634 2267 2257 273 --1330 --
NM_001024959chr34800 782 555 179 ----1538
NM_001024960chr34800 782 555 179 ----1538
NM_001025068chr321269 186 11717 ----
NM_001025069chr321269 186 11717 ----
NM_001025076chr10135674 4982 4839 4833 4158 3964 2271 2155 2107 1843 1533 642 90 --35556 4806 24 --
NM_001025077chr10117032 6340 6197 6191 5516 5322 2891 2000 1448 1329 68 --56914 6164 1168 446 24 --
NM_001025079chr3103954 3441 3347 2715 2648 2621 1672 1492 1119 1002 1496 1728 --
NM_001025081chr1871488 1463 1076 471 363 73 27 ------
NM_001025090chr1871488 1463 1076 471 363 73 27 ------
NM_001025092chr1871488 1463 1076 471 363 73 27 ------
NM_001025101chr1871488 1463 1076 471 363 73 27 ------
NM_001025105chr511346 --1578 --
NM_001025108chr264177 3143 2827 2792 1255 475 21453 886 1624 --
NM_001025109chr17958 874 470 421 288 179 53 --2932 332 --
NM_001025205chr33398 304 99 ------
NM_001025232chr121134 ------
NM_001025234chr111149 --195 126
NM_001025235chr111149 --195 126
NM_001025236chr111149 --195 126
NM_001025237chr111149 --195 126
NM_001025238chr111149 --195 126
NM_001025239chr111149 --195 126
NM_001025248chr1511149 11289 ----
NM_001025249chr1511149 11289 ----
NM_001025252chr853048 2730 2633 1099 308 13209 12102 --
NM_001025253chr853048 2730 2633 1099 308 13209 12102 --
NM_001025266chr364788 3822 1689 699 693 426 1389 23797 1664 --
NM_001025366chr61171 --21482 611 --
NM_001025366chr61171 --21482 611 --
NM_001025367chr61171 --21482 611 --
NM_001025367chr61171 --21482 611 --
NM_001025368chr61171 --21482 611 --
NM_001025368chr61171 --21482 611 --
NM_001025369chr61187 --21498 627 --
NM_001025369chr61187 --21498 627 --
NM_001025370chr61171 --21482 611 --
NM_001025370chr61171 --21482 611 --
NM_001025579chr176963 420 402 262 190 115 --1245 --
NM_001025580chrX33499 3475 36 --2387 324 --
NM_001025595chr41494 --11272 --
NM_001025596chr11147 --1113 --
NM_001025603chr121053 240 ------
NM_001025616chr41353 ----21537 721
NM_001025780chr931152 1022 496 11061 21390 997 --
NM_001029858chr672980 2123 1301 845 734 561 240 11340 1944 12920
NM_001029863chr662838 2506 2470 1132 1000 71 13110 ----
NM_001029864chr2071900 1646 681 515 293 159 127 1692 12126 11597
NM_001029875chr542660 2023 530 133 --22029 143 --
NM_001029882chr13492 144 108 --2129 117 --
NM_001029882chr13492 144 108 --2129 117 --
NM_001029884chr642655 2065 1931 1863 1984 ----
NM_001029891chrX2780 743 --261 44 1834
NM_001029998chr42926 289 11330 ----
NM_001030006chr1762534 2402 1873 1760 675 230 3796 736 224 12419 --
NM_001030007chr1662747 2483 1539 931 652 373 --1527 --
NM_001030055chr141382 ------
NM_001030272chr111191 ------
NM_001030273chr111191 ------
NM_001030287chr12282 171 11187 ----
NM_001031685chr11294 ------
NM_001031690chr782334 2104 2000 1258 1119 726 676 393 --41174 957 843 22 --
NM_001031695chr2265130 1888 1729 1056 615 202 --44479 4343 3567 877 15151
NM_001031702chr34821 808 94 32 --2682 121 --
NM_001031711chr551193 696 591 577 431 --31217 64 50 11437
NM_001031720chr41164 ------
NM_001031732chr433252 3187 99 ------
NM_001031738chr21200 --1443 1176
NM_001031740chr13647 262 135 --1383 --
NM_001031801chr22187 --1151 --
NM_001031804chr1643465 3349 2732 1774 1859 1212 --
NM_001031812chr512320 ------
NM_001032221chr971468 1419 1404 1313 516 418 106 1683 11284 --
NM_001032280chr641494 247 209 96 21321 310 ----
NM_001032283chr121410 ------
NM_001032284chr121410 ------
NM_001032288chr2041140 565 410 345 1219 1374 --
NM_001032289chrX4766 760 183 102 ------
NM_001032296chr13102746 2719 2607 2424 2225 2141 1915 1063 804 371 --1570 --
NM_001032380chr101435 21862 1380 ----
NM_001032394chr632098 1797 1063 --128 --
NM_001033026chr19----132 --
NM_001033044chr131204 404 297 --1553 --
NM_001033045chr224005 1635 14429 11490 --
NM_001033047chr432178 866 156 --12225 --
NM_001033056chr131204 404 297 --1553 --
NM_001033059chr61625 ----1227
NM_001033081chr141424 1367 374 278 --11404 --
NM_001033082chr141424 1367 374 278 --11404 --
NM_001033112chr51727 ------
NM_001033117chr394877 4759 4591 4428 3806 3542 1572 1545 703 24419 1919 24166 808 --
NM_001033518chr7112816 2703 2320 2154 2147 2128 1905 1137 633 350 204 11845 ----
NM_001033519chr7112816 2703 2320 2154 2147 2128 1905 1137 633 350 204 11845 ----
NM_001033520chr7112816 2703 2320 2154 2147 2128 1905 1137 633 350 204 11845 ----
NM_001033551chr17173744 3352 3138 2960 2881 2583 2570 1618 1371 1058 942 923 865 669 551 412 369 --42980 1026 382 244 --
NM_001033554chr17--140 ----
NM_001033557chr2126 --1567 --
NM_001033561chr173811 329 50 1790 ----
NM_001033576chr1741746 840 576 211 22487 1856 11079 --
NM_001033602chr13112674 2545 2508 2479 2472 2416 2201 1892 1711 930 93 32054 1941 717 12565 --
NM_001033677chr124389 362 120 67 ------
NM_001033723chr8144 42546 2009 804 56 ----
NM_001033756chr61105 --21416 545 --
NM_001033756chr61105 --21416 545 --
NM_001033925chr101173 12085 ----
NM_001033952chr111251 ------
NM_001034025chr122875 175 ------
NM_001034837chr53293 138 70 --1718 --
NM_001034838chr53293 138 70 --1718 --
NM_001034845chr43314 230 163 ------
NM_001034850chr521558 138 ------
NM_001034915chr811564 --1451 --
NM_001034954chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_001034955chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_001034956chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_001034957chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_001035003chr411219 ----11340
NM_001035004chr411219 ----11340
NM_001035254chr9111816 1729 1705 1663 931 772 672 576 456 95 33 21981 513 52104 965 898 640 473 --
NM_001035256chr2159 --275 70 --
NM_001035260chr1031248 556 67 ------
NM_001035267chr12----1203 --
NM_001035521chr25751 740 589 186 127 ------
NM_001037132chr721916 284 ------
NM_001037133chr721916 284 ------
NM_001037163chr71104 ------
NM_001037164chr731552 325 90 1526 ----
NM_001037317chr122776 2168 ------
NM_001037324chr34767 561 292 174 --2243 192 --
NM_001037331chr183361 263 253 --2929 51 --
NM_001037339chr151503 1198 688 636 193 21509 391 11209 --
NM_001037340chr151503 1198 688 636 193 21509 391 11209 --
NM_001037341chr151503 1198 688 636 193 21509 391 11209 --
NM_001037341chr151503 1198 688 636 193 21509 391 11209 --
NM_001037494chr122227 94 ------
NM_001037495chr122227 94 ------
NM_001037553chr21134894 4830 4640 4214 3718 3562 3518 3471 3341 1897 1687 1225 1027 24374 166 53672 3659 640 590 585 --
NM_001037582chr43617 312 29 1351 1500 --
NM_001037633chr51292 ------
NM_001037639chr3----139 --
NM_001037954chr1143400 2287 1260 970 12502 ----
NM_001038493chr21565 1555 127 --
NM_001038640chr152724 30 ------
NM_001038707chr1102227 1766 1463 1442 823 700 574 461 317 126 31974 1871 25 2843 444 1832
NM_001038707chr1102227 1766 1463 1442 823 700 574 461 317 126 31974 1871 25 2843 444 1832
NM_001039091chrX21151 442 ------
NM_001039140chr202406 388 --3169 146 127 --
NM_001039199chr2084880 4237 3336 3213 3207 1720 942 493 --31631 1532 1039 --
NM_001039459chr73895 372 309 --2722 407 --
NM_001039479chr1492124 1977 1688 1518 976 380 324 173 125 11899 22374 180 --
NM_001039538chr263411 2927 2590 1007 867 249 ------
NM_001039547chr377787 7625 6387 2722 1656 1006 970 --37483 4883 2161 --
NM_001039548chr112163 64 --1168 --
NM_001039550chr21551 --2760 711 --
NM_001039574chr141065 1056 987 749 --4995 910 885 314 --
NM_001039583chr224371 160 118 101 --2432 126 --
NM_001039584chr224371 160 118 101 --2432 126 --
NM_001039585chr163680 3659 1614 1532 827 790 1135 13454 --
NM_001039590chrX73507 2467 1368 1348 1092 375 358 ------
NM_001039591chrX73507 2467 1368 1348 1092 375 358 ------
NM_001039618chr1195711 5312 5025 2246 1751 1409 895 600 325 1239 23718 429 --
NM_001039671chr19172 --198 --
NM_001039672chr19172 --198 --
NM_001039673chr19172 --198 --
NM_001039690chr1652369 1850 1824 1785 824 --21944 665 1407
NM_001039693chr243947 3222 1198 575 1991 23071 498 --
NM_001039711chr12815 172 --1105 --
NM_001039712chr12815 172 --1105 --
NM_001039762chr1041746 1518 341 129 11546 --1197
NM_001039802chr121064 119 ------
NM_001039840chrX105996 5014 4575 4174 3908 3853 1765 939 500 444 22065 35 ----
NM_001039847chr192145 21 ------
NM_001039905chr154455 386 257 205 1145 21062 407 --
NM_001039916chr121449 --11035 --
NM_001039917chr121449 --11035 --
NM_001039918chr121449 --11035 --
NM_001039919chr121449 --11035 --
NM_001039920chr121449 --11035 --
NM_001039937chr1364128 2700 2670 1014 748 607 23842 3163 12756 11519
NM_001040031chr192265 199 --160 --
NM_001040056chr166560 503 215 209 188 29 ----2756 668
NM_001040057chr721256 179 11032 ----
NM_001040059chr17--1573 ----
NM_001040108chr1443175 1318 1169 418 ------
NM_001040110chr711307 1682 21238 601 1724
NM_001040134chr1981442 1427 1386 1031 600 582 454 73 1365 31303 1292 1176 --
NM_001040135chr71786 1195 ----
NM_001040142chr2--1383 ----
NM_001040143chr2--1383 ----
NM_001040144chr1652369 1850 1824 1785 824 --21944 665 1407
NM_001040146chr1652369 1850 1824 1785 824 --21944 665 1407
NM_001040152chr754995 4462 4430 1146 111 21471 1158 21178 347 15009
NM_001040153chr131689 ------
NM_001040181chr3----1966 --
NM_001040182chr3----1966 --
NM_001040183chr3----1966 --
NM_001040199chr3----1966 --
NM_001040200chr3----1966 --
NM_001040214chr642043 559 348 66 ------
NM_001040260chr471090 870 852 836 778 55 30 1231 31046 189 78 --
NM_001040261chr471090 870 852 836 778 55 30 1231 31046 189 78 --
NM_001040272chr931869 861 337 --1794 --
NM_001040284chr1645056 3941 1071 728 13977 ----
NM_001040402chr421121 157 ------
NM_001040424chr213954 608 275 22965 1167 2914 848 --
NM_001040427chr16162 ------
NM_001040429chr1342970 1197 703 501 ------
NM_001040431chr17388 72 32 ------
NM_001040439chr1681443 1179 1009 940 934 575 411 395 --31126 456 436 11323
NM_001040440chr51173 ------
NM_001040441chr144038 3970 1941 1285 1524 ----
NM_001040446chr54922 882 721 694 --32099 731 537 --
NM_001040451chr54472 416 116 47 2436 401 ----
NM_001040452chr54472 416 116 47 2436 401 ----
NM_001040458chr56621 532 481 314 213 137 11549 --1244
NM_001040619chr12621 173 11637 ----
NM_001040624chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040625chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040626chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040627chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040628chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040629chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040630chr842735 2452 2119 114 22300 1905 42311 2289 2130 2043 --
NM_001040653chr351738 1667 865 823 203 ------
NM_001040665chr784953 4805 4658 4600 4377 3713 1480 257 23529 845 12015 --
NM_001040666chr73655 507 79 ------
NM_001040694chr1151063 894 398 357 39 ------
NM_001040697chr11--196 ----
NM_001040708chr811020 ------
NM_001040709chr152385 877 499 378 303 22582 2077 2825 560 --
NM_001040712chr91411 12761 ----
NM_001040715chr164838 828 802 234 ----1174
NM_001042368chr91585 2157 91 1284 --
NM_001042388chr182114 28 ------
NM_001042404chr111837 --1120 --
NM_001042413chr993833 3810 2850 2595 747 432 411 115 22 150 ----
NM_001042425chr641494 247 209 96 21321 310 ----
NM_001042453chrX31514 1161 590 ------
NM_001042472chr203479 465 162 --2236 36 --
NM_001042473chr1022103 1455 --1256 --
NM_001042476chr1672173 1849 776 730 634 470 429 --11797 --
NM_001042486chr2031227 1165 531 1400 11554 --
NM_001042492chr17----4370 168 73 67 --
NM_001042494chr1563334 3260 2855 2615 2489 1467 12869 23346 2590 --
NM_001042495chr1563334 3260 2855 2615 2489 1467 12869 23346 2590 --
NM_001042496chr1563334 3260 2855 2615 2489 1467 12869 23346 2590 --
NM_001042497chr1563334 3260 2855 2615 2489 1467 12869 23346 2590 --
NM_001042506chrX71326 1186 1175 1161 990 576 290 --11111 --
NM_001042510chr851937 1410 1383 657 434 12071 ----
NM_001042511chr851937 1410 1383 657 434 12071 ----
NM_001042537chrX52397 2078 1994 1962 542 11664 ----
NM_001042599chr2107820 7434 7139 7105 6712 5795 5044 1247 226 39 --25254 4837 --
NM_001042603chr1284914 4654 3704 3503 3445 3387 3329 970 25044 807 11455 14398
NM_001042604chr344034 3151 561 261 24700 1864 --11320
NM_001042632chr2052320 1932 1782 585 465 --3992 664 385 --
NM_001042633chr2052320 1932 1782 585 465 --3992 664 385 --
NM_001042663chr181377 1245 1117 1053 330 208 78 54 2559 532 31003 336 130 --
NM_001042664chr181377 1245 1117 1053 330 208 78 54 2559 532 31003 336 130 --
NM_001042665chr181377 1245 1117 1053 330 208 78 54 2559 532 31003 336 130 --
NM_001042669chr41353 ----21537 721
NM_001042681chr162064 2045 1887 801 271 207 ----1842
NM_001042682chr162064 2045 1887 801 271 207 ----1842
NM_001042682chr162064 2045 1887 801 271 207 ----1842
NM_001042728chr125990 919 676 212 93 --2217 98 2345 322
NM_001042749chrX1389 11267 ----
NM_001042750chrX1389 11267 ----
NM_001042751chrX1389 11267 ----
NM_001043318chr14133443 3006 2714 1617 1356 1267 1186 1119 1022 1006 775 579 426 13108 21380 921 --
NM_001043351chr162095 1641 1503 779 451 144 11542 2170 22 --
NM_001044305chr63616 71 48 ------
NM_001044385chr263719 3540 3335 2567 1045 898 11255 33870 3611 1209 --
NM_001044722chr512320 ------
NM_001044723chr512320 ------
NM_001046chr5--12952 ----
NM_001065chr123548 85 38 --1428 --
NM_001066chr192176 2013 1972 1533 1463 555 293 206 61 1313 31923 1559 388 11358
NM_001068chr31285 ------
NM_001070chr17129 --153 --
NM_001071775chr1321203 39 --11481 --
NM_001077628chr1156 ------
NM_001079874chr162074 1497 1440 283 196 25 2467 223 ----
NM_001080418chr11220 --3478 430 243 --
NM_001083620chr41998 ------
NM_001083621chr1174666 4342 3847 3098 2992 1572 1560 1471 1262 1139 977 943 904 727 547 63 30 34465 1621 1239 54179 3506 1415 961 832 --
NM_001087chr2----261 55 --
NM_001092chr1782344 1942 1836 792 659 650 502 216 1892 31902 849 434 --
NM_001095chr1241658 1608 1252 83 1317 41301 1277 1200 168 --
NM_001096chr173256 248 88 ------
NM_001100108chr1127879 7863 6863 6409 5942 5283 2564 2495 2341 941 751 501 27036 2216 ----
NM_001106chr3219713 9666 8135 8021 8004 7167 6921 6736 3833 3799 3375 2857 2100 1256 1127 1103 1055 898 835 389 312 27584 1094 99362 8103 7441 6935 3174 3144 503 490 483 23307 2869
NM_001113490chrX11338 33351 3020 3010 21324 592 11272
NM_001116chr1652822 2393 2094 658 422 12869 22355 1146 22773 1124
NM_001117chr18123 11621 1493 --
NM_001119chr44450 378 339 26 11279 1194 148
NM_001121chr101362 --1233 --
NM_001122631chr112261 33 ------
NM_001122679chr511000 ------
NM_001123chr101696 194 ----
NM_001126chr12853 227 ------
NM_001127chr223717 321 33 1781 1221 1419
NM_001128chr1662747 2483 1539 931 652 373 --1527 --
NM_001140chr171142 --176 --
NM_001144chr1671011 327 302 75 64 38 31 ------
NM_001146chr8--1406 11579 --
NM_001149chr1011062 1337 ----
NM_001152chrX127 ------
NM_001154chr4----126 --
NM_001157chr104586 130 34 26 ----1619
NM_001163chr93955 947 73 --21023 816 --
NM_001167chrX65845 2203 1919 1222 1207 1051 12254 46122 5592 5285 2104 --
NM_001173chr141382 ------
NM_001174chrX2554 443 --2421 158 1912
NM_001175chr12----281 68 3422 146 30
NM_001178chr111191 ------
NM_001189chr481024 952 946 769 389 315 245 174 ------
NM_001191chr2091392 1182 1145 1054 1022 981 149 115 44 1349 11342 --
NM_001198chr642252 800 268 93 --21702 839 --
NM_001199chr82265 258 ----1103
NM_001204chr277515 3117 2117 1504 1140 599 118 36701 2262 98 ----
NM_001206chr942367 2126 757 155 ------
NM_001220chr7172 ------
NM_001222chr1051660 598 480 191 153 ------
NM_001241chr2----1194 --
NM_001241chr2----1194 --
NM_001251chr17--1573 ----
NM_001259chr796319 6099 5977 5466 2198 1553 368 138 31 11085 26377 1651 --
NM_001260chr13165 ------
NM_001265chr13162 3758 690 227 ----
NM_001267chr172406 103 1460 2395 41 2446 368
NM_001268chr134799 746 157 43 ------
NM_001271chr1562186 2123 2009 1095 967 198 1353 12043 1668
NM_001273chr122184 106 ------
NM_001274chr112126 82 ------
NM_001282chr1762534 2402 1873 1760 675 230 3796 736 224 12419 --
NM_001283chr73667 111 80 --3434 272 69 1536
NM_001308chr10144 ------
NM_001310chr1272992 2701 2564 2446 980 517 216 ------
NM_001313chr42802 350 165 1193 --
NM_001316chr20--1446 ----
NM_001326chr112407 32 ------
NM_001328chr42696 483 --1189 --
NM_001331chr1161132 1024 964 745 617 120 12788 32191 977 971 --
NM_001332chr52474 84 ------
NM_001343chr52316 97 --1282 --
NM_001345chr12--199 148 --
NM_001347chr481647 1382 1304 1094 1058 1047 104 39 11438 2465 287 --
NM_001350chr6----121 --
NM_001351chr311812 11319 ----
NM_001352chr19144 ------
NM_001356chrX22548 189 1891 --128
NM_001364chr1183886 3876 3805 3502 3353 2982 1870 270 34024 1711 1113 44533 3593 3573 3284 --
NM_001365chr174317 280 253 165 --2553 34 --
NM_001379chr19123 ------
NM_001382chr112185 179 --189 --
NM_001383chr173539 324 26 --1681 1260
NM_001387chr582538 2211 2089 2050 798 681 569 160 --1807 22903 2564
NM_001389chr212617 168 ------
NM_001391chr182990 21 ------
NM_001395chrX4795 314 304 189 --257 30 --
NM_001396chr2121869 1105 1255 11915 --
NM_001397chr1112443 2302 2180 2100 2049 987 881 720 673 514 187 1611 32280 2005 108 42506 2239 2086 1899
NM_001399chrX103578 3328 3264 3220 2413 1375 827 696 294 166 1528 13556 12929
NM_001401chr911363 ------
NM_001402chr612010 2531 22 ----
NM_001406chr1741479 369 188 101 1591 ----
NM_001407chr331683 1590 101 ----1629
NM_001408chr181512 1473 1124 584 457 106 86 70 --41270 621 150 64 --
NM_001412chrX23198 3071 13257 ----
NM_001416chr171193 ------
NM_001419chr1953703 3573 3069 1786 515 11028 43304 1942 1318 537 12948
NM_001420chr1982594 2533 2359 2158 1195 991 224 138 --42561 2515 1141 399 12746
NM_001423chr1231542 445 244 --1179 --
NM_001426chr22633 580 ------
NM_001427chr73762 703 625 1446 ----
NM_001429chr221307 ------
NM_001430chr241854 1366 806 134 11909 132 --
NM_001431chr61315 ------
NM_001438chr123314 328 --11416 1586
NM_001447chr551051 901 387 312 65 11022 31315 538 532 --
NM_001448chrX31548 506 205 11198 ----
NM_001453chr651680 1576 1166 377 347 11674 1389 11582
NM_001458chr71126 --1628 --
NM_001478chr123691 84 40 --1249 155
NM_001493chrX2288 70 --3675 514 24 --
NM_001494chr10186 ------
NM_001495chr83896 137 96 --11175 --
NM_001497chr952623 2598 1084 206 48 11046 --163
NM_001498chr611240 ------
NM_001500chr61108 --1118 --
NM_001508chr22678 69 ----1167
NM_001520chr167693 623 599 198 109 98 54 142 ----
NM_001521chr25751 740 589 186 127 ------
NM_001523chr192242 116 ------
NM_001525chr12106 40 ------
NM_001527chr674136 3394 3007 1839 889 720 611 33046 1049 1007 1537 --
NM_001530chr142848 840 ------
NM_001542chr142738 1999 1930 679 1221 --1754
NM_001546chr621195 488 ------
NM_001552chr172961 98 --3970 720 104 138
NM_001553chr4168 ------
NM_001554chr11125 ------
NM_001555chrX2197 77 ------
NM_001584chr11196 ------
NM_001608chr22257 109 ------
NM_001616chr232722 2350 216 12670 12630 --
NM_001619chr115771 440 420 163 152 1903 ----
NM_001620chr11----1125 --
NM_001626chr19103299 3263 2246 2149 1307 849 731 361 325 167 --42261 2251 1289 177 --
NM_001634chr61625 ----1227
NM_001635chr73883 353 321 --1404 --
NM_001649chrX52468 2186 1830 298 246 22176 1837 22365 464 --
NM_001650chr1831330 1072 311 12964 11061 --
NM_001655chr1142134 1795 462 133 11861 ----
NM_001656chr51426 ------
NM_001658chr1238 32 ------
NM_001659chr12112677 2492 2212 2064 1064 815 677 585 419 390 169 1579 5821 366 150 141 61 --
NM_001661chr173639 276 108 ------
NM_001662chr73133 127 39 ------
NM_001664chr33874 352 225 ------
NM_001665chr113578 481 200 --3385 191 32 --
NM_001674chr12282 171 11187 ----
NM_001678chr1771780 1753 1562 1555 1414 1344 307 --2501 62 --
NM_001679chr31192 ------
NM_001681chr12184 ------
NM_001682chr1211851 1175 ----
NM_001683chr322607 21 1953 ----
NM_001684chr183619 3392 3180 1507 1458 1348 1177 534 23517 1076 43607 1604 955 852 --
NM_001686chr12----136 --
NM_001690chr32729 144 11917 ----
NM_001693chr821037 111 11083 ----
NM_001694chr162439 317 --1162 --
NM_001695chr831539 340 29 11347 23681 3317 --
NM_001701chr911330 ------
NM_001703chr11238 --1248 --
NM_001704chr61557 ------
NM_001707chr71294 1683 3699 631 33 --
NM_001714chr12--1223 ----
NM_001717chr152542 505 ------
NM_001730chr1311124 ------
NM_001730chr1311124 ------
NM_001731chr121343 1592 ----
NM_001741chr111251 ------
NM_001742chr731749 676 523 ------
NM_001746chr572483 2271 1878 978 918 201 48 --12474 --
NM_001753chr741492 1429 1411 559 --11162 11219
NM_001754chr2153205 3181 1195 466 179 11078 11438 --
NM_001755chr1622235 770 1615 1854 --
NM_001759chr1294783 4001 3868 3278 1595 1160 1065 703 112 13558 ----
NM_001760chr62900 220 --3878 820 66 --
NM_001769chr121278 ------
NM_001773chr151324 1240 989 545 419 --31298 144 94 --
NM_001774chr192265 199 --160 --
NM_001777chr3103954 3441 3347 2715 2648 2621 1672 1492 1119 1002 1496 1728 --
NM_001789chr31201 --11386 --
NM_001791chr121064 119 ------
NM_001800chr192223 90 ------
NM_001802chr162677 376 1818 ----
NM_001806chr1942862 2544 2531 2399 ------
NM_001823chr141197 --131 --
NM_001825chr51109 ------
NM_001826chr11351 ------
NM_001842chr91158 --3500 469 174 1529
NM_001844chr12184 ------
NM_001845chr13----1155 --
NM_001854chr111084 ------
NM_001858chr624222 3497 21965 1386 --144
NM_001859chr953520 1283 1165 459 72 11007 22682 146 --
NM_001863chr19--1112 ----
NM_001874chr1295053 4960 4923 4188 1806 1688 1610 1162 1041 --45063 4897 3420 520 --
NM_001892chr511346 --1578 --
NM_001893chr171318 ------
NM_001894chr224328 310 293 203 ------
NM_001895chr2031174 1048 782 ------
NM_001901chr61387 1338 ----
NM_001904chr311033 1125 160 --
NM_001907chr16----151 --
NM_001915chr17101721 1678 1613 1396 835 792 761 748 169 43 --153 --
NM_001918chr178097 7142 6969 6860 6625 6577 3718 28218 6592 15626 --
NM_001920chr121773 1188 ----
NM_001923chr111597 --151 --
NM_001933chr1461018 988 296 274 201 194 1178 162 --
NM_001935chr22862 807 ------
NM_001938chr121212 47 --1364 --
NM_001939chrX63632 3620 2918 1471 1344 324 ------
NM_001945chr51912 31263 1131 463 --11008
NM_001946chr12122 ------
NM_001948chr1511149 11289 ----
NM_001949chr662128 1299 1155 979 708 381 1681 1223 --
NM_001954chr61823 --2234 87 --
NM_001955chr63103 61 49 11085 1796 --
NM_001961chr19124 ------
NM_001964chr53793 328 177 --1389 --
NM_001967chr32516 382 ------
NM_001969chr1453382 3198 3149 2904 684 31043 405 370 11325 --
NM_001970chr174582 528 465 402 --2558 173 --
NM_001978chr871032 972 875 660 220 198 140 --3881 281 40 --
NM_001981chr16861 355 345 313 270 236 --1878 --
NM_001986chr173592 563 44 1644 2431 24 --
NM_001995chr44967 591 324 54 ----1511
NM_001999chr5--1554 1124 --
NM_002006chr454094 4015 1947 1616 589 11819 ----
NM_002009chr15--1748 ----
NM_002014chr127644 619 547 540 62 37 26 ----1566
NM_002015chr1313136 12382 ----
NM_002017chr1121263 29 ------
NM_002024chrX51790 1587 1436 1376 310 ----1648
NM_002025chrX119093 8764 8729 8301 7879 6860 6258 2854 1863 1698 1535 16977 1911 --
NM_002039chr41667 ------
NM_002040chr2131197 869 402 1777 ----
NM_002045chr33331 97 52 ------
NM_002054chr2--142 ----
NM_002055chr1751636 1472 1416 1169 77 21630 185 127 --
NM_002059chr17121 ------
NM_002061chr141808 1702 571 162 1459 ----
NM_002063chrX132 ------
NM_002065chr131204 404 297 --1553 --
NM_002069chr72632 197 ------
NM_002074chr141646 1564 1339 383 ------
NM_002076chr1253248 3190 2708 954 34 12747 1189 11158
NM_002077chr941921 1565 423 155 1193 21513 536 1430
NM_002079chr10----2453 58 --
NM_002084chr52836 713 --1774 --
NM_002085chr193213 149 77 --135 --
NM_002086chr17102233 2151 2053 2023 1809 1610 1386 599 526 125 ------
NM_002087chr173227 57 22 ------
NM_002089chr4----152 --
NM_002092chr484797 4781 4633 4395 4052 4046 3803 939 23374 1426 13655 --
NM_002094chr16285 21 ------
NM_002103chr196717 449 290 173 40 28 1281 21013 852 --
NM_002126chr1763742 3716 3657 390 337 53 1223 11004 --
NM_002136chr121455 ------
NM_002138chr4--291 84 1527 --
NM_002139chrX1122 ------
NM_002140chr94772 346 134 85 ------
NM_002141chr73229 60 40 ------
NM_002146chr171919 21203 204 ----
NM_002147chr173884 640 113 --178 --
NM_002148chr21654 1147 ----
NM_002156chr2--1345 ----
NM_002158chr222876 707 23372 887 ----
NM_002166chr21656 ------
NM_002167chr1276 52 --1118 --
NM_002181chr21285 2616 112 1311 1124
NM_002187chr511098 1304 1888 --
NM_002193chr261256 1230 1199 1191 606 536 31670 334 260 21179 541 --
NM_002196chr202401 69 ----1864
NM_002196chr202401 69 ----1864
NM_002199chr41216 ------
NM_002202chr5131 1920 --1422
NM_002203chr533470 2837 2762 --22875 2686 --
NM_002205chr123840 712 373 1899 1931 1411
NM_002211chr10--1435 ----
NM_002214chr744893 1271 950 396 11098 21890 1246 --
NM_002221chr1132929 2854 2755 2705 2533 2439 2329 1172 1089 941 635 421 366 22942 921 42444 2302 900 311 22235 777
NM_002222chr311170 ------
NM_002223chr1263947 3068 1308 994 255 44 ------
NM_002226chr144863 747 691 58 --1669 --
NM_002227chr13973 949 50 --1389 --
NM_002229chr192372 146 --1359 --
NM_002230chr175805 413 403 205 162 --2903 291 --
NM_002232chr12471 61 --2972 150 --
NM_002235chr1261284 1198 1165 469 448 176 11562 11174 --
NM_002240chr212468 163 ------
NM_002241chr13948 819 208 13091 12099 --
NM_002246chr23213 153 86 1401 41265 322 76 51 --
NM_002247chr103594 94 84 140 ----
NM_002249chr1--1510 ----
NM_002251chr2062280 1548 857 726 489 216 12051 31559 1553 881 257 26
NM_002254chr282335 1906 1565 886 863 665 657 74 11553 1152 1324
NM_002264chr3104998 4908 4474 4349 4138 1676 1292 1173 145 132 43872 3775 3740 1241 ----
NM_002265chr17--1157 ----
NM_002267chr133761 641 257 11625 ----
NM_002268chr32734 446 ------
NM_002270chr575453 4060 1825 1014 666 568 71 25414 4941 ----
NM_002275chr17----2172 101 131
NM_002283chr124701 521 162 39 129 ----
NM_002285chr264177 3143 2827 2792 1255 475 21453 886 1624 --
NM_002286chr12------158
NM_002290chr611002 ----11376
NM_002293chr132703 2153 105 --1353 --
NM_002296chr121121 33 ------
NM_002306chr141148 ------
NM_002309chr22113069 2899 2878 2524 2418 2385 2251 730 297 272 68 --32810 2805 2059 12570
NM_002313chr10125097 5044 4937 4861 4760 1703 1453 1245 1136 1076 965 758 1185 15008 --
NM_002315chr11356 48 40 1111 ----
NM_002319chr72981 679 --4842 261 255 60 1694
NM_002333chr1931104 442 323 2994 484 172 --
NM_002334chr1141716 620 420 336 --2379 23 --
NM_002349chr22625 85 ----1165
NM_002351chrX1558 1297 ----
NM_002355chr1241060 1027 998 988 ------
NM_002356chr622233 1948 --2871 260 --
NM_002359chr17143931 3759 3647 3607 3384 3279 2803 2783 1334 1146 1132 663 486 127 --84189 3992 3983 3817 3676 3314 1124 68 12791
NM_002360chr792618 2585 2143 765 573 433 409 372 232 3657 439 75 22575 814 --
NM_002373chr1521220 948 ----31326 1230 1169
NM_002374chr263411 2927 2590 1007 867 249 ------
NM_002375chr372193 1993 1913 720 383 298 58 --41600 693 372 329 --
NM_002381chr21804 195 ----
NM_002382chr1431082 381 327 1843 3386 355 231 --
NM_002383chr163865 219 182 --1323 --
NM_002384chr181189 ------
NM_002385chr1871488 1463 1076 471 363 73 27 ------
NM_002387chr554889 952 428 254 27 --11778 --
NM_002397chr532233 1478 1379 ------
NM_002398chr21140 ------
NM_002399chr15--1985 ----
NM_002401chr17102352 2304 2290 2042 1897 1758 1720 1693 617 555 2992 209 31777 803 640 22343 547
NM_002402chr72967 23 ------
NM_002406chr571017 819 788 769 709 404 83 ----134
NM_002419chr113455 411 84 1370 1384 --
NM_002430chr22102571 2412 1894 1755 861 781 752 732 678 152 1232 149 --
NM_002436chrX3321 119 64 ------
NM_002442chr123418 135 108 1396 4252 219 167 162 --
NM_002444chrX41697 1439 1431 1330 ------
NM_002445chr82190 31 ----1317
NM_002457chr111124 ------
NM_002466chr20196 1112 1310 --
NM_002469chr121344 ------
NM_002479chr1128 ------
NM_002480chr12--1120 ----
NM_002481chr1167485 7455 7265 7221 6701 6685 5325 5203 3193 1524 1017 972 853 306 180 164 36532 2843 1681 35457 4927 73 35967 2801 1406
NM_002495chr5123 ------
NM_002499chr1531761 225 170 ------
NM_002501chr19133950 3894 3648 2874 2601 2522 2513 1552 1435 1128 988 952 879 1905 43932 3399 1016 995 1600
NM_002505chr621228 98 --1574 --
NM_002506chr1----127 --
NM_002507chr1781686 1609 1414 1287 494 278 208 64 --41915 253 247 230 1164
NM_002509chr201751 --4775 770 687 206 --
NM_002515chr141442 1269 ----
NM_002516chr193269 242 101 ------
NM_002521chr1263 28 ------
NM_002522chr1792593 2586 2500 2397 1499 868 852 665 118 13849 72449 1477 823 807 740 174 43 --
NM_002524chr12251 239 1126 --1286
NM_002530chr15--1130 151 --
NM_002537chr152995 950 1441 1383 --
NM_002545chr1173791 1945 1436 1128 883 286 34 1262 24188 1950 1325
NM_002547chrX73334 2970 1671 659 589 352 124 23192 765 --21426 282
NM_002552chr231320 151 124 ------
NM_002553chr72415 345 1427 ----
NM_002556chr1151971 1579 1342 369 353 --1308 --
NM_002576chr1141212 1051 872 825 21101 496 194 11005
NM_002577chr333508 2728 800 ------
NM_002578chrX159 ------
NM_002579chr1981442 1427 1386 1031 600 582 454 73 1365 31303 1292 1176 --
NM_002581chr9104887 4198 1827 1580 1272 928 850 819 762 130 ------
NM_002585chr1132 --1265 --
NM_002586chr631167 1075 1043 --21080 446 --
NM_002587chr5124 1371 1142 --
NM_002589chr4277 67 ------
NM_002590chr13------1459
NM_002594chr2012430 ------
NM_002599chr1151114 940 820 340 256 --2329 25 --
NM_002600chr151503 1198 688 636 193 21509 391 11209 --
NM_002607chr751121 973 963 476 439 11279 1900 --
NM_002608chr2261534 1330 1255 416 343 211 --11346 --
NM_002609chr531687 1335 574 188 5719 670 211 26 21 145
NM_002613chr16144254 1705 1563 1493 1323 1036 844 592 550 529 481 396 127 44 191 104282 4058 3677 3668 3649 1693 1422 1314 627 375 13786
NM_002622chr53606 343 30 1195 4626 286 203 89 --
NM_002623chr201134 ------
NM_002628chr311146 ------
NM_002632chr143816 86 75 --2638 116 1336
NM_002633chr11506 ------
NM_002634chr174785 604 360 279 1806 ----
NM_002636chr63157 130 72 --1146 --
NM_002644chr151426 1313 346 107 24 --41460 1146 608 95 --
NM_002645chr1132835 2610 1218 22636 2217 ----
NM_002646chr161630 1475 817 410 173 68 1741 21426 843 --
NM_002648chr641241 523 504 491 ----2420 313
NM_002650chr222260 67 --384 79 26 --
NM_002651chr1----2841 216 --
NM_002655chr831237 1062 568 ------
NM_002657chr20143435 3250 3043 2993 2795 2731 2593 2504 2457 1512 1341 1155 871 477 --52470 2444 1487 1466 447 42886 2870 845 621
NM_002663chr172506 370 --2390 62 --
NM_002670chr3--123 ----
NM_002673chr34387 235 214 23 --2533 158 --
NM_002693chr152397 102 1137 ----
NM_002698chr1952535 2317 2031 1907 1125 --62795 2457 749 349 336 102 11208
NM_002699chr141083 1070 267 255 --4967 950 304 274 --
NM_002705chr16----187 --
NM_002710chr121284 ------
NM_002711chr71714 ------
NM_002713chr11184 ------
NM_002714chr64717 281 64 35 --1853 2907 872
NM_002715chr51917 ------
NM_002716chr11103580 3384 3278 3222 3193 3107 2517 896 867 285 ------
NM_002717chr82256 35 --1510 --
NM_002718chr322572 832 1570 ----
NM_002720chr161108 ----160
NM_002721chr93473 119 35 ------
NM_002726chr61110 ------
NM_002730chr1951001 476 289 216 106 ------
NM_002731chr11158 ------
NM_002733chr122109 54 --2241 124 --
NM_002734chr1771529 918 757 696 618 504 117 ------
NM_002738chr162921 302 ------
NM_002739chr193626 610 105 1664 3259 127 89 --
NM_002742chr143544 275 75 ------
NM_002745chr2274503 4462 4449 4035 3918 210 83 21604 1261 24406 354 --
NM_002746chr163391 46 40 ----2587 499
NM_002747chr1841417 728 711 94 11484 1567 --
NM_002748chr15----1314 --
NM_002752chr51157 125 1129 --
NM_002753chr43543 292 144 ------
NM_002760chrY115774 5691 5393 5141 4535 4427 2154 1727 1228 1205 229 --35479 1991 1032 12042
NM_002761chr16133 2133 113 ----
NM_002765chrX21151 442 ------
NM_002776chr1941655 1583 813 43 11907 4776 328 197 133 1319
NM_002779chr10129 --2538 58 --
NM_002794chr1--126 ----
NM_002808chr32108 57 ------
NM_002814chrX1147 ------
NM_002819chr19101414 1138 1102 1063 553 441 354 347 174 165 ------
NM_002823chr2----1228 --
NM_002824chr124363 347 325 107 --196 1191
NM_002825chr7--1469 ----
NM_002827chr2091759 1540 1374 1343 1326 1281 1228 568 490 11458 21308 45 --
NM_002829chr921231 257 --1298 --
NM_002833chr1551430 1324 1290 1205 352 21219 1211 21330 1180 --
NM_002835chr72231 148 1762 ----
NM_002839chr91411 12761 ----
NM_002844chr62990 42 ------
NM_002849chr12184 1296 ----
NM_002850chr191403 --150 --
NM_002854chr221124 --137 --
NM_002855chr11173576 3378 3169 3115 3086 3043 2975 2704 2653 1283 1168 991 923 626 298 274 106 12349 83466 3433 2679 2673 848 819 768 64 13069
NM_002858chr13442 259 25 ------
NM_002859chr1251249 1194 1186 1161 612 --3580 164 22 1181
NM_002865chr8168 ------
NM_002866chr191455 1487 5419 206 190 103 34 --
NM_002867chr15506 164 149 96 62 ------
NM_002868chr1262259 1820 958 843 394 363 ------
NM_002869chr1131633 385 138 ------
NM_002871chr151975 589 409 190 160 --11779 11670
NM_002874chr9----2878 339 --
NM_002880chr31219 ------
NM_002885chr141021 733 298 176 1723 4892 744 134 97 1834
NM_002886chr363779 2071 1033 191 167 30 23209 589 23281 157 --
NM_002890chr5--185 ----
NM_002892chr14--1213 ----
NM_002895chr202906 771 ------
NM_002898chr122660 180 ----1113
NM_002900chr102114 69 ------
NM_002904chr6----1194 --
NM_002906chr111806 1451 1378 196
NM_002911chr1951582 1572 1281 1055 417 --41535 1310 1108 179 --
NM_002938chr491997 1628 735 597 582 530 378 321 68 1399 ----
NM_002941chr3--161 ----
NM_002942chr31327 ------
NM_002945chr173860 786 675 --1257 --
NM_002955chr651653 1630 1601 1586 1366 11241 ----
NM_002958chr32614 41 163 ----
NM_002959chr1113659 3391 3366 3166 3090 3045 874 431 366 256 62 23617 381 13682 --
NM_002966chr1166 --1216 --
NM_002968chr162448 202 --173 1319
NM_002971chr31414 ------
NM_002977chr242720 2687 926 303 32866 1189 1173 ----
NM_002994chr421292 235 ------
NM_002996chr1681800 1644 1304 743 430 404 341 246 1193 71814 1655 1630 1501 1223 578 394 --
NM_002997chr291825 1692 1303 1229 374 190 174 136 53 ----292 32
NM_002998chr821953 1398 --1412 --
NM_002999chr2041855 1785 1324 1261 2774 170 1710 1429
NM_003002chr112615 51 ------
NM_003010chr1751947 1882 1799 1755 226 3827 747 153 ----
NM_003011chr96626 347 319 306 245 118 11222 11364 1684
NM_003012chr822071 745 1103 1616 --
NM_003013chr4133 --1133 --
NM_003014chr711372 21412 1350 196 --
NM_003015chr103638 513 36 --2525 499 124
NM_003016chr1711787 ------
NM_003020chr15180 ------
NM_003026chr931107 1002 970 ------
NM_003028chr962957 2533 2360 1545 1214 993 33081 2853 1480 43324 3204 1226 21 23802 3499
NM_003029chr11189 11273 ----
NM_003030chr32219 31 ------
NM_003031chr16--176 ----
NM_003034chr12108141 7480 6903 6828 6596 6253 6074 6011 5581 417 12705 25229 2376 --
NM_003036chr14464 259 249 89 11236 ----
NM_003039chr12483 172 2214 34 ----
NM_003043chr374205 3994 3200 3095 3039 1392 36 21222 387 ----
NM_003047chr161434 1051 1042 1013 543 27 1511 101176 1114 907 588 427 313 251 166 103 78 --
NM_003051chr131937 1620 738 ------
NM_003062chr5--122 ----
NM_003072chr19----1180 --
NM_003074chr32743 292 21875 303 1260 --
NM_003076chr12101537 1376 1344 681 596 522 359 77 63 53 11425 31318 1077 1047 --
NM_003077chr172235 63 --1228 --
NM_003081chr2021151 981 ------
NM_003088chr71153 3453 267 47 51033 942 254 110 28 160
NM_003091chr20----1203 --
NM_003098chr203487 218 76 --1196 1453
NM_003099chr15136089 5707 5684 5621 5070 1572 1378 1292 805 770 680 210 92 32433 1273 1030 44552 1087 947 123 25876 1238
NM_003106chr311001 ------
NM_003107chr632412 687 455 22586 1918 2679 231 --
NM_003108chr252586 2002 1977 1136 255 1829 35105 1868 1810 15999
NM_003110chr177833 707 405 223 154 98 80 --3866 422 187 --
NM_003113chr2----1178 --
NM_003127chr93104 50 36 ------
NM_003128chr231137 882 22 --11944 11971
NM_003131chr671882 1721 1489 583 429 409 171 1399 4806 593 588 468 --
NM_003137chr641493 526 262 166 ----1225
NM_003139chr114932 706 610 92 --1264 --
NM_003146chr11130 ------
NM_003150chr1772186 2138 1883 1652 1549 464 394 159 42175 1768 1604 314 --
NM_003153chr12158 --21009 206 183
NM_003155chr82784 220 --1279 1264
NM_003156chr113320 199 145 --21222 208 11235
NM_003161chr1731407 748 65 ------
NM_003162chr23750 317 93 ------
NM_003164chr111108 1522 2175 160 --
NM_003168chr173780 343 42 --3982 661 348 --
NM_003170chr172575 225 1581 3557 535 74 --
NM_003173chrX121215 1200 1193 1152 1083 357 351 134 124 114 104 76 11092 2395 192 11289
NM_003174chr102738 557 ------
NM_003178chr321875 1439 ------
NM_003179chrX61290 1281 1211 429 250 59 --3284 175 114 --
NM_003185chr20--1246 31227 505 498 --
NM_003186chr113363 164 71 ------
NM_003188chr61835 ------
NM_003189chr183257 3163 3151 2571 2170 1009 689 648 1519 53170 743 389 384 329 --
NM_003199chr1821768 844 ------
NM_003200chr1972368 2072 1970 1764 301 269 43 --42102 1496 921 232 --
NM_003202chr551503 1160 363 171 85 1495 1511 --
NM_003204chr1731614 1208 608 11773 11592 --
NM_003211chr1241437 619 610 22 ------
NM_003214chr681391 1138 1094 1038 966 500 228 57 1103 41213 464 261 256 1164
NM_003216chr22122718 2511 2359 2306 2265 1037 840 688 577 377 123 64 --42783 2060 1317 50 --
NM_003220chr641494 247 209 96 21321 310 ----
NM_003221chr683624 3417 3265 3088 2889 2780 1321 619 --23256 3113 33247 2662 831
NM_003223chr16----1605 1291
NM_003236chr253052 2387 2376 1362 394 1331 23013 2398 12295
NM_003246chr1521644 156 --21276 302 --
NM_003247chr641971 705 106 33 21330 144 ----
NM_003250chr171179 --162 --
NM_003253chr2141528 1515 446 44 --21503 56 --
NM_003255chr1762383 1818 868 791 482 21 --31692 492 294 1218
NM_003257chr1511095 ------
NM_003269chr62295 168 ------
NM_003270chrX2288 60 ------
NM_003271chr111149 --195 126
NM_003272chr12739 198 ------
NM_003281chr1215005 4477 4437 3866 3635 3465 3419 3385 1436 1306 965 912 898 806 731 705 652 572 562 316 35 35282 3455 538 55193 5121 1843 481 76 --
NM_003286chr20177 ------
NM_003292chr132189 744 230 ------
NM_003295chr13--136 ----
NM_003298chr3176018 5276 5199 5039 4301 4266 2464 2447 2398 2184 2147 1939 1764 1611 1143 461 117 ------
NM_003317chr14154 --136 --
NM_003319chr2----1328 --
NM_003320chr11164178 4063 4029 3605 3265 3075 1737 1688 1622 1406 1194 933 843 750 169 49 1822 22706 75 1606
NM_003323chr19------144
NM_003324chr1231391 1176 1091 --178 --
NM_003325chr223292 168 129 --1253 --
NM_003334chrX--1145 ----
NM_003336chrX--176 --1134
NM_003339chr52527 115 ------
NM_003340chr4----11176 --
NM_003342chr1753042 2696 2485 2101 73 1583 1988 --
NM_003344chr751455 1346 1321 661 462 11382 ----
NM_003348chr12--144 1254 --
NM_003349chr2041140 565 410 345 1219 1374 --
NM_003367chr19146 --2447 207 --
NM_003370chr193780 490 262 2795 51 3165 67 58 1238
NM_003371chr9111982 1589 786 740 586 538 461 424 410 321 180 --3714 448 327 1638
NM_003373chr1071944 1636 1285 1260 749 604 323 --21480 329 --
NM_003374chr51609 ------
NM_003376chr61171 --21482 611 --
NM_003376chr61171 --21482 611 --
NM_003378chr7--1151 3127 121 108 --
NM_003385chr2--1229 ----
NM_003387chr231121 1060 228 --178 11815
NM_003390chr111314 ------
NM_003392chr334059 1715 1143 --11609 --
NM_003399chrX41059 207 70 51 11025 197 --
NM_003400chr2131 ------
NM_003404chr2031883 1830 1447 11485 11357 --
NM_003405chr221137 ----167
NM_003406chr841720 1428 618 24 --11590 --
NM_003410chrX32365 2047 308 ------
NM_003412chr332479 1055 82 31068 725 136 21165 1110 --
NM_003413chrX31826 1283 266 ------
NM_003418chr31122 ------
NM_003423chr1932369 2239 2084 11018 ----
NM_003427chr63680 608 63 --1169 --
NM_003442chr111558 ------
NM_003458chr3124007 3699 3427 3247 3061 2665 1587 1236 1020 360 282 96 22961 1210 83576 3368 2624 1503 1032 1026 970 570 1345
NM_003463chr61493 13101 ----
NM_003466chr2122435 2308 1974 1616 979 962 890 697 661 520 355 136 1871 ----
NM_003468chr253494 3486 3018 1724 161 --11307 --
NM_003470chr1631535 708 378 --11555 --
NM_003471chr31902 ------
NM_003478chr111936 23126 1128 1123 --
NM_003482chr1221880 480 --52669 2376 467 373 231 --
NM_003483chr1232950 2780 487 --11904 --
NM_003485chr147383 282 276 125 108 76 67 --21049 206 --
NM_003487chr17167 ------
NM_003488chr174827 817 775 305 1620 ----
NM_003489chr2153446 2999 2972 2632 1030 ------
NM_003498chr1671845 795 718 591 248 230 121 ----12182
NM_003502chr163499 190 126 1465 1270 --
NM_003557chr121387 1102 138 31313 1144 69 --
NM_003558chr91503 ------
NM_003559chr17193923 3884 3654 3196 3181 3148 3120 3038 2913 2489 1474 1373 1357 1131 970 855 788 651 201 23210 1387 23187 539 --
NM_003563chr1751159 1133 982 312 203 11284 --11352
NM_003564chr12158 135 1141 125 --
NM_003566chr12----1494 --
NM_003574chr1865173 3925 3880 3816 1216 561 ------
NM_003575chr751564 1425 1219 1167 1085 --41350 1344 1151 69 --
NM_003576chr13102746 2719 2607 2424 2225 2141 1915 1063 804 371 --1570 --
NM_003581chr22673 106 ------
NM_003583chr1253575 2908 1473 786 442 ------
NM_003586chr164446 212 193 104 --1489 1577
NM_003590chr232951 637 205 --1957 --
NM_003591chr101113 ------
NM_003592chr7192 1381 ----
NM_003593chr174539 496 445 107 1198 1268 --
NM_003597chr252040 1726 1569 814 178 21830 655 ----
NM_003602chr71445 --1311 --
NM_003603chr431597 1369 227 31947 131 35 ----
NM_003607chr144253 1647 1098 86 13412 23919 746 23674 42
NM_003612chr152547 504 --2498 93 --
NM_003613chr152252 28 ------
NM_003615chr323951 2480 --1820 --
NM_003617chr163921 1148 692 280 214 57 11715 24534 1660 --
NM_003618chr2199 ------
NM_003619chr4--1572 1140 --
NM_003620chr171807 ------
NM_003626chr1131219 925 850 ------
NM_003629chr1113150 3129 3117 3037 2551 1381 1374 1201 1063 818 402 11352 ----
NM_003632chr175716 249 220 102 53 1293 ----
NM_003633chr542402 2220 1017 333 11997 ----
NM_003635chr102378 360 --137 --
NM_003637chr141436 1166 420 228 ------
NM_003644chr17146592 6505 6480 5529 4927 4388 4179 2462 1220 924 908 594 255 30 15900 95980 5931 5380 5222 4353 2256 766 296 208 24003 778
NM_003653chr171167 ------
NM_003654chr113530 146 119 --1541 --
NM_003655chr174767 278 231 166 ------
NM_003656chr3256 30 ------
NM_003663chr342262 1343 1082 318 --1306 --
NM_003664chr52470 138 ------
NM_003671chr972738 2712 2692 1057 926 411 317 12276 ----
NM_003672chr11424 --1106 --
NM_003679chr143151 2412 2157 867 1822 1736 --
NM_003681chr21316076 6037 5461 5321 4900 4816 4808 4775 4523 4473 4359 4227 4047 4035 4010 2453 2424 2203 2169 2053 1267 1259 1237 1226 1147 935 320 289 264 78 58 31816 1485 462 86121 6057 5123 5083 4681 2458 948 942 14481
NM_003684chr151010 989 315 283 98 ------
NM_003685chr192812 389 ----1272
NM_003686chr11186 --130 --
NM_003693chr175601 255 240 196 99 ------
NM_003704chr42622 532 1100 ----
NM_003716chr31282 ------
NM_003718chr71485 ------
NM_003726chr172263 33 182 --1382
NM_003741chr32340 119 ------
NM_003743chr2--12145 21524 397 --
NM_003744chr142393 204 1401 ----
NM_003745chr16164 ------
NM_003746chr122227 94 ------
NM_003749chr1351597 953 908 523 181 --11881 --
NM_003758chr15--186 ----
NM_003758chr15--186 ----
NM_003759chr432983 919 274 1854 23138 424 --
NM_003760chr11544 ------
NM_003763chr2043215 2949 875 162 --12652 --
NM_003766chr171528 ------
NM_003768chr131778 1494 1161 --21564 1466 --
NM_003774chr1233094 2362 2283 12533 ----
NM_003779chr11422 ------
NM_003780chr13441 287 182 142 2630 507 --
NM_003787chr18----1673 --
NM_003791chr161144 1599 1223 --
NM_003792chr92159 137 ------
NM_003794chr32761 435 ------
NM_003797chr111174 ------
NM_003800chr631804 1535 499 ------
NM_003806chr12173 ------
NM_003809chr172461 111 --178 --
NM_003812chr2130 1206 ----
NM_003822chr122541 23 23135 665 1518 --
NM_003825chr151584 --1187 --
NM_003827chr194568 494 434 35 --2218 211 --
NM_003835chr17----1255 --
NM_003861chr1432856 2655 424 ------
NM_003867chr82557 378 ------
NM_003872chr222381 244 22878 573 ----
NM_003873chr1031688 799 290 --1822 --
NM_003877chr121950 --1301 --
NM_003887chr241944 1696 340 283 167 --11915
NM_003888chr1531171 369 51 ------
NM_003893chr10140 --2467 32 --
NM_003901chr1062556 2290 1681 925 594 326 12259 1794 --
NM_003913chr663245 3150 2930 2668 628 476 ------
NM_003924chr42281 246 ------
NM_003927chr18----1727 --
NM_003931chr62591 527 ------
NM_003939chr10102823 2517 1366 836 624 482 417 407 298 28 167 13150 --
NM_003941chr732261 1696 203 ------
NM_003947chr32345 25 ------
NM_003948chr452344 1707 969 694 614 ------
NM_003949chr17111975 1964 1910 1687 1447 1376 1285 545 318 59 39 11809 71884 1770 1350 640 288 275 258 --
NM_003951chrX1281 ----132
NM_003954chr17148 21352 103 7983 978 514 287 282 203 193 --
NM_003957chr115844 838 735 242 73 --1436 --
NM_003958chr6113947 3921 3880 3816 3180 2709 2682 1331 1143 522 155 23468 476 32441 248 177 --
NM_003966chr5187496 7415 7271 6673 6612 5628 5230 5183 5051 2698 2534 1339 1264 898 806 625 553 402 25600 1116 14753 1779
NM_003971chr171250 ------
NM_003975chr1163 ------
NM_003980chr621373 1017 172 ----
NM_003987chr10112010 1881 1693 899 885 846 788 760 369 262 245 22196 871 71738 1616 1600 819 814 605 349 --
NM_003988chr1092087 1958 1770 923 865 837 446 339 322 22273 948 81815 1693 1677 896 891 682 426 47 --
NM_003989chr10111946 1817 1629 835 821 782 724 696 305 198 181 22132 807 71674 1552 1536 755 750 541 285 --
NM_003990chr10111946 1817 1629 835 821 782 724 696 305 198 181 22132 807 71674 1552 1536 755 750 541 285 --
NM_003992chr15----1273 --
NM_003993chr12231 24 ------
NM_003994chr121422 24110 774 --11313
NM_004006chrX21068 826 1336 ----
NM_004007chrX21068 826 1336 ----
NM_004009chrX21068 826 1336 ----
NM_004010chrX21068 826 1336 ----
NM_004011chrX21068 826 1336 ----
NM_004012chrX21068 826 1336 ----
NM_004013chrX21068 826 1336 ----
NM_004014chrX21068 826 1336 ----
NM_004015chrX21068 826 1336 ----
NM_004016chrX2982 740 1250 ----
NM_004017chrX21068 826 1336 ----
NM_004018chrX2982 740 1250 ----
NM_004020chrX21068 826 1336 ----
NM_004021chrX2982 740 1250 ----
NM_004022chrX2982 740 1250 ----
NM_004023chrX2982 740 1250 ----
NM_004024chr11530 11546 ----
NM_004028chr1831330 1072 311 12964 11061 --
NM_004035chr1754462 3889 3306 1438 416 45148 4451 3657 1504 34414 4389 541 --
NM_004036chr21512 --3660 268 259 1170
NM_004037chr12623 84 1732 2250 238 --
NM_004040chr241194 1168 113 23 --129 --
NM_004050chr1442541 2246 2059 675 1861 22129 617 --
NM_004055chr11122007 2000 1587 1391 899 734 700 477 466 370 303 210 11962 4799 633 296 145 --
NM_004061chr51435 1209 ----
NM_004068chr33398 304 99 ------
NM_004077chr1221245 1215 --31060 412 201 1378
NM_004078chr13853 163 36 1845 2959 27 21015 106
NM_004080chr731492 528 93 ------
NM_004081chrY--11345 ----
NM_004082chr21114 --156 --
NM_004089chrX1885 ------
NM_004093chr1352690 2571 525 400 304 13163 ----
NM_004096chr1082134 1919 1688 1605 616 459 334 239 21981 785 2797 193 --
NM_004099chr941975 1943 1693 548 --1703 --
NM_004103chr83735 701 22 --261 41 1122
NM_004104chr172542 92 --1107 --
NM_004107chr191146 ------
NM_004112chr1741476 76 64 30 11538 189 --
NM_004114chrX--2932 144 ----
NM_004116chr2280 58 --1143 164
NM_004123chr17253 35 ------
NM_004124chr1433517 2356 113 12180 ----
NM_004132chr1051131 1103 1068 318 197 ------
NM_004134chr52614 457 1225 ----
NM_004156chr82235 21 ------
NM_004157chr3197 --1629 --
NM_004161chr221319 518 ------
NM_004163chr18--1121 ----
NM_004169chr172647 52 ------
NM_004171chr1197919 6341 6016 3500 3189 2051 1374 657 529 57566 3828 3658 2921 284 22479 648 12812
NM_004172chr531984 716 690 ------
NM_004176chr17167 --2381 31 --
NM_004183chr111735 ------
NM_004185chr1165 ------
NM_004186chr35675 587 297 222 156 122 1113 --
NM_004187chrX31304 561 79 --1407 1120
NM_004188chr93477 195 35 149 1175 --
NM_004193chr103351 200 72 ------
NM_004200chr11102951 2741 2118 2099 2059 1241 1044 1018 809 227 22836 766 23267 1068 22533 93
NM_004202chrY4288 185 169 147 ------
NM_004225chr82932 82 11124 --11472
NM_004227chr762661 2370 305 253 194 101 --1722 1728
NM_004230chr1942173 2124 1685 454 21724 493 ----
NM_004235chr9----1752 --
NM_004238chr2126 ------
NM_004242chr61400 ------
NM_004247chr17126 ------
NM_004253chr91952 1845 ----
NM_004254chr112361 155 --126 --
NM_004263chr251840 1522 1487 1254 668 --21259 489 --
NM_004272chr52445 72 1524 ----
NM_004274chr1452943 2924 748 393 273 --12818 --
NM_004276chr124389 362 120 67 ------
NM_004279chr722173 1980 2712 502 12370 --
NM_004283chr195928 888 221 131 36 2946 112 --1710
NM_004290chr53979 881 109 1509 ----
NM_004291chr51135 ------
NM_004293chr923668 1071 13692 ----
NM_004295chr1741074 307 240 184 ------
NM_004302chr1292929 2544 2410 2288 2123 1825 654 530 94 12492 52387 2225 2219 2168 833 22627 2191
NM_004309chr1751114 780 270 232 215 11092 21120 787 --
NM_004311chr10152992 2826 2764 2719 2527 2364 2332 2269 2249 1904 1260 1201 1013 418 227 --42260 1194 693 687 --
NM_004316chr1221147 832 ------
NM_004319chr1102756 2310 2050 1283 1045 568 433 365 152 145 1203 2494 327 --
NM_004320chr161142 --1332 --
NM_004321chr283497 3398 2566 2179 1289 460 423 74 52819 895 491 94 68 --33160 2669 2295
NM_004329chr102909 557 ------
NM_004330chr151397 ------
NM_004331chr81110 ------
NM_004338chr18136921 6363 5947 5729 5470 5457 4900 4711 4480 2522 2201 895 69 26911 6119 12357 11726
NM_004342chr712292 12187 ----
NM_004349chr821046 292 ------
NM_004356chr114451 400 110 32 --1437 --
NM_004359chr192421 21 1427 1496 --
NM_004360chr1661824 1539 753 656 569 320 --1461 1774
NM_004364chr1971015 498 372 219 167 142 85 11072 ----
NM_004370chr62480 429 --11338 --
NM_004379chr21187 ------
NM_004380chr1632184 1695 1637 ------
NM_004383chr152412 126 --172 --
NM_004384chr512320 ------
NM_004386chr1952328 2220 1836 1725 1640 --32062 2034 920 --
NM_004389chr2--186 ----
NM_004391chr3132020 1957 1860 1623 1558 1458 819 605 563 294 218 137 72 --51756 1450 1413 651 580 --
NM_004392chr1342259 2031 1647 907 ------
NM_004393chr352236 1897 1820 1531 366 --11856 --
NM_004394chr571815 1530 1178 1101 98 40 22 11274 21606 1601 11422
NM_004395chr52601 543 --1307 131
NM_004397chr1131419 1390 1199 33601 1699 1664 23854 1586 --
NM_004405chr23307 281 110 --1147 --
NM_004408chr92486 44 --1194 --
NM_004409chr191767 186 1483 --
NM_004411chr71585 ------
NM_004416chr124974 322 139 29 ------
NM_004418chr24569 418 394 21 ------
NM_004420chr1161941 1825 1531 868 478 460 21581 772 2846 445 --
NM_004421chr15570 315 137 78 51 --2212 26 --
NM_004423chr3112424 2058 1854 690 667 545 507 306 236 197 181 12201 61810 892 679 593 528 223 --
NM_004426chr1281951 1774 1590 774 710 691 542 402 ------
NM_004427chr131105 1094 901 --1401 --
NM_004428chr13652 265 68 1805 1841 --
NM_004429chrX41211 1078 1025 935 --2310 151 31172 331 85
NM_004430chr831096 870 131 --1939 11701
NM_004431chr13700 206 121 --165 --
NM_004432chr911805 1234 --1615
NM_004436chr1284 74 --147 --
NM_004437chr162923 1410 1063 646 609 568 181 31156 312 30 --
NM_004438chr233343 2241 1105 --11117 --
NM_004441chr311293 ------
NM_004443chr32734 259 --1523 --
NM_004444chr7183 1160 --1350
NM_004451chr115593 264 227 104 41 ------
NM_004454chr342243 1483 1475 104 22266 2218 12037 --
NM_004455chr16764 728 300 203 178 65 --11095 --
NM_004457chr211245 1597 ----
NM_004458chrX62425 2276 1891 1756 1698 891 --11762 --
NM_004459chr171725 11396 --11531
NM_004464chr444135 1006 881 444 13976 23770 910 --
NM_004469chrX1202 ----130
NM_004472chr51182 ------
NM_004474chr151022 863 763 385 60 --3752 424 291 1737
NM_004475chr17101189 1131 1017 901 807 776 746 244 167 158 1843 21108 346 --
NM_004484chrX142 ------
NM_004485chr1113553 3474 3308 2792 2702 1535 1172 1055 662 481 50 --22987 104 --
NM_004486chr911053 --3988 121 51 --
NM_004491chr19133797 3148 3130 3025 3006 2979 2896 1722 1428 873 563 546 325 --53407 2718 1595 1386 784 1530
NM_004494chr14503 112 39 33 ----1511
NM_004496chr142852 242 --1293 --
NM_004499chr51105 ------
NM_004500chr1441928 1482 1269 222 ------
NM_004501chr133518 1171 984 ------
NM_004504chr232898 2698 561 12929 11897 --
NM_004505chr1711346 ------
NM_004514chr1782576 2435 2315 1111 1049 319 232 92 ----12332
NM_004515chr1--159 ----
NM_004516chr194973 961 841 88 ------
NM_004517chr11--2238 196 ----
NM_004525chr221040 115 ------
NM_004529chr9--11176 --1509
NM_004537chr1211037 ------
NM_004540chr212779 150 ------
NM_004543chr22327 45 ------
NM_004571chr2173276 3209 3008 2738 1324 736 580 --12373 --
NM_004575chr42619 65 ------
NM_004578chr11694 ----1846
NM_004583chr173645 314 290 --1543 --
NM_004586chrX63590 3457 1287 870 146 134 25422 1854 ----
NM_004588chr1193456 3380 3199 3154 3065 1622 347 158 55 2253 199 63221 2804 1055 830 465 69 --
NM_004593chr3126 1840 ----
NM_004598chr54924 688 636 60 11037 22990 491 --
NM_004602chr2051416 1253 1220 531 342 ------
NM_004603chr731065 827 377 --2382 307 2835 143
NM_004606chrX136 ------
NM_004612chr944598 4516 1584 309 --34468 4099 2965 --
NM_004613chr2041447 1274 293 23 --41394 1257 1182 1100 --
NM_004615chrX8699 626 376 285 250 219 169 111 --1116 --
NM_004626chr113668 95 39 ------
NM_004630chr11--2877 835 --1749
NM_004634chr33150 86 35 --1439 --
NM_004637chr321250 252 --21007 228 --
NM_004642chr12168 ------
NM_004643chr141182 --1293 --
NM_004651chrX2351 48 ------
NM_004654chrY21176 374 ------
NM_004656chr361229 1019 965 288 36 22 1943 2499 66 11105
NM_004658chr12282 65 ------
NM_004660chrY1241 1864 ----
NM_004663chr1511271 1278 ----
NM_004684chr41270 ------
NM_004685chr1322047 672 12224 --12265
NM_004687chr172684 438 11598 11844 --
NM_004697chr92428 388 1101 --1232
NM_004698chr1----134 --
NM_004703chr1712493 --1285 --
NM_004705chr112571 152 ------
NM_004710chr171916 --148 1388
NM_004714chr191327 ------
NM_004716chr114763 717 619 195 2698 357 1708 --
NM_004717chr76572 500 376 114 56 48 11473 ----
NM_004723chr13817 424 406 11036 1988 1121
NM_004726chrX24909 825 142 24584 779 --
NM_004730chr542132 1747 1672 1540 --191 --
NM_004733chr31607 ------
NM_004737chr2251272 1140 1085 465 199 --1187 --
NM_004738chr2031829 139 119 12038 ----
NM_004739chr111194 --1558 --
NM_004742chr321811 1562 21690 1433 ----
NM_004745chr8146225 5041 4894 4627 4269 2579 2552 2111 1798 1782 1595 1381 545 281 15936 64900 2500 2328 1670 1155 539 15525
NM_004746chr18----3248 229 65 --
NM_004747chr101529 --3413 393 201 --
NM_004750chr19------2240 31
NM_004755chr141112 1325 ----
NM_004758chr1761040 980 867 858 273 230 --2848 822 --
NM_004759chr1111415 1342 776 720 645 571 439 361 293 237 23 21584 1363 41853 1347 388 374 --
NM_004762chr17101744 1706 1278 714 588 495 362 285 206 46 11313 22036 1229 1100
NM_004772chr531161 325 126 ------
NM_004774chr1722533 2379 --22865 2295 --
NM_004775chr1832169 683 200 --1183 --
NM_004779chr5--1260 ----
NM_004781chr121698 1548 167 ----
NM_004781chr121698 1548 167 ----
NM_004785chr164495 337 151 65 1108 2327 158 --
NM_004788chr1132719 1988 1676 ----1344
NM_004794chrX186 ------
NM_004796chr1422199 937 --1254 --
NM_004798chr20133414 3205 3183 3112 3102 1432 1101 883 865 608 595 320 283 1745 2923 299 --
NM_004801chr21250 ------
NM_004805chr21242 ------
NM_004807chr242268 636 612 106 1357 21055 896 --
NM_004808chr1042935 2326 2183 270 ------
NM_004821chr51659 1729 ----
NM_004824chr631328 1122 1069 --1443 --
NM_004831chr193894 160 95 ------
NM_004836chr22366 68 ------
NM_004839chr15----1577 --
NM_004840chrX62330 2003 831 558 413 366 ------
NM_004842chr631240 1156 54 --145 21530 323
NM_004845chrX104112 4027 3073 1382 1361 1064 586 401 256 131 23111 377 34132 4124 3373 1431
NM_004857chr1421589 1030 14090 --24383 3587
NM_004859chr1732485 2035 561 --22737 1909 --
NM_004861chr223262 42 24 ------
NM_004865chr62167 51 ------
NM_004866chr544932 3947 1090 201 --13476 --
NM_004872chr1--1312 ----
NM_004873chr1463141 2512 2500 1154 1123 1098 ------
NM_004879chr115339 309 272 116 63 2912 80 --1104
NM_004884chr1541744 1125 552 208 --3372 252 246 --
NM_004886chr19168 122 ----
NM_004898chr432628 2410 1959 --12794 --
NM_004899chr22305 119 ------
NM_004902chr202618 221 ------
NM_004904chr756027 4749 4478 1674 1033 --14441 --
NM_004905chr13274 218 62 --1181 --
NM_004906chr61196 ------
NM_004911chr72521 43 ----1478
NM_004922chr104959 849 201 182 3239 230 166 1985 --
NM_004924chr193889 845 104 --2877 834 --
NM_004925chr9----1171 --
NM_004926chr145710 696 655 46 25 --2609 453 --
NM_004930chr12518 192 1199 1281 --
NM_004943chr1941207 1173 751 412 --5859 834 471 269 64 1318
NM_004947chr351815 595 544 536 284 22565 47 ----
NM_004948chr1811086 11109 ----
NM_004952chr11958 --2888 883 --
NM_004953chr32370 287 --1382 --
NM_004955chr64516 441 50 28 165 140 --
NM_004956chr743150 3104 738 462 1161 --1447
NM_004959chr981363 1329 1282 1264 1224 1158 1037 226 --41386 1357 1201 286 11430
NM_004961chrX41311 574 458 117 ----2561 63
NM_004965chr21----135 --
NM_004966chr10--1904 ----
NM_004973chr651667 1624 1587 703 495 11450 ----
NM_004976chr11103886 3245 3175 1740 1580 532 508 467 283 21 1159 64457 3648 3313 2019 1893 1490 11361
NM_004977chr192538 227 --1555 --
NM_004978chr181728 1719 1650 1412 1262 1101 456 426 1611 41658 1573 1548 526 11122
NM_004979chrX41083 765 300 106 --21122 256 --
NM_004980chr11209 ------
NM_004981chr22----143 --
NM_004982chr121467 ------
NM_004985chr1252966 1162 1009 854 107 ------
NM_004991chr3185 ------
NM_004992chrX268516 8464 8258 8180 8145 8088 8058 7616 6789 6778 6057 5832 5370 5260 5210 3172 2641 2529 2478 1803 1454 1434 1404 1381 1236 636 11645 67316 6918 6693 6361 3193 1363 35979 2877 2296
NM_004992chrX268516 8464 8258 8180 8145 8088 8058 7616 6789 6778 6057 5832 5370 5260 5210 3172 2641 2529 2478 1803 1454 1434 1404 1381 1236 636 11645 67316 6918 6693 6361 3193 1363 35979 2877 2296
NM_004995chr1471305 1289 1206 311 265 176 121 --21074 248 --
NM_004998chr153980 932 886 --1333 --
NM_005005chr8162 ------
NM_005010chr721916 284 ------
NM_005011chr711307 1682 21238 601 1724
NM_005017chr32221 23 ------
NM_005027chr1921172 468 1370 3320 315 219 --
NM_005028chr1042158 1906 1468 835 --11666 --
NM_005044chrX84471 4247 4033 3660 3054 2946 1670 46 --11068 14332
NM_005045chr71927 ------
NM_005053chr193229 172 153 ------
NM_005055chr11141 --1165 --
NM_005056chr1285158 4898 3948 3747 3689 3631 3573 1214 25288 1051 11699 14642
NM_005060chr151219 1086 524 235 39 --31099 530 22 --
NM_005063chr1062992 2978 2903 2640 797 457 --1169 1969
NM_005065chr1444786 2156 735 464 33319 1982 1468 ----
NM_005067chr31328 1977 1634 --
NM_005068chr611374 ------
NM_005070chr22249 160 ------
NM_005073chr131275 --155 --
NM_005076chr1104004 3420 2656 1603 997 972 560 169 69 21 12590 43614 2688 1588 1081 1780
NM_005077chr92348 185 --1318 --
NM_005078chr1531701 699 534 11766 1345 --
NM_005079chr853048 2730 2633 1099 308 13209 12102 --
NM_005080chr224815 764 303 233 1918 ----
NM_005087chr3--168 ----
NM_005094chr9----1719 --
NM_005095chr1--11755 11586 --
NM_005096chrX41187 1087 992 250 --2420 138 --
NM_005099chr141162 881 173 125 --3247 161 138 --
NM_005103chr111224 ------
NM_005104chr62139 69 --160 --
NM_005105chr141975 687 373 181 11646 ----
NM_005109chr371959 1644 989 978 971 371 312 2391 146 1243 12066
NM_005110chr53797 580 53 --2737 730 --
NM_005112chr43971 396 150 1655 1769 --
NM_005116chr20144029 3969 3789 2911 2848 1681 1625 1618 1299 970 566 471 306 56 --53961 3541 3029 852 212 --
NM_005119chr131310 1089 25 --1408 --
NM_005121chr17----11342 1168
NM_005124chr61101 --2165 49 --
NM_005126chr31313 2739 285 ----
NM_005134chr182114 28 ------
NM_005135chr1563334 3260 2855 2615 2489 1467 12869 23346 2590 --
NM_005137chr22122340 2298 1640 1623 890 863 834 804 686 436 388 40 42423 2387 1918 167 2584 87 --
NM_005153chr161328 ------
NM_005155chr62696 178 ------
NM_005156chr933515 3441 3341 --1172 --
NM_005157chr981882 1844 1723 568 248 185 147 123 11323 41850 562 481 462 --
NM_005159chr153895 737 504 ------
NM_005161chr11122170 2122 1605 1447 730 674 553 403 334 213 126 56 11611 42019 488 426 136 1699
NM_005168chr221495 580 ------
NM_005169chr11130 --148 --
NM_005171chr12--1423 ----
NM_005178chr19----294 49 --
NM_005180chr1021221 301 ------
NM_005182chr163616 525 242 ----1442
NM_005184chr1971390 1215 1171 1066 477 408 82 --41343 1151 396 304 --
NM_005186chr113479 275 135 150 3519 194 24 --
NM_005187chr1651539 808 772 210 22 1100 31634 1490 327 --
NM_005188chr11217791 7736 7650 7469 7029 6915 6654 6496 6445 6049 6007 5762 5708 5513 5347 2367 1663 1293 422 381 111 12424 37884 7371 6980 15224
NM_005191chr311263 --1108 --
NM_005197chr1465200 5072 4912 4114 1621 807 34740 2378 1052 13824 --
NM_005206chr1751297 1099 1093 436 404 --1897 --
NM_005207chr2273549 3420 2831 682 647 39 22 --23403 2427 --
NM_005219chr55694 483 331 141 52 1708 61754 1632 725 628 282 124 --
NM_005220chr1741307 555 393 275 1435 41258 475 204 125 --
NM_005222chr7162 ------
NM_005225chr2061019 949 930 918 441 49 --31145 965 68 --
NM_005229chrX41084 1014 932 419 --2800 444 --
NM_005232chr73292 125 77 198 ----
NM_005233chr332226 973 63 11908 ----
NM_005235chr2107820 7434 7139 7105 6712 5795 5044 1247 226 39 --25254 4837 --
NM_005238chr1123005 2498 --130 --
NM_005242chr51149 ------
NM_005245chr41132 ------
NM_005249chr141756 ------
NM_005261chr83884 775 212 ------
NM_005263chr1173 --281 59 --
NM_005266chr141641 1623 1514 770 1754 11287 1713
NM_005273chr7----2125 42 --
NM_005274chr1198 ------
NM_005276chr1261619 1526 1488 1315 1308 298 --1229 1508
NM_005276chr1261619 1526 1488 1315 1308 298 --1229 1508
NM_005281chr14979 899 756 668 ----1948
NM_005284chr6172 ------
NM_005311chr742609 924 336 210 --42378 2154 975 553 --
NM_005312chr9112661 2641 2479 2328 2271 2162 2093 1953 1912 452 173 21732 161 41868 976 666 632 --
NM_005318chr222797 36 ------
NM_005324chr1731956 1303 685 ------
NM_005326chr16162 ------
NM_005328chr81641 2572 156 ----
NM_005329chr1642311 1560 797 242 --12042 --
NM_005334chrX31719 1420 677 11458 31521 511 45 --
NM_005339chr444054 709 107 34 --1158 1631
NM_005342chrX32128 534 448 --11938 --
NM_005348chr141874 ------
NM_005349chr41146 ------
NM_005354chr191424 --1203 --
NM_005359chr1875326 4900 2482 2188 1720 749 140 --24826 2163 15193
NM_005374chr1792088 1973 1776 1751 1727 1476 812 801 442 11904 32133 1824 728 32272 363 84
NM_005384chr9----1185 --
NM_005386chr202908 100 --2884 712 --
NM_005387chr111263 ------
NM_005388chr91537 ----1340
NM_005392chr96761 548 331 323 245 65 --21679 108 --
NM_005393chrX1255 ------
NM_005398chr1031370 1105 955 --11133 --
NM_005399chr194013 3437 3270 1579 1319 1128 269 143 48 --1885 --
NM_005400chr23589 425 380 32998 2632 439 2447 148 --
NM_005406chr182143 21 21112 305 ----
NM_005407chr143494 240 21 1483 11388 --
NM_005412chr121366 ------
NM_005415chr22219 56 1504 1495 --
NM_005417chr2071699 1498 1340 1312 1289 253 70 21487 459 81264 653 609 559 525 466 80 58 21670 474
NM_005418chr112262 34 1268 2136 98 1631
NM_005424chr13326 48 29 1353 ----
NM_005425chr16129 ------
NM_005426chr11294 ------
NM_005430chr127952 826 658 397 345 220 179 1204 2374 276 --
NM_005433chr1832133 287 99 135 ----
NM_005436chr1063942 3132 3120 2670 2624 1639 12549 ----
NM_005437chr101121 173 ----
NM_005438chr112471 23 ------
NM_005439chr122471 223 --1512 --
NM_005442chr31620 1469 ----
NM_005443chr41149 ------
NM_005455chr12454 422 ------
NM_005456chr113740 527 21 3705 570 100 1647 --
NM_005458chr942494 992 748 422 ------
NM_005461chr2061849 1794 1232 650 600 506 --61905 1481 92 86 50 31 --
NM_005474chr17101532 1497 639 544 501 250 192 184 155 123 --2222 115 11137
NM_005475chr1272877 2824 2020 1312 1205 499 254 1758 ----
NM_005476chr931064 308 238 --1349 11057
NM_005479chr1031507 1032 592 21556 490 11215 --
NM_005483chr19197 ------
NM_005487chr2231893 416 278 ----11453
NM_005493chr62303 67 ------
NM_005497chr1734527 1166 941 11129 11695 --
NM_005502chr942497 1112 630 567 ------
NM_005504chr1255869 4484 1254 1159 420 ------
NM_005506chr452217 2209 2087 329 81 --12062 1883
NM_005507chr112425 48 180 ----
NM_005509chr521189 311 ------
NM_005513chr351467 540 359 206 90 1398 1334 --
NM_005517chr111070 2539 487 ----
NM_005523chr721552 1503 ----1317
NM_005526chr81250 ------
NM_005529chr1--1965 1920 --
NM_005537chr131785 ------
NM_005540chr141574 1110 507 375 --1350 --
NM_005546chr552264 2224 2121 953 552 --1240 --
NM_005550chr163561 106 47 --153 --
NM_005557chr172116 30 --1109 --
NM_005558chr18998 723 379 326 316 302 218 103 1810 2254 67 --
NM_005563chr11593 1842 1581 --
NM_005565chr5135 ------
NM_005569chr226621 520 391 365 229 67 ------
NM_005575chr52606 293 --2823 61 --
NM_005578chr334084 3348 2058 21323 377 34039 1274 122 --
NM_005581chr192421 171 --4342 139 115 65 --
NM_005584chr13----1320 --
NM_005587chr152249 48 ------
NM_005593chr12------1139
NM_005595chr12918 273 ------
NM_005596chr975034 4989 4945 2370 2155 815 342 24739 2517 11492 --
NM_005598chr171575 1553 1444 1049 412 310 275 11414 31589 1348 677 --
NM_005599chr131364 1049 30 ------
NM_005602chr32498 131 ----195
NM_005603chr1811374 1529 1316 --
NM_005604chr612348 ------
NM_005607chr8181 ------
NM_005610chr11621 ------
NM_005614chr71767 --1823 --
NM_005618chr62177 166 ------
NM_005619chr193275 147 31 ------
NM_005626chr11184 ------
NM_005627chr61315 ------
NM_005628chr193574 473 99 --3496 29 24 --
NM_005629chrX71092 1075 515 335 294 111 85 --3833 317 52 1302
NM_005630chr351845 1489 417 370 59 1380 3750 631 25 --
NM_005632chr164989 959 329 311 1266 1712 1731
NM_005634chrX3602 221 96 ------
NM_005637chr1821727 76 ------
NM_005639chr121687 ------
NM_005644chr11369 1162 ----
NM_005650chr222544 154 11128 3912 127 122 11290
NM_005652chr162859 194 --31006 999 992 --
NM_005657chr15------134
NM_005660chrX2256 47 ----1199
NM_005662chr81321 ------
NM_005665chr164777 4207 1890 1860 604 163 11531 14143 --
NM_005667chr2148 ------
NM_005668chr543262 3033 1739 766 1805 ----
NM_005669chr542218 337 270 25 1555 ----
NM_005677chr331399 979 189 2543 131 ----
NM_005678chr153948 252 73 --1812 --
NM_005682chr1631273 1248 444 11171 1384 --
NM_005685chr7--1129 ----
NM_005686chr151414 1234 480 333 292 11083 11223 1497
NM_005687chr22334 159 ------
NM_005688chr3----294 52 --
NM_005698chr11235 ----129
NM_005708chr131140 ------
NM_005715chr662250 2148 1973 1842 1788 693 ------
NM_005716chr193475 222 215 --1151 --
NM_005717chr141265 307 84 25 ------
NM_005718chr34800 782 555 179 ----1538
NM_005722chr2----2701 105 --
NM_005724chr151299 ------
NM_005725chr1--11593 21830 822 --
NM_005730chr12123533 3385 2850 2687 2379 1294 1240 1096 982 678 614 199 32696 1210 352 42335 2304 2282 735 --
NM_005734chr11--1262 ----
NM_005736chr1041555 1354 1236 353 ----11453
NM_005737chr2102694 2515 1989 599 579 528 392 320 227 159 --21927 806 12417
NM_005738chr731552 325 90 1526 ----
NM_005740chr224816 769 346 27 144 --1372
NM_005746chr712302 ------
NM_005748chr1263046 2424 2223 1249 487 208 23120 825 ----
NM_005751chr71340 ----1140
NM_005752chr161997 ------
NM_005754chr51271 ------
NM_005759chr274404 3310 1902 1834 1509 363 23 23342 191 1878 --
NM_005765chrX1750 ------
NM_005766chr1391340 1248 1114 998 948 927 879 132 93 --1293 --
NM_005768chr122277 135 1580 1655 --
NM_005776chr143842 559 82 ------
NM_005779chr5--1914 1395 --
NM_005781chr37779 295 196 179 110 52 29 --2167 162 1227
NM_005783chr21634 ------
NM_005786chr1811075 ------
NM_005801chr17141 1541 ----
NM_005808chr393392 3225 3145 2281 1392 994 584 337 62 33580 2975 820 ----
NM_005811chr12----158 --
NM_005819chr183232 2999 2986 2849 2539 2319 250 32 1435 33197 781 282 --
NM_005822chr642104 711 453 58 ------
NM_005826chr11548 ------
NM_005828chr17135062 4807 3781 3760 1930 1857 1745 1617 1514 1507 1114 533 47 11306 44127 3876 342 54 --
NM_005833chr91165 127 ----
NM_005840chrX137211 6455 5096 4763 3059 2980 2457 2450 1324 1240 670 467 126 12665 32397 624 548 1222
NM_005841chr42122 100 --1931 1229
NM_005851chr111107 --1352 --
NM_005852chr173356 141 74 --1400 --
NM_005859chr5--1196 ----
NM_005860chr1951309 1269 1217 362 52 --11654 --
NM_005862chr3------1909
NM_005871chr103885 762 29 1411 ----
NM_005875chr3183 ------
NM_005876chr22653 626 1817 ----
NM_005877chr22102498 2159 2059 2014 1733 711 688 615 146 47 --3456 97 61 131
NM_005882chr44690 337 88 71 --1746 --
NM_005884chr194752 592 530 128 --3787 703 676 --
NM_005885chr51329 ------
NM_005896chr21546 ------
NM_005898chr1151068 1001 260 232 199 ------
NM_005899chr1741495 550 83 31 1146 ----
NM_005900chr4142 21219 894 ----
NM_005901chr1878292 6437 3488 2811 1826 1614 551 36187 5378 3466 22446 2322 28668 5468
NM_005902chr1554288 3917 3572 2797 1580 21128 198 1539 --
NM_005904chr182921 476 --1586 --
NM_005907chr611657 ------
NM_005909chr5104155 3986 3908 3621 3588 3272 2928 2908 249 221 23607 118 ----
NM_005910chr17133625 2607 2529 1481 1173 928 912 876 739 715 688 406 141 12701 73024 2853 1418 1149 1119 636 92 --
NM_005911chr231396 497 96 ----1434
NM_005916chr7150 --142 --
NM_005920chr193498 2805 2746 2524 2391 1199 897 600 372 --32843 1493 71 --
NM_005922chr61145 ------
NM_005924chr71886 ------
NM_005928chr154536 447 435 30 --2494 182 --
NM_005933chr1142217 1927 797 284 22882 2769 62791 2198 2074 1957 814 739 32679 2081 1206
NM_005934chr1992451 2362 2080 2052 1770 1714 669 88 66 --3458 161 117 --
NM_005938chrX11046 11236 51327 1073 356 101 28 --
NM_005941chr842920 2673 259 153 11221 ----
NM_005943chr681486 1382 1325 1219 1147 670 647 601 11459 31292 1287 1257 --
NM_005955chr1104980 4970 3875 3801 1953 1578 1313 881 669 473 167 51705 1493 1471 1047 754 --
NM_005962chr103715 673 578 ------
NM_005962chr103715 673 578 ------
NM_005964chr1751522 1299 372 153 64 --1626 --
NM_005966chr221720 451 ------
NM_005967chr122131 118 --4561 249 223 108 --
NM_005969chr1171026 983 950 456 360 347 302 --2893 143 1843
NM_005984chr221165 153 2435 365 1522
NM_005990chr592592 2491 2106 1043 737 668 441 162 132 --31122 1007 973 --
NM_005994chr172323 50 --156 126
NM_005996chr1221416 1109 --2311 170 --
NM_005997chr1134 ------
NM_006007chr934139 333 313 ----14230
NM_006009chr12----1206 --
NM_006011chr15134180 4124 3459 3407 3116 2953 2914 2704 1628 1267 1157 1119 932 44239 2689 2682 42 23682 3444 12767
NM_006015chr141048 537 364 111 1995 1267 --
NM_006016chr611539 ------
NM_006017chr41245 1902 ----
NM_006020chr1441314 875 287 38 --11320 --
NM_006022chr132353 76 ------
NM_006024chr71213 ------
NM_006026chr31299 --1387 --
NM_006030chr351171 510 314 246 66 --41702 1142 381 358 --
NM_006032chr14146 ------
NM_006034chr11122418 1693 1614 1598 971 855 796 752 487 234 226 113 1366 61809 1590 812 103 98 26 11572
NM_006037chr284923 4042 3228 3095 3039 1278 888 154 --13233 --
NM_006039chr174772 733 455 85 --2754 388 --
NM_006043chr162657 262 --1651 1180
NM_006047chr2073371 3163 2519 1290 924 558 541 1370 ----
NM_006049chr152409 367 ------
NM_006051chr5--185 3239 233 106 --
NM_006062chr261179 1105 1093 217 127 104 --31246 983 28 141
NM_006068chr41275 ------
NM_006076chr7163074 3065 3030 2831 2629 2443 2129 2089 2036 2022 1085 949 487 295 75 48 22822 583 53057 1154 936 500 31 --
NM_006080chr721152 42 --12379 --
NM_006082chr12123 ------
NM_006085chr11898 2175 164 1293 --
NM_006089chrX21486 1365 ------
NM_006091chr1541546 1148 516 370 --2629 211 1231
NM_006095chr454287 3920 3845 3779 1480 1263 ----
NM_006099chr12804 753 --2592 149 1784
NM_006106chr11----1999 --
NM_006107chr171419 ------
NM_006113chr162074 1497 1440 283 196 25 2467 223 ----
NM_006133chr11102269 2146 1511 959 733 469 360 260 68 50 --81783 1701 738 706 678 495 317 75 11942
NM_006135chr111052 21058 263 1184 1344
NM_006139chr222631 109 12414 11955 1700
NM_006141chr1622758 856 --11025 --
NM_006142chr11490 --250 28 --
NM_006148chr1772644 2270 712 649 587 332 302 1163 51934 931 813 524 465 --
NM_006153chr3--1547 ----
NM_006156chr141177 --131 --
NM_006158chr821399 1240 ----11586
NM_006160chr173344 172 126 --31471 1307 52 --
NM_006161chr51215 ------
NM_006162chr1861663 1438 1289 1235 1184 611 ------
NM_006166chr1231606 614 470 ------
NM_006176chr113542 131 99 2583 113 3708 322 78 --
NM_006177chr144835 257 118 78 1977 ----
NM_006178chr1721489 132 11336 ----
NM_006180chr941517 1342 438 347 --1288 --
NM_006187chr1232073 938 380 2755 577 31028 349 196 32079 1301 419
NM_006191chr123768 312 34 --1123 --
NM_006194chr143829 109 92 1171 143 --
NM_006195chr921241 486 ------
NM_006198chr211234 ------
NM_006201chrX8883 826 455 441 188 144 122 103 1169 4430 137 95 84 1922
NM_006206chr432902 2439 2293 12569 ----
NM_006211chr8197 ------
NM_006212chr174849 4489 3645 3499 1295 752 65 1993 14786 12113
NM_006216chr22595 66 1633 ----
NM_006224chr172737 220 --52398 935 859 654 503 --
NM_006226chr21223 --1443 --
NM_006228chr83308 292 95 1364 ----
NM_006237chr1362089 1729 1619 166 107 70 --1866 --
NM_006243chr13780 712 160 --123 --
NM_006245chr65392 272 261 202 72 1815 1682 --
NM_006246chr1421101 144 ------
NM_006251chr5----13022 --
NM_006252chr187560 7168 6296 6264 5640 1822 505 348 22155 1506 15183 --
NM_006256chr1--2873 665 ----
NM_006258chr1041088 351 283 25 ------
NM_006259chr42368 129 ------
NM_006266chr91585 2157 91 1284 --
NM_006267chr231246 351 171 ------
NM_006268chr119985 925 892 472 393 364 273 248 135 ----1919
NM_006275chr2032440 2277 672 1546 12182 --
NM_006277chr22547 142 ------
NM_006279chr13839 720 151 1791 ----
NM_006283chr864374 1424 872 372 142 68 --24425 897 --
NM_006293chr153712 357 177 --1372 --
NM_006301chr122654 239 --3604 522 511 --
NM_006304chr7141 ------
NM_006306chrX55926 4057 3951 2333 308 14959 34347 1116 26 --
NM_006310chr171147 ------
NM_006311chr17186 ------
NM_006312chr123767 204 62 --1160 --
NM_006313chr1221640 38 ------
NM_006315chr4104379 3542 3182 3042 1779 1331 1119 860 315 253 --24296 3432 --
NM_006321chr362119 1900 1767 1430 619 496 1666 182 --
NM_006322chr133932 103 76 --1831 --
NM_006328chr11----2534 244 --
NM_006335chr12811 320 --1333 --
NM_006336chr951379 1278 1039 615 265 --21077 461 --
NM_006338chr12267 210 ----184
NM_006350chr51248 ------
NM_006352chr111500 1272 ----
NM_006357chr21117 ------
NM_006359chrX52397 2078 1994 1962 542 11664 ----
NM_006361chr1731961 1628 93 166 21697 1381 --
NM_006364chr141283 ------
NM_006367chr13805 136 113 1799 1687 2829 788
NM_006369chr12304 138 --2363 291 --
NM_006371chr3115205 4959 4774 3816 3802 3302 1129 528 455 248 166 34616 4381 188 1568 --
NM_006375chrX11907 --11594 --
NM_006378chr911061 11178 ----
NM_006379chr742042 1747 349 333 ------
NM_006380chr1754422 3712 3549 3298 2966 23588 1565 23010 532 --
NM_006384chr15----133 --
NM_006389chr1151076 509 232 123 93 --1849 --
NM_006390chr1241492 682 552 106 --21483 562 --
NM_006391chr11121 ------
NM_006400chr12143 ------
NM_006405chr14150 ------
NM_006411chr64788 718 204 173 --2926 727 --
NM_006415chr9--130 ----
NM_006420chr2053126 2880 2695 692 33 --23345 1339 --
NM_006421chr8140 1817 1260 --
NM_006434chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_006451chr5--1157 ----
NM_006454chr4143049 2806 2769 2711 2533 1931 1045 842 815 208 182 170 156 28 1463 52854 2797 2144 2115 1990 22426 2340
NM_006459chr1061899 1690 758 749 579 122 11458 ----
NM_006464chr274202 3861 3286 1390 664 453 438 13519 34058 1596 105 11042
NM_006465chr15112271 2182 1682 1435 772 758 704 485 426 163 38 2395 28 1387 --
NM_006467chr5------1217
NM_006469chr111133 ----11430
NM_006472chr131120 1044 92 2838 813 1991 --
NM_006480chr53522 410 69 1112 179 --
NM_006482chr1253575 2908 1473 786 442 ------
NM_006483chr191327 ------
NM_006484chr191327 ------
NM_006486chr222635 223 --1267 --
NM_006489chr141442 1269 ----
NM_006494chr19--1630 3764 210 108 --
NM_006496chr11621 ------
NM_006500chr115533 442 373 173 104 1334 253 30 --
NM_006516chr161396 1326 1273 1054 357 29 11537 1345 --
NM_006517chrX22112 1910 31863 1596 1529 31959 1476 57 --
NM_006526chr201434 ------
NM_006532chr19101631 1607 719 605 540 466 315 274 184 134 --31693 1448 205 1725
NM_006538chr283591 3481 3412 2612 1368 1167 837 433 13731 33739 2935 2920 --
NM_006540chr821053 270 1104 --11162
NM_006544chr1455472 5307 5256 4553 2016 14092 ----
NM_006546chr1765897 5886 4297 4097 2629 212 46483 5926 5056 4492 45991 5124 4121 2508 26006 4243
NM_006547chr72268 155 ------
NM_006548chr311335 --1148 --
NM_006549chr1242644 2181 1913 1869 --12446 --
NM_006555chr791987 1964 1853 1660 1592 1529 1384 1274 137 11397 21896 1820 --
NM_006557chr91625 11479 --11208
NM_006558chr8--1394 ----
NM_006559chr121178 163 ------
NM_006560chr11147 --1113 --
NM_006561chr10135674 4982 4839 4833 4158 3964 2271 2155 2107 1843 1533 642 90 --35556 4806 24 --
NM_006565chr161851 ------
NM_006572chr1732884 975 326 12822 22781 2192 --
NM_006577chr2--11188 1957 --
NM_006578chr1521487 1464 --21620 1559 --
NM_006589chr13484 164 107 ----1435
NM_006593chr22192 94 ------
NM_006599chr1678064 7750 1838 1388 972 928 395 27989 1371 17528 --
NM_006601chr12149 1447 ----
NM_006603chrX1389 11267 ----
NM_006608chr1195 ----1128
NM_006612chr17140 1476 1386 --
NM_006618chr121383 1003 --11305 --
NM_006620chr631152 911 168 23227 1843 24842 1513 21851 694
NM_006621chr162017 1822 1810 1553 507 500 11584 21782 1340 11644
NM_006622chr52135 127 ------
NM_006624chr101554 ------
NM_006625chr11418 1845 1971 --
NM_006625chr11418 1845 1971 --
NM_006625chr11418 1845 1971 --
NM_006628chr1563858 3543 3471 1332 1165 1141 1917 24029 3518 11159
NM_006631chr192150 31 --1614 --
NM_006646chr1382249 1199 1116 649 595 573 369 324 2781 607 1902 --
NM_006650chr593815 3763 3676 3544 2819 2693 2582 898 474 13663 53645 3533 372 309 115 1625
NM_006651chr4111495 1479 1461 1279 1270 1227 953 931 433 350 321 --3529 207 130 --
NM_006653chr63302 138 64 --251 29 --
NM_006658chr731149 417 49 --1923 --
NM_006670chr6134 ------
NM_006675chr12173273 3253 2812 2734 2723 2399 1241 1144 1001 853 444 308 224 121 100 75 41 11089 83265 3211 3020 2897 1262 314 140 34 1783
NM_006677chr33197 60 40 --1231 --
NM_006681chr41114 ------
NM_006690chr20102201 1872 1782 1572 1551 1520 856 574 449 304 1697 52004 1509 1485 543 506 11645
NM_006691chr11----2198 60 --
NM_006693chr74802 794 702 209 --1762 --
NM_006698chr2051322 1289 1149 920 478 --11266 --
NM_006699chr11352 12402 ----
NM_006709chr6------161
NM_006710chr23917 805 761 1240 ----
NM_006711chr163641 609 27 1195 1310 1143
NM_006713chr51208 ------
NM_006717chr973307 3300 2545 1229 1144 331 105 ----1124
NM_006720chr10125097 5044 4937 4861 4760 1703 1453 1245 1136 1076 965 758 1185 15008 --
NM_006721chr101696 194 ----
NM_006722chr332963 2658 2378 ----12369
NM_006724chr61145 ------
NM_006727chr51343 195 ----
NM_006729chrX75341 4054 4019 3416 2217 2032 1963 --14922 --
NM_006734chr621217 96 11235 ----
NM_006736chr251561 1383 556 546 434 --21770 1721 1328
NM_006738chr15134400 4289 4135 3924 3697 3653 1537 1270 976 865 437 197 59 11109 33742 3338 1240 14116
NM_006741chr1241014 833 424 184 2966 216 3906 189 176 --
NM_006742chr1671839 1636 1604 1378 1307 1245 697 --31294 323 159 11569
NM_006744chr101167 ------
NM_006749chr83984 874 506 --1126 --
NM_006750chr16117835 7708 7488 7040 6225 4985 4892 2192 1260 1038 375 25451 4884 22500 669 --
NM_006754chr71418 ------
NM_006759chr21106 ------
NM_006761chr172614 131 ------
NM_006763chr151999 1751 1549 733 257 11698 21886 1706 --
NM_006766chr812486 12205 ----
NM_006772chr631572 1397 51 --41234 461 309 247 --
NM_006775chr64855 815 93 57 1589 ----
NM_006777chrX--2539 103 --12877
NM_006778chr621285 509 1334 ----
NM_006788chr1861814 1723 1469 652 618 402 1705 ----
NM_006795chr1141577 1207 281 268 124 51506 1253 557 480 297 --
NM_006802chr121125 1091 2430 203 ----
NM_006803chr832006 1470 82 11955 11720 --
NM_006805chr521450 107 1173 --1685
NM_006807chr172378 137 ----125
NM_006809chr203324 146 64 --130 --
NM_006813chr6----1254 --
NM_006814chr2072443 2013 993 880 698 490 170 ------
NM_006818chr12828 384 1128 131 --
NM_006822chr171237 ------
NM_006823chr831284 1076 127 ------
NM_006826chr2--1518 ----
NM_006827chr1432725 2593 748 22211 119 --13297
NM_006832chr141806 ------
NM_006833chr71304 --1124 --
NM_006836chr121631 --1409 1473
NM_006838chr121227 ------
NM_006841chr32714 286 --3601 65 45 2645 198
NM_006851chr1221139 864 22297 2245 1385 --
NM_006854chr751750 1651 1533 674 186 --1687 --
NM_006856chr1221029 85 1424 21070 291 --
NM_006861chr1291948 1520 689 662 635 585 537 360 328 12042 ----
NM_006874chr41465 ------
NM_006884chr32219 31 ------
NM_006885chr1644243 3348 3116 242 12739 ----
NM_006887chr24749 653 524 78 1563 ----
NM_006888chr1462646 2574 2355 2298 1245 190 12665 11039 --
NM_006896chr72323 25 --31101 285 236 --
NM_006897chr122633 410 ------
NM_006898chr23323 228 109 --1114 --
NM_006899chr202110 25 1266 2317 299 --
NM_006901chr153182 164 109 ------
NM_006902chr143144 3093 217 62 140 1602 --
NM_006904chr8----1911 --
NM_006906chr114799 682 336 88 --2370 70 --
NM_006908chr7130 11211 ----
NM_006910chr162371 106 ------
NM_006914chr931511 1457 114 ------
NM_006922chr221755 322 1354 1478 --
NM_006924chr1753886 1551 786 269 141 12879 ----
NM_006937chr171399 ------
NM_006939chr141273 --1893 --
NM_006940chr1231602 1184 639 ----11587
NM_006941chr2251144 1033 973 316 59 --5993 979 832 67 40 1795
NM_006946chr113505 384 97 ------
NM_006950chrX1644 --1884 --
NM_006951chr102721 331 ------
NM_006981chr942915 2876 92 46 --2810 744 --
NM_006982chr121223 ------
NM_006988chr211343 197 1807 --
NM_006990chr182481 1767 1754 1571 1007 534 203 48 --52422 2160 1786 617 511 --
NM_006993chr102214 46 ------
NM_006996chr12453 40 1746 ----
NM_006997chr101371 ------
NM_006999chr561590 1322 821 226 133 37 11269 1796 --
NM_007005chr91347 ------
NM_007007chr1264373 4335 4069 3886 1225 1007 ----14023
NM_007008chr22310 167 ------
NM_007011chr15145623 5331 4648 4543 4525 4313 2604 2316 2251 1473 941 249 143 64 --34485 2670 561 --
NM_007013chr8------1886
NM_007014chr1671557 1471 1089 454 264 169 111 11509 51757 1251 531 280 57 --
NM_007015chr131275 ------
NM_007024chr32471 107 1453 1427 --
NM_007030chr5195078 4467 4405 4374 4339 4285 4221 4159 1791 1496 1283 1180 1050 920 811 515 482 237 153 --35067 1147 880 11075
NM_007039chr14166 --31752 239 234 --
NM_007040chr1921054 58 --3372 75 35 --
NM_007043chr121563 12122 ----
NM_007045chr61112 ------
NM_007050chr20196919 6814 6085 5826 5752 5247 2859 2781 2493 2047 1732 822 747 472 462 304 156 137 23 36927 5363 4988 47140 6654 375 107 --
NM_007051chr11120 ------
NM_007055chr102809 47 11220 ----
NM_007067chr1731590 1102 288 21240 368 --11042
NM_007073chr634031 3527 675 1714 ----
NM_007084chr131567 ------
NM_007087chr162792 218 --3707 592 279 1648
NM_007106chr131101 --12522 12436
NM_007118chr55750 744 724 634 607 139 1205 --
NM_007124chr641809 753 637 430 ------
NM_007125chrY31319 335 159 ------
NM_007126chr93104 69 35 ------
NM_007146chr1712029 12848 12119 --
NM_007150chrX61972 1603 1496 1473 1381 112 11688 11392 11519
NM_007158chr11409 ------
NM_007159chr31426 ------
NM_007162chr64416 157 139 110 --1115 --
NM_007166chr1111281 ------
NM_007170chr14714 652 363 243 1793 ----
NM_007174chr1271796 1717 1515 815 225 209 70 --2624 153 --
NM_007181chr191169 ------
NM_007184chr32543 22 ------
NM_007185chr14672 336 285 86 1397 1169 --
NM_007187chr131335 ------
NM_007192chr1421028 1017 3995 295 285 ----
NM_007200chr15134400 4289 4135 3924 3697 3653 1537 1270 976 865 437 197 59 11109 33742 3338 1240 14116
NM_007202chr17------1690
NM_007203chr953928 3472 3325 3172 427 1446 1942 --
NM_007221chr12372 300 --1282 --
NM_007222chr821686 524 ------
NM_007225chr1731050 665 50 3847 652 372 1785 --
NM_007232chr2071002 967 808 763 408 382 363 --4980 289 223 68 1151
NM_007236chr1582134 2089 1718 779 689 682 158 22 22004 390 31558 440 366 --
NM_007238chr2094593 4533 4496 3848 1822 1641 1432 1345 368 14892 54718 4485 3774 3323 787 --
NM_007245chr164830 745 713 53 1645 2725 719 --
NM_007249chr13159020 8986 8288 8150 7497 7413 6616 3378 3299 2427 2392 1443 1164 852 789 48433 2654 2050 610 23259 737 26031 271
NM_007259chr11400 ------
NM_007271chr641442 1218 643 225 21656 1450 --1400
NM_007275chr321211 257 --2313 34 1356
NM_007282chr3--1166 --1800
NM_007283chr393037 2774 2464 2388 1963 1201 1098 1030 382 2689 83 62441 2361 2111 674 298 293 --
NM_007286chr592128 2117 2075 2067 1825 1752 1303 487 172 ----1735
NM_007292chr1754462 3889 3306 1438 416 45148 4451 3657 1504 34414 4389 541 --
NM_007294chr1721163 411 1209 ----
NM_007295chr1721163 411 1209 ----
NM_007296chr1721163 411 1209 ----
NM_007297chr1721163 411 1209 ----
NM_007298chr1721163 411 1209 ----
NM_007299chr1721163 411 1209 ----
NM_007300chr1721163 411 1209 ----
NM_007302chr1721163 411 1209 ----
NM_007303chr1721163 411 1209 ----
NM_007304chr1721163 411 1209 ----
NM_007305chr1721163 411 1209 ----
NM_007313chr981882 1844 1723 568 248 185 147 123 11323 41850 562 481 462 --
NM_007322chr19----4436 430 403 390 --
NM_007326chr224331 217 113 50 --1264 --
NM_007327chr94792 374 339 143 --51144 996 824 479 25 --
NM_007349chr73428 332 34 ------
NM_007350chr1244331 3217 940 791 ------
NM_007353chr772425 2311 913 890 692 526 400 --1746 --
NM_007358chr111686 1157 ----
NM_007361chr141502 ------
NM_007363chrX2806 350 --2429 117 --
NM_007365chr152113 1987 1680 805 559 --31461 213 148 --
NM_007371chr92518 207 --154 --
NM_007372chr171753 --1108 --
NM_007373chr101565 ------
NM_007375chr122432 536 1605 ----
NM_012069chrX82066 931 895 709 607 584 446 276 --1135 --
NM_012074chr141119 11044 1965 --
NM_012081chr583732 3418 3263 3199 2517 2366 608 163 ------
NM_012090chr14427 333 207 44 ------
NM_012095chr1053408 2851 2443 975 667 --11331 --
NM_012102chr162064 2045 1887 801 271 207 ----1842
NM_012104chr1163481 3165 2401 956 396 221 23616 861 31148 436 136 --
NM_012104chr1163481 3165 2401 956 396 221 23616 861 31148 436 136 --
NM_012110chr4157 ------
NM_012124chr111827 1611 ----
NM_012127chr9129 ------
NM_012134chr161762 1755 1266 1247 667 100 31609 121 27 21419 76 --
NM_012137chr142225 1934 996 557 32239 1985 608 2591 571 1635
NM_012141chr1364128 2700 2670 1014 748 607 23842 3163 12756 11519
NM_012142chr15163 1348 ----
NM_012154chr8--1577 ----
NM_012156chr2053223 2490 1342 343 203 --11277 --
NM_012161chr411135 1961 ----
NM_012164chr9126803 6344 6233 6055 6024 5795 4579 2451 2315 2099 782 67 26699 2354 --16787
NM_012175chr11187 ------
NM_012181chr193405 351 28 --4361 312 77 45 --
NM_012189chr181464 1663 ----
NM_012193chr1195421 4873 4799 4164 3355 2136 1642 336 295 35290 4555 4037 55338 5155 4010 2002 1565 --
NM_012199chr1134545 4073 3246 3199 3051 2997 2976 1823 1494 1484 785 655 367 13625 21792 745 --
NM_012200chr112149 69 --1123 --
NM_012202chr113295 273 92 --1113 1262
NM_012214chr275009 4521 4375 2512 2279 2129 531 14794 11366 16163
NM_012229chr102187 74 ------
NM_012232chr1722226 1902 --52080 1923 1918 462 244 11362
NM_012234chr343712 3102 2960 62 1141 11286 --
NM_012238chr1011214 ------
NM_012242chr101179 ------
NM_012247chr101284 ------
NM_012249chr241388 1195 348 126 12528 ----
NM_012250chr11------11159
NM_012261chr202468 31 ------
NM_012262chr185242 4675 3876 3667 1315 660 391 237 14414 24303 47 --
NM_012281chr722146 1945 ------
NM_012282chrX3660 256 209 --1839 --
NM_012284chr124307 284 234 208 --1297 --
NM_012285chr17282 25 ------
NM_012286chrX1450 ------
NM_012287chr354095 1478 1343 408 356 ------
NM_012288chr6145591 5333 4715 4264 4130 944 738 450 428 325 257 245 124 89 --55253 4907 3946 2175 76 --
NM_012294chr7103909 3693 3463 3275 3175 2881 2685 1436 1366 24 --32823 1344 946 --
NM_012296chr1153561 3108 2491 1069 296 --43527 2993 2414 196 1111
NM_012297chr43763 409 356 ----12162
NM_012300chr53924 825 740 ------
NM_012301chr732070 1465 618 --1612 --
NM_012302chr151100 970 927 146 87 ------
NM_012304chr542486 1924 1791 900 12317 ----
NM_012306chr12113510 3487 3326 1172 727 538 438 416 207 74 66 32351 2175 1040 53117 973 968 153 56 --
NM_012308chr11122454 2288 1992 952 856 607 339 264 183 123 114 78 1281 32482 1826 414 22442 1641
NM_012309chr1173614 1111 951 500 486 396 269 23599 871 34621 3546 911 --
NM_012311chr10----1591 --
NM_012316chr1184488 4469 4409 4276 3873 3805 3553 1910 1898 1856 1753 1644 1602 1476 1320 999 141 112 12248 34105 1072 413 --
NM_012317chrX3326 195 37 --2591 98 1282
NM_012324chr224761 683 664 570 --3738 292 210 --
NM_012326chr23770 309 251 --5786 737 659 216 54 --
NM_012329chr1741289 1039 534 169 1678 ----
NM_012330chr102301 245 11265 1385 --
NM_012333chr141527 1446 1301 590 ------
NM_012342chr101123 ------
NM_012384chr20102449 2383 2195 1895 1810 1702 861 820 611 374 11732 11901 --
NM_012394chr1181 ------
NM_012395chr7102953 2377 2360 650 520 315 197 178 169 125 --12112 12230
NM_012399chr2251620 1540 1507 1466 1441 11959 11513 --
NM_012402chr112494 96 --2960 198 1349
NM_012405chr193581 3561 2753 2582 2530 1305 840 655 40 33338 2411 1231 12728 --
NM_012406chr1241204 829 529 360 --1399 --
NM_012407chr224371 160 118 101 --2432 126 --
NM_012410chr161184 1461 2449 83 --
NM_012423chr192325 39 ------
NM_012425chr10165 2783 731 170 12110
NM_012428chr15--154 ----
NM_012429chr221262 ----21352 46
NM_012430chr31105 ------
NM_012434chr621244 22 1237 ----
NM_012446chr52431 137 ------
NM_012448chr1782177 2146 1956 1863 1794 697 557 492 1460 42476 2061 1831 1679 --
NM_012454chr6------1572
NM_012458chr1971025 996 810 353 198 83 28 --31245 1236 152 1160
NM_012461chr143668 654 45 --1470 --
NM_012465chr1062529 2474 865 734 313 84 13137 23075 2445 1483
NM_012471chrX21345 54 --31846 459 97 --
NM_012473chr22294 79 --130 --
NM_012475chr11239 --1214 --
NM_012479chr742171 971 434 130 ----1537
NM_013233chr221151 78 ------
NM_013235chr52828 81 ------
NM_013236chr2211139 --1474 --
NM_013245chr164488 256 164 123 1140 2694 509 --
NM_013246chr114962 302 294 66 --6836 707 668 213 156 41 --
NM_013253chr111510 --2394 247 --
NM_013255chr768079 6002 3098 2920 892 424 26100 2222 16408 --
NM_013261chr422403 743 13682 13661 --
NM_013267chr12----125 --
NM_013269chr1264363 4183 3482 940 477 435 --11740 --
NM_013275chr16----192 --
NM_013279chr1172303 2292 2143 1962 412 231 106 1237 42019 2013 664 366 --
NM_013281chr203583 265 72 ------
NM_013305chr183753 246 45 ------
NM_013306chr11137 1172 1207 --
NM_013309chr153955 39 25 --12192 --
NM_013316chr71935 --1913 --
NM_013323chr176994 913 870 480 469 123 --31140 1104 841 --
NM_013341chr212800 12631 22424 1177 --
NM_013346chrX121 ------
NM_013354chr82361 131 1508 ----
NM_013363chr3--135 ----
NM_013365chr225736 547 525 167 138 --1185 --
NM_013372chr1563269 1125 982 938 212 135 ----12160
NM_013373chr223251 191 157 --2171 83 1834
NM_013374chr332396 2309 58 11966 --22864 1121
NM_013381chr123970 367 272 ------
NM_013382chr1481975 1820 1722 904 806 710 666 327 --12102 --
NM_013386chr11249 1720 1260 --
NM_013390chr951453 1188 1090 690 462 ------
NM_013392chr23272 93 66 ------
NM_013396chr21--166 157 --
NM_013399chr1681736 1270 1261 426 293 130 61 47 21184 33 2618 144 --
NM_013400chr73878 257 81 --1369 1157
NM_013410chr11223 --1180 --
NM_013423chrX----128 --
NM_013427chrX----128 --
NM_013433chr1981951 1664 1545 1490 1461 1417 1309 177 --11350 2718 677
NM_013436chr21650 1784 1679 --
NM_013438chr931586 283 70 ------
NM_013443chr931105 899 380 ------
NM_013446chr74502 188 142 57 --2424 363 --
NM_013449chr1292904 2847 2100 1982 1072 729 712 348 75 22956 63 52362 692 536 332 131 --
NM_013450chr21885 --11063 --
NM_013951chr2122435 2308 1974 1616 979 962 890 697 661 520 355 136 1871 ----
NM_013952chr2112512 2385 2051 1693 1039 967 774 738 597 432 213 1948 ----
NM_013953chr2112512 2385 2051 1693 1039 967 774 738 597 432 213 1948 ----
NM_013958chr8----1102 --
NM_013959chr8----1102 --
NM_013960chr81565 ----1296
NM_013961chr8----1102 --
NM_013962chr8----1102 --
NM_013992chr2112512 2385 2051 1693 1039 967 774 738 597 432 213 1948 ----
NM_013993chr61823 --2234 87 --
NM_013994chr61823 --2234 87 --
NM_013995chrX22596 359 1792 ----
NM_014000chr1071944 1636 1285 1260 749 604 323 --21480 329 --
NM_014010chr93595 586 574 2560 126 1549 --
NM_014011chr221757 143 12576 ----
NM_014014chr22431 158 ------
NM_014021chr143004 1358 1322 1285 13073 32838 1245 133 --
NM_014023chr1092252 2213 2189 1942 1796 1777 1176 395 366 ----12053
NM_014028chr622584 2188 ------
NM_014030chr1741036 1001 873 470 1792 2449 160 --
NM_014039chr11----1213 --
NM_014043chr31601 ------
NM_014071chr201134 ------
NM_014079chr32286 24 ------
NM_014106chr1542347 678 413 128 1717 ----
NM_014109chr83461 223 91 ------
NM_014110chr11184 ------
NM_014112chr844742 3923 992 109 13968 21611 642 --
NM_014117chr1652570 2366 708 527 376 12114 21040 936 --
NM_014141chr775209 4725 4227 4087 3931 3620 1017 14507 34208 3525 75 --
NM_014153chr16196 ------
NM_014155chr1186139 5740 5720 5632 5610 5096 2191 1356 199 11079 26752 5650
NM_014157chr1672955 2606 1242 984 696 605 151 21477 1387 21352 92 --
NM_014159chr32495 136 ----190
NM_014171chr22782 47 --1722 --
NM_014178chr141572 ------
NM_014181chr222768 2652 ------
NM_014188chr11297 --1342 --
NM_014189chr44450 378 339 26 11279 1194 148
NM_014190chr44730 691 378 361 11631 1546 1400
NM_014191chr122759 725 1175 ----
NM_014223chr13601 520 112 ------
NM_014225chr192292 102 ------
NM_014231chr1241940 1918 1622 22 --31717 240 55 --
NM_014232chr1751338 1161 488 269 137 11465 41623 1187 441 23 --
NM_014232chr1751338 1161 488 269 137 11465 41623 1187 441 23 --
NM_014233chr1762138 1792 1658 538 444 186 1431 31572 532 94 --
NM_014234chr6257 25 --2176 46 --
NM_014240chr383502 2788 1605 1437 1055 303 181 175 13235 11593 --
NM_014241chr10--1354 ----
NM_014245chr32813 190 ----1739
NM_014248chr22----160 --
NM_014250chr2231893 416 278 ----11453
NM_014251chr73914 800 789 --1213 --
NM_014253chrX51770 1700 635 558 422 ------
NM_014268chr182980 110 ------
NM_014272chr15175 ------
NM_014275chr53257 112 26 ----1572
NM_014280chr12640 51 --1214 138
NM_014283chr121373 1257 1542 ----
NM_014284chr151031 910 769 730 320 --2742 386 1896
NM_014286chr993510 3296 2969 2906 2545 773 515 264 216 21406 928 93570 2749 2417 2256 1224 945 449 444 163 12242
NM_014289chrX31208 584 358 ------
NM_014292chr22101234 1185 747 720 445 415 317 298 97 42 --61688 594 553 278 218 78 11583
NM_014293chr2274008 3433 3026 882 234 103 80 33842 3462 2897 73990 1321 1026 280 186 166 32 23527 994
NM_014296chr31450 ----11380
NM_014299chr1981806 1551 1411 606 445 254 205 139 1793 22050 1797 --
NM_014309chr2265120 1878 1719 1046 605 192 --44469 4333 3557 867 15141
NM_014315chr14132 ------
NM_014316chr1672173 1849 776 730 634 470 429 --11797 --
NM_014319chr1211883 ------
NM_014331chr4131 27758 2289 --12508
NM_014333chr112414 185 ------
NM_014335chr1531251 958 286 ------
NM_014338chr228991 896 782 714 681 420 225 100 ------
NM_014342chr112573 140 ------
NM_014351chr223982 296 83 --11354 --
NM_014368chr991971 1917 1727 1608 1346 619 171 126 25 --11887 --
NM_014374chr73878 257 81 --1369 1157
NM_014381chr1443175 1318 1169 418 ------
NM_014382chr31155 ------
NM_014393chr83626 331 212 186 12313 --
NM_014397chr931290 576 292 1342 ----
NM_014405chr1792296 2028 1797 1685 1503 818 724 585 480 21675 357 31490 420 391 11814
NM_014408chr1----3540 209 71 --
NM_014415chr31441 ------
NM_014417chr19192 --3643 300 124 --
NM_014423chr521849 363 34679 4561 522 --14533
NM_014431chr1071626 1236 1207 1136 438 282 198 --21586 1042 1448
NM_014437chr12660 48 ------
NM_014445chr341544 330 196 103 ------
NM_014447chr41494 --11271 --
NM_014454chr61416 --2876 870 --
NM_014455chr11415 ------
NM_014470chr121707 ------
NM_014472chr101166 ------
NM_014480chr192538 326 ----1739
NM_014491chr71937 ------
NM_014494chr1652077 917 693 629 111 22145 676 ----
NM_014496chrX1255 ------
NM_014501chr19144 ------
NM_014507chr2261219 1171 980 841 756 479 ------
NM_014515chr122874 165 --1786 --
NM_014516chr19----270 53 --
NM_014517chr31263 --1781 --
NM_014520chr174183 153 141 41 1333 131 --
NM_014550chr221591 --2667 161 --
NM_014554chr1242127 1621 158 96 1273 ----
NM_014563chrX31395 489 360 11702 11370 --
NM_014564chr94856 775 313 22 --2861 784 1800
NM_014571chr1102768 2673 1996 1144 691 635 545 467 303 296 22667 2637 1527 --
NM_014572chr1321651 459 1697 ----
NM_014574chr1421264 103 1617 ----
NM_014575chr31407 ------
NM_014587chr1661404 1256 542 412 366 111 1522 41512 1067 1011 176 --
NM_014592chr53293 138 70 --1718 --
NM_014593chr18130 --1204 --
NM_014607chr252034 257 200 189 127 1248 ----
NM_014612chr9----11390 --
NM_014613chr532700 2269 438 1696 11074 --
NM_014614chr241441 1310 100 79 1372 ----
NM_014615chr1693435 3336 2774 2323 2303 2231 961 529 339 1859 23385 1149 12283
NM_014618chr91327 ------
NM_014620chr121253 --2187 21 --
NM_014621chr2274 31 ------
NM_014636chr984154 3795 3302 1443 1220 827 752 474 1184 33388 613 589 --
NM_014637chr82530 38 ------
NM_014640chr22220 68 --2107 26 --
NM_014646chr18112803 2571 2125 2095 1107 1016 901 864 793 564 268 1508 ----
NM_014647chr1621528 473 ------
NM_014653chr1252066 1721 680 198 148 --2708 285 --
NM_014661chr10163840 3831 3351 3281 3008 2826 2578 2397 1309 1286 1010 998 748 300 289 150 --73334 3322 2768 2755 2591 1184 519 33511 2984 788
NM_014663chr131025 730 375 ------
NM_014665chr8163230 2795 2706 2578 2430 2418 2366 1057 698 648 600 417 187 128 114 35 --32295 255 157 1475
NM_014666chr51824 ------
NM_014667chr321535 253 --22285 1683 --
NM_014670chr2195 --1469 --
NM_014671chr71621 1128 ----
NM_014674chr373560 3509 3467 2488 464 197 157 31493 1360 348 ----
NM_014675chr13448 130 31 ------
NM_014676chr111053 --21354 231 --
NM_014682chr82676 364 1901 ----
NM_014686chr1982482 2368 2128 2006 804 506 346 21 ------
NM_014690chr782334 2104 2000 1258 1119 726 676 393 --41174 957 843 22 --
NM_014693chr34767 561 292 174 --2243 192 --
NM_014701chr1511232 12222 11206 --
NM_014702chr653506 3242 3231 2115 164 ------
NM_014705chr7--11613 ----
NM_014707chr722268 468 1265 ----
NM_014709chr21109 ------
NM_014712chr162428 174 2482 184 2466 192 --
NM_014717chr19135 ------
NM_014718chr125717 588 566 229 38 --1170 --
NM_014720chr102404 104 21329 67 ----
NM_014721chr675767 5714 5307 5299 1413 1025 312 26287 1616 25127 56 --
NM_014723chr20112882 2664 2624 2140 2054 2047 1269 984 796 406 395 --63059 1281 1128 440 380 317 --
NM_014726chr1741381 1241 470 385 11112 41135 908 292 97 --
NM_014729chr821972 1635 ------
NM_014730chr1294321 3789 3653 3432 3236 1975 998 879 278 14351 53736 3594 3245 1929 1316 13718
NM_014730chr1294321 3789 3653 3432 3236 1975 998 879 278 14351 53736 3594 3245 1929 1316 13718
NM_014731chr2081620 1523 1173 637 564 541 376 157 139 ----
NM_014732chr16185618 5552 5348 5213 5048 4655 4602 4525 4269 3917 3731 2074 1925 1884 1268 1079 456 122 25200 1329 44778 1262 1018 177 15396
NM_014735chrX2417 324 ------
NM_014739chr62891 339 22981 1591 14088 --
NM_014740chr17140 ------
NM_014742chr2061522 1378 1266 1113 93 54 --21283 477 1553
NM_014746chr284051 3353 3221 2944 2885 1670 240 97 33091 1625 1024 23196 31 --
NM_014747chr1165568 5115 5001 3813 1876 1455 1401 1369 1287 1257 800 443 428 105 68 48 35750 1180 594 73962 3954 3661 1946 1461 1230 1124 2843 495
NM_014748chr23272 55 23 ------
NM_014751chr822095 1466 ------
NM_014752chr1141945 622 540 116 ------
NM_014754chr82950 324 1762 ----
NM_014755chr283873 3743 3443 1302 1201 657 447 88 ------
NM_014756chr113188 167 27 ------
NM_014758chr1171925 1537 899 892 637 348 206 12127 1780 --
NM_014761chr162750 153 1263 ----
NM_014762chr172214 2147 1899 923 863 729 659 ----32504 641 498
NM_014764chr121454 --1475 --
NM_014765chr131069 885 852 12541 ----
NM_014766chr753795 3714 3402 1461 1175 11208 12842 --
NM_014767chr10143627 3559 3347 3168 3111 3084 3034 2734 2564 1187 1071 1056 944 529 22688 1291 83607 3549 2484 2329 1030 665 478 105 --
NM_014770chr121363 --21145 1094 --
NM_014771chr164918 898 308 246 --3772 386 121 1709
NM_014772chr1873595 3439 3338 3053 2793 1336 889 32859 2815 857 12869 --
NM_014774chr142892 2883 2269 2084 --1843 --
NM_014776chr1282746 2602 2557 2485 1252 778 592 186 23146 1141 32154 2148 328 23053 422
NM_014779chr31818 ------
NM_014781chr8152 ------
NM_014784chr14708 285 99 25 --1821 --
NM_014790chr52166 92 --1346 --
NM_014795chr2156 ------
NM_014800chr73895 372 309 --2722 407 --
NM_014802chr121200 ------
NM_014806chr93142 136 123 ------
NM_014807chr114605 593 520 283 --1243 --
NM_014810chr151411 753 640 604 56 1490 32557 1379 1265 --
NM_014812chr111837 --1120 --
NM_014820chr31206 ------
NM_014824chr11--11722 ----
NM_014826chr144253 1647 1098 86 13412 23919 746 23674 42
NM_014827chr1--11252 ----
NM_014828chr1421995 328 --1996 --
NM_014830chr1273551 3154 2596 2583 1132 681 221 --43673 2657 1369 906 1662
NM_014832chr1311705 --1609 --
NM_014835chr203781 448 184 ------
NM_014836chr101435 21862 1380 ----
NM_014838chr2222548 2275 1229 62705 2662 2526 2070 780 81 --
NM_014839chr122162 239 --11940 --
NM_014840chr1272981 2759 848 819 779 408 220 43286 2784 2612 185 22593 2110 12505
NM_014847chr11176 ------
NM_014849chr15985 338 310 302 285 --2360 71 177
NM_014850chr394877 4759 4591 4428 3806 3542 1572 1545 703 24419 1919 24166 808 --
NM_014853chr1761433 1347 1310 1105 257 161 1929 41325 1204 1183 1007 --
NM_014864chr173463 3254 1428 1286 487 359 201 24277 2792 1978 --
NM_014868chr122367 190 2675 235 ----
NM_014869chr331284 83 36 21229 1204 ----
NM_014870chr1174666 4342 3847 3098 2992 1572 1560 1471 1262 1139 977 943 904 727 547 63 30 34465 1621 1239 54179 3506 1415 961 832 --
NM_014871chr122583 545 ------
NM_014872chr941978 1965 439 387 1475 22037 1876 --
NM_014873chr144010 1442 1310 867 2845 194 21285 478 11132
NM_014874chr171450 728 599 410 402 182 92 11229 --11507
NM_014876chr2281855 1802 1775 1609 1469 810 387 78 1718 --185
NM_014877chr1777052 6616 6143 6012 5001 2603 2423 26540 2986 25835 5600 16322
NM_014883chr44606 160 119 98 12084 22344 684 --
NM_014892chr6--198 ----
NM_014893chrY1145 22266 572 132 1887
NM_014897chr1752571 2259 2097 919 882 ------
NM_014898chr1912041 1689 11881 --
NM_014901chr5122000 1993 1785 1777 1445 693 294 210 173 160 111 98 11831 2420 34 --
NM_014902chr2031227 1165 531 1400 11554 --
NM_014903chr1232443 2163 698 ----22117 100
NM_014904chr10--1286 13188 --
NM_014906chr1733940 1149 222 12773 1485 --
NM_014909chr14163972 3621 3507 3454 3446 3178 2801 2614 1112 988 977 942 776 580 473 56 33648 3145 1449 2749 362 --
NM_014912chr1012869 ------
NM_014917chr121007 609 ------
NM_014918chr1541076 543 321 215 11487 --11186
NM_014921chr1982382 1909 1210 1200 652 621 508 339 12242 62834 2607 2483 661 635 524 --
NM_014923chr13--21940 1646 ----
NM_014924chr1473151 2705 2108 1212 1059 860 360 42010 768 476 283 ----
NM_014925chr122368 224 ----1188
NM_014926chr3173 ------
NM_014927chrX134 ------
NM_014932chr311342 ------
NM_014934chr1343544 3291 1302 92 ----13531
NM_014935chr1133210 3064 2822 2728 2608 2492 2419 1505 1437 1303 1156 1057 912 --53190 597 321 112 75 --
NM_014938chr12172509 2426 2356 2268 2021 1996 1946 913 804 463 416 379 373 321 304 210 177 1407 82601 696 446 434 310 256 120 51 --
NM_014939chr1831227 445 114 ------
NM_014941chr22248 36 --128 --
NM_014942chr61424 12477 ----
NM_014944chr141338 940 909 44 --21132 180 11093
NM_014945chr551854 1502 1243 625 335 1107 ----
NM_014946chr221132 642 --1210 --
NM_014947chr152954 1153 1021 941 864 ----1210
NM_014948chr2082305 2085 979 672 625 545 526 113 1609 72365 2155 390 330 294 241 221 32461 2063 230
NM_014949chr11683 ------
NM_014952chr1571748 1732 1710 836 673 596 149 21491 1300 21500 391 --
NM_014953chr1344291 3772 2829 872 11052 21334 1015 --
NM_014956chr114987 687 362 72 --1873 --
NM_014961chr431463 869 767 1410 1757 --
NM_014962chr20157 11793 ----
NM_014969chr1--1215 ----
NM_014974chr1031523 1253 361 --11754 --
NM_014978chr1041660 1338 1311 670 --1493 1259
NM_014982chr1455120 3637 3619 914 889 24637 176 12130 --
NM_014988chr442402 966 854 696 --11109 --
NM_014989chr632028 1859 1334 ------
NM_014990chr14--1256 ----
NM_014991chr422617 58 --32086 2080 916 --
NM_014992chr14179 ----1707
NM_014994chr1592326 2156 2024 1475 841 663 365 291 210 --52164 1691 1540 787 63 --
NM_014996chr31150 ------
NM_014999chr121342 11429 ----
NM_015000chr1222317 304 ------
NM_015001chr13846 138 45 ------
NM_015002chr1252179 1538 1494 1482 97 --1346 --
NM_015008chr333086 1405 586 --32450 1016 394 --
NM_015009chr3160 ------
NM_015015chr1951738 1266 758 722 83 --32045 1832 1532 --
NM_015018chr6167 ------
NM_015020chr1673630 2850 1016 637 406 215 72 31180 594 253 1358 --
NM_015023chr1111744 1539 1525 637 583 462 358 312 295 265 119 11666 91725 1706 1699 1679 1547 1253 1144 672 49 21260 31
NM_015024chr841292 1033 595 318 1309 1945 --
NM_015025chr222328 2020 1233 ----
NM_015026chr1211026 --14579 14747
NM_015032chr1332557 2249 428 1585 --12861
NM_015033chr9122907 2776 2707 2099 1065 863 815 795 699 302 155 119 12715 33077 164 82 --
NM_015035chr20216572 6351 6307 6191 5921 5745 4632 4125 2530 2415 2238 2215 1769 1707 1481 1443 658 583 176 159 79 36373 5098 51 46039 5037 2449 1778 --
NM_015037chr10----1202 --
NM_015039chr193518 3141 1587 1534 1388 514 433 66 55 14226 --13983
NM_015042chr15114375 4000 3780 3762 3304 3285 2845 1337 906 817 673 21059 989 53973 3690 3270 2674 843 --
NM_015044chr1673232 2994 2919 2856 2756 1274 284 23217 3084 1328 1881
NM_015045chr1022014 764 ------
NM_015049chr242420 2202 1152 500 ------
NM_015051chr922352 1013 1202 ----
NM_015057chr13177 ------
NM_015059chr15113654 3568 3215 3026 2873 956 744 579 562 349 127 --43931 1486 963 216 --
NM_015063chr1951421 1189 222 158 62 --11062 --
NM_015064chr1262306 2258 1376 1347 1260 710 22670 527 62236 1209 1018 667 539 372 31420 1353 118
NM_015068chr763847 3314 3282 1588 1493 1067 1323 21564 30 13861
NM_015069chr16140 1218 ----
NM_015071chr5156378 6366 5256 5186 5169 4975 4437 4205 4190 3999 1891 1884 1096 646 385 44867 4650 595 125 54928 4631 4103 1143 1109 1680
NM_015073chr1941459 1311 440 281 --32072 1635 53 --
NM_015074chr184957 4644 4556 3823 3576 1914 877 592 14497 21672 1346 --
NM_015075chrX102086 2055 2006 1649 1640 1495 606 596 569 287 --41539 387 319 175 --
NM_015076chr674452 4405 3664 2981 2845 1800 217 ------
NM_015079chr15113081 3066 2512 2473 2180 1116 840 433 407 337 33 23011 2560 --22489 1245
NM_015080chr114641 406 233 179 1241 1914 177
NM_015082chr582389 2087 1811 1652 1646 943 310 137 --3783 765 682 --
NM_015084chr52483 26 1836 ----
NM_015090chr1185840 5799 5465 4440 4429 4340 4090 3984 3824 2392 2109 1903 1388 1234 1213 1077 1029 706 32419 2321 130 55714 1009 764 617 264 13774
NM_015091chr141270 ------
NM_015092chr1644008 3274 1843 368 1270 13287 --
NM_015094chr2284167 3763 3708 3621 1526 803 732 36 11506 64327 3756 3158 3150 2870 833 130
NM_015097chr31725 22299 663 ----
NM_015099chr173687 295 154 --4475 279 269 88 --
NM_015100chr141887 1851 1479 157 --21990 1579 --
NM_015101chr152831 2786 1856 827 576 --42639 2619 2380 833 22251 968
NM_015102chr1490 61 47 26 ------
NM_015103chr33316 260 204 1949 ----
NM_015107chrX91978 1673 927 581 431 292 198 117 86 2894 535 32391 1506 524 --
NM_015110chr942510 2185 2008 118 ------
NM_015113chr1771982 1966 1633 921 628 556 379 138 ----
NM_015115chr421121 157 ------
NM_015116chr1331463 459 82 ----1100
NM_015125chr193417 227 132 --3514 508 463 --
NM_015132chr7----21886 1771 --
NM_015133chr1681443 1179 1009 940 934 575 411 395 --31126 456 436 11323
NM_015138chr1542703 498 310 30 22824 2776 11726 --
NM_015143chr431434 1026 224 ------
NM_015144chr1653285 3258 3228 2676 530 33200 1082 1047 13345 13237
NM_015150chr33926 619 321 ------
NM_015151chr211310 1193 1728 --
NM_015153chr6--181 ----
NM_015155chr10103100 3037 3015 2472 2283 1007 915 907 802 367 22971 1192 1825 --
NM_015156chr1493525 3508 1472 1379 1340 721 435 377 154 13492 23305 224 --
NM_015157chr116986 792 469 326 255 190 --21104 430 --
NM_015158chr91248 1838 ----
NM_015161chr1611456 --2307 119 --
NM_015163chr1441320 525 198 135 31902 482 390 1159 --
NM_015170chr852174 1535 338 261 228 ----1319
NM_015171chr163441 157 133 --1139 --
NM_015172chr111114 ------
NM_015178chr841962 405 178 60 22603 599 42419 980 834 28 --
NM_015184chr31168 ------
NM_015185chrX112905 2897 2695 2341 2141 1029 1005 954 676 599 384 --21099 307 --
NM_015191chr1192716 2360 2146 1872 1676 830 237 179 94 --12507 --
NM_015192chr2012843 --1653 --
NM_015193chr871490 1283 1258 1172 199 86 27 --61451 1444 1177 1097 999 484 21320 1049
NM_015194chr17111531 1353 797 469 426 399 363 199 156 131 97 21773 1337 21475 352 --
NM_015197chr14213261 3186 3040 2898 2433 2402 2293 2195 2129 1371 1174 1161 957 637 512 457 346 323 310 188 29 1167 42573 2411 733 658 13061
NM_015199chr362745 2557 2443 2315 799 304 12280 ----
NM_015200chr42548 307 --1126 1597
NM_015205chr13164596 3895 3881 3873 3861 3786 3524 1407 1127 1025 730 707 663 536 394 34 21231 447 71926 1885 1196 1090 839 685 281 --
NM_015206chr1553028 2889 1304 620 545 32582 988 751 1868 13372
NM_015209chr162057 1670 1563 640 188 22 22134 241 1579 --
NM_015213chr11146 ------
NM_015215chr13453 446 142 --1916 --
NM_015219chr1762052 1812 724 166 116 72 11016 31595 991 646 1929
NM_015221chr1031387 84 28 --1104 --
NM_015226chr16103386 2903 2781 2732 2265 1130 1022 977 666 134 11381 13014 13121
NM_015229chr1751032 970 479 348 158 --1947 --
NM_015230chr421747 556 ------
NM_015231chr112169 73 ------
NM_015233chr13112674 2545 2508 2479 2472 2416 2201 1892 1711 930 93 32054 1941 717 12565 --
NM_015236chr42361 204 ------
NM_015246chr1691875 1757 1591 1455 1398 481 469 105 91 --3526 351 324 1794
NM_015250chr9--11864 --138
NM_015252chr22645 599 1849 ----
NM_015254chr8112868 2859 2787 2772 2543 2281 2243 2057 877 829 804 --12443 2641 57
NM_015256chr52726 132 ------
NM_015265chr252305 1066 1032 582 323 12383 1309 --
NM_015269chr1157 ------
NM_015270chr12102177 2152 1897 1863 1675 1647 687 469 310 161 22161 336 32033 881 354 1109
NM_015271chr422950 896 12812 ----
NM_015272chr1621855 1656 21621 1338 11608 --
NM_015277chr1841225 1135 271 185 --31710 1576 1542 --
NM_015278chr642212 1365 642 372 23075 2253 12941 --
NM_015282chr292642 2609 2507 2400 2354 2343 946 287 269 --52482 2414 2406 2330 2325 22692 874
NM_015284chr142060 1887 835 351 22121 65 41869 1460 477 341 --
NM_015285chr1872489 2461 2361 2296 1984 212 100 1232 --1253
NM_015288chr5123796 3749 3202 2734 2602 2401 1332 1146 1079 646 616 84 43383 1127 950 445 5655 407 260 255 30 3662 630 233
NM_015291chr163269 819 382 349 315 52 1942 1426 --
NM_015292chr122244 39 --1529 1774
NM_015294chr173940 728 338 ------
NM_015296chr131405 --11209 --
NM_015299chr1493687 1588 1362 1251 1039 690 588 417 79 13087 13474 22789 33
NM_015305chr1471895 1786 1697 1468 743 729 496 2643 422 3391 191 178 --
NM_015308chr111677 ------
NM_015310chr8127877 7838 7561 7138 7109 6666 5467 2208 2025 1626 1215 452 --47264 7228 1841 581 --
NM_015313chr1194413 4141 4078 1626 1369 938 582 553 111 14055 ----
NM_015315chr5133425 2879 2785 2751 2654 2245 2203 2128 1220 1188 437 396 341 1576 52112 1122 654 553 350 --
NM_015316chr143557 404 397 2279 32 3994 982 416 --
NM_015317chr242536 2409 2343 1091 12578 12382 --
NM_015319chr12--1174 --1332
NM_015326chr182495 2337 2177 2155 2063 1990 777 196 11929 12527 --
NM_015327chr151247 1183 469 260 48 --1275 --
NM_015328chr7112752 2715 2689 2550 2068 2022 2002 1192 399 123 110 1880 ----
NM_015332chr7102887 2797 1389 1261 706 615 576 338 156 75 --42957 2238 507 332 13552
NM_015335chr123121 76 44 2843 68 ----
NM_015336chr12----11636 1734
NM_015338chr20101857 1575 1547 1503 1219 755 653 510 242 119 11404 11564 2773 408
NM_015339chr201281 ------
NM_015343chr171110 --2129 79 --
NM_015344chr82879 252 140 ----
NM_015346chr1461639 1625 1420 1309 393 145 1374 1109 --
NM_015347chr1252222 2152 2105 904 783 --1522 --
NM_015349chr632266 117 106 --22272 2038 --
NM_015353chr1782436 2404 1093 1032 754 225 123 78 --32449 1921 824 --
NM_015356chr8----163 143
NM_015361chr21363 --140 --
NM_015365chrX33499 3475 36 --2387 324 --
NM_015374chr22121 11451 1408 --
NM_015375chr173542 3455 3402 1803 1772 1522 498 13767 14657 --
NM_015378chr152086 1831 1174 934 283 --22435 2328 --
NM_015382chr141106 ------
NM_015385chr1082596 1190 1029 742 608 551 337 158 11126 11293 --
NM_015392chr92191 28 ------
NM_015393chr492974 2965 2775 2765 691 530 452 240 109 --12347 --
NM_015396chr321281 1132 1975 11403 --
NM_015397chr941470 1418 733 296 ------
NM_015404chr93595 568 83 ------
NM_015407chr31171 ------
NM_015416chr123740 238 31 173 ----
NM_015419chrX3986 411 202 ------
NM_015426chr33587 153 142 ----1397
NM_015429chr321063 1025 ------
NM_015443chr1751386 1048 453 276 63 --2972 251 1521
NM_015449chr1267 21 1633 ----
NM_015453chr31834 11740 1283 --
NM_015455chr54945 925 608 230 ------
NM_015457chr11133 ------
NM_015460chr361837 1795 1545 505 294 195 1588 1206 --
NM_015461chr182724 542 ------
NM_015464chr7--179 ----
NM_015470chr281246 1106 847 238 132 117 103 52 --11193 --
NM_015475chr21117 ------
NM_015477chr152698 243 ------
NM_015481chr1211116 --1219 --
NM_015483chr72976 282 ------
NM_015484chr12773 742 ------
NM_015488chr2111616 1590 1529 1519 1302 1290 1227 1173 1156 553 400 --61511 1366 1335 625 539 517 --
NM_015493chr1942132 207 142 66 11410 ----
NM_015496chr81276 ------
NM_015497chr151926 ------
NM_015508chr31987 --1453 --
NM_015509chr124545 430 211 169 11107 11161 11167
NM_015511chr2041048 818 291 117 192 11104 11008
NM_015520chr322498 1864 ------
NM_015526chr1921471 119 ------
NM_015527chr165831 632 600 239 104 --3788 656 608 --
NM_015534chr13806 154 90 ------
NM_015537chr94746 223 151 45 1261 1457 --
NM_015541chr32989 564 --1580 --
NM_015542chr10------1171
NM_015549chr143575 504 170 1521 193 --
NM_015550chr773302 2526 1056 863 815 682 48 12548 13566 --
NM_015553chr665173 5057 4259 4143 3630 3619 --74715 4531 4269 4118 3396 1561 512 --
NM_015556chr142172 57 ------
NM_015557chr1133552 3125 2760 2687 2220 1173 1143 866 531 458 69 57 21 42862 1223 902 668 83038 2804 2737 1299 1073 1013 987 571 22377 725
NM_015560chr332295 2036 29 1455 ----
NM_015564chr521436 564 1492 ----
NM_015567chr1311216 --1398 --
NM_015568chr20203956 3912 3855 3839 3676 3523 3288 3216 1619 1445 1436 1396 1172 693 660 543 248 226 194 112 2522 208 23791 3580 14205
NM_015569chr134671 4467 4113 23368 1571 ----
NM_015570chr72735 78 ------
NM_015571chr6--12282 ----
NM_015575chr273138 2424 1266 1089 219 101 35 11398 ----
NM_015576chr352161 2011 870 463 78 1730 ----
NM_015577chr561640 1399 715 709 558 353 --1580 1219
NM_015578chr1922010 724 ------
NM_015584chr1721210 1083 2553 291 1211 1338
NM_015595chr36980 863 837 345 277 124 1137 ----
NM_015609chr1102933 2894 2881 2664 2425 2009 1054 1031 693 138 12139 62724 2704 2699 2684 2679 769 --
NM_015610chr7112816 2703 2320 2154 2147 2128 1905 1137 633 350 204 11845 ----
NM_015630chr221135 329 ------
NM_015638chr203643 614 482 --6625 619 490 102 92 71 --
NM_015645chr113337 308 138 ------
NM_015646chr121851 11283 ----
NM_015649chr19----133 --
NM_015651chr9102187 1951 1914 1739 763 627 585 287 217 172 2536 149 1136 11477
NM_015652chr102439 429 ------
NM_015657chr2--1669 --1679
NM_015658chr1----2366 326 --
NM_015670chr172452 89 1340 ----
NM_015680chr22560 80 --1112 --
NM_015686chrX62506 1999 1811 952 448 362 1495 62431 2414 2245 2141 1819 512 21768 313
NM_015691chrX72966 2456 2306 2115 1085 747 578 32735 1854 875 32374 2366 833 --
NM_015695chr651943 769 190 69 29 --134 2655 76
NM_015704chr22----125 --
NM_015711chr193698 159 116 --2289 152 1229
NM_015713chr863129 1424 1364 997 277 64 ------
NM_015716chr174654 216 128 50 ------
NM_015726chr151693 1540 1192 68 48 ------
NM_015844chr181189 ------
NM_015846chr181189 ------
NM_015847chr181189 ------
NM_015850chr8112412 2292 1892 1817 1801 1606 355 194 147 101 80 22150 1886 3477 90 64 1276
NM_015866chr11356 ------
NM_015872chr141550 1215 659 107 11188 41373 597 372 265 11172
NM_015874chr41146 ------
NM_015878chr81828 ------
NM_015879chr18138580 8369 6612 6246 2960 2765 2647 2448 2300 1723 1707 507 340 1108 48186 3294 1927 521 --
NM_015881chr111510 --2394 247 --
NM_015888chr132531 2146 1031 ------
NM_015889chr226659 644 598 293 129 115 3814 143 59 ----
NM_015898chr1942070 1911 1739 753 12279 32122 1789 617 --
NM_015902chr81144 ------
NM_015906chr124482 103 13211 ----
NM_015912chr862492 2207 859 355 305 66 12460 11966 --
NM_015920chr151637 ------
NM_015933chr3------171
NM_015964chr162291 127 1112 1102 242 23
NM_015967chr1--1809 ----
NM_015975chrX31233 1186 273 --11738 --
NM_015980chr511218 11441 ----
NM_015981chr5112964 2758 2586 2559 2361 2081 2015 1982 670 521 154 12388 --32525 1042 231
NM_015982chr171317 149 188 --
NM_015984chr11126 ------
NM_015994chr144629 477 461 210 1504 ----
NM_015995chr15144966 4425 4412 3699 3549 3470 1745 1443 1285 1270 660 581 498 295 44835 3845 1632 800 64561 4556 3776 2107 668 529 21763 848
NM_015999chr1--1668 ----
NM_016003chr7112816 2703 2320 2154 2147 2128 1905 1137 633 350 204 11845 ----
NM_016009chr144633 4536 1163 963 1141 44284 4250 3464 3313 --
NM_016019chr72985 297 ------
NM_016021chr652098 1991 1865 668 184 12084 1662 --
NM_016022chr15368 325 287 274 36 --1299 --
NM_016026chr141462 --1126 --
NM_016032chrX51355 1267 1255 939 321 ------
NM_016037chr12888 323 ------
NM_016038chr7--179 ----
NM_016041chr17--1252 ----
NM_016045chr2011286 --1395 --
NM_016047chr21117 ------
NM_016053chr12--1166 ----
NM_016062chr16154 ------
NM_016063chr6----2649 561 --
NM_016072chr1221764 715 ------
NM_016073chr151328 ------
NM_016075chr1312844 12636 ----
NM_016076chr152319 1289 834 644 457 1322 ----
NM_016081chr41765 12060 11471 --
NM_016083chr643115 2870 2813 744 13199 ----
NM_016096chr851937 1410 1383 657 434 12071 ----
NM_016097chr183716 377 100 ------
NM_016098chr61167 ------
NM_016107chr511172 1550 ----
NM_016125chr171168 ------
NM_016131chr22772 762 1730 11493 --
NM_016132chr1533353 3077 756 11229 1513 1524
NM_016133chr211134 1353 ----
NM_016140chr162291 127 1112 1102 242 23
NM_016141chr31812 --158 --
NM_016144chr51296 138 ----
NM_016147chr114977 273 260 243 2724 165 41106 851 412 227 --
NM_016148chr19149 --1122 --
NM_016151chr161356 ------
NM_016152chr311054 ------
NM_016162chr123611 320 249 ------
NM_016169chr10153253 3081 3062 2794 2682 2580 2552 2484 2257 2136 2077 1129 1109 992 541 22656 683 32427 357 264 --
NM_016188chr7125 ------
NM_016192chr21103 ------
NM_016194chr1521487 1464 --21620 1559 --
NM_016195chr102780 105 ------
NM_016201chr351764 1511 907 272 211 31682 924 284 2331 48 1337
NM_016205chr42398 26 ------
NM_016206chr368172 7625 3052 2765 2115 1131 38536 7932 2966 27496 7183 16738
NM_016227chr121373 1257 1542 ----
NM_016230chr61401 ------
NM_016231chr17----1467 --
NM_016235chr1621269 491 ----1207
NM_016248chr1323495 1253 23375 1541 13366 1745
NM_016252chr2--1915 ----
NM_016257chr193296 3058 2910 2889 2795 2569 2498 1400 180 42415 2144 1350 376 42858 2336 209 129 --
NM_016260chr266787 5220 2398 1413 1216 1147 --1166 11990
NM_016269chr41113 1411 ----
NM_016271chr181256 ------
NM_016272chr2221744 163 --1350 1538
NM_016281chr12167 ------
NM_016284chr163915 154 125 ------
NM_016287chr151805 824 449 286 188 --1270 --
NM_016289chr232336 736 402 11911 ----
NM_016290chr51105 ------
NM_016291chr3199 ------
NM_016312chr121386 ------
NM_016315chr221764 277 ------
NM_016320chr111805 --2125 60 --
NM_016322chr972548 2407 1230 1050 1004 958 216 ------
NM_016328chr7--1129 ----
NM_016329chr32391 192 --162 --
NM_016338chr53163 80 59 11047 ----
NM_016339chr17101767 1735 1598 1523 1471 667 396 224 167 110 11319 31560 646 602 11572
NM_016352chr761442 388 215 200 176 128 1193 1258 --
NM_016376chr1793637 2976 1125 868 752 729 504 107 58 23036 2861 11130 --
NM_016377chr631240 1156 54 --145 21530 323
NM_016395chr1521380 1262 31780 1615 28 ----
NM_016396chr152617 607 1291 12054 --
NM_016418chr2293761 3069 2938 2646 1445 1319 956 563 246 33444 102 90 --13454
NM_016423chr143477 466 377 1409 ----
NM_016424chr1731924 533 178 ------
NM_016427chr181155 ------
NM_016429chr172259 246 --126 --
NM_016431chr224761 683 664 570 --3738 292 210 --
NM_016470chr201551 ------
NM_016472chr141484 1392 ----
NM_016480chr51727 ------
NM_016485chr61785 --1262 --
NM_016486chr1----3120 78 38 --
NM_016488chr121314 21912 1696 ----
NM_016505chr12702 235 1716 ----
NM_016507chr1732126 688 141 ------
NM_016516chr21853 ------
NM_016522chr1141339 1299 1185 207 --1338 --
NM_016526chr1172354 2340 2036 1696 1647 955 32 --32277 1798 222 12451
NM_016530chr1533996 1175 48 14014 33103 981 671 --
NM_016531chr433851 466 60 --24097 417 1397
NM_016538chr171155 ------
NM_016542chrX31514 1161 590 ------
NM_016544chr263773 3722 1366 697 431 215 11206 --1724
NM_016545chr1----1343 --
NM_016559chr331127 1002 331 ------
NM_016562chrX11034 ------
NM_016569chr1221416 1109 --2311 170 --
NM_016574chr115745 433 128 69 30 --41012 953 727 45 2869 180
NM_016575chr12115313 5237 5031 4674 4105 3814 3369 1549 1491 1360 652 1705 45005 4992 4634 1335 11957
NM_016577chr384278 3924 3811 3559 3305 2773 1261 38 11671 64232 3504 2766 1684 1479 431 --
NM_016582chr11125 ------
NM_016598chr331392 588 269 1566 ----
NM_016603chr511638 ------
NM_016604chr531176 450 289 ------
NM_016605chr5102712 2605 2591 2497 2043 1949 914 831 637 301 --1945 1264
NM_016607chrX--11666 1391 --
NM_016621chr11144162 3616 3606 3510 3429 3386 3331 2819 1125 705 675 668 661 404 --84464 4046 4038 3630 3022 1445 805 726 23322 3267
NM_016623chr8123 ------
NM_016626chr181677 ------
NM_016628chr102765 336 ------
NM_016631chr213842 724 280 1214 1748 --
NM_016641chr1641553 1343 1306 678 1378 31562 253 248 --
NM_016644chr51109 ------
NM_016653chr221076 235 ------
NM_016733chr226621 520 391 365 229 67 ------
NM_016823chr1751167 969 963 306 274 ------
NM_016824chr101362 --1233 --
NM_016827chr3--136 1693 --
NM_016830chr12----179 --
NM_016834chr17133625 2607 2529 1481 1173 928 912 876 739 715 688 406 141 12701 73024 2853 1418 1149 1119 636 92 --
NM_016835chr17133625 2607 2529 1481 1173 928 912 876 739 715 688 406 141 12701 73024 2853 1418 1149 1119 636 92 --
NM_016841chr17133625 2607 2529 1481 1173 928 912 876 739 715 688 406 141 12701 73024 2853 1418 1149 1119 636 92 --
NM_016929chr643905 2968 1665 1130 2319 151 13260 1692
NM_016932chr24883 312 85 26 ------
NM_016936chr1661891 1539 523 350 222 182 124 11766 --
NM_016938chr11127 --1401 --
NM_016946chr173492 3216 3004 2335 2201 1304 1263 --2561 556 --
NM_017409chr121720 --1726 --
NM_017412chr811006 1947 11011 --
NM_017413chrX92051 2023 1836 901 684 651 366 148 113 31851 1779 428 1312 --
NM_017415chr5124438 4354 4071 3625 3448 3417 3304 1706 1567 1288 911 669 13724 ----
NM_017420chr1433255 2872 2713 ----13261
NM_017423chr422048 76 1888 ----
NM_017447chr2154375 4169 3836 1329 579 1303 130 --
NM_017450chr1791475 1295 1120 974 561 298 265 202 121 ------
NM_017452chr2051416 1253 1220 531 342 ------
NM_017453chr2051416 1253 1220 531 342 ------
NM_017454chr2051416 1253 1220 531 342 ------
NM_017455chr15--154 ----
NM_017456chr17101744 1706 1278 714 588 495 362 285 206 46 11313 22036 1229 1100
NM_017482chr261281 626 555 152 117 24 1190 ----
NM_017488chr251276 1265 526 407 363 --11483 --
NM_017491chr43971 396 150 1655 1769 --
NM_017514chrX6836 794 740 247 186 174 --2860 303 1287
NM_017519chr6----1119 --
NM_017534chr17193 ------
NM_017540chr5113118 2800 2557 2384 2347 2080 992 506 356 157 81 --3882 710 248 --
NM_017544chrX1720 ------
NM_017548chr371905 1754 532 460 425 248 81 11704 ----
NM_017550chr191833 --6970 790 442 400 179 173 --
NM_017551chr1042224 599 366 21 --22110 660 --
NM_017553chr153990 364 78 157 31159 1000 816 --
NM_017558chr162395 162 ------
NM_017563chr3116141 6128 5400 4036 3900 2220 1801 1185 1167 764 357 22322 248 45802 4624 1425 151 14397
NM_017573chr19--1121 128 --
NM_017580chr1042043 1818 921 169 ------
NM_017582chr14670 627 243 231 1698 1127 --
NM_017594chr953319 3298 2913 2265 574 1199 11308 11343
NM_017596chr1244539 4510 4396 4157 4059 3783 3602 3209 3147 1859 1754 1652 1640 1419 1405 1081 1016 923 871 700 394 347 174 135 --124592 4479 4474 4318 4245 3776 3506 2920 886 758 162 21 13943
NM_017599chr1231919 1382 814 1308 1831 --
NM_017602chrX8901 760 254 218 194 159 90 47 --1376 1203
NM_017607chr19--147 ----
NM_017610chr1551861 1662 1488 124 23 11830 ----
NM_017626chr1031576 1303 553 1213 11660 --
NM_017628chr434556 4545 1869 ------
NM_017629chr121957 583 --11679 --
NM_017633chr663750 3686 3053 2591 2434 240 1260 13706 12576
NM_017634chr821918 1244 1517 ----
NM_017637chr9109114 8828 8762 8750 8490 7961 7913 6534 6018 3020 18515 38726 8359 7787 --
NM_017643chr1731238 1162 974 --12538 22054 843
NM_017649chr1051225 899 450 411 109 2831 811 51204 1164 1126 307 61 --
NM_017650chr774079 3870 1492 964 803 561 58 26048 5636 164 1435
NM_017657chr2174 ------
NM_017658chr1454162 3127 2920 1866 1584 1569 ----
NM_017662chr942027 558 317 33 --138 --
NM_017666chrX31410 274 259 11449 ----
NM_017668chr165723 585 552 328 135 --1213 --
NM_017670chr117874 792 756 746 726 711 312 1112 4701 237 178 29 143
NM_017679chr176658 275 251 206 190 89 --143 1198
NM_017684chr1521314 67 --1486 --
NM_017694chr242044 1806 1460 27 ----1289
NM_017697chr8----1451 --
NM_017700chr45624 401 227 184 121 ------
NM_017709chr143279 2828 1631 1178 --1849 1556
NM_017715chr7----1568 1498
NM_017719chr342228 697 368 35 ------
NM_017721chr192368 317 1186 ----
NM_017730chr31183 ------
NM_017737chr12700 417 ----1401
NM_017739chr1----1161 --
NM_017741chr422748 146 --2550 280 2338 262
NM_017742chr181521 11795 ----
NM_017744chr161892 1704 1575 955 928 436 1637 ----
NM_017745chrX2671 458 ------
NM_017749chr111184 --1409 1275
NM_017753chr91163 ----1741
NM_017763chr172181 72 ------
NM_017766chr14509 392 183 79 ------
NM_017772chr641413 1131 468 260 ------
NM_017778chr821521 135 --11167 --
NM_017779chr112732 ----11741
NM_017780chr81266 1632 ----
NM_017784chr33936 168 37 1411 ----
NM_017789chr25753 690 568 147 97 ------
NM_017790chr9124 ------
NM_017799chr1431529 736 25 ------
NM_017801chr32900 41 22040 1600 ----
NM_017811chr963109 2590 2467 2208 130 22 ----134
NM_017813chr875199 5165 2049 2023 1235 738 152 1714 15801 15025
NM_017824chr1022662 2075 ------
NM_017848chrX74017 3979 3864 1798 1772 1745 706 --24479 156 --
NM_017849chr262384 1968 854 500 231 47 32186 1245 223 42359 611 170 144 12052
NM_017857chr111216 ----2169 142
NM_017873chr9113067 2838 2540 2426 2380 2266 2121 1189 1030 615 490 12317 42168 1164 555 438 12874
NM_017893chr107468 414 404 370 335 257 135 --41455 1148 957 564 1452
NM_017895chr20152 ------
NM_017902chr10185247 4832 4715 4492 3712 2237 2062 1559 1552 1536 1197 1128 780 610 522 419 371 252 2124 27 45445 1174 234 204 11319
NM_017907chr111357 1104 ----
NM_017915chr121981 1372 ----
NM_017919chr973925 3918 3537 1839 1682 731 701 34922 4693 1003 21570 620 24681 1470
NM_017921chr17142342 2271 2170 2099 1694 1681 1627 1568 913 898 647 570 542 81 --32017 466 397 --
NM_017922chr141106 ------
NM_017933chr241487 361 329 193 --11011 --
NM_017934chr6183 ------
NM_017935chr42174 82 ------
NM_017938chrX--1122 ----
NM_017943chr1421034 893 ------
NM_017944chr1132504 2279 1893 1791 12427 --
NM_017953chr1156 ------
NM_017955chr1461141 1115 907 187 97 78 --1106 --
NM_017958chr262816 2233 1126 607 515 42 ------
NM_017964chr2------1382
NM_017966chr1141366 1132 487 108 --11079 --
NM_017982chr151097 1085 495 450 30 ------
NM_017988chr121672 ------
NM_017990chr16103860 3775 3497 3124 1567 1382 1295 1057 643 169 23136 1635 43597 3173 2748 182 13897
NM_017994chr712876 22812 2517 152 --
NM_018008chr3133 1291 ----
NM_018011chr131146 ------
NM_018014chr221381 135 175 ----
NM_018027chr1052039 427 318 232 196 1514 --1372
NM_018028chr196442 395 336 263 200 170 --2518 311 --
NM_018045chr162547 2060 2024 1261 1200 32 11060 1331 1972
NM_018047chr51792 1636 1857 --
NM_018053chr13736 682 676 ----1296
NM_018061chr121671 108 ------
NM_018063chr10157 ------
NM_018068chr81125 ------
NM_018070chr1----2504 116 --
NM_018071chr143226 198 112 ----1158
NM_018072chr11185 ------
NM_018084chr2--12347 ----
NM_018086chr241632 1394 1193 521 21483 59 ----
NM_018092chr161613 ------
NM_018096chr1741007 976 263 137 --3992 741 723 3772 64 48
NM_018103chr1--1322 ----
NM_018107chr143288 195 167 146 ----
NM_018110chr163416 402 44 --3967 877 133 --
NM_018111chr19121 ------
NM_018113chr121182 --1397 --
NM_018121chr1032243 690 287 13075 ----
NM_018133chr33852 94 83 ----11838
NM_018144chr101263 ------
NM_018150chr14854 777 205 45 ------
NM_018154chr195849 753 747 686 64 2598 366 1727 --
NM_018156chr152086 1831 1174 934 283 --22435 2328 --
NM_018157chr1253244 2241 850 160 94 --12767 --
NM_018172chr1141494 1409 1181 1110 1206 ----
NM_018178chr11437 1539 133 11654
NM_018179chr121233 ------
NM_018181chr1821787 526 --131 --
NM_018182chr1751783 1733 1612 761 591 1248 32136 2003 1640 22077 598
NM_018184chr351908 1343 655 631 234 ------
NM_018195chr1111827 12048 1616 --
NM_018198chr151445 1072 916 462 326 --21416 368 --
NM_018200chr1562199 1934 925 760 738 619 21916 1813 21592 578 11794
NM_018207chr131425 1199 659 21366 529 31445 271 58 11162
NM_018208chr13868 794 267 --3740 398 224 --
NM_018211chr131828 49 38 ------
NM_018214chr6258 40 ------
NM_018221chr2132 ------
NM_018222chr1131214 384 91 21376 491 181 --
NM_018240chr14852 252 203 29 ------
NM_018243chr4103526 3448 3374 1444 1206 1101 813 643 542 38 --22877 1226 164
NM_018244chr203520 366 81 ----1484
NM_018246chr832755 911 591 11786 1446 --
NM_018247chr632890 820 647 12879 ----
NM_018254chr11340 ------
NM_018263chr21785 12255 42106 1792 733 710 --
NM_018275chr73463 428 132 --165 --
NM_018286chr171294 1405 ----
NM_018299chr832620 2610 2431 2899 397 ----
NM_018312chr1131705 848 108 1272 ----
NM_018315chr421083 62 --151 --
NM_018317chr4171 ------
NM_018354chr20----159 181
NM_018362chr1123277 2966 ----13785
NM_018364chr132825 345 101 1358 ----
NM_018371chr821442 213 11196 ----
NM_018375chr1441716 771 404 100 1672 11486 --
NM_018387chr9179 ------
NM_018388chrX--1139 11484 --
NM_018399chr64618 602 533 124 1262 ----
NM_018403chr363559 3501 3456 2683 623 470 11113 ----
NM_018416chr1241638 807 281 179 1601 12511 --
NM_018419chr204317 149 81 26 ------
NM_018423chr121277 ------
NM_018424chr941926 1742 1319 368 11748 ----
NM_018425chr10102227 1764 1683 1659 975 865 705 698 464 122 1128 32176 314 135 12161
NM_018426chr6133 --1114 --
NM_018440chr8108155 7635 6857 6222 3430 3214 2117 1914 618 560 38539 7692 1531 56246 5731 246 207 134 15696
NM_018442chr1--1352 ----
NM_018448chr121312 ------
NM_018451chr131134 1812 1200 --
NM_018452chr6_random73073 2831 2644 1221 1078 906 583 13489 ----
NM_018469chr174346 201 171 126 11347 21198 133 --
NM_018471chr22549 130 ------
NM_018476chrX----145 --
NM_018489chr14875 541 64 57 1712 ----
NM_018490chr11--1536 ----
NM_018509chr1731464 1221 613 1103 ----
NM_018553chr1781816 1701 1555 1394 1357 1255 1215 106 ----11655
NM_018557chr23527 488 361 ------
NM_018566chr153143 2048 1567 1026 729 --11254 1255
NM_018569chr41196 1231 ----
NM_018571chr2148 ------
NM_018584chr12839 205 ------
NM_018590chr1021489 434 ------
NM_018622chr3----139 --
NM_018639chr1241070 938 461 403 149 ----
NM_018644chr1171656 1373 674 639 513 354 36 --32087 533 427 --
NM_018645chr22208 22 1400 ----
NM_018648chr15--130 ----
NM_018650chr12360 89 11945 ----
NM_018652chr152724 30 ------
NM_018660chr852321 1081 830 566 361 --42287 2241 554 37 --
NM_018667chr16102470 2020 1964 1860 1794 1761 556 448 158 36 1970 42210 1873 1811 1066 128
NM_018674chr24565 485 125 69 --1142 --
NM_018684chrX31289 1032 972 --2256 88 --
NM_018685chr7--21089 841 ----
NM_018686chr121246 ------
NM_018698chrX11560 1129 ----
NM_018699chr41224 ------
NM_018700chr51178 ------
NM_018703chr162371 106 ------
NM_018708chr1981486 1425 1304 388 281 124 90 42 1581 41604 1067 566 524 1356
NM_018712chr1141271 1109 234 63 ------
NM_018715chr152141 1542 1493 874 790 11527 ----
NM_018717chr491096 939 864 778 733 664 629 381 305 1874 3918 902 292 --
NM_018718chr752139 569 394 382 238 11675 41931 549 143 137 1401
NM_018719chr741295 446 337 219 1251 ----
NM_018837chr201727 --1208 --
NM_018841chr123509 1030 23520 350 11022 --
NM_018890chr7130 11211 ----
NM_018898chr532091 338 138 --2317 77 --
NM_018899chr532091 338 138 --2317 77 --
NM_018900chr532091 338 138 --2317 77 --
NM_018901chr532091 338 138 --2317 77 --
NM_018902chr532091 338 138 --2317 77 --
NM_018903chr532091 338 138 --2317 77 --
NM_018904chr532091 338 138 --2317 77 --
NM_018905chr532091 338 138 --2317 77 --
NM_018906chr532091 338 138 --2317 77 --
NM_018907chr532091 338 138 --2317 77 --
NM_018908chr532091 338 138 --2317 77 --
NM_018909chr532091 338 138 --2317 77 --
NM_018910chr532091 338 138 --2317 77 --
NM_018911chr532091 338 138 --2317 77 --
NM_018944chr212641 27 ------
NM_018951chr73459 353 101 --2331 71 --
NM_018952chr172429 110 ------
NM_018953chr122641 47 1676 --1759
NM_018955chr17147 ------
NM_018957chr222309 283 ------
NM_018959chr192597 578 ------
NM_018963chr21--1250 ----
NM_018964chr2131036 728 83 1678 ----
NM_018970chr772986 2737 2603 2218 1114 185 47 1777 ----
NM_018977chrX1761 --1882 --
NM_018979chr1232108 1957 641 2930 123 32083 1978 455 --
NM_018991chr71189 ------
NM_018992chr1621280 97 11123 21029 470 --
NM_018994chr13563 533 375 ------
NM_018999chr1021987 341 2970 745 --11299
NM_019000chr521558 138 ------
NM_019001chr344034 3151 561 261 24700 1864 --11320
NM_019008chr22123716 3593 3578 3411 3150 3118 2737 1449 1408 435 340 95 11111 63348 2789 1194 1043 345 218 13282
NM_019009chr11102499 2474 2325 2316 1952 1765 964 812 751 246 22233 320 41851 681 506 473 12308
NM_019015chr72138 43 ------
NM_019022chr1873188 2609 2530 2057 995 769 380 ------
NM_019027chr41663 --1776 --
NM_019035chr411945 ------
NM_019042chr7159 ------
NM_019046chr102834 353 --1359 --
NM_019048chr2167 ------
NM_019059chr72515 385 ------
NM_019063chr222281 1904 ------
NM_019064chr172785 703 173 4778 601 570 565 --
NM_019066chr15--1140 ----
NM_019072chr523529 1601 1452 11576 --
NM_019074chr151685 1158 128 1270
NM_019084chr101219 1397 ----
NM_019091chr221008 99 ------
NM_019096chr65860 764 356 275 267 1125 --2139 74
NM_019102chr72403 108 ------
NM_019102chr72403 108 ------
NM_019106chr2283204 2503 2143 792 720 701 271 104 22421 662 12197 --
NM_019114chr952420 2271 2242 2055 1648 12211 11860 --
NM_019116chr1673215 2877 2853 2778 2328 1344 785 23518 317 33338 3101 2311 --
NM_019555chr351610 1501 1238 275 209 ------
NM_019556chrX11244 --1438 --
NM_019593chr2022688 804 22716 2314 42734 2113 2065 2051 22152 2072
NM_019595chr22547 142 ------
NM_019605chr14624 608 563 298 ------
NM_019610chr131543 387 127 ------
NM_019613chr173536 473 36 1870 ----
NM_019843chr22----161 --
NM_019845chr25747 616 595 98 40 ------
NM_019849chr191167 ----1184
NM_019854chr12156 --2198 121 1164
NM_019885chr292327 2234 1108 716 445 427 266 125 116 22495 1053 42568 1001 702 636 --
NM_019895chr3----1966 --
NM_019903chr101362 --1233 --
NM_020039chr1241658 1608 1252 83 1317 41301 1277 1200 168 --
NM_020063chr12185 101 --278 46 --
NM_020066chr11863 ------
NM_020121chr13255 48 --177 --
NM_020122chr2155548 5431 5272 4338 4260 4204 1443 671 651 638 631 617 573 526 225 36018 4863 1425 ----
NM_020123chr1031211 1064 594 ------
NM_020130chr82268 208 ------
NM_020131chr1277 22 --31623 604 279 --
NM_020132chr21134894 4830 4640 4214 3718 3562 3518 3471 3341 1897 1687 1225 1027 24374 166 53672 3659 640 590 585 --
NM_020134chr251197 1142 320 225 209 11077 41066 1056 1028 361 --
NM_020137chrX2348 161 ------
NM_020139chr41759 ------
NM_020142chr123591 461 174 --2511 103 1577
NM_020144chr761679 1636 1604 182 173 25 1267 ----
NM_020145chr91606 --4226 220 192 129 163
NM_020148chr1833011 1056 508 --12455 12566
NM_020151chr251483 1358 522 329 63 --2671 43 --
NM_020152chr21146 1148 1707 --
NM_020153chr111130 --292 46 1144
NM_020155chr11--1102 ----
NM_020156chr71379 ------
NM_020159chr41672 11174 ----
NM_020168chr1571106 548 396 291 172 77 64 123 21154 141 --
NM_020177chr52910 405 21071 248 --12381
NM_020182chr20113029 2918 2761 2599 2352 2271 1241 1125 818 800 132 --43364 3173 2982 2312 --
NM_020184chr231507 107 32 1504 61564 880 866 774 720 24 1158
NM_020189chr8--153 ----
NM_020193chr11134 ------
NM_020194chr22224 81 ------
NM_020198chr1711095 ------
NM_020205chr132373 1373 215 --33378 3366 724 --
NM_020211chr1571318 1241 1056 1030 405 257 131 11193 21387 618 11329
NM_020214chr153233 49 29 ------
NM_020228chr1151760 1610 882 496 262 ------
NM_020238chr1151063 894 398 357 39 ------
NM_020239chr1102227 1766 1463 1442 823 700 574 461 317 126 31974 1871 25 2843 444 1832
NM_020245chr6104859 3662 3091 2004 1669 1546 750 689 329 261 1342 24033 965 24138 3668
NM_020246chr71377 --1102 --
NM_020248chr172337 2308 2285 1906 1518 768 706 11545 42275 128 123 92 --
NM_020309chr1941081 866 247 99 --21087 85 --
NM_020310chr17142784 2232 1969 1956 1811 1118 1005 939 912 798 517 276 244 50 --42042 839 346 180 1719
NM_020336chr2063465 3050 2963 2889 1454 211 --13749 11114
NM_020337chr432993 879 120 --12357 11119
NM_020338chr10112757 2705 2356 2331 2280 1451 1362 1288 1190 699 36 43296 1037 868 692 31323 409 401 --
NM_020342chr222473 171 ------
NM_020346chr1111346 ----11560
NM_020348chr1052574 2544 2440 2434 114 22665 382 12360 --
NM_020354chr101319 ------
NM_020362chr11582 ----2849 113
NM_020381chr631944 775 640 2679 356 ----
NM_020382chr1261344 1066 1025 1000 550 387 ------
NM_020390chr342981 1165 1027 395 24216 3475 11002 --
NM_020405chr17124397 4234 4183 3404 2935 1683 1639 1113 881 705 547 334 --43439 3100 1461 857 --
NM_020416chr442413 787 736 314 1720 3800 528 163 126
NM_020418chr32577 57 --1140 --
NM_020420chrY--11345 ----
NM_020429chr742517 2166 1164 74 22660 573 42482 2474 2274 2059 --
NM_020432chr71361 ------
NM_020433chr2071570 1458 1214 539 518 293 30 11724 41473 554 420 318 --
NM_020438chr951188 958 441 206 53 ----1568
NM_020440chr192957 2923 2500 2313 2083 1001 846 536 399 1732 1634 --
NM_020443chr1116219 6163 5844 5345 4312 2388 2317 1934 1512 1444 662 45980 2524 1865 1025 --36531 6366 6030
NM_020445chr71786 1195 ----
NM_020449chrX2738 136 ----1585
NM_020455chr632098 1797 1063 --128 --
NM_020456chr1332125 1740 1713 ------
NM_020457chr162550 22 1570 2