TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1208
miRNA Sequence: UCACUGUUCAGACAGGCGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr273972 3672 3091 1313 589 391 352 1858 13849 --
NM_000104chr272972 2814 2803 925 683 664 353 12194 1893 --
NM_000264chr963034 2464 2230 2150 275 125 --33234 3155 2795 --
NM_000267chr1783350 3146 3056 2805 2116 1234 618 459 ------
NM_000332chr6106849 6611 6340 5838 5809 4902 2291 2127 873 278 --27208 492 --
NM_000337chr5136313 5962 5778 5475 5416 5383 5360 5009 4885 4730 4482 1597 1245 26525 4076 15438 --
NM_000368chr9114381 3513 3350 3162 1591 1283 1180 823 577 235 159 13006 ----
NM_000393chr232124 626 227 ----11617
NM_000461chr364616 4002 3708 3244 1828 1049 23724 974 14451 11358
NM_000555chrX137526 7427 7274 7244 7130 6383 5862 4960 2396 1385 1193 1118 750 1692 --15959
NM_000633chr18125269 4853 4247 3709 3655 3618 2063 1129 1069 271 173 50 ------
NM_000813chr585429 5253 5102 4613 4506 4168 4094 3666 ----11679
NM_000875chr15136141 5332 4845 4765 4623 4489 2580 2365 2095 1618 1089 1074 29 36208 4811 2297 26082 1793 --
NM_000891chr1792722 2290 2244 1309 1005 744 428 67 26 ------
NM_000899chr1274239 4099 1493 1215 768 518 49 1447 23293 530 --
NM_000956chr141386 --181 21002 338
NM_001001936chr103967 873 447 ----2755 318
NM_001001995chrX41897 1849 1634 1527 --11595 11772
NM_001003652chr18158687 8167 6967 6759 5954 5260 5242 2701 2684 2491 1844 920 801 639 292 16689 12577 --
NM_001003674chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_001003675chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_001003712chr1243878 2695 1426 312 13201 13016 13181
NM_001004317chr652915 1627 1510 85 71 ----11764
NM_001004419chr12114142 3629 3070 1515 1488 1439 1414 1008 841 721 478 33990 3841 2913 11679 --
NM_001005404chr1754246 4138 3121 1092 692 24450 3496 1357 13276
NM_001005473chr585279 4442 4162 2606 1865 1661 1427 1222 --1622 26245 6152
NM_001007097chr974802 4724 3419 1927 1498 1424 450 21261 545 ----
NM_001008925chr463518 3370 3193 1054 898 650 ----11019
NM_001009899chr395971 5921 5913 4886 2323 1382 793 516 410 --36230 6198 946 --
NM_001009909chr1193913 3605 3548 3269 1487 1431 1245 933 229 ------
NM_001010867chr176391 4944 4374 4154 2556 1279 311 24588 752 25553 4261 14314
NM_001011513chr483903 3743 3646 2895 2810 844 669 456 21359 748 1110 --
NM_001011666chr7104625 4301 4105 4001 2324 2108 1902 1384 1271 823 --15161 --
NM_001013620chr12118179 7370 7173 2925 2600 1752 1445 1425 1202 1050 104 16085 --12506
NM_001014797chr10126489 6411 5805 5788 5749 5153 5003 2831 2466 2197 2008 353 26574 1858 --21565 1346
NM_001015877chrX42724 912 267 259 --22500 2299 --
NM_001018067chr165249 5156 5049 4020 3989 3437 24189 3598 1330 11390
NM_001018068chr165249 5156 5049 4020 3989 3437 24189 3598 1330 11390
NM_001018069chr165249 5156 5049 4020 3989 3437 24189 3598 1330 11390
NM_001018089chr1562934 2725 2525 836 452 37 11429 23434 47 12491
NM_001024948chr173482 2964 2331 1116 1056 795 473 1355 13307 1377
NM_001025076chr1085711 5602 3867 1870 1085 539 518 470 15765 16149 --
NM_001025077chr1097069 6960 5225 4631 2443 1897 1876 1828 944 17123 17507 --
NM_001025079chr383456 3302 2719 1558 1205 932 594 272 13792 1646 13419
NM_001025107chr1--11041 --22691 2420
NM_001025107chr1--11041 --22691 2420
NM_001025266chr3104303 3767 3553 3430 1479 1195 1186 1013 196 131 --14660 11299
NM_001029883chr253120 2903 2018 1071 245 12638 22776 2329 22114 370
NM_001030007chr1643245 2877 2842 803 12905 --24023 2659
NM_001031732chr493320 3063 2720 1347 1227 468 291 244 208 ------
NM_001033087chr2092645 2099 1166 1135 850 455 403 373 296 ----12378
NM_001037132chr772250 835 735 671 577 536 133 11647 12092 11729
NM_001037133chr772250 835 735 671 577 536 133 11647 12092 11729
NM_001039547chr3107258 6758 5141 2714 2667 2573 2066 1111 353 279 67598 6534 5702 5437 2275 2152 --11146
NM_001039569chr263329 3273 3219 1277 784 507 13112 1462 11098
NM_001039590chrX83657 2993 849 803 713 468 194 180 ------
NM_001039591chrX83657 2993 849 803 713 468 194 180 ------
NM_001039618chr1195207 2279 2176 1516 823 714 614 267 210 25220 627 --1951
NM_001040108chr1483041 3023 2958 2793 2612 2050 891 295 22844 541 --13211
NM_001040284chr1695840 4745 4306 2345 2307 884 372 335 56 11025 1542 --
NM_001040441chr174989 4965 4948 4676 4463 4071 2190 45231 5108 2072 1000 25455 4428 --
NM_001040665chr754023 3809 3389 1985 693 11377 11392 13964
NM_001042355chr1684777 4688 2138 2103 1084 816 698 413 14838 1566 --
NM_001042412chr1684777 4688 2138 2103 1084 816 698 413 14838 1566 --
NM_001042413chr963216 2651 1564 1204 830 487 1405 --13399
NM_001042481chr1452671 2267 2057 1653 1039 --11667 12532
NM_001042492chr1783350 3146 3056 2805 2116 1234 618 459 ------
NM_001042555chr1243619 1372 1227 234 --23889 1909 11390
NM_001042599chr2117659 7210 6264 6087 5576 5386 2748 1826 1253 959 545 1778 15126 --
NM_001042604chr3104184 3960 3853 3692 3385 3245 1958 1905 1805 1699 --11440 --
NM_001042683chr66660 568 328 251 146 96 --11592 --
NM_001044387chr19144081 3510 3302 2998 2981 2676 2538 1487 1285 1262 1237 849 665 544 23738 3230 13821 --
NM_001044388chr19144081 3510 3302 2998 2981 2676 2538 1487 1285 1262 1237 849 665 544 23738 3230 13821 --
NM_001071775chr1361911 1596 1264 607 350 303 --2627 102 --
NM_001099678chr3136049 5708 5613 5422 4595 4349 4007 2241 1347 1270 1163 688 299 14958 24720 4313 24562 4041
NM_001100108chr1117353 6640 6061 5781 5344 3216 2905 2571 1817 1738 886 68118 6269 5675 5634 5510 3023 28272 7781 --
NM_001106chr3139726 9572 8804 7902 7753 5974 3551 2850 2603 2530 2437 2120 1024 36569 6203 3742 27381 1756 --
NM_001111chr1--11041 --22691 2420
NM_001121chr1031935 1691 1488 ----11783
NM_001128chr1643245 2877 2842 803 12905 --24023 2659
NM_001167chrX106046 6022 5629 5531 5438 5125 1906 1559 1472 136 11329 --14442
NM_001204chr276993 5458 5269 4876 2397 517 399 25048 639 11026 --
NM_001256chr1742927 2076 611 171 1902 22565 1858 2500 346
NM_001259chr7106279 5971 5170 4398 2481 1775 1759 647 632 572 --36173 5865 3975 --
NM_001304chr1763755 3552 2968 1376 542 403 --13056 13097
NM_001396chr2152630 2363 1901 911 271 12208 --12035
NM_001427chr721788 1512 --11809 1102
NM_001432chr483685 3526 2857 2787 2705 621 615 289 --136 --
NM_001609chr1083549 3256 1784 1283 1042 657 320 55 ------
NM_001777chr383456 3302 2719 1558 1205 932 594 272 13792 1646 13419
NM_001859chr963945 3582 3144 2757 519 37 33786 2509 734 13974 --
NM_001918chr1169321 8033 7811 7645 7189 6951 6796 6702 6448 6403 3251 3179 2501 1194 825 629 68655 8224 2578 1845 1581 518 17004 --
NM_001938chr121201 591 1321 1286 163
NM_002009chr151277 --12105 1714
NM_002024chrX41995 1764 1740 89 --1779 1279
NM_002025chrX87276 7005 6422 2598 1271 807 276 184 58415 7720 2724 2416 2075 17216 --
NM_002033chr1193868 3539 3182 2575 1554 1274 1146 953 792 --13658 11057
NM_002040chr2193197 3145 2191 986 576 358 259 251 225 --1603 --
NM_002092chr484578 4174 3739 806 514 477 359 159 44205 3832 3605 3341 44985 3308 668 346 1439
NM_002128chr1372507 2259 2120 2027 1591 559 129 ------
NM_002130chr531389 1192 63 ----21696 644
NM_002214chr755661 4118 1968 1263 462 --11830 13604
NM_002270chr595270 5047 4907 2234 1974 892 439 312 260 --24885 1775 --
NM_002310chr576174 4851 2389 1744 1141 1012 621 35900 841 187 14104 --
NM_002451chr973601 3565 2913 2696 1116 1069 896 42722 1554 1538 881 ----
NM_002581chr9135422 4822 4335 4235 3464 2235 2047 1466 1436 1325 923 586 242 --11140 --
NM_002595chr1281357 1257 498 463 379 293 179 127 ----11407
NM_002655chr8115264 5238 4293 3802 3433 2024 1187 962 775 698 88 25143 3410 2782 348 --
NM_002740chr362600 2461 1967 1032 538 336 2815 601 --22261 841
NM_002745chr2273164 2968 2921 2914 1719 869 312 --1711 13407
NM_002760chrY55488 4863 4478 4165 932 52068 1625 1154 1023 571 14623 --
NM_002837chr1273823 3100 1698 1560 668 558 515 23929 808 23705 1082 --
NM_003010chr1772422 2170 1698 1619 858 196 79 21575 388 12192 --
NM_003034chr1287929 7189 7159 6233 5961 2110 1930 1739 48075 6745 6298 2324 16161 11885
NM_003099chr1555566 4452 1946 436 203 34655 4543 4408 24395 2344 12059
NM_003108chr2117251 7227 6961 6749 6492 5172 4719 4536 2309 2196 1609 25785 984 17071 --
NM_003112chr773182 2947 2846 2602 564 539 500 ------
NM_003298chr3146151 5386 5336 5172 5005 4668 4563 4395 4091 4082 1587 1445 967 345 --21883 1538 --
NM_003392chr384288 3482 3114 2987 1361 1205 1155 897 162 13370 11007
NM_003468chr284160 3942 3725 3694 3468 1631 1374 978 ----1439
NM_003489chr2143399 3063 855 319 13451 --22775 2448
NM_003574chr1895026 4417 4278 3830 2190 2178 1731 1030 461 21416 98 13726 --
NM_003630chr6283 26 1750 --1550
NM_003663chr363021 2394 955 468 411 114 1690 12517 23221 1328
NM_003759chr463952 3257 2818 1615 1608 1198 --1309 --
NM_003902chr13823 785 714 1798 1117 1660
NM_003913chr663987 3376 1354 1174 240 62 --24313 2712 --
NM_003966chr5117811 7604 6987 6601 5676 4919 3013 3003 2518 2061 1827 36486 6354 819 ----
NM_003994chr1274239 4099 1493 1215 768 518 49 1447 23293 530 --
NM_004124chr1463548 3451 1146 708 378 344 ----12508
NM_004133chr84769 515 465 381 12663 --1716
NM_004171chr11119392 9154 7424 2979 2280 1990 1809 1619 1368 590 173 --28052 352 18807
NM_004229chrX62089 1657 1592 801 341 198 ----1542
NM_004337chr872099 1662 735 321 176 67 31 --156 --
NM_004338chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_004440chr621822 48 ----2223 117
NM_004457chr221572 693 133 11318 1278
NM_004586chrX125082 4678 4215 4012 3343 1491 1141 604 591 574 468 379 11706 ----
NM_004598chr583288 3074 2742 2575 2311 831 407 317 12625 --13207
NM_004685chr1352995 2163 927 125 114 ------
NM_004713chr142509 217 ----2611 320
NM_004726chrX125478 5183 4747 4239 4037 4012 2253 1883 1408 1170 800 24 --11828 --
NM_004775chr1841553 130 122 95 1909 --12345
NM_004834chr293360 3271 3086 2932 2327 1291 834 399 362 12274 22089 481 --
NM_004857chr14114747 4620 4572 4542 3517 3117 1533 643 560 432 222 13027 --14411
NM_004859chr1792680 2368 2176 2002 1133 1105 965 523 217 ------
NM_004863chr1485282 4741 4668 965 887 881 562 165 24183 1739 23793 1492 --
NM_004866chr574667 4606 3686 3337 3161 1459 176 24323 1374 ----
NM_004904chr7104625 4301 4105 4001 2324 2108 1902 1384 1271 823 --15161 --
NM_004956chr774296 4182 3637 3628 2839 1851 1403 --23391 1172 --
NM_004985chr12114540 4342 4284 4135 4008 3971 3829 3710 3197 3000 158 14548 ----
NM_004992chrX126743 6249 5468 5287 2888 2651 2328 2130 1083 877 496 377 --27346 6517 15220
NM_004992chrX126743 6249 5468 5287 2888 2651 2328 2130 1083 877 496 377 --27346 6517 15220
NM_004999chr674170 3566 3308 1742 804 634 543 11644 13340 1854
NM_005010chr772250 835 735 671 577 536 133 11647 12092 11729
NM_005121chr1742604 2345 1159 637 --22571 1052 13663
NM_005156chr9105151 5129 4039 3950 3533 1917 1864 1251 1214 671 13360 13608 --
NM_005188chr11138109 7347 5914 5845 5213 3319 2134 2014 1476 1261 1114 941 285 37813 2002 102 46235 3049 1629 1216 --
NM_005235chr2117659 7210 6264 6087 5576 5386 2748 1826 1253 959 545 1778 15126 --
NM_005436chr1073778 3550 2861 1224 1164 1088 833 --44016 1575 430 289 --
NM_005596chr9146163 6143 5125 4857 3973 2355 2253 2098 1994 1668 1380 825 757 136 --45682 5399 4452 2114 --
NM_005668chr542941 1841 711 425 --1274 11520
NM_005669chr562224 2045 1580 721 208 201 --22152 1633 --
NM_005739chr1572101 2040 1993 1853 1625 790 105 141 ----
NM_005759chr294677 4514 3333 3068 1906 1533 1006 981 36 --13182 --
NM_005795chr262916 2641 2363 2312 2168 2156 --1777 --
NM_005813chr282580 1806 1726 1663 1653 1056 978 91 ----1618
NM_005840chrX87179 6104 5761 5487 5089 1772 940 130 16737 27250 809 21669 1371
NM_005843chr291898 1663 1620 1501 1265 1229 769 409 308 ----1715
NM_005901chr18158687 8167 6967 6759 5954 5260 5242 2701 2684 2491 1844 920 801 639 292 16689 12577 --
NM_005935chr484484 3790 1972 1729 1436 1296 352 65 14449 2576 158 14993
NM_005941chr863771 2777 1593 1102 962 938 --23830 3265 33407 3370 1426
NM_006011chr1524309 3751 13818 21547 1420 1131
NM_006095chr454434 4070 3351 1338 1124 --22890 2797 --
NM_006106chr1173057 2575 2554 1323 1153 823 403 --1962 --
NM_006252chr1147067 6201 5911 5902 5478 4680 4659 2656 1817 1692 1300 875 846 539 11809 --1837
NM_006300chr1942368 1554 361 228 --41944 1592 634 561 --
NM_006371chr345266 3210 949 471 --24518 1688 24631 4368
NM_006380chr1764415 4147 3654 1141 1034 926 13176 24196 3156 --
NM_006457chr483903 3743 3646 2895 2810 844 669 456 21359 748 1110 --
NM_006504chr1031045 962 368 ----22511 413
NM_006534chr2052660 2098 945 679 663 --12904 1773
NM_006544chr1485928 5906 4858 4610 4181 1735 1238 881 25464 1949 --14667
NM_006561chr1085711 5602 3867 1870 1085 539 518 470 15765 16149 --
NM_006599chr1656739 6515 5093 1465 1096 25855 1167 27305 1053 22142 223
NM_006620chr633699 702 284 53811 3750 1791 1662 37 13945 --
NM_006628chr15113933 3535 3488 3333 3050 2900 2838 1475 541 234 123 --1181 --
NM_006654chr1243619 1372 1227 234 --23889 1909 11390
NM_006699chr141816 1710 502 406 --12051 11056
NM_006750chr1667020 6502 6289 2014 955 103 45958 2365 1760 1226 23035 1164 --
NM_006922chr272266 2167 1006 922 826 639 462 1145 ----
NM_007005chr941467 1448 1253 176 ----1249
NM_007006chr1673105 2918 2907 2328 173 146 63 ------
NM_007137chrX114753 4478 4258 3389 3370 1967 1721 1710 1379 1229 476 13925 24429 968 11296
NM_007207chr12847 319 --1738 1635
NM_007249chr13179071 8977 8700 8001 7604 7365 7303 7182 6564 3547 3427 2978 2955 2931 1219 822 83 --27596 1993 --
NM_012164chr9117576 7255 6858 6203 5685 5626 4739 2788 1632 1046 120 --37185 5153 1584 1740
NM_012214chr225939 5260 31481 1357 664 34822 4724 3877 --
NM_012234chr393771 3510 3274 3256 2868 1086 1015 592 575 --12566 --
NM_012252chr765051 4772 1932 935 370 172 11322 15137 --
NM_012262chr195044 4588 4116 3455 1174 645 451 136 89 --34476 4238 4167 --
NM_012281chr751914 1776 1561 946 185 --11789 1503
NM_012290chr251604 1588 1103 443 160 1511 --1229
NM_012309chr11104849 4842 4408 4188 1977 1696 1214 1120 862 654 1516 --13467
NM_012382chr574454 4174 3684 3350 2782 1659 162 13533 --1314
NM_012420chr1051826 1537 1421 492 117 ----1697
NM_012425chr1052196 2139 1940 518 269 12287 --11024
NM_012465chr1022584 678 32570 2146 551 195 21208 558
NM_012479chr742700 2550 1069 567 32613 2440 1676 21958 472 12401
NM_013255chr7137393 7357 6073 6064 5796 2858 1976 1737 1589 777 595 534 80 193 13147 11598
NM_013269chr12114069 3556 2997 1442 1415 1366 1341 935 768 648 405 33917 3768 2840 11606 --
NM_013374chr372592 2432 1222 732 599 483 121 ----11164
NM_013381chr1252250 2244 1558 790 667 1297 1889 11574
NM_013943chr163111 2595 2427 929 371 178 12095 --12006
NM_014011chr262598 1673 877 522 245 56 --2360 84 --
NM_014028chr653091 2527 2087 974 643 12174 --11027
NM_014043chr341123 196 127 60 ----11497
NM_014048chr1695246 4802 4618 4433 4114 3501 1760 1246 507 1325 23260 1694 --
NM_014112chr895407 5351 4432 4409 2082 1718 1557 1080 383 13559 15049 --
NM_014155chr1197265 6034 5252 5090 4860 4739 1637 1301 918 12072 1207 24566 1914
NM_014253chrX71821 1714 1683 902 408 352 257 ----12349
NM_014381chr1483041 3023 2958 2793 2612 2050 891 295 22844 541 --13211
NM_014423chr564837 4270 3821 2012 1645 108 32142 1785 732 ----
NM_014630chr1543588 3570 3220 565 13031 --13687
NM_014683chr1711470 11820 1366 22064 133
NM_014732chr1665118 5056 4120 1511 959 431 35692 4837 3677 45804 4043 909 719 --
NM_014739chr653476 1416 1239 1012 163 24190 3925 1661 --
NM_014755chr284296 4260 2966 2809 946 817 288 62 24063 1346 23426 2868 --
NM_014923chr1352306 1930 1865 1548 646 --186 21729 339
NM_014936chr662543 2210 1933 1814 1747 1128 --22873 69 --
NM_014946chr242924 2802 653 409 ----1349
NM_014953chr1394202 4028 3749 3638 3554 1627 1344 1238 147 21039 245 13065 --
NM_014982chr1455408 1604 1182 818 464 1486 --11735
NM_014991chr443264 2042 265 84 --22113 713 11157
NM_015026chr1233496 3388 759 11175 54149 4016 3421 534 200 --
NM_015032chr1392661 2179 1974 1026 866 640 396 334 124 11077 1987 11854
NM_015039chr1104341 3825 3806 1675 1541 1319 999 846 760 132 14307 11351 --
NM_015040chr253159 3122 2841 2314 2271 22916 1294 1342 12799
NM_015045chr1092209 2115 1980 1868 1414 786 730 610 180 ------
NM_015092chr1664289 4029 1863 1522 957 495 31737 1611 1355 14496 11248
NM_015156chr1463553 2972 2675 2655 2451 989 --23281 3128 12846
NM_015247chr1684777 4688 2138 2103 1084 816 698 413 14838 1566 --
NM_015310chr8138129 8040 7911 6800 6174 5834 5626 3271 2895 2566 1491 792 506 16337 36906 3115 111 28365 5592
NM_015336chr1252373 2277 2037 1022 822 ----21655 896
NM_015375chr164755 3410 1744 582 409 354 2914 165 23698 363 --
NM_015436chr473337 3189 3012 1351 873 717 469 ----1838
NM_015455chr563366 2625 2496 1452 1324 1181 ----1785
NM_015458chr875281 4479 4364 3613 3604 530 347 34127 4003 2014 --11159
NM_015535chr284023 3708 3299 3200 2910 2704 901 21 ----1317
NM_015553chr675177 4323 4088 1686 1675 826 568 23326 262 11967 1469
NM_015569chr163932 3388 1248 1228 423 367 --11820 1666
NM_015640chr165249 5156 5049 4020 3989 3437 24189 3598 1330 11390
NM_015840chr1--11041 --22691 2420
NM_015841chr1--11041 --22691 2420
NM_015906chr131626 922 111 14367 --1986
NM_016072chr1252025 1842 1649 1540 822 --1919 1169
NM_016107chr55986 960 472 220 154 11292 --21209 1094
NM_016206chr398011 7965 7440 5984 2109 1623 1464 1182 1167 12713 18276 --
NM_016248chr1333822 3699 2741 11613 23908 324 187
NM_016260chr2167294 7232 6969 6694 6151 6005 5836 4874 4692 2790 2446 1797 1004 768 260 152 35281 2958 2113 ----
NM_016322chr993212 2819 1984 1240 1150 868 742 138 57 11209 ----
NM_016621chr1141148 1099 584 568 13302 22832 225 23357 1375
NM_016824chr1031935 1691 1488 ----11783
NM_017563chr365702 5520 5289 4323 2288 2114 35915 4737 1571 1951 --
NM_017628chr4105174 5063 4996 4867 4184 4074 1931 1659 1599 1077 11243 --24810 893
NM_017637chr9149167 8648 7553 7151 6732 6646 6392 3465 3150 2712 1900 1456 736 327 --26079 5850 13512
NM_017650chr755973 4024 3774 1459 1184 1528 25852 1616 14710
NM_017658chr1444384 3451 1326 24 --1825 11134
NM_017709chr162867 2748 424 207 169 27 --11368 21643 1086
NM_017719chr332285 2206 595 21770 528 21983 1856 147
NM_017831chr1874354 3532 1762 1715 1611 1543 143 33762 3622 762 14710 --
NM_017902chr10135740 5526 5276 4540 4034 3542 1801 1692 1524 1355 1036 1030 532 24085 1878 23921 3491 --
NM_017958chr252508 2120 982 353 100 2970 846 1942 11186
NM_018085chr187948 7057 6109 5981 5755 5660 2230 887 56323 5926 1394 1269 134 ----
NM_018155chr382618 2337 2211 1002 958 658 97 51 12716 --13327
NM_018227chr4113169 3055 2488 2397 2383 2316 1198 1153 1120 680 197 --1428 --
NM_018293chr362728 2292 1109 660 551 36 11874 22944 741 --
NM_018364chr164019 3978 3083 1286 861 668 32598 1582 438 23794 214 --
NM_018367chr1142042 1848 303 277 ----12427
NM_018429chr582891 2058 1770 733 584 516 340 72 ------
NM_018566chr174952 4761 4705 4084 3668 498 197 ------
NM_018638chr12105714 5242 4280 4193 3724 2172 1952 1352 1188 868 15471 11663 --
NM_018841chr133617 2486 736 11109 13105 12657
NM_018945chr653448 3141 2920 2300 1145 ----13304
NM_018970chr772576 2521 1012 789 570 146 106 23036 2463 12826 12066
NM_019001chr3104184 3960 3853 3692 3385 3245 1958 1905 1805 1699 --11440 --
NM_019903chr1031935 1691 1488 ----11783
NM_020122chr2105122 4647 4184 4065 3997 3900 3852 3756 2092 577 34961 4918 3713 25830 209 15466
NM_020336chr2073591 3459 2922 2465 1436 1214 60 23535 2619 13334 1757
NM_020342chr262414 2124 1753 901 880 611 --12588 --
NM_020390chr394930 4798 4625 3772 3451 3430 972 877 696 --13736 11943
NM_020466chr663816 3272 3225 570 206 146 24782 521 --14883
NM_020699chr151545 1309 1132 674 83 ----25341 254
NM_020718chr1676071 4972 4768 2276 1934 1819 872 26321 4924 26044 4649 12529
NM_020772chr1768435 8081 6699 5950 5909 709 --16120 --
NM_020774chr18155804 5302 4705 4431 4268 4100 2339 2016 1669 1422 1382 1101 1021 767 477 24186 388 35322 2506 715 --
NM_020802chr1132135 934 324 42994 2481 1234 896 --3180 162 144
NM_020830chr272405 2066 1321 1237 350 208 97 12907 ----
NM_020841chr1243878 2695 1426 312 13201 13016 13181
NM_020844chr8137300 7199 6557 4960 4883 3081 2975 2652 2264 1321 543 370 309 1884 1426 --
NM_020918chr1063011 1325 1190 904 678 492 ----12304
NM_021033chr1353502 3307 3168 2286 935 12794 --1140
NM_021045chr1052577 2275 1616 699 304 22302 616 32374 1950 847 --
NM_021090chr2284711 4621 4457 4446 1819 1511 1108 25 13288 --11168
NM_021116chr7108039 7989 6566 6247 6151 2465 1153 1107 644 69 46916 6466 3202 1738 33538 1230 926 1194
NM_021629chr375070 3474 3180 1253 1220 1000 936 25047 1938 --14090
NM_021813chr685438 4804 4613 3865 3624 2199 1938 1909 15228 14541 1232
NM_021911chr585429 5253 5102 4613 4506 4168 4094 3666 ----11679
NM_021954chr1363425 2499 895 713 616 199 --33656 2371 848 --
NM_021964chr396100 5419 4932 2513 2376 2174 1875 1126 697 15705 11391 --
NM_022048chr1574857 4806 4751 2436 2412 1872 1460 21292 288 15778 14831
NM_022459chr1386358 6027 5686 5143 1864 1585 392 309 44497 3926 1410 149 ----
NM_022473chr1584101 3570 3430 2942 1082 726 527 500 2656 256 22868 605 --
NM_024341chr19144081 3510 3302 2998 2981 2676 2538 1487 1285 1262 1237 849 665 544 23738 3230 13821 --
NM_024611chr1562934 2725 2525 836 452 37 11429 23434 47 12491
NM_024665chr374082 3708 1599 823 455 412 143 ----11265
NM_024749chr141738 443 384 328 ----11836
NM_024761chr951869 1571 1214 890 631 25156 3691 21985 1156 24402 131
NM_024770chr286484 6181 6001 5720 5056 4440 2176 1469 46318 2137 1147 866 26612 5418 15016
NM_024947chr3139154 8029 7831 7601 7354 6834 3535 3166 2845 2741 2043 1211 31 17272 21422 661 --
NM_024989chr2107816 6545 6368 6324 2636 2231 1495 1041 784 281 --11085 15279
NM_025160chr163833 3384 3262 3215 752 390 --1827 --
NM_030627chr594086 3435 1594 1442 1415 1183 702 430 106 13256 ----
NM_030647chr7126036 5764 5583 4373 4264 4095 3992 2050 1777 505 469 91 14352 ----
NM_030648chr4103965 3799 3706 3582 2170 2091 1862 1749 972 365 11504 1634 13552
NM_030650chr293715 1478 1437 1225 885 634 623 560 553 14230 --11023
NM_030806chr1159258 9101 7874 7690 7116 6122 6105 3170 2162 2083 1912 1410 1179 490 149 16950 39279 8641 2887 --
NM_031435chr1263430 3268 2141 1276 1223 896 11132 1883 --
NM_031438chr541949 1936 1305 571 --1557 21516 631
NM_032012chr995019 4607 4117 3642 1575 1001 916 734 431 24888 1652 ----
NM_032373chr1064815 4806 3900 3680 2163 1009 24829 4113 21944 77 --
NM_032446chr573181 3048 2819 1325 813 662 315 13022 ----
NM_032458chrX43054 1242 597 589 --22830 2629 --
NM_032505chr382661 2351 2106 2077 1100 916 270 78 ------
NM_032547chr431348 943 486 ----11032
NM_032550chr103967 873 447 ----2755 318
NM_032826chr7125092 4387 4095 2087 1289 1093 754 720 588 383 213 100 1968 23799 1827 13566
NM_032869chr831446 391 66 ----21604 1540
NM_032873chr1134042 3028 1104 14076 166 13556
NM_032968chrX94135 4122 3904 3879 3270 2754 1333 779 156 ------
NM_032969chrX94135 4122 3904 3879 3270 2754 1333 779 156 ------
NM_032973chrY94127 4114 3896 3871 3265 2749 1333 779 156 ------
NM_033020chr131626 922 111 14367 --1986
NM_033030chr241397 1295 604 462 ----1311
NM_033224chr7117049 5992 3212 2864 2719 2234 2091 808 770 381 190 25297 2431 21311 1076 1168
NM_033285chr863762 3639 3080 2755 1343 253 173 12723 11183
NM_033290chrX103570 3403 3344 2506 2403 1367 907 867 759 37 --23395 2830 --
NM_033360chr12114661 4463 4405 4256 4129 4092 3950 3831 3318 3121 279 14669 ----
NM_033429chr1573214 2296 1994 1248 972 556 101 1605 12531 --
NM_033430chr443795 2917 1069 85 1462 21033 514 23338 3026
NM_033437chr443795 2917 1069 85 1462 21033 514 23338 3026
NM_033505chr296410 5978 4717 4192 1410 786 495 414 373 35235 2454 1657 ----
NM_033540chr33399 244 61 ----1766
NM_033656chr21105968 5470 5192 4337 3984 3844 2163 2064 1210 240 ------
NM_052879chr1263778 3249 1522 1278 1208 962 12766 13462 12966
NM_052907chr1244069 1113 382 234 23105 790 21602 1239 22707 62
NM_053016chr9106642 6066 5489 5468 5317 2768 2138 1414 1324 956 1938 --16510
NM_057175chr462231 1769 1710 1007 925 690 --1129 --
NM_080676chr2092645 2099 1166 1135 850 455 403 373 296 ----12378
NM_130435chr1031045 962 368 ----22511 413
NM_130436chr2152630 2363 1901 911 271 12208 --12035
NM_130438chr2163207 2940 2478 2164 848 100 12785 --12612
NM_133370chr493320 3063 2720 1347 1227 468 291 244 208 ------
NM_133646chr2135613 5510 5198 4770 3795 3752 3728 2161 1819 1678 1510 1149 82 44590 4009 1694 621 1832 13466
NM_138426chr762425 2118 483 474 187 171 12194 ----
NM_138444chr1394663 4167 3932 3662 3405 1943 913 802 660 23527 890 13093 --
NM_138459chr633371 3332 1397 --22895 2547 22999 280
NM_138468chr2116215 6046 5573 4656 4380 4287 4244 1825 891 455 103 55145 4948 3942 2408 1580 ----
NM_138713chr1656739 6515 5093 1465 1096 25855 1167 27305 1053 22142 223
NM_138714chr1656739 6515 5093 1465 1096 25855 1167 27305 1053 22142 223
NM_138782chr52316 172 22222 868 --11828
NM_144571chr466824 6687 5017 4742 2365 1039 22796 1276 1308 --
NM_144578chr1475404 4626 3591 2010 1185 1029 270 --11312 --
NM_144599chr15104707 4105 3571 2196 1814 1644 1217 1005 573 205 1426 14650 24279 3980
NM_144664chr1172113 1940 948 504 393 256 246 12488 ----
NM_144728chr12847 319 --1738 1635
NM_144729chr12847 319 --1738 1635
NM_144949chr262598 1673 877 522 245 56 --2360 84 --
NM_144963chr852625 2228 302 99 66 11791 --11890
NM_145013chr1152934 913 622 189 163 12902 1151 --
NM_145176chr672993 2947 2581 902 670 473 31 ----12333
NM_145259chr286166 5561 5217 2080 1555 1527 617 110 11217 26864 789 --
NM_145307chr1094586 3971 3610 3439 3159 2984 2916 1171 1135 31024 287 100 1211 1972
NM_145686chr293360 3271 3086 2932 2327 1291 834 399 362 12274 22089 481 --
NM_145687chr293360 3271 3086 2932 2327 1291 834 399 362 12274 22089 481 --
NM_148955chr1555566 4452 1946 436 203 34655 4543 4408 24395 2344 12059
NM_152330chr1452671 2267 2057 1653 1039 --11667 12532
NM_152409chr573620 3070 2973 2810 2276 969 771 11119 12628 1648
NM_152624chr5157289 5855 5813 5586 5533 4693 4612 2836 2584 2311 1325 1148 1078 940 373 1360 11571 25382 2776
NM_152629chr963216 2651 1564 1204 830 487 1405 --13399
NM_152699chr383534 3463 3331 3300 3107 1489 627 422 22737 281 13475 13138
NM_152724chr1052196 2139 1940 518 269 12287 --11024
NM_152756chr552853 1098 1048 326 146 23538 2920 23579 3082 --
NM_152826chr1555566 4452 1946 436 203 34655 4543 4408 24395 2344 12059
NM_152835chr142690 2395 2042 1106 ----153
NM_152999chr754023 3809 3389 1985 693 11377 11392 13964
NM_153050chr2284711 4621 4457 4446 1819 1511 1108 25 13288 --11168
NM_153051chr2284711 4621 4457 4446 1819 1511 1108 25 13288 --11168
NM_153184chr351714 1658 1502 555 248 ----11382
NM_153188chr595270 5047 4907 2234 1974 892 439 312 260 --24885 1775 --
NM_153207chr1283639 3551 3263 3241 2609 1528 764 439 31512 1463 1398 13392 1603
NM_153262chr162752 2326 1967 1104 242 21 --11291 --
NM_153619chr1543325 2397 2271 689 --12416 12768
NM_170665chr1274437 3670 3269 3248 1272 306 269 --11255 12812
NM_170706chr1104341 3825 3806 1675 1541 1319 999 846 760 132 14307 11351 --
NM_172071chr1137147 5290 4937 4824 4752 4583 2728 2442 2248 2151 1113 519 220 --1892 --
NM_173214chr1656739 6515 5093 1465 1096 25855 1167 27305 1053 22142 223
NM_173468chr486095 5788 4698 3920 2236 1743 1580 1293 --25597 43 22031 1654
NM_173470chrX82534 1864 1112 1036 753 743 472 174 1622 ----
NM_173510chr2261831 1813 482 438 397 209 ----22853 1150
NM_173536chr484965 4880 4743 4273 1960 1265 1033 122 ------
NM_173582chr11106182 6152 5654 5482 4541 2444 1246 991 564 316 11458 2740 662 --
NM_173642chr1158588 8434 8375 8224 8130 6849 6638 5652 3518 3203 2672 1851 1608 1174 308 36798 2907 2804 27522 3013 --
NM_173667chr542356 1671 743 647 --12403 1370
NM_173808chr183841 2791 1686 1621 1517 1111 845 201 1357 1105 --
NM_173829chr585960 4499 2394 2386 2011 1910 1858 354 44699 1433 816 484 --15116
NM_174911chr863882 2895 2860 1374 1265 622 ----32748 2597 1053
NM_175624chr1296722 6712 6251 5789 5558 2548 1651 747 439 13043 11424 --
NM_175625chr1296722 6712 6251 5789 5558 2548 1651 747 439 13043 11424 --
NM_175736chr1297779 7352 7084 6900 6792 6485 6146 2384 1845 26926 1565 16015 --
NM_175767chr571717 1599 1367 1223 414 132 93 ----11161
NM_175861chr1295472 4869 3737 1833 1785 1528 1355 1341 829 25645 4594 --12075
NM_177538chr278351 7348 7248 5843 5720 3265 1211 97973 6914 6732 5571 2311 2072 1738 1427 1022 ----
NM_178151chrX137526 7427 7274 7244 7130 6383 5862 4960 2396 1385 1193 1118 750 1692 --15959
NM_178152chrX137526 7427 7274 7244 7130 6383 5862 4960 2396 1385 1193 1118 750 1692 --15959
NM_178153chrX137526 7427 7274 7244 7130 6383 5862 4960 2396 1385 1193 1118 750 1692 --15959
NM_178566chr93382 319 79 1275 --21246 151
NM_178585chr443264 2042 265 84 --22113 713 11157
NM_181481chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_181482chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_181483chr18146800 6072 5670 5249 4585 4484 2701 2374 2187 2147 1468 1384 962 77 --41480 984 802 215 15502
NM_181659chr2052660 2098 945 679 663 --12904 1773
NM_181659chr2052660 2098 945 679 663 --12904 1773
NM_182485chr463689 3221 3144 3039 1458 329 11068 12977 1416
NM_182515chr1976075 5315 5081 4995 2609 2284 1768 44767 1100 1016 65 ----
NM_182646chr463689 3221 3144 3039 1458 329 11068 12977 1416
NM_182765chr1062052 1798 1472 591 532 447 1318 ----
NM_182898chr7104625 4301 4105 4001 2324 2108 1902 1384 1271 823 --15161 --
NM_182899chr7104625 4301 4105 4001 2324 2108 1902 1384 1271 823 --15161 --
NM_194071chr765495 5244 5124 4915 4055 732 23381 161 25288 297 15221
NM_194247chr274232 4005 3954 3752 3147 2762 82 23344 3236 23533 1793 --
NM_194314chr185374 4610 3868 3854 1388 1183 874 122 ----11512
NM_194434chr1895026 4417 4278 3830 2190 2178 1731 1030 461 21416 98 13726 --
NM_197970chr241397 1295 604 462 ----1311
NM_198270chrX93434 3200 3141 2384 1345 1055 1016 966 905 ------
NM_198465chrX82817 2646 2360 1957 1949 287 278 145 --1880 --
NM_198485chr352238 1986 1964 1813 1703 ----12309
NM_198581chr2106021 5851 5192 5161 2563 1254 1076 975 512 391 --21898 1360 --
NM_198793chr383452 3298 2715 1554 1201 928 590 268 13788 1642 13415
NM_198900chr1297779 7352 7084 6900 6792 6485 6146 2384 1845 26926 1565 16015 --
NM_199072chr763039 2630 2560 806 429 412 1643 11211 --
NM_199188chr1263778 3249 1522 1278 1208 962 12766 13462 12966
NM_199190chr1263778 3249 1522 1278 1208 962 12766 13462 12966
NM_199436chr242924 2802 653 409 ----1349
NM_199462chr164755 3410 1744 582 409 354 2914 165 23698 363 --
NM_203372chr221572 693 133 11318 1278
NM_203458chr143633 2518 2442 1490 --42937 2397 413 62 --
NM_203463chr283977 3642 3518 1633 999 573 482 225 1333 21321 137 --
NM_206854chr695255 5208 4987 4743 4346 3770 1359 1276 994 --11127 13323
NM_206855chr6106220 6173 5952 5708 5311 4735 2324 2241 1959 787 --12092 14288
NM_206909chr8138129 8040 7911 6800 6174 5834 5626 3271 2895 2566 1491 792 506 16337 36906 3115 111 28365 5592