TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-122-3p
miRNA Sequence: AACGCCAUUAUCACACUAAAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51822 ------
NM_000044chrX----1272 --
NM_000052chrX----13005 --
NM_000061chrX----1378 --
NM_000081chr1----11280 --
NM_000084chrX34516 938 100 ----25103 4508
NM_000089chr71524 1577 ----
NM_000090chr22686 246 ------
NM_000093chr9--12258 ----
NM_000114chr20------2894 230
NM_000176chr522743 222 1400 ----
NM_000192chr121398 ------
NM_000210chr222238 445 --11965 --
NM_000214chr201326 ------
NM_000216chrX11385 --1275 --
NM_000245chr721921 574 11452 1480 --
NM_000255chr62283 152 ------
NM_000259chr1535754 4180 1142 ------
NM_000264chr932060 1051 963 11297 --12133
NM_000267chr171218 ----11071
NM_000276chrX1222 11844 ----
NM_000280chr11--1253 ----
NM_000304chr1711031 ------
NM_000314chr10------12357
NM_000337chr554383 2404 1908 1861 440 14167 ----
NM_000345chr411033 ------
NM_000368chr964402 3764 1352 781 741 262 ------
NM_000378chr111268 ------
NM_000379chr231482 1463 223 --1343 --
NM_000380chr92460 394 ------
NM_000386chr171776 ------
NM_000396chr1284 49 ------
NM_000399chr101251 ------
NM_000408chr213094 1152 ----
NM_000411chr2142362 604 555 169 ------
NM_000430chr1732915 881 167 --12927 --
NM_000484chr21----11087 --
NM_000489chrX22731 836 ------
NM_000495chrX1110 ------
NM_000533chrX21344 616 1449 ----
NM_000572chr12755 710 ------
NM_000582chr42449 406 ------
NM_000617chr1222248 1423 ------
NM_000633chr1833853 1599 1280 ------
NM_000641chr1921235 1118 ------
NM_000673chr4136 ------
NM_000693chr1511758 ------
NM_000801chr201375 ------
NM_000811chr51571 ------
NM_000813chr52677 234 --1488 --
NM_000817chr211017 ------
NM_000818chr101376 ------
NM_000826chr41797 ------
NM_000833chr162981 321 --1429 --
NM_000857chr4--1464 ----
NM_000868chrX----11933 --
NM_000872chr101138 ------
NM_000875chr1566562 5178 4980 4512 4273 2000 ------
NM_000876chr631289 1205 494 --11146 --
NM_000919chr51554 ------
NM_000921chr12----1437 --
NM_000933chr201302 ------
NM_000944chr422287 204 --12305 --
NM_000983chr1162 ------
NM_001001323chr1222071 1014 --13101 --
NM_001001342chr1021256 578 ------
NM_001001396chr134191 2921 179 ------
NM_001001436chr161742 ------
NM_001001552chr1136 ------
NM_001001706chr61196 --11060 --
NM_001001787chr11403 ------
NM_001001870chr172774 566 ------
NM_001001938chr943151 783 760 364 --12644 --
NM_001001974chr1012046 ------
NM_001002009chr72523 142 ------
NM_001002010chr72523 142 ------
NM_001002243chr21294 ------
NM_001002259chr12----135 --
NM_001002295chr101167 ------
NM_001002814chr821155 1110 12685 13752 --
NM_001002838chrX1641 1565 ----
NM_001002860chr1441349 1293 1207 924 ------
NM_001003652chr1828026 7793 --12480 --
NM_001003674chr1824942 1247 ----26944 6169
NM_001003675chr1824942 1247 ----26944 6169
NM_001003679chr11142 ------
NM_001003683chr2130 ------
NM_001003688chr41343 ------
NM_001003698chr63755 563 361 ------
NM_001003699chr63755 563 361 ------
NM_001003712chr121709 ------
NM_001004051chrX166 ------
NM_001004065chr933710 894 359 --1510 --
NM_001004317chr623196 1310 22980 1568 24235 4088 --
NM_001004419chr1253644 2959 1698 495 252 ------
NM_001005209chr21641 ------
NM_001005366chr122868 166 ------
NM_001005386chr242032 895 469 139 ------
NM_001005463chr10------11788
NM_001005473chr514946 16538 14647 14253
NM_001005476chr2--1455 ----
NM_001005609chrX22822 100 ------
NM_001005612chrX1305 ------
NM_001005732chr21183 ------
NM_001005733chr21183 ------
NM_001005782chr221020 74 ------
NM_001005861chr31768 ------
NM_001006600chr51866 ------
NM_001006634chr161550 ------
NM_001006684chrX1385 ------
NM_001006935chrX1158 ------
NM_001006936chrX1158 ------
NM_001006937chrX1158 ------
NM_001007156chr1531511 1412 1326 ------
NM_001007466chr644888 3777 1671 106 --24311 2031 --
NM_001007565chr31134 ------
NM_001008225chr71478 ------
NM_001008405chr721824 21 ------
NM_001008539chr885103 4508 4021 3685 3546 1694 308 162 15392 1513 --
NM_001008701chr1912089 ------
NM_001008738chr511860 ------
NM_001009552chr8--1586 ----
NM_001009899chr321385 1144 ----1211
NM_001009993chr244079 3436 3063 1217 ------
NM_001010862chrX23266 276 ------
NM_001010867chr196502 5988 4464 2693 2563 1648 1237 410 259 12425 ----
NM_001010891chr526865 6203 16197 ----
NM_001010898chr142709 941 723 395 --12360 --
NM_001010924chr101235 ------
NM_001010971chr1------1847
NM_001011537chr322312 643 ------
NM_001011645chrX----1272 --
NM_001011666chr721816 457 ------
NM_001011722chr11377 ----1409
NM_001011722chr11377 ----1409
NM_001012393chr1154881 4581 3795 1565 235 ------
NM_001012420chr1512918 ------
NM_001012423chr1522918 2757 ------
NM_001012755chrX33448 3338 709 13536 11241 --
NM_001012968chrX------1299
NM_001012977chrX2563 460 ------
NM_001013031chr1033362 2616 1207 ------
NM_001013399chr61844 ------
NM_001013438chr3----1147 --
NM_001014380chr1343637 1977 1313 174 ------
NM_001014434chr11141 ------
NM_001014794chr11----1204 --
NM_001014795chr11----1204 --
NM_001015877chrX22060 1043 ------
NM_001015887chr311163 ------
NM_001017424chr111886 ------
NM_001017425chr111886 ------
NM_001017523chr1211887 ------
NM_001018054chr111198 ----165
NM_001018072chr1211887 ------
NM_001018074chr522743 222 1400 ----
NM_001018075chr522743 222 1400 ----
NM_001018076chr522743 222 1400 ----
NM_001018077chr522743 222 1400 ----
NM_001020658chr1--1245 ----
NM_001020658chr1--1245 ----
NM_001020825chr51218 ------
NM_001023567chr1522310 2149 ------
NM_001024094chr522743 222 1400 ----
NM_001024226chr121070 74 ------
NM_001024227chr121070 74 ------
NM_001024228chr121070 74 ------
NM_001024455chrX32336 961 506 ------
NM_001024460chr61191 ------
NM_001024680chr211655 ------
NM_001024688chr832103 1611 777 ------
NM_001024736chr1521343 1193 ------
NM_001024808chr1212777 ------
NM_001024948chr142689 1161 1090 204 --12629 --
NM_001025068chr321257 331 ------
NM_001025069chr321257 331 ------
NM_001025079chr3--13184 ----
NM_001025105chr5--1126 1235 --
NM_001025366chr61463 ------
NM_001025366chr61463 ------
NM_001025367chr61463 ------
NM_001025367chr61463 ------
NM_001025368chr61463 ------
NM_001025368chr61463 ------
NM_001025369chr61479 ------
NM_001025369chr61479 ------
NM_001025370chr61463 ------
NM_001025370chr61463 ------
NM_001025580chrX33986 620 126 --12677 --
NM_001025595chr4----1488 --
NM_001029863chr623245 2182 1379 ----
NM_001029875chr511003 --1839 1761
NM_001029882chr12523 507 ------
NM_001029882chr12523 507 ------
NM_001030007chr162726 349 --11204 --
NM_001030055chr1412977 ------
NM_001030272chr11----1347 --
NM_001030273chr11----1347 --
NM_001031684chr21526 ------
NM_001031690chr71238 ----11238
NM_001031695chr2213695 ------
NM_001031710chr7193 ------
NM_001033045chr23496 446 356 ----2670 342
NM_001033057chr311792 ------
NM_001033059chr622015 662 ------
NM_001033081chr131772 413 97 ------
NM_001033082chr131772 413 97 ------
NM_001033507chr111445 --1703 1148
NM_001033521chr201175 ------
NM_001033522chr201175 ------
NM_001033551chr1773170 2916 1539 1204 734 566 31 ----11422
NM_001033723chr822414 2002 ------
NM_001033756chr61397 ------
NM_001033756chr61397 ------
NM_001033925chr10----1728 --
NM_001034850chr511586 ------
NM_001035003chr4--11311 ----
NM_001035004chr4--11311 ----
NM_001037132chr7------12192
NM_001037133chr7------12192
NM_001037164chr71678 ------
NM_001037172chr311299 ------
NM_001037290chr111659 ------
NM_001037332chr522436 756 ------
NM_001037333chr522436 756 ------
NM_001037872chr21630 ------
NM_001037954chr1132811 2483 557 ------
NM_001039538chr21879 1634 ----
NM_001039570chr2274160 4098 4045 3158 1450 1316 859 --11548 --
NM_001039571chr2274160 4098 4045 3158 1450 1316 859 --11548 --
NM_001039590chrX32797 1486 975 ------
NM_001039591chrX32797 1486 975 ------
NM_001039618chr11----22030 1256 --
NM_001039693chr253807 3644 2944 2894 2659 ------
NM_001039772chr11133 ------
NM_001039802chr1135 --1949 --
NM_001039840chrX25184 284 ------
NM_001039916chr12148 --1223 --
NM_001039917chr12148 --1223 --
NM_001039918chr12148 --1223 --
NM_001039919chr12148 --1223 --
NM_001039920chr12148 --1223 --
NM_001039937chr1322819 2535 13472 ----
NM_001040020chr71108 ------
NM_001040058chr42449 406 ------
NM_001040060chr42449 406 ------
NM_001040101chr431421 1279 1015 11203 ----
NM_001040108chr1432545 901 715 ------
NM_001040110chr7------11492
NM_001040142chr2155 ------
NM_001040143chr2155 ------
NM_001040152chr734302 3362 1899 ------
NM_001040159chr42975 560 ------
NM_001040167chr711178 ------
NM_001040179chr6------1252
NM_001040214chr61772 ------
NM_001040280chr62511 298 --11033 --
NM_001040284chr1634967 4857 767 ------
NM_001040402chr41132 ------
NM_001040431chr17151 ------
NM_001040624chr82229 100 ------
NM_001040625chr82229 100 ------
NM_001040626chr82229 100 ------
NM_001040627chr82229 100 ------
NM_001040628chr82229 100 ------
NM_001040629chr82229 100 ------
NM_001040630chr82229 100 ------
NM_001040708chr8----1863 --
NM_001040875chr822425 667 ------
NM_001042355chr1613531 --1599 --
NM_001042388chr181721 ------
NM_001042406chr61914 1944 ----
NM_001042412chr1613531 --1599 --
NM_001042453chrX11413 1641 1157 --
NM_001042473chr103677 582 69 ------
NM_001042492chr171218 ----11071
NM_001042506chrX2563 460 ------
NM_001042510chr8----11999 --
NM_001042511chr8----11999 --
NM_001042555chr121863 ------
NM_001042599chr226726 2331 17475 1510 16797
NM_001042601chr32793 496 ------
NM_001042603chr1255223 4583 1682 1531 314 ------
NM_001042604chr314755 ------
NM_001042683chr62647 468 ------
NM_001043318chr1423158 2663 ------
NM_001043351chr112268 ------
NM_001048183chr152648 2381 1312 873 825 13696 ----
NM_001077628chr11239 ------
NM_001079874chr11651 --11880 --
NM_001083620chr41796 ------
NM_001083621chr174541 4397 3638 3556 2931 1689 869 ------
NM_001087chr22263 31 ------
NM_001099678chr325801 4744 ------
NM_001100108chr187962 7794 7784 7676 6887 6151 5558 391 1612 15607 --
NM_001106chr377555 6848 6093 3754 2906 2748 2025 12977 ----
NM_001122679chr51822 ------
NM_001128chr162726 349 --11204 --
NM_001144chr161247 ------
NM_001148chr422133 1912 ------
NM_001149chr1021081 309 ------
NM_001173chr1412977 ------
NM_001178chr11----1347 --
NM_001199chr8----1217 --
NM_001204chr247767 7423 4966 403 ------
NM_001206chr9--1401 ----
NM_001220chr7137 ------
NM_001256chr1712796 --1453 --
NM_001257chr161294 1357 ----
NM_001324chr201175 ------
NM_001329chr1011420 ------
NM_001379chr19----1108 --
NM_001383chr173810 279 140 ------
NM_001387chr523016 2427 ------
NM_001397chr122668 1815 --22270 152 --
NM_001399chrX22822 100 ------
NM_001401chr9--11245 ----
NM_001406chr1721701 1399 ------
NM_001409chr12870 174 --12144 --
NM_001418chr111643 ------
NM_001418chr111643 ------
NM_001419chr1954277 3770 1472 557 287 ------
NM_001431chr611048 ------
NM_001438chr111371 ------
NM_001451chr16------11028
NM_001494chr101576 ------
NM_001543chr544136 1405 1095 728 --13682 --
NM_001564chr4------1124
NM_001587chrX1222 11844 ----
NM_001604chr11--1253 ----
NM_001616chr253047 3039 2876 2548 2491 --1815 --
NM_001619chr1121101 962 ------
NM_001620chr11161 ------
NM_001634chr622015 662 ------
NM_001635chr7------11024
NM_001642chr11--11185 ----
NM_001658chr121070 74 ------
NM_001659chr1212603 --1953 --
NM_001663chr14----1920 --
NM_001677chr121041 892 ------
NM_001682chr1221785 728 --12815 --
NM_001684chr133908 2638 1609 ------
NM_001695chr833142 1436 547 ----1358
NM_001704chr61134 ----1597
NM_001731chr121646 1842 ----
NM_001755chr1621854 1773 ------
NM_001777chr3--13184 ----
NM_001791chr1135 --1949 --
NM_001839chr11595 ------
NM_001844chr122365 268 ------
NM_001854chr131166 326 203 ------
NM_001855chr9----1615 --
NM_001858chr631804 1347 414 --13408 --
NM_001863chr19151 ------
NM_001875chr22306 293 ------
NM_001880chr21306 ------
NM_001892chr5--1126 1235 --
NM_001895chr20--11241 ----
NM_001904chr3------1761
NM_001918chr162456 1940 1713 394 304 241 --18343 1183
NM_001938chr1----1236 --
NM_001964chr5--11188 ----
NM_001969chr14--11169 ----
NM_001987chr12----1312 --
NM_001999chr52975 951 ------
NM_002006chr422053 681 ------
NM_002014chr124528 521 194 129 ------
NM_002015chr1323296 317 ------
NM_002039chr41608 ------
NM_002048chr9--1149 ----
NM_002051chr101167 ------
NM_002063chrX----1931 --
NM_002072chr91955 ------
NM_002086chr171730 12135 ----
NM_002107chr1----1378 --
NM_002126chr1733754 1195 135 11320 11339 --
NM_002128chr1312111 ------
NM_002136chr12--1493 ----
NM_002137chr7--12246 --1417
NM_002166chr21646 ------
NM_002182chr31815 ------
NM_002198chr5265 56 1201 ----
NM_002202chr51393 ------
NM_002203chr513915 ----13168
NM_002204chr172472 34 ------
NM_002222chr31437 ------
NM_002223chr1221179 890 --13427 --
NM_002224chr6--1714 ----
NM_002234chr121241 ------
NM_002247chr1031812 1708 60 ------
NM_002254chr23465 421 144 12070 ----
NM_002267chr1321942 359 ------
NM_002270chr524827 4194 ------
NM_002336chr1224892 4862 ------
NM_002355chr1211385 ----1307
NM_002356chr6----11790 1487
NM_002373chr151855 ------
NM_002374chr21879 1634 ----
NM_002384chr182825 631 ------
NM_002398chr21352 ------
NM_002402chr711072 ------
NM_002460chr643265 2870 1133 771 ------
NM_002478chr11136 --1532 --
NM_002485chr832103 1611 777 ------
NM_002490chr221183 1613 ----
NM_002500chr221020 270 ----11269
NM_002515chr141382 ------
NM_002519chr11----11441 --
NM_002520chr51269 ------
NM_002545chr1154881 4581 3795 1565 235 ------
NM_002570chr151191 ------
NM_002581chr923524 1010 ------
NM_002594chr20--12156 ----
NM_002595chr1211501 ------
NM_002612chr751723 1615 1426 389 327 ------
NM_002645chr111617 ------
NM_002670chr32502 372 ------
NM_002698chr1922995 120 ------
NM_002710chr12----1250 --
NM_002715chr51895 ------
NM_002719chr141173 ------
NM_002721chr91169 ------
NM_002731chr122782 331 11112 ----
NM_002742chr141550 ------
NM_002745chr2234349 3360 2929 ------
NM_002748chr15----1100 --
NM_002752chr51452 ------
NM_002787chr71595 ------
NM_002816chr17------167
NM_002819chr1911254 ------
NM_002822chr1211756 ------
NM_002827chr2021552 1357 ------
NM_002829chr9--1177 1364 --
NM_002844chr621390 271 ------
NM_002852chr31226 ------
NM_002855chr11----1217 --
NM_002859chr1221539 1268 ------
NM_002880chr31212 ------
NM_002886chr31906 --1885 --
NM_002890chr5--1252 ----
NM_002897chr2----1483 --
NM_002902chr151616 ------
NM_002906chr1131945 700 353 --1224 --
NM_002912chr6169 ------
NM_002923chr11247 --1568 --
NM_002955chr63755 563 361 ------
NM_002958chr31768 ------
NM_002968chr162378 56 ------
NM_002998chr81467 ------
NM_003010chr1721733 122 --1352 --
NM_003016chr1722031 1647 11447 --11960
NM_003017chr6--127 ----
NM_003026chr91169 ------
NM_003043chr344143 3843 2824 773 ------
NM_003045chr1343462 3264 1824 865 ------
NM_003046chr885103 4508 4021 3685 3546 1694 308 162 15392 1513 --
NM_003070chr91846 ----1165
NM_003074chr32552 267 ------
NM_003079chr17----169 --
NM_003099chr1565884 5139 4212 2427 728 349 14013 ----
NM_003105chr11------133
NM_003108chr241480 1240 117 105 ------
NM_003112chr713089 ------
NM_003161chr172605 172 ------
NM_003174chr10185 ------
NM_003189chr1156 --12093 --
NM_003199chr1813792 24420 1645 ----
NM_003217chr12180 ------
NM_003222chr201971 ------
NM_003234chr3----1918 --
NM_003236chr22845 298 ------
NM_003239chr141874 ------
NM_003291chr13----1199 --
NM_003304chr311151 ------
NM_003337chr51259 --1186 --
NM_003340chr411278 ------
NM_003342chr1712219 ------
NM_003348chr12--11610 ----
NM_003352chr221020 74 ------
NM_003369chr1112679 ------
NM_003374chr51684 ------
NM_003376chr61463 ------
NM_003376chr61463 ------
NM_003390chr112265 99 ------
NM_003392chr333950 2965 1396 ------
NM_003410chrX22141 2034 ------
NM_003418chr31596 ------
NM_003435chr19186 ------
NM_003442chr11--1818 ----
NM_003453chr13--1610 ----
NM_003463chr633355 2220 1124 --12896 --
NM_003474chr1031922 837 163 ------
NM_003478chr1122207 591 ------
NM_003482chr121860 ------
NM_003488chr171937 ------
NM_003489chr2113294 ------
NM_003498chr161955 --11790 --
NM_003505chr71427 --11962 --
NM_003574chr181449 ------
NM_003583chr121324 ------
NM_003591chr10254 24 ------
NM_003607chr114115 ------
NM_003615chr331610 1471 525 ------
NM_003620chr171827 ------
NM_003622chr1222641 566 ------
NM_003628chr2--1455 ----
NM_003663chr31788 ------
NM_003692chr91880 ------
NM_003711chr5--191 ----
NM_003750chr10129 ------
NM_003758chr152428 21 ------
NM_003758chr152428 21 ------
NM_003759chr424119 3347 11320 ----
NM_003766chr17----1554 --
NM_003768chr111175 ------
NM_003816chr8--1327 ----
NM_003818chr20173 ------
NM_003831chr182739 110 1283 ----
NM_003861chr1411082 ------
NM_003872chr222620 2049 1563 ----
NM_003873chr101243 1550 ----
NM_003884chr311510 ------
NM_003913chr621589 560 1437 ----
NM_003916chrX31408 1377 210 ----186
NM_003947chr32258 116 ------
NM_003952chr111235 ------
NM_003958chr6--1500 ----
NM_003968chr31171 --1526 --
NM_003972chr1021043 80 ------
NM_004035chr1774362 4287 3565 3255 1948 1854 1806 1394 15066 --
NM_004036chr21474 ------
NM_004040chr221298 159 --1532 --
NM_004061chr5--1422 ----
NM_004074chr111153 ------
NM_004087chr311453 ------
NM_004094chr1412783 --12249 --
NM_004124chr1413566 ------
NM_004156chr8--1586 ----
NM_004161chr221089 632 ------
NM_004165chr16124 ------
NM_004171chr1159180 8430 7841 7327 2327 21360 852 --18113
NM_004233chr62511 298 --11033 --
NM_004242chr61283 ------
NM_004272chr51643 ------
NM_004273chr1064534 3999 1349 975 424 400 13668 ----
NM_004274chr14----1636 --
NM_004311chr1023087 1080 ------
NM_004326chr111225 ------
NM_004330chr1511035 ------
NM_004331chr8--148 --1737
NM_004338chr1824942 1247 ----26944 6169
NM_004349chr821084 1001 --21121 516 --
NM_004369chr22259 170 ------
NM_004370chr62672 199 ------
NM_004393chr3----157 --
NM_004417chr51152 ------
NM_004420chr112645 514 ------
NM_004432chr911491 ----1820
NM_004436chr12472 154 ------
NM_004438chr222806 1188 ------
NM_004447chr121766 --1397 --
NM_004461chr191196 ------
NM_004474chr111041 ------
NM_004481chr122699 589 ------
NM_004491chr1954129 3735 2825 1248 1147 11544 --14326
NM_004496chr141479 --11118 --
NM_004498chr15----1384 --
NM_004499chr51196 ------
NM_004501chr133795 1628 325 13143 ----
NM_004515chr1176 ------
NM_004517chr11----1204 --
NM_004520chr5--1790 ----
NM_004535chr2021761 396 ------
NM_004540chr21----1829 --
NM_004575chr421564 1154 ------
NM_004586chrX33308 1627 1581 ----135
NM_004598chr51620 --11121 --
NM_004603chr72765 442 ------
NM_004622chr21133 ------
NM_004626chr11--1269 ----
NM_004631chr111198 ----165
NM_004654chrY1934 ------
NM_004663chr1511319 ------
NM_004667chr152555 84 ------
NM_004687chr17182 ------
NM_004698chr11168 ------
NM_004718chr22609 214 ------
NM_004725chr10164 11170 ----
NM_004730chr542163 1695 282 70 --1195 --
NM_004734chr1342928 2763 2099 784 12672 ----
NM_004739chr111156 ------
NM_004742chr32473 377 ------
NM_004747chr101423 ------
NM_004748chr152814 678 ------
NM_004761chr6170 --136 --
NM_004768chr11206 ------
NM_004772chr51558 ----134
NM_004774chr1732456 698 538 ------
NM_004788chr1122492 2424 ------
NM_004796chr141896 --2739 713 --
NM_004815chr113832 ------
NM_004824chr6----11107 --
NM_004850chr221655 1518 ------
NM_004859chr1732524 1901 798 ------
NM_004863chr1474801 4756 4117 3934 3405 1663 1614 ------
NM_004884chr1511514 ------
NM_004898chr412438 ------
NM_004902chr201587 ------
NM_004904chr721816 457 ------
NM_004948chr1811337 ------
NM_004956chr724097 3689 ------
NM_004958chr1183 ------
NM_004966chr102805 796 ------
NM_004976chr1123799 438 --15001 --
NM_004985chr1231484 1266 322 ------
NM_004992chrX47898 7276 7100 772 11919 --12247
NM_004992chrX47898 7276 7100 772 11919 --12247
NM_005010chr7------12192
NM_005011chr7------11492
NM_005056chr1265467 4827 1926 1775 558 62 ------
NM_005077chr91387 ------
NM_005088chrX1897 --1871 --
NM_005096chrX----1780 --
NM_005103chr112230 212 ------
NM_005113chr14--1462 ----
NM_005119chr11267 ------
NM_005121chr1713376 11266 ----
NM_005126chr311797 --1544 --
NM_005134chr181721 ------
NM_005159chr151906 --11395 --
NM_005168chr21317 ------
NM_005180chr1011357 ------
NM_005190chr61844 ------
NM_005194chr201224 ------
NM_005197chr1486057 5657 5435 5189 4970 4850 2185 558 11068 14795 --
NM_005221chr71213 ------
NM_005225chr202780 204 ------
NM_005233chr32348 269 ------
NM_005235chr226726 2331 17475 1510 16797
NM_005241chr3----1935 --
NM_005249chr141347 ------
NM_005254chr151394 ------
NM_005259chr21501 ------
NM_005261chr81253 ------
NM_005277chr431893 1261 42 ------
NM_005329chr161564 ------
NM_005338chr763587 3542 2668 2529 746 620 --13453 --
NM_005339chr454018 4004 1060 547 385 ------
NM_005342chrX1293 ------
NM_005358chr131327 ------
NM_005359chr1845737 5710 4808 41 ------
NM_005375chr61737 ------
NM_005378chr21338 ------
NM_005402chr71339 21289 567 ----
NM_005433chr181976 11885 ----
NM_005455chr121853 174 ------
NM_005488chr22181 ------
NM_005497chr1786104 5999 5606 5270 5135 4321 4233 2452 ------
NM_005502chr91608 --1536 --
NM_005504chr1256502 4445 4356 4321 2197 15154 1188 --
NM_005520chr51670 ------
NM_005539chr101923 ------
NM_005542chr72581 395 ----1420
NM_005563chr1--1269 ----
NM_005585chr15--1381 ----
NM_005594chr12127 ------
NM_005595chr11185 ------
NM_005596chr921765 1326 16319 ----
NM_005602chr331289 448 235 ------
NM_005603chr183599 515 306 --11488 --
NM_005604chr611925 ------
NM_005610chr1----1634 --
NM_005626chr11342 --1120 --
NM_005638chrX11201 ------
NM_005665chr133866 3186 553 ------
NM_005715chr6----22796 1096 --
NM_005722chr242032 895 469 139 ------
NM_005724chr152229 115 ----1540
NM_005736chr1011333 ------
NM_005738chr71678 ------
NM_005742chr21541 ------
NM_005748chr1222762 499 ------
NM_005754chr52494 53 --1150 --
NM_005759chr244023 3783 3413 3108 --11634 --
NM_005776chr141249 ------
NM_005779chr511062 12734 1559 --
NM_005786chr182340 235 ------
NM_005793chr33412 367 199 ------
NM_005819chr11330 ------
NM_005822chr6----21764 801 --
NM_005840chrX46592 2424 2240 1448 ------
NM_005859chr511439 11261 ----
NM_005864chr141593 ------
NM_005871chr10--1953 1310 --
NM_005880chr16--1642 ----
NM_005898chr1111160 12511 ----
NM_005899chr1741589 1311 1041 595 ------
NM_005900chr41343 ------
NM_005901chr1828026 7793 --12480 --
NM_005902chr1534006 3853 3184 --1244 --
NM_005904chr1811433 ------
NM_005907chr611300 11687 ----
NM_005909chr533016 1254 140 --14108 --
NM_005911chr221347 1286 21009 36 --11124
NM_005920chr113782 ------
NM_005955chr134793 1903 1511 --25428 545 --
NM_005969chr1111047 ------
NM_006007chr914204 ------
NM_006010chr3--1194 ----
NM_006047chr2012772 ------
NM_006048chr111265 ------
NM_006049chr152268 150 ------
NM_006054chr112261 133 ------
NM_006064chrX1425 ------
NM_006070chr31134 ------
NM_006080chr71117 --21892 762 --
NM_006089chrX21575 516 ------
NM_006094chr8--1382 138 --
NM_006095chr422748 1069 ------
NM_006113chr11651 --11880 --
NM_006135chr111171 ------
NM_006136chr7----1979 --
NM_006141chr1622660 466 ------
NM_006203chr5----14809 --
NM_006206chr421908 228 12060 12834 --
NM_006211chr8----174 --
NM_006212chr155163 5119 3666 541 345 132 15186 --
NM_006241chr312271 ----12336
NM_006255chr14----1743 --
NM_006258chr101224 ------
NM_006265chr8------1403
NM_006267chr2--2444 204 1178 --
NM_006275chr201173 --12396 --
NM_006279chr1--1318 ----
NM_006306chrX--1108 ----
NM_006310chr1731330 1230 426 ------
NM_006315chr423862 450 ------
NM_006317chr51902 ------
NM_006328chr112603 560 ------
NM_006352chr112052 ------
NM_006378chr911286 11369 ----
NM_006379chr732246 279 205 ------
NM_006393chr10----14337 --
NM_006400chr121284 ------
NM_006415chr92849 524 11022 1131 --
NM_006451chr5147 ------
NM_006482chr121324 ------
NM_006489chr141382 ------
NM_006496chr1--11331 11987 --
NM_006526chr2022210 94 ------
NM_006534chr2033394 2318 847 --2521 224 --
NM_006538chr223708 889 --1290 --
NM_006544chr1421259 860 ------
NM_006547chr7----1526 --
NM_006557chr91638 ------
NM_006575chr14--1500 ----
NM_006614chr323608 3281 ------
NM_006621chr11740 ------
NM_006624chr1031644 1516 1478 11757 ----
NM_006626chr912085 1845 12165 --
NM_006629chr1872834 2142 1992 1970 390 342 78 11736 ----
NM_006634chr2170 ------
NM_006646chr131358 ------
NM_006654chr121863 ------
NM_006698chr2021445 913 ------
NM_006703chr62160 117 ------
NM_006726chr4--1966 ----
NM_006734chr611134 ------
NM_006751chr21709 ------
NM_006761chr171574 ------
NM_006766chr812539 ------
NM_006769chr1--1167 --1753
NM_006771chr171227 ------
NM_006791chr152521 436 ------
NM_006802chr111046 ------
NM_006806chr21124 ------
NM_006807chr171516 1425 ----
NM_006816chr51232 ------
NM_006824chr1184 ------
NM_006827chr142541 139 ------
NM_006838chr1221425 381 ------
NM_006852chr1711802 --32280 490 54 11058
NM_006885chr1634028 3205 853 ------
NM_006888chr1443344 2844 900 576 ------
NM_006897chr121200 ------
NM_006901chr151192 ------
NM_006916chr21173 ------
NM_006922chr211962 ------
NM_006924chr1734185 4143 2843 2950 795 ----
NM_006930chr52683 533 ------
NM_006936chr212400 52 --1806 --
NM_006939chr14----1403 --
NM_006951chr101237 ------
NM_006981chr91537 ------
NM_006991chr31240 ------
NM_006999chr511931 ------
NM_007005chr9----11415 --
NM_007007chr1224546 4177 13431 ----
NM_007067chr1711180 ------
NM_007118chr51365 ------
NM_007124chr611761 ------
NM_007129chr13--1404 ----
NM_007159chr32604 273 ------
NM_007162chr61523 ------
NM_007203chr933710 894 359 --1510 --
NM_007212chr112089 11629 ----
NM_007217chr31303 ------
NM_007218chr82822 301 --1833 --
NM_007232chr201321 ------
NM_007246chr41806 1707 ----
NM_007249chr1349122 8485 3384 1343 --19242 --
NM_007292chr1774362 4287 3565 3255 1948 1854 1806 1394 15066 --
NM_007308chr41539 ------
NM_007347chr1522283 1097 --11978 --
NM_007349chr7------1318
NM_007358chr111955 --1287 --
NM_007363chrX--1998 ----
NM_007373chr10--1590 ----
NM_007375chr12802 35 --21119 447 --
NM_009588chr62449 407 ------
NM_012081chr51779 --12769 --
NM_012083chr101981 ------
NM_012092chr221786 124 --11675 --
NM_012093chr12955 470 ----1188
NM_012095chr1023141 3096 ------
NM_012096chr322975 52 --12428 --
NM_012100chr22781 730 ------
NM_012110chr42110 51 ------
NM_012120chr61345 ------
NM_012137chr11304 --12772 --
NM_012141chr1322819 2535 13472 ----
NM_012155chr191198 ------
NM_012156chr2011155 ------
NM_012158chr1311390 ------
NM_012180chr4------1294
NM_012193chr1133306 1332 579 ------
NM_012199chr1--24309 146 ----
NM_012210chr921401 1056 --1237 --
NM_012238chr1011089 ------
NM_012244chr142723 134 11813 11491 --
NM_012247chr101356 ------
NM_012249chr222931 2197 --11437 --
NM_012252chr723822 1717 25308 318 ----
NM_012257chr73964 818 716 ------
NM_012262chr134496 4041 581 ------
NM_012272chr121167 ------
NM_012279chr521818 646 ------
NM_012281chr72851 610 ------
NM_012286chrX2509 423 ------
NM_012297chr422305 895 ------
NM_012300chr511913 ------
NM_012307chr1811052 ------
NM_012316chr11867 11824 ----
NM_012324chr222768 285 ------
NM_012329chr1711265 ------
NM_012330chr10198 1670 ----
NM_012405chr132562 2490 633 ------
NM_012448chr1722203 153 --1234 --
NM_012464chr432352 1097 539 --1665 --
NM_012479chr732530 2519 228 ------
NM_013269chr1253571 2886 1625 422 179 ------
NM_013357chr8--1827 ----
NM_013368chr191437 ------
NM_013390chr9--1224 ----
NM_013399chr163643 544 256 ------
NM_013436chr21644 ------
NM_013438chr911740 ------
NM_014005chr523004 933 ------
NM_014011chr21168 ------
NM_014021chr123134 906 --12687 --
NM_014023chr1021169 891 --12343 --
NM_014028chr632218 979 44 ------
NM_014035chr51167 ------
NM_014038chr71342 ------
NM_014056chr311701 --2927 256 --
NM_014071chr201189 ------
NM_014112chr831525 616 508 15444 ----
NM_014155chr1155432 4745 1451 1111 839 ------
NM_014157chr1663790 1306 770 753 388 102 1875 23540 3118 --
NM_014181chr212000 12875 ----
NM_014186chr1121696 110 --1788 --
NM_014217chr111886 ------
NM_014243chr42791 64 ------
NM_014245chr31239 ------
NM_014268chr181347 11074 ----
NM_014283chr11621 ------
NM_014324chr531180 461 405 ------
NM_014325chr1241995 1629 599 69 ------
NM_014331chr447420 4950 1488 1355 --17579 --
NM_014333chr1112354 ------
NM_014341chr61617 ------
NM_014344chr11--1867 ----
NM_014350chr511080 ------
NM_014363chr131204 ------
NM_014372chr11803 ------
NM_014376chr522436 756 ------
NM_014381chr1432545 901 715 ------
NM_014382chr31378 ------
NM_014392chr431421 1279 1015 11203 ----
NM_014393chr81347 ------
NM_014421chr4167 ------
NM_014423chr535382 4767 1417 ------
NM_014432chr61197 ------
NM_014447chr4----1488 --
NM_014496chrX1229 ------
NM_014517chr3--11304 ----
NM_014574chr14------11299
NM_014606chr411567 ------
NM_014612chr911504 21510 1062 ----
NM_014613chr512819 ------
NM_014647chr1631656 422 373 --1299 --
NM_014655chr111454 ------
NM_014676chr1--1245 ----
NM_014682chr831441 879 619 22334 938 ----
NM_014683chr17----12050 --
NM_014689chr2----1104 --
NM_014690chr71238 ----11238
NM_014701chr1521318 864 ------
NM_014709chr21504 ------
NM_014711chr1611944 ------
NM_014717chr191616 ------
NM_014721chr616145 ------
NM_014730chr1224774 1357 ------
NM_014730chr1224774 1357 ------
NM_014736chr154879 622 364 346 --1928 --
NM_014738chr171954 1678 1942 --
NM_014739chr644136 3912 2871 2619 ------
NM_014755chr21723 11605 ----
NM_014779chr3163 ------
NM_014781chr8--1131 ----
NM_014802chr121880 ------
NM_014803chr10----11890 --
NM_014820chr33812 119 93 ------
NM_014826chr114115 ------
NM_014832chr131477 --11950 --
NM_014838chr221245 --12129 --
NM_014839chr11520 ------
NM_014840chr1232531 1250 805 23250 525 1900 --
NM_014849chr11122 1417 ----
NM_014870chr174541 4397 3638 3556 2931 1689 869 ------
NM_014871chr121137 ------
NM_014873chr111052 ------
NM_014877chr1727178 5718 ------
NM_014888chr71108 ------
NM_014891chr711246 11385 ----
NM_014900chr221035 323 ------
NM_014903chr1232346 1539 811 ------
NM_014904chr101995 ------
NM_014906chr171717 --13706 12561
NM_014912chr1032888 2590 363 ------
NM_014921chr1912089 ------
NM_014943chr8--11107 ----
NM_014950chr141215 ------
NM_014969chr12266 161 ------
NM_014989chr6--11735 ----
NM_014990chr141933 ------
NM_014997chr721152 665 1894 ----
NM_015000chr1242949 844 471 102 167 ----
NM_015018chr61206 ------
NM_015020chr1631212 321 163 13165 --12993
NM_015032chr131469 ------
NM_015039chr123966 273 ------
NM_015052chr711178 ------
NM_015068chr723154 751 ------
NM_015076chr6--1403 ----
NM_015093chr6----1122 --
NM_015094chr2221083 364 ------
NM_015115chr41132 ------
NM_015144chr161200 ------
NM_015172chr11547 ------
NM_015176chr1----188 --
NM_015192chr20--1356 ----
NM_015199chr312886 ------
NM_015206chr1531312 817 342 ------
NM_015215chr112027 ------
NM_015231chr111202 ------
NM_015234chr621360 1118 ------
NM_015238chr5177 ------
NM_015247chr1613531 --1599 --
NM_015250chr91470 11449 ----
NM_015268chr3--1237 ----
NM_015271chr4--11203 1974 --
NM_015272chr161705 188 ----
NM_015296chr1311052 11099 ----
NM_015313chr1131221 1165 659 13146 ----
NM_015317chr222052 737 ------
NM_015335chr1222021 248 1414 ----
NM_015336chr1232357 2051 123 ----1332
NM_015344chr81247 ------
NM_015349chr622849 1990 ------
NM_015355chr17----11332 --
NM_015365chrX33986 620 126 --12677 --
NM_015375chr174260 4214 3424 1956 789 701 266 ------
NM_015397chr931572 1206 770 ------
NM_015401chr121704 ------
NM_015434chr11315 --1367 --
NM_015435chr811272 ------
NM_015455chr51217 ----13941
NM_015457chr1111019 ------
NM_015460chr311624 ------
NM_015526chr191303 ------
NM_015534chr11729 --1450 --
NM_015542chr10----1367 --
NM_015548chr6------172
NM_015549chr141618 ------
NM_015554chr151567 ------
NM_015557chr153184 2411 2392 634 488 ------
NM_015564chr5188 ------
NM_015568chr2023637 3119 24025 1592 ----
NM_015571chr622331 2191 ------
NM_015577chr521527 1238 ------
NM_015601chr102874 305 ------
NM_015630chr211091 --136 --
NM_015642chr31234 ------
NM_015678chr1311620 ------
NM_015695chr61647 ----11613
NM_015696chr1173 ------
NM_015713chr811295 13413 ----
NM_015844chr182825 631 ------
NM_015846chr182825 631 ------
NM_015847chr182825 631 ------
NM_015878chr811832 ------
NM_015879chr1825661 3042 ----15738
NM_015886chr845637 4018 3899 1852 13590 ----
NM_015888chr112156 ------
NM_015904chr2------1549
NM_015906chr124684 3731 ------
NM_015912chr812180 ------
NM_015948chr6----1381 --
NM_015980chr51156 21624 1581 ----
NM_015981chr523184 2938 ------
NM_016025chr1621924 1471 ------
NM_016041chr17------1338
NM_016061chr221182 614 ------
NM_016096chr8----11999 --
NM_016107chr531156 999 981 ------
NM_016120chrX11082 ------
NM_016205chr41941 ------
NM_016219chr92457 190 ------
NM_016227chr11621 ------
NM_016228chr4127 ------
NM_016231chr1741633 1517 1332 590 ------
NM_016271chr1811661 ------
NM_016300chr31174 ------
NM_016308chr11215 ------
NM_016316chr21630 ------
NM_016374chr11985 ------
NM_016374chr11985 ------
NM_016376chr1734117 2746 341 --1141 --
NM_016424chr1721246 644 ------
NM_016431chr222768 285 ------
NM_016441chr21323 ------
NM_016489chr72523 142 ------
NM_016505chr11489 ------
NM_016542chrX11413 1641 1157 --
NM_016545chr11818 ------
NM_016596chr121704 ------
NM_016603chr51869 --1777 --
NM_016620chr111168 ------
NM_016654chr151394 ------
NM_016656chrX1425 ------
NM_016836chr2----1483 --
NM_016839chr2----1483 --
NM_016931chr111283 ------
NM_016936chr1642172 2160 759 100 ------
NM_016950chr42975 560 ------
NM_017409chr122260 223 ------
NM_017415chr544431 3257 267 147 --1332 --
NM_017420chr14--12913 ----
NM_017522chr111198 ----165
NM_017551chr1011039 --12435 --
NM_017553chr15----1151 --
NM_017563chr386179 6022 5792 5277 4754 4533 4167 814 --16193 --
NM_017590chr2221795 1701 ------
NM_017610chr15--1634 ----
NM_017629chr121708 328 ------
NM_017633chr61932 ------
NM_017634chr821289 535 --11764 --
NM_017637chr958916 8450 3346 2475 1192 --16788 --
NM_017644chr353973 3722 3318 1080 215 --1322 --
NM_017657chr21294 ------
NM_017658chr1454123 4048 3762 926 30 ------
NM_017667chr72555 157 ------
NM_017679chr171703 ------
NM_017709chr134042 3492 3349 ------
NM_017719chr342573 2071 1962 420 ------
NM_017730chr31208 1105 ----
NM_017738chr921244 50 ------
NM_017753chr91929 ------
NM_017768chr11233 ------
NM_017772chr6------11786
NM_017775chr172459 305 ------
NM_017790chr91111 --1182 --
NM_017799chr14--11894 ----
NM_017811chr92587 545 ------
NM_017824chr101554 ------
NM_017848chrX43508 3158 1349 1103 ------
NM_017864chr81103 ------
NM_017867chr4--123 ----
NM_017913chr91453 ------
NM_017919chr945718 5268 3807 1135 --21231 1154 --
NM_017933chr2----11421 --
NM_017946chr711289 ------
NM_017988chr121334 ------
NM_018003chr1521677 1632 ------
NM_018011chr13--1463 ----
NM_018014chr21425 ------
NM_018054chr161550 ------
NM_018061chr11176 ------
NM_018078chr43701 128 38 ------
NM_018092chr162234 139 ------
NM_018116chr11591 ------
NM_018125chr11377 ----1409
NM_018133chr321692 1485 1532 ----
NM_018150chr11859 1600 ----
NM_018157chr1222568 937 ------
NM_018181chr1811513 ------
NM_018214chr621271 1201 ----1451
NM_018221chr21162 ------
NM_018237chr10----130 --
NM_018244chr201530 ----1335
NM_018245chr101163 ------
NM_018312chr1121520 549 --11736 --
NM_018313chr312522 --1764 --
NM_018325chr92403 64 ------
NM_018328chr21347 ------
NM_018330chr1021240 343 ------
NM_018334chr7--1422 ----
NM_018340chr1623816 1629 ------
NM_018362chr1143445 3221 3211 2727 13646 ----
NM_018369chr5158 --1308 --
NM_018388chrX1533 ------
NM_018398chr3183 ------
NM_018403chr322847 687 --11150 --
NM_018416chr1242151 1625 639 541 ------
NM_018429chr522003 953 ----12131
NM_018440chr847271 6284 1369 534 ------
NM_018462chr32646 170 --1701 --
NM_018469chr171246 11307 ----
NM_018486chrX1486 ------
NM_018490chr111109 ------
NM_018638chr1224820 2277 ------
NM_018650chr111621 ------
NM_018657chr31710 ------
NM_018695chr51866 ------
NM_018697chr72400 241 ------
NM_018708chr1931665 1648 609 --11597 --
NM_018711chr1221507 569 ------
NM_018844chr722066 263 ------
NM_018846chr7193 ------
NM_018898chr522402 195 ------
NM_018899chr522402 195 ------
NM_018900chr522402 195 ------
NM_018901chr522402 195 ------
NM_018902chr522402 195 ------
NM_018903chr522402 195 ------
NM_018904chr522402 195 ------
NM_018905chr522402 195 ------
NM_018906chr522402 195 ------
NM_018907chr522402 195 ------
NM_018908chr522402 195 ------
NM_018909chr522402 195 ------
NM_018910chr522402 195 ------
NM_018911chr522402 195 ------
NM_018945chr642872 1435 1424 1289 ------
NM_018948chr121161 232 ------
NM_018951chr71430 ------
NM_018972chr822425 667 ------
NM_018979chr1212305 ------
NM_019000chr511586 ------
NM_019001chr314755 ------
NM_019036chr61914 1944 ----
NM_019042chr711134 ------
NM_019046chr101672 ------
NM_019058chr101312 ------
NM_019071chr71206 ------
NM_019084chr1012556 ------
NM_019091chr221116 462 ----1253
NM_019116chr1622950 735 13629 ----
NM_019556chrX----1468 --
NM_019843chr221140 ------
NM_019891chr11413 ------
NM_020122chr234795 3835 1858 ------
NM_020123chr10--21511 1028 ----
NM_020177chr5----2925 318 --
NM_020182chr2033421 1457 1052 --12439 --
NM_020204chr11141 ------
NM_020205chr142516 431 330 261 ------
NM_020226chr41259 ------
NM_020307chr31365 ------
NM_020309chr191800 11113 ----
NM_020311chr21598 ------
NM_020336chr2013427 ------
NM_020341chr201699 --1706 --
NM_020342chr222592 719 ------
NM_020346chr11--11497 ----
NM_020416chr452635 2567 2554 1061 566 ------
NM_020443chr166322 5782 2290 1302 201 193 --16609 --
NM_020452chr11565 ------
NM_020463chr21410 ------
NM_020466chr635012 437 396 11049 --1718
NM_020640chr332261 303 180 --1506 --
NM_020644chr111730 ------
NM_020647chr8139 ------
NM_020651chr21489 --1475 --
NM_020697chr821255 180 ----188
NM_020727chr2113585 12475 1293 --
NM_020737chr6189 ------
NM_020739chr152814 678 ------
NM_020740chr17--1339 ----
NM_020742chrX2693 187 ------
NM_020747chr5----177 --
NM_020755chr621324 219 ------
NM_020766chrX34099 2949 647 --14517 --
NM_020770chr11142 ------
NM_020772chr1726033 5494 ------
NM_020774chr18----1169 15498
NM_020782chr12158 --11899 --
NM_020783chr1811881 --12358 --
NM_020795chr1721384 467 ------
NM_020796chr522704 1986 --11201 --
NM_020808chr11224 ------
NM_020819chr611213 ------
NM_020830chr223208 748 ------
NM_020841chr121709 ------
NM_020860chr411183 ------
NM_020873chr3--1779 ----
NM_020888chr11160 ------
NM_020918chr1033069 1283 740 --12789 --
NM_020920chr141256 ------
NM_020922chrX1641 1565 ----
NM_020948chr1142 ------
NM_020964chr1814790 ------
NM_020977chr422133 1912 ------
NM_020981chr21745 ------
NM_020987chr1021081 309 ------
NM_020993chr1212777 ------
NM_021007chr2155 ------
NM_021012chr1723129 320 12203 ----
NM_021019chr12133 ------
NM_021072chr521902 469 ------
NM_021136chr141265 ------
NM_021148chr7----1891 11561
NM_021183chrX11797 ------
NM_021192chr21353 ------
NM_021222chr111394 --21145 549 --
NM_021255chr142176 138 1408 ----
NM_021619chr921047 512 ------
NM_021622chr1012046 ------
NM_021630chr8178 --1329 --
NM_021638chr465017 4662 3449 1597 1490 186 34993 1432 517 ----
NM_021643chr221846 1762 ------
NM_021738chr10185 ------
NM_021813chr62745 197 ------
NM_021911chr52677 234 --1488 --
NM_021945chr61127 --23525 3363 --
NM_021964chr366585 6497 6051 4903 1798 728 ------
NM_021999chr131188 ------
NM_022048chr1555375 4368 2547 2502 661 14622 11651 --
NM_022072chr3----1221 --
NM_022079chr102874 305 ------
NM_022118chr13------1552
NM_022130chr51126 ----11402
NM_022157chr1--1170 ----
NM_022166chr1633839 2302 1718 ------
NM_022170chr7--11569 ----
NM_022443chr3155 ------
NM_022459chr1365617 4921 4406 4096 1894 237 15873 ----
NM_022465chr1212863 ------
NM_022474chr141536 ------
NM_022497chr321107 242 --2759 34 --
NM_022566chr151475 ------
NM_022648chr213448 14549 ----
NM_022650chr5--1252 ----
NM_022659chr81179 ------
NM_022726chr61425 --1604 --
NM_022749chr821285 946 --11438 --
NM_022758chr663191 3148 2958 2937 1096 490 --1209 --
NM_022771chr12--1804 ----
NM_022780chr22652 277 ------
NM_022781chr922759 565 ------
NM_022802chr1011420 ------
NM_022845chr1621808 1727 ------
NM_022893chr232776 2501 2043 ------
NM_023012chr121163 ------
NM_023074chr191239 ----11280
NM_023923chr152648 2381 1312 873 825 13696 ----
NM_023925chr12----135 --
NM_023940chr42809 312 ------
NM_024007chr512443 ------
NM_024034chr2021017 22 ------
NM_024046chr321264 484 ------
NM_024060chr111289 ------
NM_024089chr13132 ------
NM_024111chr152218 108 ------
NM_024294chr663191 3148 2958 2937 1096 490 --1209 --
NM_024337chr5--197 ----
NM_024345chr953841 1639 641 367 36 ------
NM_024415chr5----1206 --
NM_024424chr111268 ------
NM_024425chr111268 ------
NM_024426chr111268 ------
NM_024490chr151576 ------
NM_024503chr11294 ------
NM_024524chr342894 1088 731 313 --1578 --
NM_024539chrX21295 981 ------
NM_024545chr23718 300 49 ------
NM_024554chr121506 97 ------
NM_024567chr81153 ------
NM_024569chr112570 155 ----
NM_024617chr91812 --1337 --
NM_024631chr111232 ------
NM_024645chr821106 1092 --11546 --
NM_024665chr323689 3255 13238 ----
NM_024686chr11496 ------
NM_024700chr1296 76 ------
NM_024770chr254905 1800 1472 908 787 15969 ----
NM_024798chr1512308 ------
NM_024811chr112349 295 ------
NM_024863chrX1158 ------
NM_024873chr41801 ------
NM_024884chr1454035 3834 3585 2806 184 --24158 693 --
NM_024887chr11619 --1105 --
NM_024947chr3109192 8909 8810 7348 7237 6493 6159 6143 5851 768 29290 3382 ----
NM_024989chr258194 5140 2234 243 192 ----18099
NM_025057chr141145 ------
NM_025073chr123781 1871 --11706 13027
NM_025099chr174895 357 321 147 ------
NM_025133chr21292 ------
NM_025146chr3----12614 --
NM_025191chr131190 523 111 1138 ----
NM_025221chr4--11311 ----
NM_025222chr322964 2921 ------
NM_025248chr171173 13067 ----
NM_030625chr101455 ------
NM_030627chr533513 3108 3064 ------
NM_030634chr131677 696 193 ------
NM_030640chr121307 ----1124
NM_030650chr212878 --11331 --
NM_030674chr1243919 3782 3571 1536 15825 ----
NM_030795chr82457 146 ------
NM_030796chr762091 2052 1608 1467 794 275 ------
NM_030816chr11945 12981 ----
NM_030820chr6135 ------
NM_030885chr312109 11635 ----
NM_030920chr121613 331 ------
NM_030927chr10--11516 ----
NM_030963chr6----1561 --
NM_030981chr1111144 ------
NM_030984chr7----134 --
NM_031157chr12--1493 ----
NM_031216chr1811584 --1763 --
NM_031243chr7--12246 --1417
NM_031266chr51196 ------
NM_031371chr11985 ------
NM_031371chr11985 ------
NM_031411chr522402 195 ------
NM_031442chrX----11075 --
NM_031461chr82911 306 ------
NM_031462chrX21975 34 ------
NM_031844chr133795 1628 325 13143 ----
NM_031845chr21879 1634 ----
NM_031847chr21879 1634 ----
NM_031849chr522402 195 ------
NM_031857chr522402 195 ------
NM_031858chr1741589 1311 1041 595 ------
NM_031860chr522402 195 ------
NM_031862chr1741589 1311 1041 595 ------
NM_031935chr12895 114 ------
NM_031936chr12670 231 ------
NM_031938chr111659 ------
NM_031990chr1911254 ------
NM_031991chr1911254 ------
NM_031992chr7--11569 ----
NM_032012chr944542 1664 1579 1256 ----1383
NM_032041chr82229 100 ------
NM_032042chr511128 ------
NM_032102chr1142160 2115 2025 1008 1443 ----
NM_032116chr1343637 1977 1313 174 ------
NM_032124chr181378 ------
NM_032156chr12----135 --
NM_032181chr22738 226 ------
NM_032186chr111168 ------
NM_032217chr4--1561 ----
NM_032228chr11140 ------
NM_032288chr322312 643 ------
NM_032321chr2173 ------
NM_032364chr121165 ------
NM_032373chr1035307 3989 363 --11864 --
NM_032439chr10----1347 --
NM_032440chr10----12521 --
NM_032458chrX22390 1373 ------
NM_032486chr1622536 1951 ------
NM_032491chr1211140 ------
NM_032503chr6------1252
NM_032514chr20--1392 ----
NM_032523chr21478 ------
NM_032536chr91685 ------
NM_032547chr41459 11307 --11014
NM_032552chr921909 1225 ------
NM_032558chr9179 ------
NM_032575chr1621875 140 ------
NM_032632chr14--1495 ----
NM_032689chr191143 ------
NM_032701chr191553 ------
NM_032765chr5----1292 --
NM_032786chr12----1160 --
NM_032800chr131647 1048 53 11853 ----
NM_032804chr1022575 2450 11828 ----
NM_032810chr1021404 42 ------
NM_032859chr1313582 1295 12872 --
NM_032876chr1411383 --1695 --
NM_032895chr172774 566 ------
NM_032961chr4--11044 ----
NM_032983chr732804 2684 68 --2312 291 --
NM_033020chr124684 3731 ------
NM_033081chr2011220 ------
NM_033089chr201606 ------
NM_033132chr1321863 314 --1154 --
NM_033141chr1412107 ------
NM_033150chr122365 268 ------
NM_033224chr758015 7935 6379 5218 5173 ------
NM_033290chrX43113 2566 2299 451 ------
NM_033300chr111198 ----165
NM_033326chr1111557 ------
NM_033360chr1231605 1387 443 ------
NM_033380chrX1110 ------
NM_033381chrX1110 ------
NM_033389chr1733945 3898 1338 13008 13872 --
NM_033394chr2----11250 --
NM_033425chr1132811 2483 557 ------
NM_033430chr4----142 --
NM_033437chr4----142 --
NM_033450chr61334 ------
NM_033644chr511913 ------
NM_033645chr511913 ------
NM_052840chr1521330 1261 ------
NM_052855chr171486 ------
NM_052867chr1311000 ------
NM_052874chr162583 145 ------
NM_052879chr1224016 1650 ------
NM_052913chr6159 ------
NM_052918chr1033561 2815 1406 ------
NM_052948chr191385 ------
NM_052951chr201230 ------
NM_052978chr141255 --11649 --
NM_053016chr956734 6482 3137 2640 1008 ------
NM_053023chr111678 12561 ----
NM_053064chr141251 1612 ----
NM_054016chr12630 220 ------
NM_054016chr12630 220 ------
NM_054016chr12630 220 ------
NM_057159chr9--11245 ----
NM_057164chr22259 170 ------
NM_057165chr22259 170 ------
NM_057166chr22259 170 ------
NM_057167chr22259 170 ------
NM_057175chr432475 2244 647 ------
NM_058172chr411688 ------
NM_058243chr19----1843 --
NM_078470chr10----1661 11028
NM_078625chr61254 ------
NM_080546chr911615 ------
NM_080552chr201632 ------
NM_080599chr10----1367 --
NM_080629chr131166 326 203 ------
NM_080630chr131166 326 203 ------
NM_080645chr62672 199 ------
NM_080717chr121398 ------
NM_080738chr131622 1613 1386 ------
NM_080743chr611028 ------
NM_080792chr2021459 856 ------
NM_080867chr1433619 1864 101 1594 13750 14838
NM_080927chr32679 180 ------
NM_130384chr3126 ------
NM_133334chr445001 2000 1165 747 139 11598 --
NM_133372chr511860 ------
NM_133468chr71534 ------
NM_133476chr12148 --1223 --
NM_133477chr432367 590 512 --1409 --
NM_133494chr1181 ------
NM_133638chr51421 ------
NM_133646chr255533 3931 3885 1929 1254 --13648 --
NM_134428chr9--1345 ----
NM_138270chrX22731 836 ------
NM_138319chr151191 ------
NM_138415chr2221357 410 ------
NM_138426chr71744 ------
NM_138437chrX166 ------
NM_138444chr1313315 ------
NM_138468chr295347 4635 3863 2284 2234 2194 2132 1592 1455 14575 11553 --
NM_138473chr1215101 --1117 --
NM_138559chr21415 ------
NM_138621chr223708 889 --1290 --
NM_138694chr6------1300
NM_138709chr9148 ------
NM_138730chr61308 ------
NM_138766chr51554 ------
NM_138782chr5------12156
NM_138799chr221973 1838 ------
NM_138804chr2------1572
NM_138811chr711079 ------
NM_138821chr51554 ------
NM_138822chr51554 ------
NM_138927chr2111065 ------
NM_138970chr141896 --2739 713 --
NM_139015chr1221146 533 ------
NM_139045chr91846 ----1165
NM_139070chr51452 ------
NM_139168chr51241 ------
NM_139316chr7------11024
NM_144571chr415198 ------
NM_144580chr11237 ------
NM_144582chr221805 346 --12275 --
NM_144590chr101406 ------
NM_144599chr1523932 3416 --34941 3877 97 --
NM_144632chr2--11879 ----
NM_144642chr3--1410 ----
NM_144657chrX1585 ------
NM_144664chr112437 117 12346 12340 --
NM_144723chr51666 ------
NM_144778chr131629 ------
NM_144949chr21168 ------
NM_145005chr91183 ------
NM_145049chr5--11081 --11048
NM_145068chr17290 22 1228 ----
NM_145203chr131234 1125 ----
NM_145206chr1012829 --13173 --
NM_145284chrX32094 985 791 --12136 --
NM_145296chr191102 ------
NM_145698chr103677 582 69 ------
NM_145727chr62389 47 ------
NM_145739chr21478 ------
NM_145808chr7----11226 --
NM_145859chr31303 ------
NM_145860chr31303 ------
NM_145861chr131622 1613 1386 ------
NM_145909chr61217 ------
NM_147128chr7--11427 ----
NM_147150chr933710 894 359 --1510 --
NM_147156chr1011395 ------
NM_147175chrX22003 525 12142 ----
NM_147181chr4--11311 ----
NM_147182chr4--11311 ----
NM_147183chr4--11311 ----
NM_148174chr811832 ------
NM_148955chr1565884 5139 4212 2427 728 349 14013 ----
NM_152265chr1--1287 ----
NM_152267chr22168 ------
NM_152277chr512073 ------
NM_152282chr311299 ------
NM_152345chr172922 735 ------
NM_152380chr1----11438 --
NM_152390chr2----1447 --
NM_152414chr811538 --11313 --
NM_152422chr9----1283 --
NM_152423chrX21578 542 ------
NM_152447chr141107 ------
NM_152455chr15----1264 --
NM_152462chr171101 ------
NM_152470chr1843961 3552 2584 199 ------
NM_152475chr19--12420 ----
NM_152495chr11264 --11145 --
NM_152523chr21716 ------
NM_152529chr23496 446 356 ----2670 342
NM_152538chr311163 ------
NM_152542chr41678 ------
NM_152553chr62433 198 ------
NM_152586chr101157 ------
NM_152622chr512724 13494 1398 --
NM_152636chr1132408 2317 2285 --12151 --
NM_152641chr121681 ------
NM_152660chr11646 ------
NM_152671chr21106 ------
NM_152678chr332288 919 874 --12394 --
NM_152682chr411644 ------
NM_152699chr32592 108 ------
NM_152748chr71515 ------
NM_152756chr514102 ----13980
NM_152758chr812083 1619 ----
NM_152826chr1565884 5139 4212 2427 728 349 14013 ----
NM_152835chr1----12463 --
NM_152838chr2012772 ------
NM_152896chr94640 564 85 31 ------
NM_153029chr1633216 1357 595 ------
NM_153035chr133092 273 121 ------
NM_153188chr524827 4194 ------
NM_153260chr1531016 597 310 ------
NM_153321chr1711031 ------
NM_153322chr1711031 ------
NM_153333chrX1385 ------
NM_153362chr61227 ------
NM_153367chr1063246 2876 1590 1128 1075 860 --12465 --
NM_153437chr9199 ------
NM_153453chr61325 ------
NM_153498chr102666 100 --1332 --
NM_153619chr15----1976 --
NM_153649chr112268 ------
NM_153687chr12----11026 --
NM_153689chr211633 ------
NM_153715chr71430 ------
NM_153756chr121516 1464 ------
NM_153810chr1064994 3951 3570 3127 1447 999 1397 ----
NM_153812chr122063 798 --1929 --
NM_153819chr111151 ------
NM_153836chr2126 ------
NM_170706chr123966 273 ------
NM_170750chrX2137 42 --1691 --
NM_170751chr6----11107 --
NM_170752chr6----11107 --
NM_171825chr523184 2938 ------
NM_172070chr212130 ------
NM_172071chr146929 6345 4571 851 ------
NM_172078chr7137 ------
NM_172079chr7137 ------
NM_172080chr7137 ------
NM_172081chr7137 ------
NM_172082chr7137 ------
NM_172083chr7137 ------
NM_172084chr7137 ------
NM_172127chr431928 506 96 ------
NM_172128chr431884 462 52 ------
NM_173156chr112033 --11729 --
NM_173172chr2------11524
NM_173198chr91537 ------
NM_173200chr91537 ------
NM_173468chr41527 --12271 --
NM_173476chr162658 413 ------
NM_173478chr171769 ------
NM_173508chr111135 ------
NM_173510chr2212924 ------
NM_173552chr3----1676 --
NM_173562chr633181 2552 793 ------
NM_173576chr101665 ------
NM_173602chr1213312 1755 12678 --
NM_173642chr136711 2828 2161 --58740 7877 6956 6938 533 --
NM_173809chr1021256 578 ------
NM_173822chr211844 --12012 1348
NM_173829chr565131 4779 2459 2082 1862 1371 --1583 --
NM_174858chr12955 470 ----1188
NM_174869chrX1149 ------
NM_174921chr411019 ------
NM_174934chr1132667 1316 258 ------
NM_174936chr111232 ------
NM_174963chr1--1318 ----
NM_174964chr1--1318 ----
NM_174965chr1--1337 ----
NM_174966chr1--1318 ----
NM_174967chr1--1337 ----
NM_174968chr1--1318 ----
NM_174969chr1--1318 ----
NM_174970chr1--1337 ----
NM_174971chr1--1318 ----
NM_175069chr91217 --1795 --
NM_175634chr821084 1001 --21121 516 --
NM_175635chr821084 1001 --21121 516 --
NM_175636chr821084 1001 --21121 516 --
NM_175847chr1911254 ------
NM_175854chr1312283 ------
NM_176812chr20----1622 --
NM_176814chr7164 ------
NM_176895chr5--191 ----
NM_177398chr111445 --1703 1148
NM_177399chr111445 --1703 1148
NM_177524chr711072 ------
NM_177525chr711072 ------
NM_177559chr20--11241 ----
NM_177560chr20--11241 ----
NM_177990chr201699 --1706 --
NM_177995chr9----1283 --
NM_177996chr2011155 ------
NM_178123chr23697 423 309 ------
NM_178126chr171490 ------
NM_178148chr61440 ------
NM_178313chr212165 1430 ----
NM_178505chr1043279 980 899 607 188 ----
NM_178539chr12------1487
NM_178565chr82130 82 ------
NM_178586chr141173 ------
NM_178818chr1641958 485 464 126 --1319 --
NM_178860chr172410 192 --11025 --
NM_181077chr1512142 ------
NM_181332chrX2693 187 ------
NM_181354chr81315 ------
NM_181358chr133752 1234 887 ------
NM_181481chr1824942 1247 ----26944 6169
NM_181482chr1824942 1247 ----26944 6169
NM_181483chr1824942 1247 ----26944 6169
NM_181486chr121398 ------
NM_181504chr51335 ------
NM_181509chr20--1392 ----
NM_181521chr1666739 6291 5266 5245 4907 1518 --15100 --
NM_181523chr51335 ------
NM_181524chr51335 ------
NM_181532chrX----1228 --
NM_181571chr10178 ------
NM_181656chr171957 ------
NM_181659chr2033394 2318 847 --2521 224 --
NM_181659chr2033394 2318 847 --2521 224 --
NM_181672chrX1238 1523 ----
NM_181673chrX1238 1523 ----
NM_181702chr81253 ------
NM_181714chr61434 ------
NM_181783chr121677 ------
NM_181784chr211018 ------
NM_181825chr22147 ------
NM_181876chr452635 2567 2554 1061 566 ------
NM_181886chr411278 ------
NM_181887chr411278 ------
NM_181888chr411278 ------
NM_181889chr411278 ------
NM_181890chr411278 ------
NM_181891chr411278 ------
NM_181892chr411325 ------
NM_181893chr411278 ------
NM_182485chr411360 ------
NM_182509chr14--11404 ----
NM_182511chr182961 22 ------
NM_182594chr51327 ------
NM_182603chr112923 94 ------
NM_182643chr8--1382 138 --
NM_182645chr61325 ------
NM_182646chr411360 ------
NM_182662chr4127 ------
NM_182717chr101483 ------
NM_182718chr10178 ------
NM_182719chr10178 ------
NM_182720chr101483 ------
NM_182721chr101483 ------
NM_182722chr101483 ------
NM_182723chr101483 ------
NM_182724chr10178 ------
NM_182725chr10178 ------
NM_182728chr142723 134 11813 11491 --
NM_182769chr10178 ------
NM_182770chr10178 ------
NM_182771chr10178 ------
NM_182772chr10178 ------
NM_182789chr5147 ------
NM_182797chr201322 ------
NM_182850chr10178 ------
NM_182853chr101483 ------
NM_182894chr1421669 1369 ------
NM_182898chr721816 457 ------
NM_182899chr721816 457 ------
NM_182948chr122782 331 11112 ----
NM_182972chr122152 797 ------
NM_182976chr11269 ------
NM_183004chr14--11169 ----
NM_183011chr101483 ------
NM_183012chr101483 ------
NM_183013chr101483 ------
NM_183057chr82217 204 ------
NM_183060chr10178 ------
NM_183078chr6--1406 ----
NM_183079chr20188 ------
NM_183237chr31301 ------
NM_183323chr5147 ------
NM_183353chrX11082 ------
NM_183380chr6------172
NM_183397chr2084597 4449 3985 1853 854 399 329 75 --13750 --
NM_183419chr811272 ------
NM_184234chr201587 ------
NM_194247chr223049 929 ------
NM_194278chr1423158 2663 ------
NM_194282chr442760 2710 2620 997 --1332 --
NM_194285chr1112712 --12803 --
NM_194286chr12----16248 --
NM_194301chr141761 ------
NM_194328chr922759 565 ------
NM_194329chr922759 565 ------
NM_194330chr922759 565 ------
NM_194332chr922759 565 ------
NM_194434chr181449 ------
NM_194463chrX21295 981 ------
NM_197968chr13--1610 ----
NM_198042chr81182 --1433 --
NM_198086chr1411383 --1695 --
NM_198128chr1811661 ------
NM_198195chr31171 --1526 --
NM_198243chr15--1795 ----
NM_198261chr121163 ------
NM_198262chr121163 ------
NM_198268chr133752 1234 887 ------
NM_198269chr133752 1234 887 ------
NM_198270chrX13429 ------
NM_198271chr342191 1422 667 602 --11827 --
NM_198273chr522900 200 ------
NM_198336chr72493 307 ----1332
NM_198395chr52494 53 --1150 --
NM_198399chr321257 331 ------
NM_198446chr11151 ------
NM_198465chrX1531 12502 --1212
NM_198513chr81395 ------
NM_198552chr11171 ------
NM_198563chr3149 ------
NM_198581chr276210 5195 4896 4730 2358 2105 1050 ------
NM_198595chr465017 4662 3449 1597 1490 186 34993 1432 517 ----
NM_198793chr3--13180 ----
NM_198794chr14--1500 ----
NM_198859chr335061 3233 1674 ------
NM_198880chr31208 1105 ----
NM_198889chr4--1561 ----
NM_198902chr152229 115 ----1540
NM_198904chr511941 ------
NM_198935chr2042626 2452 197 177 13246 ----
NM_198990chr72645 586 ------
NM_199169chr2033421 1457 1052 --12439 --
NM_199170chr2033421 1457 1052 --12439 --
NM_199171chr2033421 1457 1052 --12439 --
NM_199185chr51269 ------
NM_199188chr1224016 1650 ------
NM_199190chr1224016 1650 ------
NM_199229chr21173 ------
NM_199290chr17127 ------
NM_199320chr412725 ------
NM_199320chr412725 ------
NM_199324chr422653 777 1765 13728 --
NM_199355chr162563 507 ------
NM_199421chr1433619 1864 101 1594 13750 14838
NM_199461chr1032381 2337 792 ------
NM_199462chr174260 4214 3424 1956 789 701 266 ------
NM_199478chrX21344 616 1449 ----
NM_199487chr201530 ----1335
NM_201266chr222620 2049 1563 ----
NM_201269chr111168 ------
NM_201279chr222620 2049 1563 ----
NM_201413chr21----11087 --
NM_201414chr21----11087 --
NM_201568chr112033 --11729 --
NM_201569chr112033 --11729 --
NM_201591chr431893 1261 42 ------
NM_201592chr431893 1261 42 ------
NM_201599chrX----1780 --
NM_201633chr5--1352 ----
NM_203344chr191437 ------
NM_203350chr121748 69 ------
NM_203364chr1111233 ------
NM_203382chr521571 94 ------
NM_203394chr12----2475 212 --
NM_203399chr1--1269 ----
NM_203401chr1--1269 ----
NM_203403chr9276 27 ------
NM_203434chr92944 282 ------
NM_203437chr21294 ------
NM_203446chr211563 ------
NM_203453chr921993 1247 ------
NM_203459chr112161 --22506 571 --
NM_203494chr15----1132 --
NM_203504chr422305 895 ------
NM_203505chr422305 895 ------
NM_203506chr171730 12135 ----
NM_205768chr112052 ------
NM_205842chr21644 ------
NM_205861chr11619 --1105 --
NM_206594chr111371 ------
NM_206595chr111371 ------
NM_206839chr152521 436 ------
NM_206852chr141265 ------
NM_206853chr622910 1210 --1402 --
NM_206855chr625136 884 1544 ----
NM_206857chr141265 ------
NM_207012chr1023141 3096 ------
NM_207042chr12472 154 ------
NM_207045chr12472 154 ------
NM_207046chr12472 154 ------
NM_207111chr72203 81 ------
NM_207116chr72203 81 ------
NM_207123chr41608 ------
NM_207299chr91929 ------
NM_207304chr131516 ------
NM_207371chr10--11518 ----
NM_207422chrX----145 --
NM_207442chr141256 ------
NM_207467chr14567 520 410 376 ------
NM_207578chr1--1612 ----
NM_212460chr71678 ------
NM_213589chr224624 1044 1497 13562 1699
NM_213594chr1211140 ------