TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-122-5p
miRNA Sequence: UGGAGUGUGACAAUGGUGUUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr54988 968 853 22 ------
NM_000034chr16155 ----134
NM_000037chr821737 633 1573 42303 608 135 77 --
NM_000038chr541783 1607 1352 192 --11740 11992
NM_000044chrX181 ------
NM_000052chrX43381 2824 829 415 13304 13369 --
NM_000053chr1332079 1531 115 11788 1714 --
NM_000068chr1931568 1269 47 ------
NM_000081chr131519 1323 693 --1429 --
NM_000084chrX156598 5889 5261 5029 5006 2505 1758 1533 1480 1473 1452 1375 1082 1044 392 22015 1407 11365 11831
NM_000089chr71200 --2551 232 --
NM_000090chr2----1272 --
NM_000092chr294044 3407 3151 1547 1277 1033 1020 985 224 13161 12968 --
NM_000103chr155982 502 389 99 24 1813 ----
NM_000104chr222996 328 22586 2161 ----
NM_000108chr721870 157 --21246 63 --
NM_000110chr11764 ------
NM_000114chr2011265 11066 11170 --
NM_000115chr1352167 756 614 295 145 1254 ----
NM_000117chrX1232 ------
NM_000125chr684205 4061 3569 3328 2887 2718 1477 583 23762 1538 21158 96 --
NM_000141chr102990 353 ------
NM_000142chr42510 70 --11339 --
NM_000161chr1421608 1467 ----183
NM_000165chr611544 ----21616 485
NM_000168chr773236 2736 2730 2109 843 790 232 22931 622 22488 424 --
NM_000176chr553355 3267 2934 2594 2470 --23081 1168 --
NM_000188chr10139 ------
NM_000189chr242313 2093 592 235 ------
NM_000192chr1251295 318 297 287 138 ------
NM_000194chrX1166 ------
NM_000210chr241483 537 492 42 ------
NM_000212chr1722161 1761 21886 413 ----
NM_000214chr203672 306 72 ------
NM_000216chrX33144 1624 1208 --176 --
NM_000217chr1263687 3585 2150 1252 999 784 ------
NM_000222chr431337 245 141 11834 ----
NM_000227chr181302 ------
NM_000245chr752051 2039 547 436 34 --3820 505 233 --
NM_000252chrX11379 11434 ----
NM_000264chr932071 1030 249 --13089 --
NM_000266chrX2798 173 ------
NM_000267chr1742665 2458 642 103 ------
NM_000276chrX1446 1457 1269 --
NM_000277chr123692 245 184 ------
NM_000280chr111875 ------
NM_000286chr171882 --187 --
NM_000297chr42425 415 11682 ----
NM_000304chr173876 699 200 ------
NM_000314chr1073113 2421 1199 988 620 479 176 ------
NM_000318chr832929 2605 1043 --12676 --
NM_000330chrX32274 2181 377 1724 11990 --
NM_000332chr6157188 7018 6900 5552 5451 5108 4953 4724 2835 2743 1968 1476 1140 912 454 14637 ----
NM_000333chr381122 1095 1023 1004 447 333 71 39 11139 ----
NM_000337chr5136229 5944 5905 5053 4319 2514 1977 1936 1779 1423 1282 880 458 24584 1929 1330 --
NM_000352chr11131 ------
NM_000358chr51103 ------
NM_000362chr2222741 27 1333 12460 11147
NM_000387chr32726 26 ------
NM_000393chr21807 1471 ----
NM_000399chr102936 328 ------
NM_000408chr243469 2117 288 81 22352 1141 12523 1131
NM_000411chr2162041 1256 1122 915 844 479 13283 12241 --
NM_000430chr1743498 1331 741 47 ----12746
NM_000435chr1951028 995 804 273 257 2664 654 1311 --
NM_000441chr7187 11890 ----
NM_000447chr1------173
NM_000461chr3124262 4195 4153 3880 2963 2886 1783 1287 1254 1028 812 511 157 --11365
NM_000462chr1521856 1152 ------
NM_000474chr71574 ------
NM_000478chr13282 191 156 1524 1618 --
NM_000484chr2111109 ------
NM_000486chr1263250 2723 1165 1052 960 523 --23056 1036 --
NM_000489chrX43131 2967 2933 2473 ------
NM_000503chr811301 ------
NM_000522chr741191 1142 988 428 ------
NM_000523chr221173 385 ------
NM_000530chr121077 338 1327 --1830
NM_000533chrX21667 754 ------
NM_000544chr6_cox_hap143232 2398 370 302 --13104 --
NM_000555chrX73022 2688 2621 2592 1232 514 507 33031 1625 246 ----
NM_000572chr1--2859 362 ----
NM_000575chr2----1140 --
NM_000595chr6--1111 ----
NM_000596chr7160 ----1126
NM_000599chr274587 4292 3652 3161 2873 1456 770 34072 3217 669 --1541
NM_000602chr71437 11221 ----
NM_000609chr1042822 2532 286 132 --12345 --
NM_000610chr1142713 2348 2103 69 12005 ----
NM_000612chr1152882 1458 858 698 496 ------
NM_000615chr1162786 2701 1842 682 377 227 --21862 282 --
NM_000618chr1296298 6007 4218 4081 2631 2282 1728 1564 427 11256 --1158
NM_000618chr1296298 6007 4218 4081 2631 2282 1728 1564 427 11256 --1158
NM_000620chr1261944 1930 1904 737 250 179 ------
NM_000627chr22873 33 ------
NM_000663chr1632868 2451 731 --1458 --
NM_000680chr8153 ----1363
NM_000681chr1041306 407 222 81 ------
NM_000684chr1011276 --21114 340 --
NM_000693chr1561734 1446 484 285 158 103 ------
NM_000701chr1----142 --
NM_000719chr12146428 6165 5360 5327 4913 4300 2520 2364 2246 2005 1996 1684 723 554 35266 5023 4139 --16293
NM_000724chr1021450 708 11391 ----
NM_000725chr12--2221 60 ----
NM_000726chr231444 1152 531 --21346 974 --
NM_000757chr12881 327 ------
NM_000794chr5------1162
NM_000800chr51156 2480 30 11387 --
NM_000801chr202797 450 1114 ----
NM_000806chr531841 1700 312 11272 --1772
NM_000809chr488548 6540 3438 3407 3205 3196 2997 2620 17173 --26229 6160
NM_000811chr52691 173 ------
NM_000813chr544857 4323 4292 2125 11906 1360 14354
NM_000814chr1543394 3380 1238 453 22827 2671 11153 --
NM_000818chr10129 1413 1398 --
NM_000826chr432485 1697 485 ------
NM_000827chr542349 1839 1611 574 ------
NM_000828chrX3655 637 85 21611 582 1184 --
NM_000829chr1121947 551 ----12081
NM_000833chr1631539 1202 1151 11304 ----
NM_000864chr11987 ------
NM_000868chrX42332 715 459 452 ------
NM_000870chr531175 552 455 --2420 231 --
NM_000875chr15136951 6414 5732 5436 5004 4990 4964 4776 2630 2218 1576 301 262 24840 1353 1703 --
NM_000878chr2262015 655 516 301 156 96 --1467 11376
NM_000883chr75661 616 584 526 440 ------
NM_000883chr75661 616 584 526 440 ------
NM_000891chr1743430 1270 876 756 23359 1381 13284 11083
NM_000898chrX2824 611 --2676 28 --
NM_000899chr1244423 4032 3614 3144 11135 ----
NM_000901chr452115 2007 1918 585 106 ------
NM_000919chr51127 ------
NM_000922chr112168 108 11016 ----
NM_000944chr421810 689 ------
NM_000945chr2129 ------
NM_000950chrX63150 2871 1366 918 843 686 22375 123 2908 696 --
NM_000957chr12561 516 ------
NM_000958chr511355 ------
NM_000961chr2073092 2778 2730 2468 719 612 118 11495 1993 --
NM_000962chr921009 552 2372 51 ----
NM_000965chr33847 400 267 --2159 28 --
NM_000966chr121767 1327 ----
NM_001001323chr1232934 409 284 ------
NM_001001331chr382604 2531 2524 2317 1858 1832 595 343 22651 200 1897 --
NM_001001342chr1021121 209 ----11340
NM_001001344chrX62188 2169 1695 879 728 37 1937 ----
NM_001001389chr1142713 2348 2103 69 12005 ----
NM_001001390chr1142713 2348 2103 69 12005 ----
NM_001001391chr1142713 2348 2103 69 12005 ----
NM_001001392chr1142759 2394 2149 115 12051 ----
NM_001001394chr21274 ------
NM_001001395chr1221979 42 12716 ----
NM_001001396chr183628 3511 3217 2906 1510 599 532 107 23816 190 11683 --
NM_001001419chr541813 1598 1292 897 11543 ----
NM_001001420chr541813 1598 1292 897 11543 ----
NM_001001433chr2013116 22319 1023 --12608
NM_001001436chr161664 --1149 --
NM_001001481chr812950 --32696 2399 884 --
NM_001001483chr111434 ------
NM_001001484chr1022082 52 21999 1739 12262 --
NM_001001664chr262750 2608 2521 1210 1065 43 1202 ----
NM_001001684chr1722529 867 1639 1223 --
NM_001001787chr11529 ------
NM_001001890chr21--11050 13234 --
NM_001001924chr842122 1633 1533 680 11758 ----
NM_001001925chr842122 1633 1533 680 11758 ----
NM_001001931chr842122 1633 1533 680 11758 ----
NM_001001933chr11166 ------
NM_001001974chr1042205 1952 887 411 ------
NM_001001995chrX2308 230 --1328 1115
NM_001002233chr821440 851 11367 1194 --
NM_001002244chr171114 ------
NM_001002245chr171149 ------
NM_001002246chr171149 ------
NM_001002247chr171149 ------
NM_001002248chr171149 ------
NM_001002249chr171149 ------
NM_001002255chr6197 125 ----
NM_001002258chr221876 407 ------
NM_001002295chr101860 ------
NM_001002296chr83363 95 25 2264 134 ----
NM_001002814chr832900 1440 851 32506 1367 1259 2951 194 --
NM_001002838chrX31680 399 318 2498 226 --11749
NM_001002843chr1521265 126 ------
NM_001002909chr1722098 1955 ------
NM_001002926chr72985 959 22505 269 ----
NM_001003652chr18128192 7808 6887 6350 3320 2431 2027 1671 1538 746 452 202 ------
NM_001003676chr111384 ------
NM_001003688chr42828 223 ------
NM_001003694chr3------1183
NM_001003712chr1243038 1007 522 301 12732 ----
NM_001003786chr172609 115 --2244 80 1172
NM_001003787chr172609 115 --2244 80 1172
NM_001003788chr172609 115 --2244 80 1172
NM_001003800chr952643 1146 265 186 158 ------
NM_001003940chr1533734 3259 159 1893 12538 --
NM_001003942chr1533734 3259 159 1893 12538 --
NM_001003943chr1533738 3263 163 1897 12542 --
NM_001003945chr931892 1220 661 ------
NM_001003954chr8------158
NM_001004065chr953878 3169 2918 1583 554 ------
NM_001004106chr5147 --1794 --
NM_001004304chr1262782 2180 1282 544 223 107 --12036 --
NM_001004313chr171498 1550 1405 --
NM_001004317chr664330 4057 3623 2790 1328 450 1150 14439 --
NM_001004323chr7139 ------
NM_001004329chr1221044 376 21181 146 ----
NM_001004360chr22421 129 11417 ----
NM_001004419chr1214426 --24550 4353 11145
NM_001004720chr24805 377 179 21 --11011 --
NM_001004722chr23974 348 190 --11180 126
NM_001005266chr151492 ------
NM_001005267chr151492 ------
NM_001005268chr151492 ------
NM_001005269chr151492 ------
NM_001005271chr1731102 1041 183 --1715 --
NM_001005273chr1731102 1041 183 --1715 --
NM_001005366chr123941 655 254 --186 1179
NM_001005375chrY31673 1166 475 --11617 --
NM_001005386chr21274 ------
NM_001005404chr1743617 455 86 56 ------
NM_001005463chr1021039 941 22512 2489 ----
NM_001005473chr565032 4581 2045 1849 1344 170 --25638 75 --
NM_001005474chr321320 33 ------
NM_001005476chr21671 ----1695
NM_001005502chr1274228 4059 3937 3527 1131 243 215 64750 3838 1533 651 83 57 ----
NM_001005505chr32633 28 11865 21137 76 --
NM_001005609chrX41268 974 805 765 2609 368 --13214
NM_001005612chrX2156 62 1441 ----
NM_001005746chr231444 1152 531 --21346 974 --
NM_001005747chr231444 1152 531 --21346 974 --
NM_001005781chr21530 ------
NM_001005782chr22979 366 ------
NM_001005849chr172147 58 125 ----
NM_001005910chr3177 ------
NM_001005911chr3177 ------
NM_001006115chr372751 2442 1963 1813 1039 716 403 ------
NM_001006600chr522091 1748 11537 ----
NM_001006641chr931629 1475 225 11636 ----
NM_001006642chr931629 1475 225 11636 ----
NM_001006643chr931629 1475 225 11636 ----
NM_001006684chrX--1224 ----
NM_001006945chr11537 ------
NM_001007024chr1734164 3125 1668 ------
NM_001007025chr1734164 3125 1668 ------
NM_001007067chr811039 ------
NM_001007068chr811039 ------
NM_001007069chr811039 ------
NM_001007070chr811039 ------
NM_001007094chr1053479 3117 1178 373 255 11562 ----
NM_001007098chr1148 ------
NM_001007102chr611636 ------
NM_001007156chr1511966 ------
NM_001007214chr1----1189 --
NM_001007246chr2111629 ------
NM_001007255chr1267 38 1293 ----
NM_001007257chr141485 1041 423 139 ------
NM_001007271chr102752 24 1156 1302 --
NM_001007277chr111416 ------
NM_001007471chr92649 226 --1579 1341
NM_001007553chr13940 418 373 ------
NM_001007559chr182397 194 196 ----
NM_001008220chr583673 3658 3313 2975 2734 868 796 199 127 1301 1364
NM_001008222chrX11192 11219 ----
NM_001008239chr1833694 423 43 ------
NM_001008392chr362853 2620 2181 824 727 34 --1101 22364 2205
NM_001008407chr7--1399 ----
NM_001008408chr7116443 6265 5667 5578 5028 4450 2028 1253 977 884 219 36001 5746 5567 46078 4803 3975 677 --
NM_001008491chr242018 384 362 38 --21906 218 21399 64
NM_001008492chr242018 384 362 38 --21906 218 21399 64
NM_001008495chr822276 2027 163 --11922
NM_001008529chr1721293 1043 1436 ----
NM_001008541chr1011695 ------
NM_001008541chr1011695 ------
NM_001008660chr1111534 2968 28 1530 --
NM_001008701chr1942748 867 306 108 --12861 --
NM_001008738chr552909 2759 2363 1833 1089 ----1711
NM_001008744chr143555 132 83 --1176 --
NM_001008895chr1311284 ------
NM_001009554chr444058 3942 1718 655 ------
NM_001009554chr444058 3942 1718 655 ------
NM_001009555chr421366 1242 ------
NM_001009566chr141431 1370 958 377 1325 ----
NM_001009881chr13579 462 96 ------
NM_001009882chr13579 462 96 ------
NM_001009899chr325291 4497 --14562 14310
NM_001009993chr233009 966 116 ------
NM_001010000chr1873345 3002 2582 2561 890 767 281 22894 2172 ----
NM_001010861chr152668 1772 861 616 292 --11824 --
NM_001010888chrX74000 3921 3638 3332 3190 1406 443 ------
NM_001010895chr911926 21843 1383 1374 --
NM_001010908chr10----1230 --
NM_001010924chr101133 ------
NM_001010938chr31202 ------
NM_001010942chr122273 165 2431 72 ----
NM_001010980chr182656 2251 2217 1314 933 740 431 229 13119 22527 71 --
NM_001010986chrX42232 2076 397 76 12238 ----
NM_001010989chr161235 ------
NM_001010990chr161235 ------
NM_001011513chr414128 21384 773 ----
NM_001011553chr71775 ------
NM_001011645chrX181 ------
NM_001011657chrX1124 2416 116 ----
NM_001011666chr7116603 5577 5564 5546 5180 4952 4293 2399 1629 1329 1280 ----24095 779
NM_001011708chr242164 1142 997 397 32397 384 235 ----
NM_001011713chr14--11053 ----
NM_001011724chr13--1237 ----
NM_001011725chr13--1237 ----
NM_001012264chr141745 --2642 61 --
NM_001012393chr1154668 3240 1254 622 307 --1943 --
NM_001012398chr161796 1229 ----
NM_001012420chr1542216 1163 1106 201 ------
NM_001012421chr92625 290 ------
NM_001012423chr1542216 1163 1106 201 ------
NM_001012642chr1541747 421 286 27 --1485 --
NM_001012644chr20130 ------
NM_001012732chr411238 ------
NM_001012753chr192913 772 11242 1335 --
NM_001012755chrX84884 4595 4471 4353 1020 500 340 281 34764 1510 938 14409 25066 997
NM_001012968chrX52684 2598 823 557 542 12397 ----
NM_001012977chrX31146 945 429 ----11291
NM_001012989chrX131 ------
NM_001013031chr1062970 1338 703 542 169 89 12721 32202 985 226 --
NM_001013415chr41632 --21060 46 --
NM_001013437chr181455 ------
NM_001013438chr31122 182 ----
NM_001013642chr11920 1173 ----
NM_001013693chr162772 2319 2256 1047 888 319 11863 ----
NM_001013693chr162772 2319 2256 1047 888 319 11863 ----
NM_001013699chr121570 1115 ----
NM_001013703chr15173 1353 ----
NM_001013717chr52481 253 ------
NM_001013843chr151644 ------
NM_001014434chr1------1758
NM_001014796chr12176 153 ------
NM_001014796chr12176 153 ------
NM_001014797chr10117838 7685 6039 5890 2325 2210 2173 1805 1602 1056 29 47941 6890 1762 1304 --25553 3142
NM_001014809chr44890 741 299 244 ------
NM_001014812chr152324 306 ------
NM_001014839chr111091 --21020 819 1856
NM_001014841chr111091 --21020 819 1856
NM_001015053chr1751528 1489 647 412 80 ------
NM_001015508chr8----199 --
NM_001015877chrX2447 358 --13001 1842
NM_001015881chrX11189 1163 ----
NM_001015887chr341630 1488 1435 1381 --194 --
NM_001017368chr171421 22434 643 ----
NM_001017371chr21944 ----1962
NM_001017395chr353539 2983 2972 2813 793 13016 12832 1459
NM_001017415chr11276 ------
NM_001017416chr11276 ------
NM_001017440chr777099 6370 2727 2574 1258 893 388 45170 4985 1325 169 16549 --
NM_001017926chr831544 288 112 ------
NM_001017977chr11348 ------
NM_001017979chr46752 667 229 203 119 113 ------
NM_001017999chr152129 1885 1466 492 455 ------
NM_001017999chr152129 1885 1466 492 455 ------
NM_001018000chr152129 1885 1466 492 455 ------
NM_001018000chr152129 1885 1466 492 455 ------
NM_001018001chr152129 1885 1466 492 455 ------
NM_001018004chr154611 544 224 26 ------
NM_001018006chr154611 544 224 26 ------
NM_001018007chr154611 544 224 26 ------
NM_001018020chr154611 544 224 26 ------
NM_001018050chr2232750 531 152 1800 13013 --
NM_001018052chr2232750 531 152 1800 13013 --
NM_001018054chr131043 989 228 --155 2933 473
NM_001018056chr91189 ------
NM_001018064chr961486 740 533 495 108 38 31596 1562 1551 --1397
NM_001018065chr9125734 5326 5292 5159 4607 3885 3823 2346 2119 1906 1096 130 13655 15214 12024
NM_001018066chr9125734 5326 5292 5159 4607 3885 3823 2346 2119 1906 1096 130 13655 15214 12024
NM_001018074chr553355 3267 2934 2594 2470 --23081 1168 --
NM_001018075chr553355 3267 2934 2594 2470 --23081 1168 --
NM_001018076chr553355 3267 2934 2594 2470 --23081 1168 --
NM_001018077chr553355 3267 2934 2594 2470 --23081 1168 --
NM_001018108chr1581912 1889 917 698 446 190 114 67 21872 1608 ----
NM_001020658chr131573 126 29 ------
NM_001020658chr131573 126 29 ------
NM_001020825chr52409 69 --1556 --
NM_001023567chr154798 535 309 201 ------
NM_001023587chr31886 --11175 --
NM_001024094chr553355 3267 2934 2594 2470 --23081 1168 --
NM_001024226chr15821 803 443 213 25 ------
NM_001024227chr15821 803 443 213 25 ------
NM_001024228chr15821 803 443 213 25 ------
NM_001024401chr1632832 2182 1802 --1350 --
NM_001024455chrX41889 1064 1023 547 12155 22296 2233 --
NM_001024457chr251046 865 561 548 418 ------
NM_001024601chr1133 ------
NM_001024649chr562221 2178 2123 854 449 94 ------
NM_001024688chr832161 1727 354 11641 ----
NM_001024808chr1262379 818 719 317 199 161 12299 --12583
NM_001024847chr3102532 2501 2402 2282 2178 1011 609 595 225 116 21614 979 --12358
NM_001024934chr62626 438 ------
NM_001024935chr62626 438 ------
NM_001024936chr62626 438 ------
NM_001024937chr172641 572 --1563 --
NM_001024947chr51922 1818 ----
NM_001024956chr1195703 5108 4052 4033 2272 1274 1239 1018 861 15199 14878 15042
NM_001025068chr341797 1744 1200 679 ------
NM_001025069chr341797 1744 1200 679 ------
NM_001025076chr1085424 5200 5187 4663 4177 2499 2383 1346 --24733 1907 14318
NM_001025077chr1076782 6558 6545 6021 5535 2704 161 1535 16091 15676
NM_001025079chr3103093 2598 2539 1129 1095 944 861 621 500 59 --23204 629 --
NM_001025107chr152488 1770 868 801 69 --12709 --
NM_001025107chr152488 1770 868 801 69 --12709 --
NM_001025108chr263473 1613 1085 697 353 329 2678 367 14008 --
NM_001025232chr122132 64 ------
NM_001025266chr3144900 4512 4032 3744 3284 3156 3089 1510 778 632 452 416 393 179 1113 14684 --
NM_001025366chr621473 218 --11516 --
NM_001025366chr621473 218 --11516 --
NM_001025367chr621473 218 --11516 --
NM_001025367chr621473 218 --11516 --
NM_001025368chr621473 218 --11516 --
NM_001025368chr621473 218 --11516 --
NM_001025369chr621489 234 --11532 --
NM_001025369chr621489 234 --11532 --
NM_001025370chr621473 218 --11516 --
NM_001025370chr621473 218 --11516 --
NM_001025595chr421555 1115 --11634 --
NM_001025780chr931274 558 51 ------
NM_001029858chr663010 2945 2325 1223 1181 357 1684 12221 --
NM_001029860chr81303 ------
NM_001029863chr6----22936 429 12217
NM_001029875chr552794 2589 2213 534 164 --11858 --
NM_001029976chr8182 ------
NM_001029998chr461459 1301 1119 968 581 522 --1547 --
NM_001030006chr1732622 2234 769 32361 2074 1644 ----
NM_001030007chr1683515 3399 3012 2673 1098 360 254 228 11052 22949 292 --
NM_001030055chr1463478 1599 540 436 278 108 ------
NM_001031665chr191353 1365 ----
NM_001031677chr51538 ------
NM_001031679chr1263496 3305 3230 2400 2286 1023 33165 1100 922 23282 2212 21325 947
NM_001031690chr772736 1106 1063 1020 977 425 31 --12925 1180
NM_001031695chr2255264 5107 4938 1241 810 ------
NM_001031716chr231085 783 55 ------
NM_001031717chr32873 264 ------
NM_001031723chr4------1413
NM_001031732chr453629 3206 2675 900 221 12604 --13429
NM_001031738chr23452 440 122 ------
NM_001031740chr141430 1285 616 223 21660 315 ----
NM_001031746chr1011400 ------
NM_001031804chr1663756 3557 3250 2907 1224 576 14220 ----
NM_001031812chr561875 1714 940 554 158 105 ------
NM_001032282chr811068 ------
NM_001032283chr12172 ------
NM_001032284chr12172 ------
NM_001032296chr1352683 2371 2275 2163 1119 --21027 676 --
NM_001032393chrX3608 295 134 130 ----
NM_001033044chr131836 1773 1244 2125 52 ----
NM_001033045chr244042 3948 697 318 33305 1463 597 ----
NM_001033056chr131836 1773 1244 2125 52 ----
NM_001033059chr642092 1374 292 231 ------
NM_001033112chr51103 ------
NM_001033117chr374109 3468 1492 1341 842 328 257 11709 14329 1997
NM_001033507chr141971 1747 1502 273 ------
NM_001033518chr722500 781 31756 1143 186 12085 --
NM_001033519chr722500 781 31756 1143 186 12085 --
NM_001033520chr722500 781 31756 1143 186 12085 --
NM_001033551chr1772874 1123 902 498 479 177 74 13243 13349 14101
NM_001033561chr172794 95 --1294 --
NM_001033566chr172352 51 ------
NM_001033568chr172352 51 ------
NM_001033602chr1332320 1044 244 31923 1023 956 1712 --
NM_001033723chr851765 1087 539 398 41 --12704 --
NM_001033756chr621407 152 --11450 --
NM_001033756chr621407 152 --11450 --
NM_001033925chr1021966 870 --31872 434 59 --
NM_001034837chr51122 --1823 --
NM_001034838chr51122 --1823 --
NM_001034841chr1665246 3720 3694 2038 1851 1279 ------
NM_001034850chr511465 ------
NM_001035chr13824 353 219 11174 ----
NM_001035003chr41233 ------
NM_001035004chr41233 ------
NM_001035254chr9--4415 157 130 64 1141 1624
NM_001035260chr102657 358 11311 ----
NM_001035511chr131906 1514 641 ------
NM_001035512chr142013 1621 748 45 ------
NM_001035513chr142013 1621 748 45 ------
NM_001035521chr22258 154 --1638 --
NM_001037131chr22424 139 --11271 --
NM_001037132chr732082 1551 631 1857 ----
NM_001037133chr732082 1551 631 1857 ----
NM_001037164chr711313 ------
NM_001037174chr211608 --11980 --
NM_001037317chr152668 1772 861 616 292 --11824 --
NM_001037332chr532094 526 142 ----1638
NM_001037333chr532094 526 142 ----1638
NM_001037339chr131634 663 29 --1609 --
NM_001037340chr131634 663 29 --1609 --
NM_001037341chr131634 663 29 --1609 --
NM_001037341chr131634 663 29 --1609 --
NM_001037494chr121255 ------
NM_001037495chr121255 ------
NM_001037582chr41234 ------
NM_001037954chr1133094 361 42 22913 2350 13267 --
NM_001038702chr552290 2061 1774 847 784 ------
NM_001038707chr12513 170 1526 22006 1531 1797
NM_001038707chr12513 170 1526 22006 1531 1797
NM_001039199chr2044465 3498 1915 1617 33713 1505 184 14876 --
NM_001039348chr21115 ----1883
NM_001039349chr21115 ----1883
NM_001039372chr72600 26 ------
NM_001039395chr932166 648 84 11914 1301 --
NM_001039459chr71224 1810 31154 761 124 --
NM_001039465chr142477 401 ------
NM_001039538chr293511 3312 2638 2598 2328 2289 1478 1427 327 ----13146
NM_001039547chr367830 7621 7536 7190 1996 1747 15727 26353 5073 --
NM_001039548chr11----162 --
NM_001039569chr232823 850 501 13137 --1694
NM_001039574chr11245 ------
NM_001039577chr194221 4144 4110 3859 3404 3391 2783 1672 408 2867 471 ----
NM_001039585chr154050 3665 2857 684 38 --13819 --
NM_001039590chrX33963 878 355 --13615 --
NM_001039591chrX33963 878 355 --13615 --
NM_001039618chr1144850 4099 2206 316 --14151 --
NM_001039664chr11229 ------
NM_001039690chr1612232 12106 ----
NM_001039711chr14920 908 776 325 --1744 --
NM_001039712chr14920 908 776 325 --1744 --
NM_001039762chr1041674 823 191 120 ------
NM_001039771chr1411017 --1867 --
NM_001039802chr131107 379 137 ----1541
NM_001039840chrX94554 4074 2081 1662 1555 884 335 201 21 ------
NM_001039877chr193778 756 268 --1547 --
NM_001039888chr13788 627 557 ------
NM_001039937chr1332840 1379 1027 1207 1738 14149
NM_001040001chr672077 1685 1404 1306 632 479 21 1819 ----
NM_001040002chr171149 --1228 --
NM_001040020chr731592 1466 41 ------
NM_001040057chr71989 ------
NM_001040101chr441599 1299 1159 606 ------
NM_001040102chr1031937 1085 132 --22286 502 --
NM_001040103chr1031937 1085 132 --22286 502 --
NM_001040110chr71177 ------
NM_001040113chr164970 773 762 103 ------
NM_001040142chr221861 333 11682 ----
NM_001040143chr221861 333 11682 ----
NM_001040144chr1612232 12106 ----
NM_001040146chr1612232 12106 ----
NM_001040151chr1154305 4258 4131 3635 1029 1615 23564 965 23908 293
NM_001040152chr753398 1302 474 402 67 35086 740 502 --1572
NM_001040153chr132229 198 ------
NM_001040157chr422383 950 ----1370
NM_001040172chr531175 552 455 --2420 231 --
NM_001040173chr531175 552 455 --2420 231 --
NM_001040181chr32159 141 ------
NM_001040182chr32159 141 ------
NM_001040183chr32159 141 ------
NM_001040199chr32159 141 ------
NM_001040200chr32159 141 ------
NM_001040202chr411762 1523 12135 --
NM_001040214chr631974 1729 617 2948 426 ----
NM_001040273chr1062063 2044 2000 1747 767 39 1479 ----
NM_001040284chr1665116 4491 3731 2083 1685 1014 11201 13613 13883
NM_001040402chr453104 2609 2008 916 755 1844 ----
NM_001040409chr22362 309 2189 34 ----
NM_001040429chr1322618 363 23426 3171 --1596
NM_001040436chr121406 1619 ----
NM_001040441chr125495 4057 55424 5256 4701 1879 1025 --11961
NM_001040446chr572089 2053 1733 951 830 725 109 22198 1861 --12228
NM_001040450chr1542343 2082 299 233 --22506 181 --
NM_001040453chr1542343 2082 299 233 --22506 181 --
NM_001040624chr842447 2384 2166 526 --12263 --
NM_001040625chr842447 2384 2166 526 --12263 --
NM_001040626chr842447 2384 2166 526 --12263 --
NM_001040627chr842447 2384 2166 526 --12263 --
NM_001040628chr842447 2384 2166 526 --12263 --
NM_001040629chr842447 2384 2166 526 --12263 --
NM_001040630chr842447 2384 2166 526 --12263 --
NM_001040708chr82268 111 ------
NM_001040712chr9--12697 --33283 1235 776
NM_001040715chr1631027 812 131 1364 ----
NM_001040876chr431941 640 101 1691 ----
NM_001042355chr1655272 5103 3610 3391 958 21352 199 14302 --
NM_001042388chr182897 790 ------
NM_001042404chr121845 535 1751 --11441
NM_001042406chr6154 ------
NM_001042412chr1655272 5103 3610 3391 958 21352 199 14302 --
NM_001042413chr983644 3536 3383 2754 2680 1413 934 264 11645 11099 --
NM_001042424chr441271 1106 260 240 1296 ----
NM_001042430chr141111 --1204 --
NM_001042453chrX1655 ----11741
NM_001042481chr1431801 880 399 --12307 --
NM_001042492chr1742665 2458 642 103 ------
NM_001042494chr15183 13438 11072 12450
NM_001042495chr15183 13438 11072 12450
NM_001042496chr15183 13438 11072 12450
NM_001042497chr15183 13438 11072 12450
NM_001042506chrX31170 945 429 --11301 --
NM_001042510chr821340 127 ------
NM_001042511chr821340 127 ------
NM_001042533chr342811 2457 670 622 ------
NM_001042537chrX2325 202 --11567 --
NM_001042555chr1253486 1207 1087 221 171 11270 --13962
NM_001042599chr2127628 7438 7021 6914 5832 5377 5186 3033 2004 1467 1068 637 37779 6553 6530 1111 --
NM_001042601chr363210 3112 2647 2502 2467 630 1513 ----
NM_001042603chr1265322 5060 3895 1363 1335 172 24136 1480 ----
NM_001042604chr311794 1314 ----
NM_001042681chr122503 1012 22477 1879 21046 374 --
NM_001042682chr122503 1012 22477 1879 21046 374 --
NM_001042682chr122503 1012 22477 1879 21046 374 --
NM_001042728chr121767 1327 ----
NM_001042729chr11541 1379 ----
NM_001042747chr11541 1379 ----
NM_001042749chrX21821 1722 11403 ----
NM_001042750chrX21821 1722 11403 ----
NM_001042751chrX21821 1722 11403 ----
NM_001043318chr1433580 1535 1179 --1758 --
NM_001044305chr631465 1450 1038 2571 498 144 --
NM_001044385chr233771 2828 1386 12799 ----
NM_001044387chr1953344 1177 642 279 140 23763 968 --13255
NM_001044388chr1953344 1177 642 279 140 23763 968 --13255
NM_001044722chr561875 1714 940 554 158 105 ------
NM_001044723chr561875 1714 940 554 158 105 ------
NM_001046chr552817 2287 1088 1073 797 ------
NM_001049chr1462351 1789 1762 898 678 286 1685 ----
NM_001066chr112173 1860 --11896
NM_001071775chr1321676 1399 ------
NM_001077628chr11181 1528 ----
NM_001079874chr12547 364 --11815 --
NM_001080418chr1----1146 --
NM_001083620chr432483 1696 484 ------
NM_001092chr1761753 1724 765 699 693 278 2534 107 ----
NM_001095chr1231265 548 338 --21682 103 --
NM_001099678chr365646 4541 3898 2018 894 864 14983 ----
NM_001100108chr1107835 6870 6220 5916 5839 5267 2073 1301 1228 703 37041 6294 5659 15848 --
NM_001106chr387328 7223 7068 5896 2957 2837 950 695 17122 17713 --
NM_001111chr152488 1770 868 801 69 --12709 --
NM_001113490chrX52336 2270 2258 673 469 ----12364
NM_001117chr1821908 388 ------
NM_001121chr1011272 ------
NM_001122679chr54988 968 853 22 ------
NM_001126chr11414 --128 --
NM_001127chr223977 713 198 --1748 --
NM_001128chr1683515 3399 3012 2673 1098 360 254 228 11052 22949 292 --
NM_001130chr191190 ------
NM_001135chr151725 ------
NM_001140chr171191 ------
NM_001143chrY138 ------
NM_001148chr441880 1442 858 206 21760 723 11410 --
NM_001153chr22905 39 ----1698
NM_001156chr101504 ------
NM_001157chr104571 530 272 22 ------
NM_001167chrX35347 4929 1586 76259 5424 4611 4467 4266 2646 2479 --12378
NM_001172chr142656 123 2564 40 ----
NM_001173chr1463478 1599 540 436 278 108 ------
NM_001174chrX22215 153 11461 ----
NM_001177chr1272477 2208 2034 1772 1619 1543 876 --1299 --
NM_001191chr2021418 450 123 1178 --
NM_001194chr191657 ------
NM_001197chr222272 156 ------
NM_001200chr20197 ------
NM_001204chr277380 7373 7332 5329 2593 981 592 35445 5151 5073 ----
NM_001206chr982123 1998 1967 1216 539 205 100 55 1623 ----
NM_001218chr15122679 2231 1741 1045 872 782 677 607 414 329 207 75 12237 32552 2307 59 --
NM_001219chr782306 1841 1686 539 480 229 209 145 ------
NM_001222chr1031802 1786 750 11341 ----
NM_001232chr12949 136 ------
NM_001237chr41404 ------
NM_001237chr41404 ------
NM_001241chr242410 917 619 55 ----1771
NM_001241chr242410 917 619 55 ----1771
NM_001249chr14--1311 ----
NM_001256chr1742463 2169 1149 777 ------
NM_001259chr775964 4986 4514 2512 1825 1550 1135 ------
NM_001262chr11353 ------
NM_001263chr42439 159 ------
NM_001265chr132263 187 ------
NM_001270chr54979 935 728 434 ------
NM_001271chr1572844 2821 2791 2776 581 460 195 2222 144 11091 --
NM_001280chr19------1641
NM_001282chr1732622 2234 769 32361 2074 1644 ----
NM_001283chr7--1610 1160 --
NM_001284chr51373 ------
NM_001293chr11168 ------
NM_001304chr1722649 980 --13615 --
NM_001310chr1252276 1051 901 207 188 1549 --12002
NM_001313chr44890 741 299 244 ------
NM_001315chr621723 1431 21805 33 ----
NM_001329chr10136 --11018 --
NM_001331chr1162521 2302 1989 1851 929 213 12170 ----
NM_001332chr531223 980 21 ------
NM_001345chr12163 --194 --
NM_001346chr372551 1015 1007 370 176 82 59 --2285 115 --
NM_001349chr2186 ------
NM_001351chr331589 376 102 ------
NM_001356chrX42276 2090 1585 708 2670 626 --12117
NM_001358chr4----1351 --
NM_001364chr1184663 4154 3960 3622 2999 851 420 373 24606 1631 44599 4573 4528 954 --
NM_001380chr1031030 382 296 ------
NM_001385chr8149 ------
NM_001386chr851985 770 276 206 56 11767 ----
NM_001387chr552959 2045 2038 921 153 22177 1220 1785 --
NM_001389chr21----1573 --
NM_001390chr1853257 2227 1240 912 766 12332 125 --
NM_001396chr2132087 1824 504 ------
NM_001399chrX41268 974 805 765 2609 368 --13214
NM_001406chr1751667 1146 578 184 123 21338 698 --1628
NM_001408chr14302 208 94 54 11350 ----
NM_001412chrX73460 3192 2867 1315 885 676 296 ----125
NM_001417chr1231834 462 51 ------
NM_001418chr11187 ------
NM_001418chr11187 ------
NM_001419chr1934810 1002 144 ------
NM_001420chr192252 160 --23079 1152 --
NM_001422chr11170 ------
NM_001427chr71322 ------
NM_001429chr221969 ------
NM_001430chr2157 ------
NM_001431chr63898 228 29 1773 ----
NM_001432chr443640 2878 1278 828 ------
NM_001438chr133153 362 292 ------
NM_001440chr84881 683 420 319 ------
NM_001448chrX--1286 ----
NM_001449chrX21263 1220 ------
NM_001452chr62635 629 ------
NM_001453chr631774 1703 1685 1307 ----
NM_001461chr11211 ------
NM_001478chr122917 127 3697 592 94 ----
NM_001494chr101204 --1136 --
NM_001521chr22258 154 --1638 --
NM_001530chr1421097 21 ------
NM_001543chr5103774 3696 3652 3255 3214 1917 1392 345 234 120 21895 621 ----
NM_001546chr621232 207 1146 ----
NM_001554chr1--2487 428 --1453
NM_001584chr112871 73 ------
NM_001587chrX1446 1457 1269 --
NM_001604chr111875 ------
NM_001609chr1043237 3043 2781 1499 ------
NM_001616chr222619 1071 13518 ----
NM_001621chr722474 927 12219 --1577
NM_001621chr722474 927 12219 --1577
NM_001634chr642092 1374 292 231 ------
NM_001635chr72430 204 11079 ----
NM_001642chr112933 292 ------
NM_001649chrX22439 67 --11645 1940
NM_001650chr1842953 1203 1083 451 11041 ----
NM_001655chr1161827 1775 1769 836 785 183 ----12161
NM_001658chr15821 803 443 213 25 ------
NM_001659chr1272576 2498 2220 1061 857 813 386 52484 2270 2175 1712 218 12442 --
NM_001660chr31630 ------
NM_001661chr17149 ------
NM_001663chr1421764 825 ------
NM_001664chr34977 853 409 229 1397 ----
NM_001668chr162139 1968 1599 922 828 589 ------
NM_001677chr131167 357 108 ------
NM_001678chr1751624 1230 455 441 302 ----11679
NM_001682chr1222648 123 ------
NM_001683chr382604 2531 2524 2317 1858 1832 595 343 22651 200 1897 --
NM_001684chr173345 3228 2934 2623 1227 316 249 13533 11400 --
NM_001688chr12606 222 1877 ----
NM_001689chr221876 407 ------
NM_001690chr34927 590 540 248 --1178 --
NM_001693chr82811 69 11155 ----
NM_001694chr16--159 ----
NM_001701chr921544 1344 11419 --11128
NM_001703chr11298 ----160
NM_001704chr63447 385 51 ------
NM_001706chr32988 69 ------
NM_001709chr1131769 978 853 --2396 226 1754
NM_001730chr131648 ------
NM_001730chr131648 ------
NM_001731chr121379 ------
NM_001743chr21135 1568 ----
NM_001746chr562221 2178 2123 854 449 94 ------
NM_001748chr13293 276 76 ------
NM_001753chr721526 1479 2506 374 ----
NM_001754chr21--11050 13234 --
NM_001759chr1234585 1962 1424 1959 31183 1169 1032 --
NM_001777chr3103093 2598 2539 1129 1095 944 861 621 500 59 --23204 629 --
NM_001788chr71775 ------
NM_001791chr131107 379 137 ----1541
NM_001792chr182880 205 ------
NM_001797chr162738 244 ------
NM_001798chr122857 117 ------
NM_001799chr51223 ------
NM_001800chr192191 70 ------
NM_001830chrX3869 779 335 21507 1146 13986 --
NM_001839chr1----1143 --
NM_001844chr12--175 ----
NM_001845chr1311087 ------
NM_001858chr665051 4048 3774 3707 3661 1270 21188 206 ----
NM_001859chr983594 3495 2654 2443 1306 1272 987 975 33811 1456 759 ----
NM_001874chr1274228 4059 3937 3527 1131 243 215 64750 3838 1533 651 83 57 ----
NM_001879chr331622 1503 163 ------
NM_001880chr2134 ------
NM_001881chr102517 511 ------
NM_001882chr51571 ------
NM_001890chr41368 ------
NM_001895chr202397 368 ----196
NM_001903chr52707 655 ------
NM_001904chr31260 1785 ----
NM_001918chr1118349 7012 6928 6739 6113 5702 3477 3320 3067 2696 1893 69160 8680 6745 2603 1870 543 15937 28436 8325
NM_001920chr121525 ------
NM_001921chr411238 ------
NM_001924chr1180 ------
NM_001938chr121897 562 1753 ----
NM_001945chr52298 273 21150 890 ----
NM_001949chr661201 1187 1010 840 729 723 23219 686 ----
NM_001951chr82654 228 ----1549
NM_001955chr62271 65 ----1150
NM_001968chr42849 271 --1796 --
NM_001969chr1433536 681 115 ----13081
NM_001973chr13362 126 50 ------
NM_001977chr421429 204 ------
NM_001980chr1221953 1506 ------
NM_001981chr111744 1559 ----
NM_001987chr1274092 4019 3906 3804 3627 3279 1431 11127 22870 134 --
NM_001995chr421163 219 ------
NM_001999chr521518 346 ------
NM_002006chr445540 1563 872 765 ------
NM_002015chr1363192 2917 1072 956 415 23 22047 1288 ----
NM_002023chr12633 206 2500 491 ----
NM_002024chrX1337 1238 ----
NM_002025chrX148905 7924 6681 6381 5990 5970 3387 2770 1950 1934 1702 1491 1418 1197 21817 41 17963 1848
NM_002035chr1853873 3686 1488 611 88 13382 21406 1376 11479
NM_002037chr61164 1294 ----
NM_002039chr43936 764 260 187 180 --
NM_002040chr2123075 145 --11211 --
NM_002045chr3181 ------
NM_002048chr931190 181 48 ------
NM_002051chr101860 ------
NM_002054chr21435 ------
NM_002061chr131735 1374 526 21947 1472 ----
NM_002065chr131836 1773 1244 2125 52 ----
NM_002074chr161538 1490 1388 1153 344 227 144 ----
NM_002077chr952133 1835 679 150 40 ------
NM_002078chr31104 ------
NM_002082chr5----1757 --
NM_002083chr142296 100 135 ----
NM_002087chr171302 ------
NM_002106chr42341 42 ------
NM_002114chr6141 ----1484
NM_002126chr1753527 2716 1052 517 334 --12778 --
NM_002130chr521479 1407 11108 1466 --
NM_002136chr121142 1237 ----
NM_002137chr742019 1780 1723 315 ------
NM_002140chr921202 904 --1129 --
NM_002146chr171941 --1558 --
NM_002154chr51162 ------
NM_002157chr2--146 1169 --
NM_002158chr243693 2416 857 25 22471 1200 1655 --
NM_002167chr11510 ------
NM_002184chr5--1164 ----
NM_002192chr71492 --1616 --
NM_002193chr22389 367 ------
NM_002194chr21172 ------
NM_002196chr203868 175 73 ----1878
NM_002196chr203868 175 73 ----1878
NM_002199chr41757 ------
NM_002203chr593617 2901 1554 1490 1119 1056 948 349 279 ------
NM_002204chr1741292 1070 998 410 ------
NM_002210chr243373 3013 2619 933 --1631 --
NM_002211chr1011085 ------
NM_002214chr793948 3557 3538 1917 1528 1192 517 304 126 24109 1085 --1457
NM_002222chr32423 119 ------
NM_002223chr1273133 2815 1305 1281 1147 1033 227 13497 ----
NM_002228chr13843 402 321 --1940 --
NM_002232chr1--11136 --1133
NM_002234chr121130 ----1216
NM_002239chr21341 ------
NM_002247chr1011437 ------
NM_002249chr12524 88 ------
NM_002252chr21129 ------
NM_002253chr421087 1015 11060 1353 --
NM_002254chr21531 22185 391 12240 11977
NM_002264chr375013 4928 4316 676 613 350 227 24900 1776 ----
NM_002266chr171234 ------
NM_002267chr1342216 740 379 32 --1345 --
NM_002268chr311807 ------
NM_002270chr565279 3849 3794 3553 1718 688 15256 ----
NM_002271chr1331680 1667 637 --12387 --
NM_002283chr123760 226 157 ------
NM_002285chr263473 1613 1085 697 353 329 2678 367 14008 --
NM_002290chr61313 1975 ----
NM_002293chr162734 2151 2077 757 244 100 12337 22496 2137 --
NM_002294chrX177 ------
NM_002296chr121712 1495 --130 --
NM_002298chr132513 34 184 --1107
NM_002309chr2232776 2285 2211 1152 ----
NM_002310chr576404 6233 5413 4528 4288 2462 452 --1788 15248
NM_002315chr11--179 ----
NM_002334chr1121762 719 1249 ----
NM_002336chr1234959 1688 861 13618 14197 --
NM_002351chrX21682 1259 ------
NM_002356chr622575 2257 1222 ----
NM_002359chr1763095 1237 1118 585 431 391 12815 24127 3229 --
NM_002373chr152177 34 ----1934
NM_002374chr293511 3312 2638 2598 2328 2289 1478 1427 327 ----13146
NM_002375chr332207 2064 348 12159 21855 180 --
NM_002382chr1431215 1181 1057 11247 ----
NM_002387chr5115166 4871 4781 4616 4576 3975 3186 1961 1290 871 285 23269 3193 --11496
NM_002395chr6196 ------
NM_002397chr531705 540 227 ------
NM_002398chr221084 310 --1179 --
NM_002399chr152405 313 --1116 --
NM_002401chr1742338 860 739 485 32275 2048 1009 11865 --
NM_002408chr143697 583 315 ------
NM_002409chr2243143 2807 2402 790 ------
NM_002430chr2242199 2134 1723 675 --1304 --
NM_002442chr1231580 1559 1109 ------
NM_002469chr123410 340 142 ------
NM_002480chr121566 1924 ----
NM_002481chr187945 7535 6142 3023 1921 1653 979 823 67665 7236 2806 2295 2084 435 1115 36659 965 152
NM_002485chr832161 1727 354 11641 ----
NM_002486chr952421 2241 1569 755 105 21899 466 --11003
NM_002487chr152773 708 ------
NM_002489chr7----1314 1407
NM_002499chr1562493 2401 1969 1642 1623 609 ------
NM_002500chr221291 928 1939 --1113
NM_002506chr1----140 --
NM_002508chr141596 1547 536 476 ----149
NM_002515chr1411959 1787 ----
NM_002519chr111613 ------
NM_002522chr1742711 2639 1234 203 23268 1179 ----
NM_002524chr11235 ------
NM_002526chr611628 ------
NM_002538chr51474 ----1194
NM_002539chr21213 ------
NM_002545chr1154668 3240 1254 622 307 --1943 --
NM_002553chr71395 ------
NM_002568chr81306 ------
NM_002572chr111268 ------
NM_002578chrX1153 --1323 --
NM_002581chr975513 4726 3965 1955 1923 1586 1441 --1523 15183
NM_002586chr611446 --1350 --
NM_002588chr511743 21093 374 ----
NM_002589chr4157 ------
NM_002594chr2021963 1892 2657 61 ----
NM_002595chr1241867 1299 771 525 11898 ----
NM_002600chr131634 663 29 --1609 --
NM_002607chr731115 221 158 --178 --
NM_002612chr742038 1465 722 21 ------
NM_002613chr1675063 4524 4389 3446 2077 1453 1367 24500 4212 11811 11234
NM_002627chr10158 ------
NM_002628chr331057 437 429 ------
NM_002645chr1192962 2898 2568 2221 1235 1103 965 647 89 22060 860 --1919
NM_002646chr122153 1840 21901 1724 ----
NM_002648chr61231 1143 ----
NM_002653chr54337 190 153 146 ------
NM_002655chr855162 4235 3306 1707 1195 24942 1942 14417 14355
NM_002657chr2093690 3643 2735 2481 1542 1359 679 527 276 22754 694 ----
NM_002662chr331369 624 533 ------
NM_002667chr6198 2932 342 ----
NM_002687chr143414 281 154 ------
NM_002698chr191323 --12544 --
NM_002707chr24375 362 303 130 1140 ----
NM_002709chr252737 2455 2246 489 195 1725 ----
NM_002710chr121970 1187 ----
NM_002715chr541309 833 518 103 ------
NM_002716chr111242 21331 415 13320 --
NM_002717chr83650 462 31 ------
NM_002719chr1432275 2034 95 21532 660 ----
NM_002721chr9----1354 --
NM_002730chr191285 ------
NM_002731chr142931 155 45 32 22227 110 12345 --
NM_002734chr1721977 850 ------
NM_002736chr711910 1236 ----
NM_002738chr162716 389 1738 ----
NM_002739chr192668 591 2119 65 ----
NM_002740chr332575 1840 904 11977 ----
NM_002742chr141678 ------
NM_002745chr2253549 2939 1666 761 718 1482 13377 --
NM_002752chr5----1213 --
NM_002763chr1--1464 ----
NM_002776chr194711 683 323 174 21792 1328 11902 --
NM_002819chr1921491 1095 151 11335 --
NM_002821chr63803 744 511 ------
NM_002822chr1251580 1189 590 459 134 176 --21620 260
NM_002823chr2166 1482 ----
NM_002825chr7--1441 ----
NM_002827chr2021525 1110 21178 394 21242 1190 --
NM_002828chr182981 225 ------
NM_002829chr9124 ------
NM_002833chr151361 11389 21395 624 --
NM_002835chr72161 22 ------
NM_002837chr1284603 4512 3955 3736 2917 1291 942 917 14247 ----
NM_002839chr9--12697 --33283 1235 776
NM_002840chr121528 274 11269 --11498
NM_002843chr1121247 215 ----11081
NM_002844chr6180 11353 ----
NM_002848chr1261278 1232 867 283 256 201 ------
NM_002849chr121370 ------
NM_002852chr3299 45 ------
NM_002855chr1152862 1050 896 758 34 185 ----
NM_002858chr131329 1314 547 ------
NM_002859chr1231377 663 234 11557 ----
NM_002863chr14162 ------
NM_002867chr14630 188 114 90 ------
NM_002869chr1121779 414 ------
NM_002874chr941999 1979 871 297 ----128
NM_002886chr364655 4246 1638 1572 1129 204 --14592 13415
NM_002890chr52396 100 159 --1112
NM_002893chrX1331 --1348 --
NM_002894chr18--1192 ----
NM_002902chr15----195 1252
NM_002912chr61182 ------
NM_002923chr12626 255 ------
NM_002924chr12501 49 2564 181 --1143
NM_002930chr18128 ----1257
NM_002940chr431941 640 101 1691 ----
NM_002942chr341322 1051 474 315 ------
NM_002943chr15121 ------
NM_002945chr172250 180 1728 1783 --
NM_002959chr154055 3808 2848 1456 342 1524 21189 58 --
NM_002968chr164439 140 68 33 ------
NM_002970chrX--1108 ----
NM_002971chr31900 1392 ----
NM_002998chr821898 587 --11850 --
NM_003001chr142013 1621 748 45 ------
NM_003010chr17----1148 --
NM_003011chr921132 643 1144 ----
NM_003012chr852992 2677 507 153 147 ----23053 176
NM_003013chr4----194 1576
NM_003016chr1721769 1416 ------
NM_003022chrX2388 139 --1523 --
NM_003026chr9--1835 ----
NM_003030chr331981 1341 42 ------
NM_003036chr141240 869 287 273 ------
NM_003043chr373377 2912 1638 1201 1194 1021 342 33369 1382 920 12955 --
NM_003045chr1364979 4446 4243 4040 691 258 --11370 34117 1098 402
NM_003060chr551229 1032 972 406 154 ------
NM_003068chr8146 --1679 --
NM_003071chr331794 666 377 1494 ----
NM_003074chr361592 846 728 196 169 143 21901 1470 ----
NM_003075chr121301 ------
NM_003076chr1231176 616 394 1425 1677 --
NM_003077chr17------1677
NM_003081chr201805 ----1367
NM_003088chr731069 200 175 ------
NM_003096chr2--1175 ----
NM_003099chr15106195 6171 5996 5408 2637 1973 1459 1367 609 341 14680 35590 1268 460 --
NM_003100chr5----2405 166 --
NM_003101chr131509 379 188 2133 110 ----
NM_003106chr32193 111 11074 ----
NM_003107chr631681 228 194 ----11876
NM_003108chr295869 5083 5036 2916 2070 1863 1033 997 435 16820 24484 2559 27259 6536
NM_003110chr173363 316 112 1759 ----
NM_003111chr21944 ----1962
NM_003112chr732757 2374 988 --22935 2407 --
NM_003113chr2166 ----1573
NM_003128chr222642 175 ------
NM_003131chr642285 1922 1915 598 21897 151 ----
NM_003137chr611677 ------
NM_003139chr114812 683 261 149 ------
NM_003142chr2--194 ----
NM_003144chr632075 1879 1843 --11653 --
NM_003150chr17--1844 21935 440 --
NM_003153chr1261058 859 200 183 125 68 ------
NM_003155chr862436 1984 884 311 190 173 --12092 --
NM_003156chr1141328 1229 389 241 1253 ----
NM_003157chr31953 ------
NM_003161chr1723005 1066 ----22991 126
NM_003178chr311725 --11477 --
NM_003179chrX21129 391 1184 ----
NM_003185chr2031096 534 195 ------
NM_003189chr131162 1100 434 13288 --12873
NM_003194chr6------1481
NM_003199chr1875121 4990 4598 3761 585 163 47 --186 --
NM_003200chr1941840 375 259 225 ------
NM_003202chr5--11643 --1621
NM_003203chr221780 45 1906 ----
NM_003204chr1711320 ------
NM_003211chr1221151 522 1227 ----
NM_003214chr6----2458 158 --
NM_003221chr6103397 3200 3192 3128 3119 3092 2859 1629 1132 253 --11211 11222
NM_003222chr202918 350 --1326 --
NM_003223chr161579 ------
NM_003239chr143845 759 59 ----1390
NM_003242chr3102532 2501 2402 2282 2178 1011 609 595 225 116 21614 979 --12358
NM_003244chr181347 1162 ----
NM_003246chr1532020 1456 94 1295 ----
NM_003250chr171348 1464 ----
NM_003253chr2121772 1309 ------
NM_003257chr1511354 167 ----
NM_003262chr3135281 4977 4438 4321 3698 3653 3477 1755 1641 1230 1011 796 129 --1561 1912
NM_003269chr611101 1152 ----
NM_003275chr91407 --1375 --
NM_003281chr174997 2049 1839 1142 719 593 114 --53926 3696 3461 962 326 --
NM_003288chr2041582 1306 1022 202 11413 ----
NM_003291chr132803 518 ------
NM_003299chr12----1178 --
NM_003300chr14------1196
NM_003304chr321480 387 1586 ----
NM_003319chr23617 29 22 ------
NM_003325chr22----146 --
NM_003326chr12938 876 12135 ----
NM_003336chrX21083 71 ------
NM_003338chr1021823 639 ------
NM_003339chr5--11114 21588 1196 --
NM_003340chr421207 329 1302 ----
NM_003342chr1723122 2628 179 1557 --
NM_003344chr7------1213
NM_003348chr1221571 31 ------
NM_003352chr22979 366 ------
NM_003366chr161169 ------
NM_003368chr11276 ------
NM_003369chr1142579 2520 1101 873 ------
NM_003371chr92627 595 150 ----
NM_003373chr1081787 1562 1294 1240 386 230 181 164 --2351 321 --
NM_003374chr52826 693 ------
NM_003376chr621473 218 --11516 --
NM_003376chr621473 218 --11516 --
NM_003383chr91189 ------
NM_003385chr22998 160 ------
NM_003387chr232502 699 317 11100 ----
NM_003390chr1111143 ----1968
NM_003392chr364078 4013 3772 3708 2774 30 ------
NM_003394chr123539 280 91 ------
NM_003403chr141337 ------
NM_003404chr2041506 531 210 37 ------
NM_003406chr831416 646 500 ----1597
NM_003409chr1831478 333 22 ------
NM_003410chrX32916 2453 769 --12602 12574
NM_003412chr31954 12110 12852 --
NM_003413chrX2469 306 ------
NM_003421chr1053479 3117 1178 373 255 11562 ----
NM_003423chr1931689 1013 67 12075 12646 22555 800
NM_003430chr1931110 665 131 ------
NM_003439chr763454 3031 939 754 310 120 23157 2490 ----
NM_003442chr112157 101 ------
NM_003453chr132208 91 ------
NM_003455chr1141694 1648 549 508 ------
NM_003458chr353270 2965 1468 1286 964 33276 3255 885 --1534
NM_003463chr633123 724 520 11342 ----
NM_003466chr21435 21980 558 22467 132 1765
NM_003468chr274086 3256 1441 1051 954 704 79 12835 ----
NM_003469chr2132 ------
NM_003474chr1042157 1860 1518 772 ----11744
NM_003478chr1162387 2049 1104 867 456 181 --1199 12510
NM_003482chr1242457 2447 2043 585 ------
NM_003483chr1252485 832 565 483 406 12368 --1774
NM_003489chr2121259 893 --2744 225 --
NM_003498chr1672749 2462 2259 2236 2219 487 104 ------
NM_003502chr162617 217 ------
NM_003543chr6121 ------
NM_003559chr1743381 2576 2497 1017 --23178 1471 --
NM_003564chr11573 --2192 78 --
NM_003566chr1223174 485 ------
NM_003569chr61588 ------
NM_003576chr1352683 2371 2275 2163 1119 --21027 676 --
NM_003581chr24805 377 179 21 --11011 --
NM_003583chr1293610 3343 3206 1293 1235 1018 612 514 335 ------
NM_003589chr1311284 ------
NM_003590chr232909 1621 146 ------
NM_003601chr41202 ------
NM_003603chr411607 ------
NM_003607chr1104189 3892 3438 3282 3047 2650 1361 796 278 36 33776 865 237 1938 --
NM_003612chr152102 64 ------
NM_003615chr323403 810 ------
NM_003618chr211180 ----1937
NM_003620chr171768 ------
NM_003624chr1921213 552 ------
NM_003628chr21671 ----1695
NM_003633chr542358 2236 2170 1031 141 ----
NM_003637chr121374 574 21228 435 ----
NM_003655chr17132 ------
NM_003659chr231207 825 222 ------
NM_003663chr313408 ------
NM_003670chr31378 ------
NM_003672chr121447 1270 ------
NM_003677chr1211609 22299 1951 ----
NM_003679chr182801 2603 2459 2275 1154 683 269 218 1765 12209 --
NM_003685chr191175 ------
NM_003692chr92703 314 ------
NM_003716chr31370 ------
NM_003728chr4--1107 ----
NM_003732chr52307 226 ------
NM_003735chr511743 21093 374 ----
NM_003736chr511743 21093 374 ----
NM_003737chr112423 63 ------
NM_003741chr31128 ----1333
NM_003743chr221740 1505 22150 1924 ----
NM_003746chr121255 ------
NM_003750chr10152 ------
NM_003758chr151144 ------
NM_003758chr151144 ------
NM_003760chr11698 ------
NM_003763chr2013116 22319 1023 --12608
NM_003766chr171494 ------
NM_003768chr151788 509 322 157 48 --1298 --
NM_003769chr12------172
NM_003778chr31674 ------
NM_003787chr1821309 652 ------
NM_003795chr61121 1193 ----
NM_003797chr111156 ------
NM_003800chr61454 12222 12395 --
NM_003825chr1531005 95 36 --11388 11510
NM_003829chr921104 129 ------
NM_003872chr242675 2103 2096 449 32398 2320 37 12748 --
NM_003873chr1042410 2050 2003 797 ----12544
NM_003876chr17----175 --
NM_003884chr331651 1174 530 ------
NM_003895chr2132178 1399 847 1752 11349 --
NM_003901chr1082515 2436 1837 1821 1737 987 835 442 ------
NM_003902chr1------1244
NM_003913chr663740 3531 3205 3018 1182 1056 13556 33411 3117 3035 --
NM_003922chr15150 ------
NM_003927chr1831018 863 442 ------
NM_003931chr62626 438 ------
NM_003932chr2221743 237 ------
NM_003934chr9----11125 11291
NM_003936chr24374 309 242 51 1232 ----
NM_003939chr1073195 3140 1526 866 773 664 433 13953 --12624
NM_003941chr72410 199 1261 ----
NM_003944chr1145 --125 --
NM_003947chr34993 900 836 397 --11138 --
NM_003956chr10153 ------
NM_003968chr32455 128 ------
NM_003972chr10--11359 ----
NM_003980chr61552 ------
NM_003983chr16114324 4296 3777 3331 3240 2740 1216 1177 746 252 143 --11742 --
NM_003994chr1244423 4032 3614 3144 11135 ----
NM_004028chr1842953 1203 1083 451 11041 ----
NM_004034chr101504 ------
NM_004035chr1784880 4622 3735 3728 3665 3270 3230 868 14216 24731 3746 14900
NM_004036chr22643 95 ------
NM_004040chr23932 895 886 ------
NM_004050chr1422559 2068 11099 22023 551 --
NM_004061chr52556 531 --3516 433 130 --
NM_004073chr11251 ------
NM_004078chr121073 33 31006 971 55 ----
NM_004079chr142764 2703 874 584 21092 390 ----
NM_004081chrY31673 1166 475 --11617 --
NM_004087chr32581 338 11649 ----
NM_004089chrX11189 1163 ----
NM_004093chr1352981 2068 956 908 577 1552 2202 127 13235
NM_004094chr1452940 2076 1968 920 199 11960 ----
NM_004096chr1031338 789 639 ------
NM_004098chr102506 358 --1930 --
NM_004100chr631808 443 215 --1359 --
NM_004103chr82825 756 ------
NM_004105chr21115 ----1883
NM_004111chr111230 ------
NM_004113chr362026 1649 492 400 233 140 ------
NM_004117chr621423 700 1206 --12051
NM_004124chr1462789 2643 2253 732 686 250 --12228 11084
NM_004132chr105764 454 399 390 32 --11187 --
NM_004161chr221389 515 ------
NM_004162chr32395 232 ----1496
NM_004171chr1189338 8972 8609 8030 6298 2663 2247 1021 --17460 26498 364
NM_004187chrX3970 415 240 1313 ----
NM_004193chr103368 349 60 1206 ----
NM_004200chr1172804 2567 2071 1213 1138 520 382 1900 ----
NM_004202chrY134 ------
NM_004215chr8----1498 --
NM_004229chrX31561 547 150 11384 21900 704 --
NM_004232chr1833718 3519 592 ------
NM_004235chr91853 1226 ----
NM_004236chr15----1422 --
NM_004241chr10------1550
NM_004264chr1221279 159 --11109 --
NM_004267chr31141 ------
NM_004272chr53616 280 118 --1638 --
NM_004274chr1452979 2580 2096 661 345 13087 12828 --
NM_004277chr611401 1690 ----
NM_004293chr953188 2986 2493 1410 993 21088 470 ----
NM_004296chr1443904 2460 1379 363 34058 3104 63 --1265
NM_004301chr3163 1389 ----
NM_004302chr1262854 2631 2526 2507 1880 161 ------
NM_004306chr8------158
NM_004311chr1092915 2852 2824 2753 2560 2266 2048 609 423 22998 156 ----
NM_004331chr831984 1778 981 ------
NM_004337chr861967 1928 1644 1556 756 255 ------
NM_004342chr732211 2191 463 12241 ----
NM_004349chr8----11095 --
NM_004354chr41657 ------
NM_004369chr23640 468 125 --1274 --
NM_004379chr22481 195 11760 ----
NM_004380chr1652301 1935 1662 943 688 ------
NM_004384chr561875 1714 940 554 158 105 ------
NM_004385chr51676 ------
NM_004389chr21239 --1201 --
NM_004391chr372033 1882 1720 1684 1431 405 373 --11498 --
NM_004392chr1352426 1926 524 445 56 1737 ----
NM_004393chr342300 1646 1529 796 ------
NM_004397chr1133428 2805 794 --13472 --
NM_004404chr242018 384 362 38 --21906 218 21399 64
NM_004408chr91143 1348 ----
NM_004414chr2151187 1017 974 390 37 127 ----
NM_004417chr52419 192 ------
NM_004420chr1131950 1634 814 ------
NM_004426chr1221394 517 11352 21314 40 --
NM_004427chr131011 418 271 --21019 69 --
NM_004428chr14648 568 262 109 2810 60 ----
NM_004430chr832191 2142 949 32371 1029 907 ----
NM_004433chr131467 546 469 --1534 --
NM_004437chr122295 1162 2941 240 ----
NM_004438chr252955 2898 2386 1164 1042 13016 22063 786 --
NM_004440chr6----11957 --
NM_004441chr33458 426 402 --11204 --
NM_004443chr31292 ------
NM_004449chr211989 --1559 --
NM_004450chr142306 111 ------
NM_004454chr342097 1517 721 577 11626 ----
NM_004455chr131071 931 811 ----11108
NM_004457chr2196 ------
NM_004458chrX32660 2242 1963 ------
NM_004459chr1711657 ------
NM_004463chrX1585 ----140
NM_004464chr433037 1405 1042 --21138 210 --
NM_004472chr53664 456 85 ------
NM_004474chr12401 35 1135 1317 --
NM_004480chr143698 631 124 ------
NM_004482chr23336 328 302 ----1636
NM_004487chr3128 1775 ----
NM_004494chr11349 1141 1211 --
NM_004496chr142455 330 ------
NM_004497chr19----1579 183
NM_004499chr51148 ------
NM_004501chr153636 3599 2662 1540 346 13993 --2482 93
NM_004504chr22787 266 --13018 --
NM_004505chr1731812 1634 1593 ------
NM_004506chr6----1160 --
NM_004514chr1772866 2772 2328 1058 871 170 74 1478 22311 149 --
NM_004516chr1911137 142 ----
NM_004520chr5--1679 2534 155 --
NM_004521chr10193 ------
NM_004525chr231312 82 38 ------
NM_004527chr171149 --1228 --
NM_004529chr931119 230 104 2923 357 ----
NM_004535chr2031796 1753 160 ----1567
NM_004537chr1221150 242 11518 ----
NM_004540chr212246 164 --1147 --
NM_004543chr2121 ------
NM_004549chr11------11070
NM_004560chr9186 1339 --1666
NM_004571chr2153295 3065 2334 880 271 12496 --1983
NM_004575chr41398 ------
NM_004576chr5----1149 --
NM_004578chr11824 ------
NM_004580chr1531633 615 447 ------
NM_004583chr172531 256 2170 65 ----
NM_004586chrX54909 4730 4136 1937 875 23350 1731 ----
NM_004588chr1173151 3124 1468 1462 1081 421 177 1552 ----
NM_004593chr3----1764 1749
NM_004598chr562675 2350 2260 1329 1174 50 ------
NM_004600chr11415 ------
NM_004603chr711062 242 23 ----
NM_004612chr983672 3447 1450 1323 656 500 412 398 1977 14879 --
NM_004622chr222286 155 --11817 --
NM_004626chr111541 ----184
NM_004631chr131043 989 228 --155 2933 473
NM_004634chr3------1183
NM_004637chr331306 1282 1112 ----11017
NM_004654chrY11084 ------
NM_004655chr1731172 1047 243 ------
NM_004656chr33974 73 32 1948 1150 --
NM_004660chrY22181 1527 2666 622 22041 653 --
NM_004663chr1511590 --1408 --
NM_004671chr181227 ------
NM_004684chr41266 2354 56 ----
NM_004686chr861732 1205 718 512 389 345 11707 147 --
NM_004687chr171511 21837 1503 11999 --
NM_004694chr172703 234 199 1307 --
NM_004705chr111247 --2657 603 --
NM_004717chr72525 442 21200 969 ----
NM_004719chr1222859 2273 11018 1599 12662
NM_004721chr32303 79 ------
NM_004725chr1021483 55 ------
NM_004726chrX65688 4961 4215 3630 1985 204 1153 ----
NM_004730chr542068 1446 588 179 ------
NM_004733chr3121 ------
NM_004734chr1332724 89 62 ------
NM_004740chr172118 69 ------
NM_004742chr3----2454 299 --
NM_004745chr8186691 6630 6197 5623 4720 2742 2630 2608 2031 1677 702 528 510 485 418 240 121 113 16099 56917 5955 4427 2154 623 --
NM_004748chr1513712 1425 ----
NM_004758chr17--11084 11036 --
NM_004760chr762187 1922 1656 768 725 499 21992 1586 2841 347 1753
NM_004768chr12856 49 ------
NM_004772chr551547 1399 1348 322 201 ------
NM_004774chr1731936 1093 522 11157 1427 --
NM_004775chr1822104 1851 ------
NM_004776chr2073256 3034 1300 1263 941 907 599 ------
NM_004779chr54886 536 230 222 1895 ----
NM_004781chr121101 304 1167 ----
NM_004781chr121101 304 1167 ----
NM_004788chr1122137 959 ----22692 2463
NM_004796chr142309 274 1721 ----
NM_004801chr241191 1173 576 24 --11180 --
NM_004805chr21292 ------
NM_004808chr1042482 2371 686 244 43153 2105 960 74 21208 508 --
NM_004814chr11155 ------
NM_004815chr1114893 4697 4249 4104 4093 3593 3476 3334 3258 3017 884 13122 11108 --
NM_004821chr55581 556 317 165 41 ------
NM_004830chr6----1752 --
NM_004831chr194923 912 325 28 ------
NM_004834chr233235 2609 2282 1203 ----
NM_004839chr151148 --1449 --
NM_004840chrX32305 393 84 11626 ----
NM_004845chrX43400 3271 1061 167 21070 249 11082 --
NM_004850chr241329 1113 622 126 11756 ----
NM_004859chr1742354 1074 313 61 2711 651 --22497 182
NM_004863chr1495220 4691 4031 3620 3458 907 855 806 330 44906 4208 1764 145 185 --
NM_004866chr544973 1820 401 257 14348 ----
NM_004869chr18--1125 1179 --
NM_004871chr1734164 3125 1668 ------
NM_004874chr8152 ----1112
NM_004879chr111294 ------
NM_004884chr1541351 657 620 533 --11742 --
NM_004887chr52847 414 ------
NM_004896chr102572 273 21226 586 ----
NM_004898chr422427 1084 22529 2312 12174 --
NM_004904chr7116603 5577 5564 5546 5180 4952 4293 2399 1629 1329 1280 ----24095 779
NM_004921chr131903 1802 316 1366 ----
NM_004922chr102764 170 ------
NM_004924chr19399 80 72 ------
NM_004925chr93811 71 26 ------
NM_004926chr1441374 664 539 87 133 --11645
NM_004929chr841361 1147 484 392 ------
NM_004932chr54658 499 165 77 ----1325
NM_004936chr932411 2344 206 31980 432 370 1598 1268
NM_004947chr352595 2119 1947 1830 112 31741 672 56 ----
NM_004948chr1821060 361 21439 1305 ----
NM_004952chr12955 811 ------
NM_004953chr31324 ------
NM_004956chr723122 3053 13096 33072 1443 972 --
NM_004958chr12852 751 ------
NM_004961chrX1125 11029 ----
NM_004965chr21------1282
NM_004966chr101822 ------
NM_004969chr10140 ------
NM_004985chr1274513 4420 3949 1669 1373 1149 579 12825 ----
NM_004992chrX158231 7833 7613 7235 6013 5821 5765 5667 3086 2684 2557 2289 1336 1262 454 47893 7367 6847 1007 27729 391 --
NM_004992chrX158231 7833 7613 7235 6013 5821 5765 5667 3086 2684 2557 2289 1336 1262 454 47893 7367 6847 1007 27729 391 --
NM_004995chr1431315 1055 25 1432 ----
NM_004998chr151971 1184 ----
NM_004999chr6104323 4301 3777 3651 3521 3420 3095 2738 1425 404 34077 3143 81 1566 --
NM_005010chr732082 1551 631 1857 ----
NM_005011chr71177 ------
NM_005016chr121128 ------
NM_005020chr72604 490 ------
NM_005023chr521213 387 ----1356
NM_005026chr152017 1971 1831 1683 743 ------
NM_005028chr1022295 303 --1616 12186
NM_005045chr71362 1968 ----
NM_005055chr11277 38 ------
NM_005056chr1265566 5304 4139 1607 1579 416 24380 1724 ----
NM_005057chr11461 21897 1702 ----
NM_005063chr1032986 2676 2406 1119 ----
NM_005065chr1444156 3485 278 60 --43512 2136 1899 633 --
NM_005066chr1--125 ----
NM_005073chr131683 ----176
NM_005095chr122046 494 11703 ----
NM_005096chrX31078 433 133 ------
NM_005097chr10189 1268 ----
NM_005103chr111305 155 ----
NM_005110chr51667 ------
NM_005112chr41987 ----1289
NM_005114chr41560 ------
NM_005116chr2063723 1767 1677 999 302 104 24133 3660 14090 --
NM_005121chr1723309 3221 --13474 --
NM_005134chr182897 790 ------
NM_005135chr15183 13438 11072 12450
NM_005139chr4--1288 ----
NM_005144chr861207 1150 379 291 146 127 31124 934 395 11201 --
NM_005156chr984544 4469 4236 3844 2093 1696 1516 788 11896 1619 --
NM_005168chr221458 135 --1309 --
NM_005180chr101360 --1165 --
NM_005181chr81833 186 ----
NM_005184chr193991 641 62 1536 21185 77 --
NM_005187chr1631651 1429 405 ------
NM_005188chr1196644 6492 5739 5719 5344 5175 3264 1815 1405 27517 822 1544 1921
NM_005194chr201569 ------
NM_005197chr14106152 5726 5708 5635 4696 2445 2437 1212 374 236 24248 1692 15535 --
NM_005201chr321118 134 ------
NM_005204chr101644 ------
NM_005211chr52176 27 1543 ----
NM_005216chr11231 1506 ----
NM_005219chr531425 1229 106 ------
NM_005220chr172560 265 ----1243
NM_005224chr194491 483 260 236 ------
NM_005229chrX31205 506 144 3948 788 41 ----
NM_005231chr11----1224 --
NM_005233chr332045 1867 119 ------
NM_005235chr2127628 7438 7021 6914 5832 5377 5186 3033 2004 1467 1068 637 37779 6553 6530 1111 --
NM_005238chr111740 1510 22982 1153 13111
NM_005241chr3--11106 1955 1372
NM_005244chr20--1474 ----
NM_005248chr11541 1379 ----
NM_005252chr14------1248
NM_005254chr151415 ------
NM_005256chr112364 50 1382 1668 --
NM_005257chr1831004 972 251 2215 49 11024 --
NM_005259chr241196 622 523 440 ------
NM_005263chr1293 71 ------
NM_005264chr102811 616 --1731 --
NM_005277chr451944 1787 1561 1281 319 ------
NM_005281chr11975 2848 280 ----
NM_005284chr6------1333
NM_005295chr7132 ------
NM_005324chr1761996 1983 1737 1387 811 571 1118 ----
NM_005333chrX2119 82 ----1368
NM_005334chrX21079 125 1101 ----
NM_005336chr251493 339 292 168 109 11754 ----
NM_005338chr724009 2767 23691 2877 1147 --
NM_005339chr434248 2820 1029 --1763 --
NM_005342chrX42848 2679 273 255 1914 ----
NM_005349chr42563 522 ------
NM_005359chr1885611 5521 5174 4841 4479 4287 1663 237 2884 278 15655 11455
NM_005374chr1741766 415 222 29 12148 ----
NM_005375chr62899 64 1374 --140
NM_005376chr111037 --2440 258 1208
NM_005378chr21321 ------
NM_005384chr91182 ------
NM_005385chr322102 536 1308 21983 120 12698
NM_005386chr201693 1620 ----
NM_005392chr911559 --11269 --
NM_005398chr1051430 1039 949 934 149 194 ----
NM_005399chr144024 3380 1104 573 ------
NM_005400chr252121 1954 289 142 73 --12627 12408
NM_005402chr711520 11468 ----
NM_005410chr51614 --123 --
NM_005413chr2147 --1165 --
NM_005418chr111576 ------
NM_005430chr1251053 808 147 69 32 --1113 --
NM_005433chr1842578 1918 1902 1112 2682 442 12148 --
NM_005435chr72568 542 1552 ----
NM_005436chr1084084 4031 3793 2885 2565 2521 1181 242 12831 11448 --
NM_005437chr1021452 983 --1343 --
NM_005458chr972184 1621 989 745 703 469 141 --11539 --
NM_005465chr131757 1729 1570 ----1185
NM_005474chr1751528 1489 647 412 80 ------
NM_005476chr91173 1364 --11102
NM_005479chr1011614 11353 11441 11112
NM_005493chr62529 25 ------
NM_005494chr7--1264 ----
NM_005497chr1785831 5502 4636 4074 4006 1767 1583 1029 55715 5374 4808 4469 1719 23959 1009 --
NM_005499chr191409 ------
NM_005502chr932467 1260 307 23077 1274 ----
NM_005509chr52397 369 --21741 391 --
NM_005511chr9148 1903 ----
NM_005517chr131282 1066 554 1912 --1146
NM_005520chr51295 ------
NM_005523chr72600 259 ------
NM_005527chr62260 51 --1155 --
NM_005530chr1521234 294 135 1451 11056
NM_005534chr21----1491 --
NM_005537chr132246 127 ------
NM_005539chr103434 160 77 --2138 40 --
NM_005542chr731898 636 563 11866 --21222 524
NM_005552chr142600 164 ------
NM_005561chr132865 83 ------
NM_005563chr11263 ------
NM_005569chr222133 64 1511 ----
NM_005574chr11174 ----1187
NM_005575chr53856 818 114 ------
NM_005578chr384262 4132 3870 1315 1212 886 274 266 ------
NM_005584chr13189 --2317 275 1662
NM_005587chr153884 768 273 ------
NM_005595chr11300 ------
NM_005596chr995242 4715 2432 2091 1562 1437 1282 864 582 24886 1627 ----
NM_005599chr131042 343 284 11128 ----
NM_005603chr1811420 2697 454 11469 --
NM_005604chr631831 1709 674 --1742 --
NM_005613chr12572 144 1206 12129 12232
NM_005618chr61528 ------
NM_005619chr192280 132 ------
NM_005625chr811039 ------
NM_005627chr62799 173 ------
NM_005637chr182397 194 196 ----
NM_005638chrX31599 1295 541 ------
NM_005639chr1251785 1549 1509 725 105 31426 1208 455 ----
NM_005647chrX73383 3354 2350 2181 677 524 246 ------
NM_005650chr2241286 190 168 79 ----1926
NM_005652chr161919 1463 11161 --
NM_005655chr811068 ------
NM_005664chr151301 --178 --
NM_005665chr144824 3957 3778 3086 24797 4116 24006 3561 13978
NM_005668chr563009 2864 1140 279 219 31 1757 ----
NM_005686chr131558 1448 148 11256 1413 --
NM_005687chr21331 ------
NM_005688chr321284 47 1232 ----
NM_005693chr11----197 --
NM_005704chr121014 34 --1102 --
NM_005708chr13159 --173 --
NM_005711chr531016 841 387 ------
NM_005715chr612292 2589 410 1120 22628 841
NM_005717chr12996 277 ------
NM_005721chr21776 --1349 --
NM_005722chr21274 ------
NM_005731chr2150 ------
NM_005736chr101643 ------
NM_005738chr711313 ------
NM_005746chr722635 1100 --22659 903 --
NM_005748chr123650 95 31 --12453 --
NM_005749chr172207 107 ------
NM_005754chr51199 ------
NM_005759chr284165 4152 3750 3128 3094 1112 495 121 24205 80 1668 11850
NM_005760chr2------197
NM_005776chr142272 190 ------
NM_005778chr3--1126 1322 --
NM_005779chr522496 947 1629 11386 --
NM_005781chr31202 ------
NM_005783chr24598 573 416 101 ------
NM_005785chr1221758 716 155 ----
NM_005795chr222445 2420 --1219 1937
NM_005802chr91605 ------
NM_005808chr362853 2620 2181 824 727 34 --1101 22364 2205
NM_005811chr12193 ------
NM_005819chr133061 883 210 2942 349 194 --
NM_005822chr62961 706 --1466 --
NM_005826chr13488 153 58 ------
NM_005835chr6--1144 1204 --
NM_005839chr12993 189 ------
NM_005840chrX157653 7531 7342 7273 7119 5946 5714 5445 5236 2714 2375 1385 845 366 199 --26269 2445 --
NM_005842chr13----1261 --
NM_005843chr22520 283 ------
NM_005848chr15262 25 ------
NM_005852chr1731102 1041 183 --1715 --
NM_005853chr161475 ------
NM_005862chr3188 ------
NM_005863chr101583 1900 1570 --
NM_005871chr101368 ------
NM_005876chr21610 ----166
NM_005880chr1611282 11507 ----
NM_005895chr1243576 3225 399 170 13454 32818 1347 611 --
NM_005898chr113829 775 243 13005 1935 --
NM_005900chr42828 223 ------
NM_005901chr18128192 7808 6887 6350 3320 2431 2027 1671 1538 746 452 202 ------
NM_005902chr1554586 4283 3992 3461 1135 1527 1491 --
NM_005903chr541813 1598 1292 897 11543 ----
NM_005904chr1831517 1069 491 ----146
NM_005907chr621201 33 1584 ----
NM_005909chr564163 3471 3150 3010 843 647 34080 2695 1135 24086 3116 --
NM_005911chr211222 2925 130 --1318
NM_005920chr173243 3083 2651 2466 1136 291 100 --13694 1450
NM_005922chr61139 ------
NM_005924chr7------1385
NM_005927chr511311 ------
NM_005930chr142584 84 ------
NM_005933chr11103035 2712 2192 2151 1941 1056 718 707 533 150 22398 863 1809 --
NM_005937chr1733842 3292 599 1986 ----
NM_005941chr854190 3568 837 265 173 ------
NM_005955chr164660 3962 2171 1932 1620 1589 24352 1821 ----
NM_005962chr1011695 ------
NM_005962chr1011695 ------
NM_005966chr222333 533 --1235 157
NM_005973chr11344 ------
NM_005996chr12--21246 29 11105 --
NM_006007chr953450 3143 1160 592 119 ------
NM_006015chr12490 222 ------
NM_006016chr621906 1832 ----1557
NM_006022chr132334 161 ------
NM_006030chr32633 28 11865 21137 76 --
NM_006035chr1431128 448 311 --1910 --
NM_006037chr242991 1459 1394 1054 24849 3553 23520 274 --
NM_006041chr17--1374 1143 1178
NM_006047chr2063274 2196 2174 1287 1207 698 12996 1655 --
NM_006051chr52275 89 ------
NM_006054chr11186 21300 111 1521 --
NM_006060chr774282 3810 3476 2795 2705 824 73 --1924 --
NM_006068chr41273 ------
NM_006079chr62284 217 --169 --
NM_006080chr722064 1862 12762 --12622
NM_006089chrX41287 1211 508 206 ------
NM_006094chr852060 1931 1774 926 901 22030 725 ----
NM_006095chr454284 3156 2860 1601 137 ----11438
NM_006096chr82400 265 ----1326
NM_006099chr1--1602 1244 1574
NM_006106chr1153317 3146 661 352 308 ------
NM_006108chr112413 383 2314 32 ----
NM_006113chr12547 364 --11815 --
NM_006134chr2151463 1113 623 313 267 1573 --11257
NM_006135chr12483 402 --11196 --
NM_006136chr721183 402 ------
NM_006139chr252810 2629 2608 694 403 12323 --1237
NM_006142chr12497 172 ------
NM_006145chr191949 1231 2721 404 --
NM_006153chr31567 ------
NM_006154chr1532904 2407 919 11017 12090 --
NM_006155chr242018 384 362 38 --21906 218 21399 64
NM_006156chr14165 ------
NM_006162chr1851543 1298 1180 66 44 --1608 --
NM_006166chr1232488 2464 2204 22280 1774 ----
NM_006180chr961486 740 533 495 108 38 31596 1562 1551 --1397
NM_006182chr12176 153 ------
NM_006186chr2----1908 --
NM_006190chr221077 56 --1352 --
NM_006194chr142880 156 ------
NM_006195chr91931 ------
NM_006198chr211228 ------
NM_006203chr555018 4915 1826 1400 904 1274 15394 --
NM_006212chr145310 4918 1336 23 14582 3467 319 292 24019 128
NM_006216chr21650 ------
NM_006224chr1742457 2169 1860 1722 1583 ----
NM_006237chr1372214 2027 1853 1796 1636 873 383 ------
NM_006241chr351873 910 827 784 468 ------
NM_006243chr12726 223 1991 ----
NM_006251chr532486 2060 907 ------
NM_006256chr132512 2465 784 32532 1027 864 ----
NM_006258chr10------1325
NM_006265chr821354 480 --2986 439 --
NM_006267chr21233 21400 1360 ----
NM_006268chr113991 351 271 156 ----
NM_006275chr2022467 38 ------
NM_006283chr844930 4450 3523 3404 23332 1184 2756 510 --
NM_006288chr112947 474 --11090 --
NM_006293chr151186 ------
NM_006298chr652186 1044 961 513 344 21203 622 12594 --
NM_006301chr121252 ----1680
NM_006302chr2241 31 ------
NM_006304chr7151 ------
NM_006305chr151212 ------
NM_006306chrX54470 4434 3708 1516 1389 ------
NM_006310chr1711151 ----2308 157
NM_006313chr1231433 1159 32 ----1673
NM_006315chr474239 4167 3667 2921 1405 968 150 1351 --1197
NM_006320chr43945 107 51 ------
NM_006321chr321417 118 11393 ----
NM_006322chr131676 ------
NM_006325chr122312 306 ------
NM_006327chr101293 ----134
NM_006328chr111579 ------
NM_006335chr11202 1865 ----
NM_006336chr951434 1418 1162 1027 590 --2321 254 --
NM_006348chr72677 321 ----171
NM_006352chr111942 ------
NM_006354chr32290 60 ------
NM_006359chrX2325 202 --11567 --
NM_006361chr1711691 1212 11959 --
NM_006364chr142477 25 ------
NM_006367chr12979 768 ------
NM_006371chr365245 4001 3651 3410 1148 586 23288 1348 23974 707 --
NM_006372chr6----1156 --
NM_006373chr1711259 --11082 --
NM_006379chr732188 1996 118 ------
NM_006380chr1722820 644 32859 2788 557 ----
NM_006386chr221635 --22343 622 --
NM_006389chr1151074 545 377 228 51 ------
NM_006393chr1054198 2989 2792 1114 981 23801 940 13254 --
NM_006401chr9----1155 --
NM_006408chr72959 686 1942 ----
NM_006409chr7--1210 ----
NM_006411chr64921 779 223 170 2936 413 --1314
NM_006416chr61316 ------
NM_006419chr43767 602 195 ------
NM_006420chr2073340 2700 2138 1206 1124 1020 342 1245 1830 --
NM_006421chr821095 490 ----1157
NM_006422chr12172 ------
NM_006425chr52149 45 ------
NM_006439chr41190 ------
NM_006449chr231501 1478 365 11589 ----
NM_006457chr414128 21384 773 ----
NM_006459chr1061861 1753 1493 1429 754 353 ----1103
NM_006469chr121170 65 ----1426
NM_006472chr121184 64 ------
NM_006482chr1293610 3343 3206 1293 1235 1018 612 514 335 ------
NM_006489chr1411959 1787 ----
NM_006497chr172820 633 ------
NM_006500chr113473 59 41 1867 ----
NM_006504chr1042987 2647 2470 902 12165 ----
NM_006516chr141626 1091 1076 354 31503 1305 490 ----
NM_006517chrX82094 2070 1982 1563 1473 726 620 88 ------
NM_006521chrX11291 --11279 --
NM_006526chr20150 12085 ----
NM_006527chr4------1599
NM_006534chr2053280 2589 2426 2213 801 1253 1783 --
NM_006540chr8----157 --
NM_006544chr1466043 5450 5425 4515 2039 1305 ------
NM_006546chr1776067 5814 4569 1079 776 753 597 16652 12656 16609
NM_006547chr742073 1949 1415 273 ------
NM_006548chr31669 1267 ----
NM_006549chr1242836 2523 2432 2240 ------
NM_006557chr921725 1250 21228 458 ----
NM_006561chr1085424 5200 5187 4663 4177 2499 2383 1346 --24733 1907 14318
NM_006565chr1611096 1320 ----
NM_006566chr181376 ------
NM_006575chr14------145
NM_006584chr17149 ------
NM_006591chr112426 64 1261 1472 --
NM_006593chr22750 727 --187 --
NM_006595chr111538 ----11612
NM_006599chr16118248 7913 7259 6832 6346 6058 5301 3185 1150 608 542 25829 2224 17387 11322
NM_006601chr121856 ------
NM_006603chrX21821 1722 11403 ----
NM_006609chr242085 797 338 287 --12874 --
NM_006612chr171452 ------
NM_006614chr313233 21024 186 --1492
NM_006618chr141490 1427 369 195 21607 1133 ----
NM_006620chr664465 3196 1911 1596 1510 1260 11302 ----
NM_006621chr151803 1638 607 412 87 1216 --2653 45
NM_006622chr51483 ------
NM_006624chr1021674 120 21768 1409 ----
NM_006626chr932672 1678 917 22613 1962 12434 --
NM_006628chr15104286 4056 3953 3913 3467 1773 1389 1138 1101 959 11147 24524 4186 13216
NM_006629chr1841860 1000 919 103 2493 182 ----
NM_006633chr51543 ------
NM_006636chr22362 309 2189 34 ----
NM_006642chr1151 ------
NM_006644chr131648 ------
NM_006646chr1333073 1093 768 ------
NM_006650chr583673 3658 3313 2975 2734 868 796 199 127 1301 1364
NM_006654chr1253486 1207 1087 221 171 11270 --13962
NM_006667chrX162 ------
NM_006675chr1253155 2651 2397 333 276 --11084 --
NM_006690chr2062031 2010 1992 934 350 241 1825 ----
NM_006698chr20----1111 --
NM_006699chr132546 2298 682 ------
NM_006706chr52202 153 --1768 --
NM_006717chr91629 11261 13031 --
NM_006724chr61139 ------
NM_006727chr51205 162 ----
NM_006729chrX124942 4894 4848 4502 3976 3797 3638 3589 1047 658 321 77 --14810 --
NM_006732chr1941524 679 509 446 ----11478
NM_006734chr621400 360 --11319 --
NM_006738chr1554194 3890 1725 1481 563 ------
NM_006742chr1611679 22033 803 1456 --
NM_006749chr811051 21149 1061 ----
NM_006750chr1657968 6382 5037 3223 603 56308 5983 1577 472 201 17997 13108
NM_006751chr21360 ------
NM_006763chr121693 1584 --11680 --
NM_006766chr852601 2217 1743 762 625 22338 479 ----
NM_006769chr12581 515 ------
NM_006772chr661705 1662 1283 585 573 285 ------
NM_006775chr662979 2820 2278 2270 2126 1902 ------
NM_006777chrX42859 2834 2338 1860 ------
NM_006788chr1851752 1696 556 450 95 ------
NM_006805chr52565 130 ------
NM_006811chr2011002 ------
NM_006815chr1221247 106 ----11327
NM_006818chr13990 752 70 1170 ----
NM_006826chr241163 259 160 59 --1406 --
NM_006828chr6--1651 ----
NM_006832chr14----1214 --
NM_006852chr171859 1672 --11008
NM_006854chr732026 1836 385 1435 ----
NM_006856chr1231046 418 337 ------
NM_006861chr1221310 148 ------
NM_006873chr233342 2473 1402 23007 2706 ----
NM_006884chr331981 1341 42 ------
NM_006885chr1653424 994 725 521 188 --24211 3038 --
NM_006888chr1412834 1836 13328 --
NM_006892chr2031263 898 375 --1570 --
NM_006892chr2031263 898 375 --1570 --
NM_006896chr73737 465 375 2175 153 11136 --
NM_006901chr15------1532
NM_006908chr73429 222 113 ------
NM_006913chr63378 345 76 ------
NM_006915chrX32184 1740 72 ------
NM_006916chr231388 1377 511 1123 ----
NM_006918chr1195703 5108 4052 4033 2272 1274 1239 1018 861 15199 14878 15042
NM_006922chr232391 1630 118 11604 ----
NM_006924chr1743259 1335 586 234 --1159 --
NM_006925chr142477 401 ------
NM_006930chr541925 1381 148 116 ------
NM_006931chr1221458 434 21944 134 ----
NM_006937chr172147 58 125 ----
NM_006940chr12--11840 --11395
NM_006943chr2043221 710 599 587 33108 2496 2100 ----
NM_006947chr42440 94 ------
NM_006948chr212547 219 ------
NM_006950chrX3879 599 131 1238 1271 --
NM_006951chr102673 599 ------
NM_006955chr1033096 1233 652 22181 130 12356 11300
NM_006958chr8182 ------
NM_006965chr1821166 31 --1377 --
NM_006981chr922159 1207 ------
NM_006982chr12147 ------
NM_006999chr521616 131 11666 ----
NM_007005chr93612 150 108 ------
NM_007006chr1611298 12162 --1411
NM_007007chr1264144 3664 3541 1576 1088 884 14672 14135 --
NM_007011chr15176501 6243 5400 5328 5074 5037 4997 4990 4959 4919 4880 4873 2439 2031 1862 1431 1207 36047 5629 4834 26559 5866 22447 25
NM_007013chr811007 ------
NM_007024chr3--167 ----
NM_007026chr17174 ------
NM_007030chr565033 5011 4657 4460 1177 183 24237 67 33156 851 76 11111
NM_007038chr2195455 5284 5034 4473 2197 2150 993 811 397 25949 5211 ----
NM_007039chr1442280 1677 1665 92 --11827 --
NM_007047chr652389 2170 2077 1769 685 1421 ----
NM_007051chr1130 --1116 --
NM_007067chr1721569 425 ------
NM_007073chr664170 3983 1177 670 628 597 33560 3018 948 43934 3257 1555 1161 --
NM_007076chr122105 82 ------
NM_007084chr1331541 295 234 ------
NM_007106chr1362345 917 689 641 459 186 ------
NM_007107chr322238 1540 ------
NM_007114chr342468 2437 2343 2311 ------
NM_007118chr51813 1127 1202 --
NM_007124chr6----1406 --
NM_007125chrY1361 ------
NM_007139chr731115 904 814 ------
NM_007145chr1911147 ------
NM_007146chr1732737 1807 557 1305 11800 --
NM_007150chrX31832 1541 507 ----11711
NM_007158chr13940 418 373 ------
NM_007166chr1111534 2968 28 1530 --
NM_007172chr2273079 2565 2153 1322 1121 183 93 --12046 --
NM_007174chr1252154 1840 954 922 881 ------
NM_007175chr853301 2315 1100 609 146 ------
NM_007189chr71159 11208 195 11508
NM_007191chr12193 ------
NM_007197chr121925 ------
NM_007200chr1554194 3890 1725 1481 563 ------
NM_007203chr953878 3169 2918 1583 554 ------
NM_007207chr12355 140 ------
NM_007214chr61998 ------
NM_007217chr3----1278 --
NM_007222chr831544 288 112 ------
NM_007236chr1541796 1505 686 91 1791 ----
NM_007246chr45838 715 687 674 84 ------
NM_007249chr13179424 9091 8998 7066 6995 6947 6503 6394 6147 6088 5913 5853 5749 1837 1771 592 547 36634 2662 812 28788 150 --
NM_007259chr1----2397 344 --
NM_007269chr11616 ------
NM_007270chr711519 11525 11108 --
NM_007271chr61393 --21168 70 --
NM_007275chr32449 241 1771 ----
NM_007278chr171120 ------
NM_007281chr4132 ------
NM_007282chr31750 ------
NM_007285chr161402 ------
NM_007292chr1784880 4622 3735 3728 3665 3270 3230 868 14216 24731 3746 14900
NM_007325chrX3655 637 85 21611 582 1184 --
NM_007331chr472668 2441 2314 1106 957 722 646 ------
NM_007332chr851579 1353 1345 1267 1104 ------
NM_007345chr182709 488 --12167 --
NM_007347chr1522059 1189 2687 26 --11138
NM_007350chr12104543 3255 3030 2845 1776 1444 978 936 657 509 13476 24445 3634 --
NM_007361chr14--1658 ----
NM_007363chrX2309 225 ------
NM_007372chr171881 1303 ----
NM_007375chr152600 2496 1079 485 368 1576 12105 --
NM_012064chr121456 --11028 --
NM_012069chrX1861 1557 1928 --
NM_012072chr2084060 2961 1694 1359 824 522 349 253 34325 930 69 21655 1456 --
NM_012081chr542717 835 818 351 --13261 --
NM_012090chr131285 1163 955 ------
NM_012095chr10103433 3427 3303 2498 2190 2180 1281 1229 1043 547 ------
NM_012097chr211608 --11980 --
NM_012102chr122503 1012 22477 1879 21046 374 --
NM_012104chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_012104chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_012117chr12145 ------
NM_012120chr632470 1048 232 ----12791
NM_012134chr141589 1262 438 149 --11579 --
NM_012137chr142834 2732 280 67 12811 ----
NM_012141chr1332840 1379 1027 1207 1738 14149
NM_012156chr2083421 3043 2561 2431 2375 2179 1006 503 12404 --13235
NM_012157chr33949 327 319 ------
NM_012158chr132710 556 ------
NM_012164chr9107486 7271 6984 6918 6092 5840 5217 4678 4646 1305 26365 5408 ----
NM_012166chr911118 ----1148
NM_012175chr111810 ------
NM_012180chr42716 280 ------
NM_012183chr11444 ------
NM_012193chr1184871 4581 3680 3601 1746 1529 1074 565 14520 --12103
NM_012197chr931345 240 218 11176 --1229
NM_012199chr153711 3252 2974 1498 1137 ------
NM_012207chr101254 ------
NM_012214chr276088 5726 4326 958 699 464 297 55843 5538 2399 1846 1506 25628 5468 --
NM_012218chr1922741 41 1598 1290 --
NM_012232chr1751428 363 138 36 29 ------
NM_012234chr342919 1436 911 194 11148 ----
NM_012242chr10--1120 ----
NM_012244chr1451645 1377 1264 1196 169 1223 1239 --
NM_012247chr102775 274 161 ----
NM_012248chr161171 ------
NM_012249chr253528 3434 3277 3218 2341 1485 22890 741 --
NM_012257chr71853 --11014 --
NM_012259chr61241 11288 ----
NM_012262chr154409 4394 3623 657 325 24316 2084 11847 --
NM_012264chr2231775 147 135 22080 1890 ----
NM_012264chr2231775 147 135 22080 1890 ----
NM_012281chr721876 832 11604 ----
NM_012286chrX2230 47 ------
NM_012288chr685250 5112 4928 4630 4353 3943 1204 253 35266 4095 1603 12038 --
NM_012290chr241399 1369 456 53 --1207 --
NM_012294chr783805 2736 2683 1430 1423 1017 856 124 12807 ----
NM_012297chr41463 1918 1803 --
NM_012300chr532575 2553 2209 ----11676
NM_012301chr731724 1546 534 12031 ----
NM_012302chr121010 795 ------
NM_012304chr572199 2090 1849 994 895 501 475 1646 ----
NM_012306chr1273054 2989 2344 837 711 467 71 --13484 --
NM_012307chr181923 1789 ----
NM_012308chr1131832 1645 615 --2468 106 --
NM_012309chr1134636 1518 1497 31773 368 107 14085 24578 4403
NM_012317chrX2761 574 1185 1646 --
NM_012325chr2021248 157 141 169 --
NM_012326chr22703 61 --1269 --
NM_012328chr71169 ----1962
NM_012329chr1711541 1211 --1583
NM_012330chr10--21177 392 11141 1447
NM_012333chr121522 260 --1129 --
NM_012334chr563902 3005 1507 1095 901 622 23258 1078 ----
NM_012347chr612814 1410 23033 2971 1894
NM_012383chr9--151 ----
NM_012384chr2012020 21999 1647 11624 --
NM_012394chr1143 ------
NM_012396chr11546 1489 1614 --
NM_012398chr1962885 2674 2368 1093 357 39 12777 12567 --
NM_012402chr1141147 296 276 226 21386 248 ----
NM_012405chr141446 1303 602 118 --12574 1379
NM_012414chr12269 177 ------
NM_012416chr91451 ------
NM_012417chr171405 ------
NM_012419chr62506 102 ------
NM_012428chr152765 379 ------
NM_012433chr21273 ------
NM_012448chr1762234 1922 1826 452 101 53 ------
NM_012461chr142536 35 ------
NM_012463chr1221643 459 ------
NM_012465chr1052350 2333 1133 639 276 ------
NM_012470chr71363 ------
NM_012479chr732205 969 387 ------
NM_012482chr12655 217 1661 ----
NM_012486chr1------173
NM_013227chr151725 ------
NM_013230chrY31323 526 311 --21687 1516 --
NM_013231chr14104350 3752 3298 3233 1733 1687 835 689 128 55 24373 3698 ----
NM_013233chr23339 102 55 11399 1190 --
NM_013235chr52851 642 ------
NM_013247chr21161 ------
NM_013261chr443305 2770 1433 1061 --1113 --
NM_013262chr621122 155 --1237 --
NM_013267chr123442 339 167 ------
NM_013269chr1214353 --24477 4280 11072
NM_013281chr20----11374 --
NM_013283chr52886 719 ------
NM_013286chr363821 3742 3406 2309 486 441 12933 ----
NM_013293chr73178 136 98 ------
NM_013302chr1643762 2911 1416 445 23240 768 11177 13386
NM_013309chr1512587 1965 ----
NM_013313chr2232889 2544 880 2770 607 1138 11104
NM_013314chr10140 ------
NM_013336chr331884 1394 362 1130 21462 612 --
NM_013341chr242164 1142 997 397 32397 384 235 ----
NM_013354chr811364 ----11303
NM_013357chr82285 277 ------
NM_013368chr191463 ------
NM_013372chr1542581 2115 891 224 11072 13177 --
NM_013381chr12--21736 1517 1268 --
NM_013382chr1422412 757 ------
NM_013386chr111280 1143 ----
NM_013390chr911106 ------
NM_013403chr193778 756 268 --1547 --
NM_013411chr162627 2331 2230 2179 2030 1747 ------
NM_013423chrX31177 157 86 1423 1107 --
NM_013427chrX31177 157 86 1423 1107 --
NM_013433chr1921510 400 2704 467 1712 11523
NM_013434chr241784 1259 764 465 1615 11475 11491
NM_013434chr241784 1259 764 465 1615 11475 11491
NM_013436chr21195 --1819 --
NM_013437chr81460 --11111 --
NM_013438chr941822 1601 581 219 1377 11350 --
NM_013444chrX2231 178 --1341 --
NM_013447chr1923035 256 23795 3710 ----
NM_013449chr1232991 2149 1121 --1422 --
NM_013450chr22315 169 ------
NM_013943chr172494 2080 1259 1216 1144 761 69 --1170 1251
NM_013951chr21435 21980 558 22467 132 1765
NM_013952chr21512 22057 635 22544 209 1842
NM_013953chr21512 22057 635 22544 209 1842
NM_013992chr21512 22057 635 22544 209 1842
NM_013995chrX42463 2262 978 299 --12042 --
NM_013999chr171186 --1265 --
NM_014000chr1081787 1562 1294 1240 386 230 181 164 --2351 321 --
NM_014007chr921146 951 --11125 11030
NM_014021chr143388 3152 1351 1065 13435 --12119
NM_014023chr101880 --11107 --
NM_014030chr173856 819 282 165 1126 2336 215
NM_014042chr11--1214 ----
NM_014043chr31565 ------
NM_014044chr2----1161 --
NM_014048chr1654836 4322 4191 3230 1671 13440 11051 --
NM_014106chr1531890 601 363 ------
NM_014112chr854623 4579 4376 3328 700 22015 1826 ----
NM_014141chr735232 425 83 23383 1135 11350 11752
NM_014155chr1121278 1236 25032 890 25072 4641 --
NM_014157chr1693967 3330 2899 1486 1440 1381 1292 402 232 1218 ----
NM_014181chr242854 2043 543 323 ------
NM_014182chr123519 306 239 1507 ----
NM_014183chr202215 29 ------
NM_014188chr11267 ------
NM_014212chr122928 897 2678 148 ----
NM_014231chr1261827 1697 658 158 130 43 1104 21611 81 --
NM_014232chr173649 420 94 --11503 --
NM_014232chr173649 420 94 --11503 --
NM_014240chr383919 3508 3289 2866 2686 1589 1433 399 ------
NM_014243chr43803 598 376 ------
NM_014246chr2222157 444 11776 ----
NM_014267chr111160 ------
NM_014268chr1821231 996 1923 126 --
NM_014271chrX3685 606 546 1739 --1713
NM_014283chr131563 583 201 ------
NM_014284chr111091 --21020 819 1856
NM_014292chr2221411 56 --11667 --
NM_014300chr151328 ------
NM_014309chr2255254 5097 4928 1231 800 ------
NM_014313chr1166 1634 ----
NM_014317chr10169 ------
NM_014323chr221390 1136 ----
NM_014325chr1252256 2210 1465 565 302 ----2154 118
NM_014331chr497250 7119 6234 5924 4994 2706 1724 1191 532 35864 4757 1592 --17375
NM_014333chr1112090 --1183 --
NM_014335chr15--174 ----
NM_014344chr113619 360 222 ------
NM_014345chr62905 824 ------
NM_014352chr11--21448 24 ----
NM_014368chr921698 452 --11884 --
NM_014376chr532094 526 142 ----1638
NM_014379chr811021 ------
NM_014386chr51202 ------
NM_014388chr175351 5202 4692 4660 792 764 326 35952 5388 1225 1365 11210
NM_014392chr441599 1299 1159 606 ------
NM_014393chr851901 1768 783 486 362 ------
NM_014400chr192419 69 1399 1121 --
NM_014408chr14615 532 217 190 ------
NM_014418chr1421581 462 31872 1343 335 11786 --
NM_014423chr584607 4192 3638 3520 3463 1815 1161 885 11665 ----
NM_014426chr201529 1464 ----
NM_014429chr32642 467 ------
NM_014430chr14--134 ----
NM_014432chr61335 --1587 --
NM_014445chr321818 57 31679 166 143 1456 --
NM_014447chr421554 1114 --11633 --
NM_014456chr1031857 1322 317 1287 ----
NM_014494chr16----1212 --
NM_014507chr22--2137 48 --11245
NM_014515chr123968 840 66 ------
NM_014522chrX2691 456 ------
NM_014554chr1221782 260 11589 ----
NM_014572chr1331633 1557 167 --1457 --
NM_014575chr31514 ------
NM_014588chr202580 90 ------
NM_014592chr51122 --1823 --
NM_014593chr18--136 ----
NM_014603chr172661 441 --1524 --
NM_014606chr441169 474 399 290 ------
NM_014612chr911313 ------
NM_014614chr21586 2155 23 ----
NM_014615chr1673503 2978 2937 2299 1142 656 443 11074 ----
NM_014623chr61208 ----135
NM_014630chr1553267 2455 861 847 382 ----13396
NM_014636chr964120 2943 1334 1016 849 209 ----1570
NM_014644chr11125 1693 ----
NM_014647chr1622233 1544 11978 ----
NM_014661chr1061425 996 967 492 450 55 43878 3419 2916 2584 ----
NM_014666chr51432 1191 ----
NM_014667chr332148 1774 1701 --12108 --
NM_014670chr221658 1087 ------
NM_014671chr731287 132 81 1365 ----
NM_014676chr131573 126 29 ------
NM_014677chr82340 238 ------
NM_014679chr1131102 433 85 ------
NM_014680chr171127 1425 ----
NM_014682chr842279 1657 1640 643 --1533 --
NM_014685chr161235 ------
NM_014690chr772736 1106 1063 1020 977 425 31 --12925 1180
NM_014702chr61521 13183 ----
NM_014705chr721799 604 --11781 --
NM_014706chr122216 39 --21062 362 --
NM_014709chr21546 ------
NM_014711chr1611933 --1572 --
NM_014720chr1021697 1218 ------
NM_014721chr675184 4698 4686 2226 2056 753 561 16230 --16670
NM_014726chr17158 ----1987
NM_014729chr831690 535 150 21558 494 1433 --
NM_014730chr1245240 4751 3676 1044 11775 15318 --
NM_014730chr1245240 4751 3676 1044 11775 15318 --
NM_014732chr16115306 5247 4921 4339 4300 4259 2227 1973 1949 1496 119 25024 1156 ----
NM_014735chrX1629 --1573 --
NM_014739chr643849 1400 678 539 13831 ----
NM_014740chr17149 ------
NM_014741chr111613 11471 --22142 404
NM_014743chr462930 2839 2284 1175 1091 375 --12007 --
NM_014746chr271687 1615 1418 1143 622 433 391 ------
NM_014747chr195744 5414 3987 2219 1580 943 577 475 237 1821 ----
NM_014751chr81381 2853 72 ----
NM_014755chr262688 1575 1472 1380 494 195 ------
NM_014759chr821121 111 1508 1640 --
NM_014761chr1611028 --1134 --
NM_014764chr12153 ------
NM_014765chr132480 2253 380 ------
NM_014766chr773301 2836 1381 1273 1203 721 73 ------
NM_014767chr1073520 2743 2727 2352 1329 1266 344 13073 11183 13660
NM_014770chr1231021 240 122 ------
NM_014771chr162381 96 1869 ----
NM_014772chr1853450 2427 1412 684 278 11085 --1584
NM_014774chr112933 ------
NM_014779chr321094 978 ------
NM_014781chr83429 417 24 172 ----
NM_014784chr131100 735 36 --192 --
NM_014787chr142417 2099 1038 866 1251 ----
NM_014791chr91266 ------
NM_014795chr2--1309 ----
NM_014798chr173670 472 86 --1363 11598
NM_014800chr71224 1810 31154 761 124 --
NM_014803chr103902 352 189 1487 1643 --
NM_014807chr112581 42 ------
NM_014810chr183580 2633 1445 808 750 501 460 325 ------
NM_014812chr121845 535 1751 --11441
NM_014819chr532505 1694 810 ------
NM_014820chr332099 1496 622 31978 1362 605 ----
NM_014824chr1121252 353 21501 318 11570 --
NM_014826chr1104189 3892 3438 3282 3047 2650 1361 796 278 36 33776 865 237 1938 --
NM_014828chr1421580 895 ------
NM_014835chr2071721 1593 1578 1514 1459 871 182 11973 1313 --
NM_014839chr142313 1853 1827 148 --1957 12225
NM_014840chr1263069 2685 2659 2287 372 288 --22804 2501 --
NM_014847chr11157 ------
NM_014848chr1542511 2429 2266 536 22523 149 166 --
NM_014850chr374109 3468 1492 1341 842 328 257 11709 14329 1997
NM_014859chr1721337 1054 ------
NM_014864chr143471 1632 1207 398 23018 493 31062 515 198 --
NM_014871chr122199 97 ------
NM_014873chr143749 3712 655 558 13932 --1232
NM_014874chr121891 221 11572 ----
NM_014876chr2232121 601 89 ----11821
NM_014877chr17107580 6881 5590 5378 4759 2965 2500 2450 1917 1860 ----1720
NM_014884chr19157 ------
NM_014888chr731592 1466 41 ------
NM_014895chr6----1300 1694
NM_014900chr21311 240 29 ----
NM_014901chr52321 108 12107 --1597
NM_014903chr121704 1495 ----
NM_014904chr1043905 3733 1232 682 23705 1173 ----
NM_014906chr1753606 3510 3461 2884 2705 ----13258
NM_014909chr1473927 3827 2898 2666 2524 160 34 23718 3529 --13918
NM_014912chr1052895 973 775 727 452 ------
NM_014914chr22424 139 --11271 --
NM_014917chr11952 ------
NM_014918chr151610 --1318 1386
NM_014920chr631445 583 112 --1859 --
NM_014921chr1942748 867 306 108 --12861 --
NM_014923chr1321457 911 ----12024
NM_014924chr1432713 837 385 --1601 161
NM_014925chr123828 761 232 ------
NM_014926chr33822 209 86 ----1910
NM_014927chrX187 ------
NM_014932chr31239 ------
NM_014933chr41146 ------
NM_014935chr163391 2435 1509 1346 121 58 --22768 357 --
NM_014937chr102867 392 11280 ----
NM_014938chr1252405 2354 998 453 92 ------
NM_014939chr1861554 1344 1333 1288 371 180 ------
NM_014942chr621884 1846 ------
NM_014944chr141431 1370 958 377 1325 ----
NM_014947chr132504 1249 791 --12714 1603
NM_014961chr4----2822 561 --
NM_014962chr2042624 2148 1788 178 --11962 1589
NM_014969chr12787 320 2915 274 ----
NM_014978chr1021486 713 --1369 --
NM_014982chr1434661 4178 1860 ------
NM_014988chr442852 1926 1743 379 11116 22063 719 12507
NM_014989chr631933 1304 340 31869 1376 24 12023 --
NM_014990chr1411355 ----11119
NM_014991chr442478 2281 2126 237 ----12776
NM_014992chr14----1351 --
NM_014994chr1551960 486 464 196 144 22251 1834 --1618
NM_014999chr1221248 1025 ------
NM_015000chr1253115 3085 2751 1907 736 1674 191 --
NM_015001chr11943 --1407 --
NM_015002chr122781 279 31602 336 117 1310 --
NM_015008chr353539 2983 2972 2813 793 13016 12832 1459
NM_015015chr192713 321 11505 11928 --
NM_015017chr1----174 --
NM_015020chr1653699 3595 3093 1366 919 ----11543
NM_015024chr841304 1120 1037 173 ------
NM_015025chr222602 1877 1651 ----
NM_015026chr1213611 ----1449
NM_015035chr2076414 5842 4620 4146 2035 1950 981 15514 ----
NM_015039chr194026 2883 2679 1496 675 622 510 330 162 --23752 1061 --
NM_015040chr232259 918 755 23446 1319 ----
NM_015042chr1564203 3939 3538 1703 1378 636 ----14067
NM_015045chr103809 438 103 11968 ----
NM_015051chr933039 2461 434 ------
NM_015052chr71321 1391 ----
NM_015055chr1152987 2845 952 937 789 22082 341 ----
NM_015061chr91730 ------
NM_015062chr101212 ------
NM_015063chr1911223 1411 ----
NM_015064chr1282987 2969 2726 2696 2674 2231 1043 982 33642 3012 155 ----
NM_015071chr585851 5662 4711 1763 1250 806 454 293 26116 4005 ----
NM_015075chrX51758 834 771 733 451 2650 406 11475 --
NM_015076chr643607 1737 1387 271 12811 ----
NM_015078chr341323 267 48 24 1509 ----
NM_015080chr112893 799 ------
NM_015091chr14--192 ----
NM_015092chr1684255 4004 3270 3121 1189 654 479 177 21762 357 23261 942 --
NM_015093chr61542 ------
NM_015094chr2284502 3671 3254 2987 1587 1523 1510 728 --23336 1219 14039
NM_015100chr13559 233 129 --1152 --
NM_015102chr1--1104 ----
NM_015107chrX41654 397 281 70 ------
NM_015113chr17--21909 123 ----
NM_015115chr453104 2609 2008 916 755 1844 ----
NM_015129chrX31682 611 137 1329 11120 --
NM_015130chr411410 --21263 199 --
NM_015134chr172630 175 ----1441
NM_015137chr842508 2332 595 552 ------
NM_015138chr1542780 798 422 308 ------
NM_015144chr1653533 3526 3252 2785 1343 ------
NM_015155chr1083227 2265 2182 1209 1063 1046 859 746 1674 158 --
NM_015156chr1473891 2991 1409 1149 1092 192 23 --1221 --
NM_015170chr832272 776 625 ----2878 397
NM_015171chr162401 144 2495 361 199 --
NM_015176chr131333 1209 150 ------
NM_015185chrX42384 2208 860 379 ------
NM_015192chr2032324 1946 762 140 22712 726 --
NM_015194chr1741613 1464 809 397 --21347 39 --
NM_015199chr332920 2575 2275 1297 12102 --
NM_015200chr431766 796 292 1108 1121 --
NM_015206chr1572878 2808 1474 946 830 603 161 21094 790 23749 207 --
NM_015208chr18186 14053 ----
NM_015209chr152129 1885 1466 492 455 ------
NM_015213chr112194 113 ------
NM_015215chr112692 ------
NM_015231chr112288 118 ------
NM_015233chr1332320 1044 244 31923 1023 956 1712 --
NM_015234chr621278 1251 ------
NM_015236chr431272 284 92 ------
NM_015239chr91525 ------
NM_015245chr652636 2127 1839 987 315 2234 205 ----
NM_015247chr1655272 5103 3610 3391 958 21352 199 14302 --
NM_015254chr852539 2489 2314 2064 458 ------
NM_015265chr232176 811 256 1542 --12264
NM_015269chr13579 462 96 ------
NM_015270chr1232027 878 510 ----1695
NM_015271chr484086 3832 3164 2819 2704 1251 1221 305 --11263 24032 3140
NM_015272chr1631762 1327 31 ------
NM_015288chr593866 3410 3292 2481 1291 1280 895 836 116 ----1452
NM_015291chr153397 3187 2576 1189 1148 ------
NM_015294chr1731081 894 269 ------
NM_015296chr1331223 942 876 --1374 --
NM_015299chr1473443 3406 3298 1386 984 890 89 13032 33616 1358 1116 24055 3466
NM_015310chr8127491 7221 7022 6717 6676 6530 5741 5268 2247 831 479 381 27170 1209 16751 12839
NM_015313chr1134797 357 215 1224 ----
NM_015315chr583497 3274 2530 2309 1311 670 647 339 12600 ----
NM_015317chr252787 2480 2139 2112 1049 --22084 744 --
NM_015320chr241000 815 222 159 --1659 --
NM_015326chr122132 2060 --22089 2024 --
NM_015328chr732064 1129 280 12094 43033 2749 635 357 --
NM_015332chr711386 181 23049 1396 --
NM_015335chr1222659 109 --2193 74 --
NM_015336chr123258 150 74 11990 ----
NM_015343chr17------1221
NM_015344chr851480 529 477 325 222 ------
NM_015347chr122798 353 12466 --1474
NM_015349chr642555 2462 2329 70 ------
NM_015354chr91272 --1354 --
NM_015355chr172611 215 21269 165 ----
NM_015358chr2111112 --1470 --
NM_015361chr21653 ------
NM_015375chr144507 3893 861 26 34364 1982 939 199 14833
NM_015381chr2221300 117 ----1473
NM_015382chr142685 103 ------
NM_015386chr162432 34 1158 ----
NM_015397chr941415 776 344 289 ------
NM_015401chr122290 78 ------
NM_015435chr83969 569 457 11429 ----
NM_015443chr172949 212 --1965 --
NM_015455chr573984 3089 1636 1286 836 623 399 --1920 --
NM_015460chr341541 1508 620 201 1269 ----
NM_015470chr221199 113 ------
NM_015472chr3198 ------
NM_015472chr3198 ------
NM_015477chr153932 366 63 ------
NM_015483chr71385 ------
NM_015493chr1922214 1419 11559 22097 101 --
NM_015497chr15--11078 1753 --
NM_015508chr331377 977 263 --1249 --
NM_015509chr1231171 164 144 --11308 --
NM_015513chr32685 76 ------
NM_015520chr322764 318 --1527 1717
NM_015528chr171173 ------
NM_015534chr11109 --1196 --
NM_015535chr223244 1628 ----33611 3060 3024
NM_015550chr732632 1424 93 12532 ----
NM_015554chr15--3294 167 25 ----
NM_015559chr182854 308 ----1406
NM_015564chr531153 545 214 12888 23402 975 --
NM_015567chr1321336 1001 ------
NM_015568chr2044037 3339 916 246 --1689 --
NM_015569chr184332 4099 4068 1520 1111 924 869 407 31153 627 461 ----
NM_015575chr253063 2820 248 99 73 --22255 623 --
NM_015576chr31487 1475 ----
NM_015577chr51374 11614 ----
NM_015578chr1921938 1382 ------
NM_015595chr33214 121 44 1258 ----
NM_015602chr121835 53 ------
NM_015610chr722500 781 31756 1143 186 12085 --
NM_015630chr2----178 --
NM_015634chr101399 ------
NM_015635chr91480 11985 ----
NM_015641chr73938 349 313 --1363 --
NM_015646chr122273 165 2431 72 ----
NM_015657chr22664 218 --2861 74 --
NM_015678chr1341309 1195 1092 544 ----1114
NM_015686chrX1948 32172 500 410 31829 935 416 --
NM_015691chrX32898 933 545 12790 ----
NM_015695chr641834 1443 616 357 1348 1457 --
NM_015713chr81496 1286 --1923
NM_015716chr172641 572 --1563 --
NM_015726chr161827 1743 1304 639 421 83 --21296 564 --
NM_015840chr152488 1770 868 801 69 --12709 --
NM_015841chr152488 1770 868 801 69 --12709 --
NM_015845chr181205 ------
NM_015850chr821958 397 21528 238 ----
NM_015866chr141485 1041 423 139 ------
NM_015872chr151753 1213 714 704 324 1148 ----
NM_015874chr42563 522 ------
NM_015878chr8------162
NM_015879chr18138210 7290 6437 6135 5745 5330 2975 2825 2806 2151 1387 516 497 21065 883 13429 --
NM_015888chr123279 3001 --13086 --
NM_015892chr1042356 2178 1988 518 31754 620 122 2925 534 1421
NM_015902chr8--1739 1140 --
NM_015906chr133448 1112 180 --1743 --
NM_015915chr14176 ------
NM_015948chr61446 1369 ----
NM_015955chr2243 35 ------
NM_015980chr531448 1091 91 ------
NM_015981chr542600 776 129 48 --1458 --
NM_015994chr141558 1667 --1255
NM_015995chr15104847 3886 3773 3593 3571 2043 1861 1182 324 28 1624 24661 4322 --
NM_016003chr722500 781 31756 1143 186 12085 --
NM_016004chr201145 ----1193
NM_016022chr1190 1920 ----
NM_016025chr1641383 1310 308 238 21936 1316 --1258
NM_016032chrX11192 11219 ----
NM_016038chr71658 ------
NM_016039chr14----156 --
NM_016040chr121820 677 --1631 --
NM_016061chr21586 ------
NM_016075chr1322650 2348 --11219 --
NM_016076chr162817 1230 1163 900 605 22 ------
NM_016081chr411465 ------
NM_016083chr663387 3113 3026 2671 2616 1180 ----13259
NM_016089chr382006 1778 809 785 641 221 137 53 --31336 700 390 31738 1504 559
NM_016096chr821340 127 ------
NM_016098chr61346 ------
NM_016099chr83363 95 25 2264 134 ----
NM_016120chrX3468 435 272 ------
NM_016124chr141323 1275 164 87 ------
NM_016131chr241828 754 467 70 ------
NM_016144chr52231 131 --133 --
NM_016147chr111380 1902 ----
NM_016152chr33847 400 267 --2159 28 --
NM_016166chr151225 ------
NM_016169chr1042243 1163 593 414 --1777 --
NM_016192chr21279 ------
NM_016195chr102650 103 1703 ----
NM_016205chr441274 1090 1043 496 ------
NM_016206chr398396 8342 8233 7816 7098 6278 3594 1829 1809 58255 7461 3078 2949 2738 --18576
NM_016210chr3166 11102 ----
NM_016211chr41146 ------
NM_016216chr34611 582 562 60 ------
NM_016217chr62239 75 11185 ----
NM_016221chr562323 1909 1885 1566 608 455 ------
NM_016224chr621701 752 ----1559
NM_016227chr131563 583 201 ------
NM_016230chr61342 ------
NM_016231chr1721677 421 ------
NM_016235chr1631368 1214 397 ------
NM_016248chr1353527 3327 1332 1279 305 --13577 --
NM_016252chr22904 615 ------
NM_016255chr643181 2782 2302 1132 1110 1427 --
NM_016257chr193071 2487 2198 2168 1075 994 965 849 403 12640 12802 197
NM_016258chr11793 ------
NM_016260chr266647 5957 5789 5034 2181 1921 17260 16253 16386
NM_016261chr17--3776 580 259 ----
NM_016264chr193556 544 43 ------
NM_016269chr43819 342 27 11142 ----
NM_016272chr225712 661 569 498 114 --21018 373 --
NM_016275chr342078 1911 858 203 11800 --11874
NM_016277chr631560 1523 598 11192 ----
NM_016281chr1231031 739 108 1167 180 --
NM_016283chr5283 31 ------
NM_016287chr121478 663 21904 504 ----
NM_016308chr121655 726 11937 ----
NM_016322chr962932 2892 2484 2416 791 689 ------
NM_016338chr511089 1100 ----
NM_016339chr1741586 1155 210 49 --1641 --
NM_016352chr72932 276 11104 11178 --
NM_016356chr642897 2485 681 302 12565 ----
NM_016357chr1221211 182 ------
NM_016374chr111372 ------
NM_016374chr111372 ------
NM_016376chr17103379 3254 3153 3010 2955 2709 1567 1384 750 308 ------
NM_016395chr1521619 1572 1408 21628 145 11536
NM_016396chr1532783 2204 525 12224 11116 --
NM_016410chr91633 ------
NM_016424chr1741473 1355 1305 721 11431 ----
NM_016436chr2022047 764 12396 1182 --
NM_016441chr232086 670 176 ------
NM_016442chr522112 1717 1891 11558 --
NM_016463chr51133 ------
NM_016476chr171149 ------
NM_016480chr51103 ------
NM_016485chr632263 780 483 ------
NM_016506chr112227 33 ------
NM_016507chr1742338 2122 1092 590 1658 ----
NM_016513chr631445 583 112 --1859 --
NM_016519chr4182 ------
NM_016530chr1573607 3363 3263 2882 931 772 351 --13418 --
NM_016531chr473103 2886 903 837 811 406 222 ------
NM_016542chrX1655 ----11741
NM_016569chr12--21246 29 11105 --
NM_016571chr6121 ------
NM_016577chr394365 4244 3723 3579 3344 3163 1297 517 181 21388 532 134 --
NM_016578chr112590 445 ------
NM_016582chr11--134 ----
NM_016588chr62119 38 144 ----
NM_016591chr521194 243 ----1457
NM_016596chr122290 78 ------
NM_016604chr53295 141 54 --1508 --
NM_016605chr542583 2518 2201 1860 21694 147 ----
NM_016617chr131157 --1710 --
NM_016621chr1173088 2963 2956 2886 2844 694 665 13218 13823 --
NM_016623chr8----1192 --
NM_016626chr18----21597 416 --
NM_016628chr101684 ------
NM_016631chr212743 41 ------
NM_016651chr142796 743 --11036 --
NM_016654chr151415 ------
NM_016733chr222133 64 1511 ----
NM_016824chr1011272 ------
NM_016830chr122189 59 ------
NM_016929chr673987 3271 1775 1440 1350 600 48 13417 1551 14426
NM_016936chr163873 147 74 ------
NM_016938chr112391 359 ------
NM_016952chr1143044 2750 750 203 23262 2489 13521 --
NM_016954chrX------1637
NM_017412chr81366 ------
NM_017415chr564477 4206 4009 3664 3495 3103 13697 13465 --
NM_017420chr1413588 22932 413 11337 199
NM_017423chr461928 1372 783 765 369 327 ------
NM_017425chr112213 112 ------
NM_017437chr1422335 823 ------
NM_017439chr7160 ----1178
NM_017444chr831249 649 101 153 11346 --
NM_017447chr2143829 2828 869 166 13705 --11478
NM_017455chr152765 379 ------
NM_017488chr241322 1272 564 453 11094 ----
NM_017491chr41987 ----1289
NM_017519chr61447 ------
NM_017522chr131043 989 228 --155 2933 473
NM_017551chr102315 92 ------
NM_017553chr151342 ------
NM_017558chr161306 --1357 --
NM_017563chr365135 5111 4863 1965 1470 1291 15940 ----
NM_017577chr321220 198 ------
NM_017582chr1--11681 ----
NM_017588chr941943 1847 1708 488 ------
NM_017590chr2222578 1774 ------
NM_017594chr972622 1010 492 476 227 180 49 11176 ----
NM_017596chr154333 2926 1479 111 70 --13931 14361
NM_017602chrX5768 353 163 137 44 1260 ----
NM_017610chr15137 --1482 --
NM_017628chr484983 4553 4310 3604 3240 1764 1493 1119 --1424 --
NM_017632chr41130 ------
NM_017633chr653792 2644 2405 1428 1364 1428 ----
NM_017634chr831657 738 207 1684 ----
NM_017637chr9108184 7793 7002 3422 3090 2784 2067 1302 1094 208 18903 11505 --
NM_017640chr6----1264 --
NM_017641chr123284 242 45 ------
NM_017643chr17--1967 21894 1158 --
NM_017644chr374400 4306 3874 3198 1933 1741 890 13165 ----
NM_017650chr794920 4805 4258 3735 2158 1888 1130 944 171 25487 484 35929 5363 4206 --
NM_017658chr1443827 3421 1473 1153 --12918 --
NM_017661chr1521265 126 ------
NM_017664chr1331096 942 410 --1665 --
NM_017667chr72574 80 ------
NM_017684chr1541398 789 206 65 1253 ----
NM_017700chr41131 ------
NM_017709chr133525 3511 1511 21497 1273 --11002
NM_017712chr1966357 6038 5914 4941 1515 1480 35044 4826 1001 ----
NM_017719chr332079 224 182 163 1413 --
NM_017730chr32683 658 ------
NM_017737chr1------1631
NM_017742chr1831369 458 31 --1437 --
NM_017744chr141888 1660 953 359 12054 ----
NM_017745chrX--1137 ----
NM_017752chrX31770 1520 147 --143 --
NM_017753chr9----11003 --
NM_017758chr1721507 495 ------
NM_017768chr11830 ------
NM_017772chr631695 1382 100 21357 159 ----
NM_017779chr122501 478 11932 ----
NM_017784chr341211 471 378 286 11117 1166 --
NM_017787chr1031976 1869 241 --12752 --
NM_017811chr962395 2166 2143 1975 983 289 12732 ----
NM_017813chr865248 1970 1671 961 780 484 14478 ----
NM_017824chr1022001 519 12358 ----
NM_017826chr133803 223 150 --2279 26 --
NM_017831chr1874344 4241 1691 1493 1175 415 310 14601 --1787
NM_017848chrX84459 4174 3669 1630 1180 762 501 384 ----1634
NM_017849chr252949 2863 2010 842 244 1407 ----
NM_017860chr13801 609 222 ------
NM_017893chr1041239 983 476 296 1104 11370 --
NM_017902chr1095387 4354 3694 2049 1950 1896 1411 1083 396 1173 --13588
NM_017910chr21271 1286 ----
NM_017911chr2231170 432 405 11525 11388 --
NM_017913chr9174 ------
NM_017919chr995713 5577 4899 4402 2196 2075 1511 1257 1179 --169 25604 4729
NM_017923chr42321 90 ------
NM_017926chr141872 --196 --
NM_017933chr241550 353 326 314 1639 ----
NM_017935chr4--1258 ----
NM_017938chrX61894 1702 1486 1452 548 214 ------
NM_017943chr1421015 318 197 ----
NM_017944chr1133103 2540 2062 ------
NM_017958chr252669 2516 2290 2099 112 2995 225 ----
NM_017972chr141872 --196 --
NM_017994chr752964 2532 2359 2344 791 ------
NM_018003chr1542414 833 810 52 11781 ----
NM_018011chr131619 ------
NM_018018chr1221419 1327 ----154
NM_018027chr1053306 865 753 275 242 1542 ----
NM_018028chr1951247 917 542 534 177 ------
NM_018030chr184965 840 803 116 ------
NM_018043chr1121500 81 --21268 1045 --
NM_018045chr162914 2754 2277 2118 556 200 22921 594 ----
NM_018056chr1----1187 --
NM_018061chr171703 1657 1254 678 560 511 92 11746 ----
NM_018072chr1242 24 ------
NM_018078chr41323 ------
NM_018079chr22217 135 --1580 --
NM_018084chr273304 2852 2324 2223 1187 786 189 1342 ----
NM_018086chr221342 253 ------
NM_018092chr16----1398 --
NM_018094chrX------1410
NM_018095chr112227 33 ------
NM_018098chr321150 49 ------
NM_018107chr142856 809 151 ----
NM_018121chr101708 1986 ----
NM_018126chr411331 --1458 --
NM_018128chr1721170 224 2482 45 ----
NM_018133chr3126 ------
NM_018137chr121178 943 ------
NM_018144chr102319 44 ----1330
NM_018155chr333479 3217 234 --13069 --
NM_018159chrX2533 90 --31377 407 144 --
NM_018172chr1191361 1300 594 542 490 438 386 334 59 --1316 --
NM_018176chr451672 1517 1157 640 470 1381 --11322
NM_018178chr1--1206 1199 --
NM_018181chr183631 511 228 21424 565 ----
NM_018195chr1132173 2111 54 ----11323
NM_018198chr151479 1312 913 598 394 ------
NM_018200chr1532067 1817 243 ------
NM_018203chr11838 2708 44 ----
NM_018206chr161155 --124 --
NM_018227chr453028 995 989 704 187 125 12585 --
NM_018237chr10----1203 --
NM_018244chr2011117 --2841 269 --
NM_018246chr842802 2737 398 370 --11916 --
NM_018247chr642066 1053 914 885 11013 --1476
NM_018263chr242446 1842 1799 877 11821 22475 1767 11678
NM_018266chr31721 ----1987
NM_018275chr7----1356 133
NM_018293chr322671 1177 ------
NM_018299chr812950 --32696 2399 884 --
NM_018307chr172352 51 ------
NM_018310chr82580 377 124 152 --
NM_018313chr322460 151 ------
NM_018315chr41632 --21060 46 --
NM_018319chr143555 132 83 --1176 --
NM_018320chr1151242 860 847 404 56 ------
NM_018325chr9------193
NM_018327chr201745 11340 1257 11306
NM_018328chr21407 ------
NM_018330chr101300 --1401 --
NM_018332chr1621385 1330 21217 132 1243 --
NM_018339chr9198 ------
NM_018362chr1152857 977 883 324 180 23238 3085 22572 1405 --
NM_018364chr143207 1244 768 327 ----2967 131
NM_018367chr1132208 1608 451 --1885 1224
NM_018370chr1242228 2075 2049 541 11802 ----
NM_018371chr821491 30 ------
NM_018372chr11537 ------
NM_018373chr1475836 5325 5105 4358 4041 2594 1997 25115 1531 22068 25 --
NM_018374chr765079 3173 1516 588 169 54 24670 3242 1116 13497
NM_018375chr1451260 740 589 326 77 1677 1781 --
NM_018383chr21564 21741 1311 ----
NM_018400chr1154305 4258 4131 3635 1029 1615 23564 965 23908 293
NM_018403chr32860 155 23769 2996 12909 --
NM_018409chr412936 13002 12179 12962
NM_018412chr71108 ------
NM_018413chr12--1276 ----
NM_018423chr122208 23 ------
NM_018424chr93613 596 556 151 ----
NM_018440chr898454 7696 7530 7213 5307 5269 1163 857 334 26917 6388 ----
NM_018442chr11348 ------
NM_018444chr84830 654 233 123 1142 1598 --
NM_018445chr151201 ------
NM_018448chr121940 --1959 --
NM_018452chr6_random12713 ------
NM_018469chr173406 357 167 21298 150 1435 --
NM_018488chr171518 172 ----
NM_018489chr131942 1683 616 11476 ----
NM_018527chr13--1172 ----
NM_018566chr164262 3933 3650 1225 991 580 14004 ----
NM_018569chr411638 ----11082
NM_018571chr23599 141 39 ------
NM_018638chr12104501 3470 1893 1399 1146 1124 1000 973 560 419 23634 2006 ----
NM_018640chr1221979 42 12716 ----
NM_018649chr101496 --1153 --
NM_018650chr122100 371 11499 11385 --
NM_018652chr15--1165 ----
NM_018660chr842645 1917 306 143 ------
NM_018682chr7------1220
NM_018683chr2031648 321 134 ------
NM_018685chr731015 758 57 ------
NM_018689chr1542237 2025 474 234 12693 12545 --
NM_018695chr522091 1748 11537 ----
NM_018700chr541598 1173 665 310 ------
NM_018704chr141981 1656 697 323 ----134
NM_018710chr81536 ----11320
NM_018713chr12763 196 ------
NM_018715chr162087 1477 822 515 486 253 --1335 --
NM_018718chr752252 2220 2073 1792 636 ------
NM_018834chr5------1413
NM_018890chr73429 222 113 ------
NM_018898chr52350 215 ------
NM_018899chr52350 215 ------
NM_018900chr52350 215 ------
NM_018901chr52350 215 ------
NM_018902chr52350 215 ------
NM_018903chr52350 215 ------
NM_018904chr52350 215 ------
NM_018905chr52350 215 ------
NM_018906chr52350 215 ------
NM_018907chr52350 215 ------
NM_018908chr52350 215 ------
NM_018909chr52350 215 ------
NM_018910chr52350 215 ------
NM_018911chr52350 215 ------
NM_018912chr511743 21093 374 ----
NM_018913chr511743 21093 374 ----
NM_018914chr511743 21093 374 ----
NM_018915chr511743 21093 374 ----
NM_018916chr511743 21093 374 ----
NM_018917chr511743 21093 374 ----
NM_018918chr511743 21093 374 ----
NM_018919chr511743 21093 374 ----
NM_018920chr511743 21093 374 ----
NM_018921chr511743 21093 374 ----
NM_018922chr511743 21093 374 ----
NM_018923chr511743 21093 374 ----
NM_018924chr511743 21093 374 ----
NM_018925chr511743 21093 374 ----
NM_018926chr511743 21093 374 ----
NM_018927chr511743 21093 374 ----
NM_018928chr511743 21093 374 ----
NM_018929chr511743 21093 374 ----
NM_018940chr51423 ------
NM_018945chr621129 723 13021 ----
NM_018948chr1----11046 --
NM_018951chr72118 32 ------
NM_018970chr752646 2483 1175 528 128 22652 563 ----
NM_018976chr1231062 473 96 21880 260 ----
NM_018979chr1252409 1964 788 398 266 1182 11657 --
NM_018993chr2031059 385 317 ------
NM_018999chr1044291 4243 3657 240 13190 ----
NM_019000chr511465 ------
NM_019001chr311794 1314 ----
NM_019004chr72884 360 --12330 21494 287
NM_019027chr442585 758 670 412 2351 242 11901 --
NM_019028chr111434 ------
NM_019035chr421960 254 ------
NM_019036chr6154 ------
NM_019040chr11------144
NM_019042chr71322 ----1234
NM_019045chrX1967 ------
NM_019058chr103783 764 601 ------
NM_019063chr262277 2064 1670 1468 794 747 11445 11900 --
NM_019084chr1072142 1932 1926 1766 945 932 744 ------
NM_019087chr51289 --11570 --
NM_019098chr811857 1389 ----
NM_019106chr2253397 3010 2392 846 815 22241 37 ----
NM_019114chr952205 1854 980 950 485 179 ----
NM_019116chr1653333 2508 2337 725 289 ------
NM_019555chr3--161 ----
NM_019593chr2022753 334 ------
NM_019594chr921278 1163 --1398 --
NM_019596chr2141144 1051 1036 110 2717 670 --1677
NM_019597chrX3608 295 134 130 ----
NM_019600chr151308 1218 ----
NM_019610chr11294 1860 11812 --
NM_019854chr122689 96 ------
NM_019857chrX31775 1305 1111 --198 --
NM_019859chr1011001 --1340 --
NM_019884chr192489 27 ------
NM_019885chr252943 976 406 217 171 ------
NM_019895chr32159 141 ------
NM_019903chr1011272 ------
NM_020039chr1231265 548 338 --21682 103 --
NM_020116chr41199 ------
NM_020122chr264382 4319 914 609 127 108 24943 3741 15609 1266
NM_020123chr1021221 1193 ------
NM_020126chr192627 428 ----145
NM_020141chr121860 431 21988 1565 ----
NM_020142chr125581 501 91 64 55 ------
NM_020148chr1822022 1918 11953 1516 22225 467
NM_020151chr231812 591 61 --11417 1339
NM_020156chr71615 --1114 --
NM_020159chr42174 52 1562 ----
NM_020177chr553365 3108 1328 1001 226 --12611 --
NM_020178chr171190 1997 1261 --
NM_020179chr112394 384 ------
NM_020182chr2033611 3168 2349 --153 --
NM_020193chr111916 ------
NM_020204chr1------1758
NM_020205chr143357 3131 2641 2315 ------
NM_020208chr322625 2347 32841 1010 272 --13353
NM_020214chr15--1176 ----
NM_020225chr4----1403 --
NM_020226chr42237 124 ------
NM_020228chr1132508 2081 1009 22429 2087 ----
NM_020239chr12513 170 1526 22006 1531 1797
NM_020240chr552290 2061 1774 847 784 ------
NM_020310chr172273 59 --1324 185
NM_020336chr2052775 2767 2516 768 100 --1208 --
NM_020337chr442201 1189 1112 807 1781 22849 2554 --
NM_020338chr10103703 3214 2765 1427 1330 1069 914 696 642 63 --22278 34 --
NM_020340chr62880 431 22284 1910 11646 1577
NM_020342chr2--21924 1682 22222 1981 --
NM_020344chr9--1169 151 --
NM_020346chr111614 ------
NM_020348chr1032672 1766 308 ------
NM_020357chr311397 1628 ----
NM_020360chr173626 256 139 ------
NM_020379chr11861 1261 1217 --
NM_020383chr101262 ------
NM_020384chrX31930 529 282 11709 ----
NM_020390chr353859 3552 3411 1846 302 1950 1899 --
NM_020403chr1331401 1212 501 --1216 --
NM_020420chrY31673 1166 475 --11617 --
NM_020424chr161658 --174 --
NM_020428chr19--11142 ----
NM_020429chr782567 2544 2289 2253 2177 1095 220 210 ------
NM_020432chr732338 1515 814 ----1899
NM_020438chr911064 11255 ----
NM_020443chr156648 4826 2040 1208 659 35632 2581 2490 11255 15580
NM_020444chr5150 ----1351
NM_020452chr13368 362 95 ------
NM_020456chr132814 360 11493 11997 --
NM_020463chr21475 ----11050
NM_020466chr6114288 4177 3677 3570 3448 3383 3343 1983 1413 785 612 54866 4807 4247 727 546 24232 3609 13092
NM_020474chr182638 72 11874 ----
NM_020475chr821674 570 1510 32240 545 72 --
NM_020476chr821674 570 1510 32240 545 72 --
NM_020477chr821674 570 1510 32240 545 72 --
NM_020478chr821737 633 1573 42303 608 135 77 --
NM_020480chr821674 570 1510 32240 545 72 --
NM_020526chr131670 1276 607 11753 ----
NM_020546chr542069 1978 290 56 13179 1994 --
NM_020647chr831849 1502 516 1331 ----
NM_020648chr1842783 2277 491 433 1327 ----
NM_020654chr321426 551 ----11096
NM_020666chr52622 75 ------
NM_020673chr2077718 6845 6388 5773 5298 5069 2516 14922 22724 1364 1969
NM_020676chr3173 --1344 --
NM_020686chr1632868 2451 731 --1458 --
NM_020689chr2051673 1525 522 173 131 ------
NM_020690chr52332 251 ------
NM_020697chr821302 222 ------
NM_020699chr195003 4822 3875 3370 3354 1821 745 483 60 --15304 --
NM_020706chr21----136 --
NM_020713chr2042665 2467 1953 143 --12241 --
NM_020715chr1421737 1409 --1714 --
NM_020717chrX33296 3066 1141 14930 1240 14135
NM_020718chr1675765 5426 5307 1942 1880 1863 581 26132 1115 24129 2226 --
NM_020726chr52584 417 ------
NM_020727chr2163754 3554 983 611 520 383 23540 287 --11578
NM_020728chr742975 2346 1997 1141 32858 2355 2077 12380 --
NM_020732chr61447 ------
NM_020734chr1222488 2302 ------
NM_020739chr1513712 1425 ----
NM_020742chrX32150 1930 380 1280 21862 358 --
NM_020748chr1712171 --11946 --
NM_020749chr842122 1633 1533 680 11758 ----
NM_020752chr1032474 2318 858 42256 1945 987 554 ----
NM_020760chr21448 11533 11842 --
NM_020762chr1241018 761 708 234 1813 ----
NM_020766chrX44235 1291 1283 761 --21455 1079 --
NM_020769chrX3817 786 645 2124 73 ----
NM_020772chr1797129 6717 5915 3423 2829 2608 2573 2478 488 ----18591
NM_020773chr442593 282 102 23 12524 --12396
NM_020775chr11207 ------
NM_020778chr1594547 4243 4161 1719 1256 1039 776 637 293 2949 831 ----
NM_020791chr1711400 ------
NM_020792chr331883 1714 99 --12436 --
NM_020801chr542208 417 236 175 --1985 --
NM_020802chr1143324 2420 2089 1073 13019 13043 --
NM_020804chr6112552 2324 2216 1062 963 531 506 380 336 61 31 32150 2137 351 21732 22 --
NM_020805chr1821263 35 ------
NM_020807chr161182 ------
NM_020808chr1--1729 ----
NM_020809chr1131978 845 790 1571 12005 22099 413
NM_020810chr1433403 2438 353 2855 749 1177 12995
NM_020818chr142400 107 --132 --
NM_020821chr1541398 789 206 65 1253 ----
NM_020824chr10--1498 ----
NM_020826chr1133705 1407 142 33470 2343 1021 1540 --
NM_020830chr233171 2424 529 1963 13313 1369
NM_020831chr222999 163 151 1876 --
NM_020832chr13505 473 218 ------
NM_020834chr1431899 1589 1549 ------
NM_020839chr331394 1042 336 --1397 21098 424
NM_020841chr1243038 1007 522 301 12732 ----
NM_020843chr152105 65 ------
NM_020845chr1252252 2057 1883 740 373 ------
NM_020850chr1682932 2813 2790 2555 2045 1252 1026 114 21165 852 ----
NM_020854chr1841509 1379 1347 982 1543 ----
NM_020856chr1921047 123 --11506 --
NM_020858chr1521681 1480 2969 224 --21952 1501
NM_020860chr43893 837 67 ------
NM_020868chr22421 129 11417 ----
NM_020870chr432194 1715 1437 135 ----
NM_020871chrX22553 1032 --1424 --
NM_020872chr3----1297 --
NM_020873chr32833 729 ------
NM_020888chr122004 543 1450 ----
NM_020898chr124305 68 50 34 1169 ----
NM_020899chr1721697 1689 --22031 104 1449
NM_020918chr1042524 2284 468 205 12737 ----
NM_020922chrX31680 399 318 2498 226 --11749
NM_020925chr11570 ------
NM_020935chr254428 3743 3501 2977 236 ------
NM_020940chr1062922 2855 2648 1891 373 157 ------
NM_020946chr931499 539 80 11680 ----
NM_020948chr143022 2719 2496 648 ----12239
NM_020952chr92649 226 --1579 1341
NM_020956chr1953104 1122 840 538 428 --21133 378 --
NM_020962chr1572454 1673 904 728 633 177 167 --1406 --
NM_020964chr1864432 3314 3070 988 783 348 ------
NM_020977chr441880 1442 858 206 21760 723 11410 --
NM_020981chr21582 ------
NM_020983chr1232027 878 510 ----1695
NM_020993chr1262379 818 719 317 199 161 12299 --12583
NM_021007chr221861 333 11682 ----
NM_021020chr853117 2944 2242 764 106 ------
NM_021032chr362026 1649 492 400 233 140 ------
NM_021033chr1312507 169 ----
NM_021038chr353107 2453 2344 1125 207 23171 2601 ----
NM_021045chr1061649 883 766 758 751 23 12099 ----
NM_021047chr191265 ------
NM_021064chr631507 1454 500 ------
NM_021069chr411607 ------
NM_021072chr5255 34 1805 12406 --
NM_021079chr1722674 423 23175 2959 ----
NM_021083chrX82938 2335 1406 1364 809 795 469 52 12429 ----
NM_021097chr252687 2540 246 172 132 --11965 --
NM_021109chrX------136
NM_021109chrX------136
NM_021111chr9261 40 1288 ----
NM_021120chrX52981 2805 737 239 71 --1559 --
NM_021133chr13607 224 68 ------
NM_021140chrX2763 470 1176 ----
NM_021144chr9----1444 --
NM_021145chr71934 1279 ----
NM_021148chr752231 863 724 713 44 ----1609
NM_021149chr1631206 1049 199 1815 ----
NM_021180chr11783 ------
NM_021183chrX41907 1650 972 358 ------
NM_021188chr142485 131 ------
NM_021189chr13947 910 756 ------
NM_021190chr11146 ------
NM_021202chr2071989 837 456 430 373 244 201 21923 906 ----
NM_021215chr2031747 1547 744 1246 --11827
NM_021218chr91289 1994 ----
NM_021226chr10122 ------
NM_021235chr192150 28 --1114 --
NM_021239chr144505 425 208 165 ------
NM_021240chr9--1173 ----
NM_021242chrX4821 692 377 59 ------
NM_021249chr1461173 1034 671 326 242 233 --11360 --
NM_021252chr1041465 1409 795 244 --21426 348 --
NM_021255chr1483427 3348 2987 2590 2546 1217 1001 739 1393 ----
NM_021614chr5--1259 ----
NM_021622chr1042205 1952 887 411 ------
NM_021629chr355055 4903 4778 836 765 23429 1963 21868 1499 --
NM_021637chrX3869 382 207 11131 ----
NM_021643chr221751 278 1575 1111 --
NM_021644chr101254 ------
NM_021647chr444058 3942 1718 655 ------
NM_021724chr172217 57 ------
NM_021728chr14------158
NM_021813chr655142 4945 3798 1529 983 34860 1879 1833 1559 14662
NM_021814chr621633 1447 ------
NM_021815chr243011 2264 1241 440 ------
NM_021818chr1431446 555 209 ------
NM_021907chr21268 --198 --
NM_021911chr544857 4323 4292 2125 11906 1360 14354
NM_021912chr1543394 3380 1238 453 22827 2671 11153 --
NM_021940chr631465 1450 1038 2571 498 144 --
NM_021945chr633173 2762 2283 22366 1033 33387 2640 2290 --
NM_021947chr1721111 957 1330 ----
NM_021949chrX52483 2464 1990 1023 332 1273 ----
NM_021959chr63334 312 23 --1823 --
NM_021960chr142655 2573 2345 1109 11020 ----
NM_021961chr1186835 6789 6593 4864 2487 1932 1257 1140 37353 5938 4991 165 15214
NM_021962chr1761753 1724 765 699 693 278 2534 107 ----
NM_021964chr394560 4055 2442 2395 2313 1420 1354 703 325 1397 1831 1909
NM_021967chr52219 82 11012 ----
NM_021972chr17----1267 --
NM_021973chr42579 93 1233 1258 --
NM_021977chr653259 3242 3046 2389 1386 ------
NM_021984chrX1125 11029 ----
NM_021987chrX1125 11029 ----
NM_021990chrX1125 11029 ----
NM_021998chrX21237 118 ------
NM_022037chr21357 ------
NM_022041chr16193 ----12609
NM_022048chr1596342 5421 5038 4901 4227 4058 966 895 347 36379 5132 1789 --11530
NM_022062chr1151681 1555 671 482 204 ------
NM_022090chr52507 478 ------
NM_022098chr221343 41410 1009 309 108 ----
NM_022114chr163535 1489 1134 309 137 104 13884 ----
NM_022117chrX199 ------
NM_022123chr14--1135 ----
NM_022130chr531378 1036 577 1227 ----
NM_022166chr1645373 2079 1906 1574 45796 5030 4267 4247 11437 --
NM_022170chr771709 1700 1538 601 415 174 91 ------
NM_022173chr21357 ------
NM_022336chr2--61945 939 850 717 422 383 --11810
NM_022351chr843005 2533 1339 131 33253 3181 477 11029 --
NM_022374chr2143 ------
NM_022405chr322625 2347 32841 1010 272 --13353
NM_022454chr81781 --2772 52 --
NM_022455chr52295 111 ------
NM_022458chr742647 1142 824 785 --21962 61 --
NM_022461chr331295 1021 37 ----11440
NM_022465chr1272635 2318 1891 1159 801 738 315 2554 34 --12200
NM_022470chr3--11249 2783 96 --
NM_022473chr1553523 1098 679 173 73 34180 3357 1519 ----
NM_022474chr1452379 1727 1069 668 403 1262 --31784 679 617
NM_022475chr42563 197 --192 --
NM_022476chr161796 1229 ----
NM_022477chr2031693 663 193 154 --1215
NM_022484chr741155 1127 547 34 ----1539
NM_022496chr121406 ------
NM_022557chr17--1202 189 --
NM_022640chr17--1200 189 --
NM_022648chr254600 3773 3660 3641 76 1794 ----
NM_022650chr52396 100 159 --1112
NM_022658chr124270 253 184 118 --1360 --
NM_022716chr132729 2398 941 1279 ----
NM_022726chr641746 1717 1292 464 ------
NM_022730chr25733 420 178 164 24 ------
NM_022739chr172306 223 --1103 --
NM_022748chr71350 11797 --1110
NM_022756chr121493 1158 11351 ----
NM_022763chr31105 1375 167 23020 2324
NM_022771chr123911 320 33 --1214 --
NM_022781chr943348 2191 2139 280 22421 799 1258 1669
NM_022782chr121134 ------
NM_022802chr10136 --11018 --
NM_022821chr12390 186 ------
NM_022823chr22384 112 1449 ----
NM_022826chr231177 1074 807 ------
NM_022831chr121633 287 11325 ----
NM_022832chr452595 2390 785 384 109 --12241 12256
NM_022841chr1532295 1793 991 ------
NM_022844chr164970 773 762 103 ------
NM_022893chr252188 492 85 56 28 ----22672 1993
NM_022898chr1463850 3180 1703 695 525 491 1135 13460 13087
NM_022900chr711198 ------
NM_022918chr1142193 778 320 116 1355 ----
NM_022965chr42510 70 --11339 --
NM_022970chr102990 353 ------
NM_022977chrX32660 2242 1963 ------
NM_022978chr52219 82 11012 ----
NM_023012chr121192 184 ----
NM_023016chr282715 2475 2450 1056 771 667 327 227 11923 12534 --
NM_023035chr192835 536 ------
NM_023037chr1311086 ------
NM_023076chr1652937 2731 2004 1971 50 22025 1199 ----
NM_023079chr1721639 429 11652 ----
NM_023105chr821958 397 21528 238 ----
NM_023106chr821958 397 21528 238 ----
NM_023110chr821958 397 21528 238 ----
NM_023111chr821958 397 21528 238 ----
NM_023112chr1452982 2694 2286 2030 537 22573 2016 164 1329
NM_023927chr511183 --1286 1324
NM_023929chr882745 2451 2241 2096 666 391 321 230 ------
NM_023930chr112835 791 2856 164 ----
NM_024007chr522793 2175 11051 2945 907 --
NM_024015chr171130 ----11096
NM_024017chr1741199 631 333 49 11735 --31530 470 387
NM_024034chr202887 93 --1151 --
NM_024037chr11855 ------
NM_024038chr191290 ------
NM_024046chr351214 1044 350 303 104 --1380 --
NM_024050chr191131 ------
NM_024055chr52656 634 ------
NM_024063chr15174 ------
NM_024092chr1141276 895 464 169 1911 1495 --
NM_024095chr1241360 1186 1168 63 ------
NM_024293chr2183 1306 1601 --
NM_024295chr851694 1472 1381 634 25 11674 ----
NM_024297chr172377 180 1105 ----
NM_024329chr131564 189 179 ------
NM_024341chr1953344 1177 642 279 140 23763 968 --13255
NM_024345chr955706 2121 309 220 138 11788 --24863 4438
NM_024490chr151232 1461 ----
NM_024513chr393350 2680 1109 1070 879 639 479 179 164 127 13558 --
NM_024524chr333171 3157 1201 ------
NM_024525chr11534 ------
NM_024532chr2132 ------
NM_024545chr22689 576 ----1528
NM_024546chr131459 1899 ----
NM_024548chr311618 11492 186 --
NM_024554chr141697 609 599 354 1188 ----
NM_024557chr1111162 --21382 1370 --
NM_024561chr1311289 ------
NM_024567chr81175 1278 ----
NM_024574chr42362 77 ------
NM_024582chr441076 913 747 47 --1760 --
NM_024586chr1--193 ----
NM_024595chr12114 58 21223 936 ----
NM_024602chr11693 ----1895
NM_024607chr863753 2740 1380 1197 798 145 --12820 13287
NM_024612chr173988 972 961 1355 11050 --
NM_024613chr821283 179 1668 1188 --
NM_024617chr91734 123 ----
NM_024624chr251319 1024 604 482 409 ------
NM_024626chr11507 --11558 --
NM_024631chr11154 ------
NM_024639chr6--1188 --1177
NM_024643chr14183 --1176 --
NM_024645chr831372 990 419 ------
NM_024665chr364568 4184 3892 3363 2942 1880 ------
NM_024670chr1041433 1365 453 441 ------
NM_024674chr143066 2412 2240 408 12678 ----
NM_024680chr112380 83 ------
NM_024682chr19----1117 --
NM_024692chr221876 1438 ------
NM_024698chr11----1238 11092
NM_024704chr2051034 990 915 713 425 ------
NM_024713chr1531075 662 439 ------
NM_024721chr811945 ------
NM_024725chr112790 611 1163 --1170
NM_024744chr222472 2183 --12198 --
NM_024755chr151644 ------
NM_024757chr921048 237 ------
NM_024761chr984661 4527 4377 3364 1082 782 287 100 11069 44011 3643 1075 148 24760 649
NM_024770chr285670 5614 5500 2546 2479 2299 2221 1070 1891 25685 1221 --
NM_024779chr1251165 1026 564 507 52 11591 11052 --
NM_024780chr16--21065 170 --1431
NM_024792chr1731145 1133 1003 158 ----
NM_024804chr1--1342 ----
NM_024811chr111505 11651 11581 --
NM_024824chr1431271 1207 66 21566 1539 ----
NM_024837chr1541839 1644 509 228 141 ----
NM_024850chr53944 610 49 1781 ----
NM_024852chr11670 1562 ----
NM_024854chr1231436 1283 466 ------
NM_024881chr1923300 365 21291 355 12321 --
NM_024887chr131583 722 55 --1842 --
NM_024896chr92516 201 2300 227 --142
NM_024900chr451727 270 209 71 36 --1611 --
NM_024900chr451727 270 209 71 36 --1611 --
NM_024913chr751632 1530 1344 327 112 --3679 657 172 1424
NM_024915chr862343 2083 2019 1909 588 356 ----12441
NM_024920chr411334 ----1413
NM_024930chr532764 2316 681 ------
NM_024933chr22613 70 1190 1588 --
NM_024947chr379444 9165 7989 7176 6822 2853 92 16033 11288 --
NM_024948chr101668 ------
NM_024949chr464560 4315 3566 1623 1250 933 13513 ----
NM_024971chr92649 226 --1579 1341
NM_024989chr277832 7083 5503 5374 5116 2692 1223 ------
NM_024993chr221308 646 ----11406
NM_025054chr832750 1481 529 ----13219
NM_025057chr1461273 1266 1164 1108 351 213 --1897 --
NM_025065chr1178 1602 ----
NM_025076chr2140 ------
NM_025080chr11--2255 245 1772 11097
NM_025083chr1551997 1584 1431 573 492 11761 ----
NM_025099chr17--1124 ----
NM_025126chr122553 247 ------
NM_025133chr23841 424 55 ------
NM_025134chr1622165 618 --12186 --
NM_025146chr33505 448 83 1483 ----
NM_025147chr221100 382 1732 ----
NM_025151chr821440 851 11367 1194 --
NM_025160chr154276 3684 3676 591 262 ------
NM_025164chr1122065 441 ------
NM_025179chr164720 4284 3647 3184 1317 477 23705 1115 34913 4597 640 --
NM_025182chr93920 428 411 2928 193 ----
NM_025191chr153266 3008 2358 2281 287 1921 --1484
NM_025195chr841750 1301 518 501 --1663 --
NM_025201chr1522023 1852 --1378 --
NM_025208chr1142375 2212 1898 1824 11982 ----
NM_025216chr26614 593 516 502 465 199 ------
NM_025219chr201575 --3883 476 274 12278
NM_025221chr41233 ------
NM_025224chr2072112 2079 1776 834 756 91 37 1705 ----
NM_025234chr15----159 --
NM_025235chr102146 73 1226 11473 22239 720
NM_025236chr63643 202 92 ------
NM_025237chr17--1288 ----
NM_025248chr1763195 1300 553 386 331 44 12082 --1400
NM_025257chr62140 63 1354 ----
NM_025263chr64744 538 391 138 --1435 --
NM_030579chr1633083 357 188 --13607 --
NM_030621chr1453366 3038 1510 1346 241 12583 23211 730 --
NM_030623chr261601 1430 617 312 83 28 ------
NM_030625chr1042413 2104 912 807 ------
NM_030627chr541490 1062 960 46 13026 --12877
NM_030634chr132378 1817 97 ------
NM_030647chr765156 4966 4729 3856 772 719 11749 14955 --
NM_030648chr463438 2136 1897 543 405 288 ------
NM_030650chr213108 14255 ----
NM_030661chr73419 289 136 ------
NM_030664chr1022082 52 21999 1739 12262 --
NM_030667chr1261278 1232 867 283 256 201 ------
NM_030668chr1261278 1232 867 283 256 201 ------
NM_030669chr1261278 1232 867 283 256 201 ------
NM_030670chr1262310 2264 1899 892 542 275 21583 569 1433 --
NM_030671chr1262310 2264 1899 892 542 275 21583 569 1433 --
NM_030674chr1285641 5610 5106 4085 1743 1484 657 76 --1870 --
NM_030751chr101383 ------
NM_030751chr101383 ------
NM_030755chr1442626 2469 1233 142 --1916 --
NM_030758chr223147 101 64 11268 --11209
NM_030759chr101530 1199 ----
NM_030761chr152640 2560 2220 1999 706 ------
NM_030762chr124780 760 683 174 11727 ----
NM_030782chr51396 ------
NM_030786chr121397 575 11814 ----
NM_030791chr14--11491 ----
NM_030806chr188699 8613 8347 7999 6166 2622 1060 255 ----16580
NM_030820chr62705 325 ------
NM_030881chr221635 --22343 622 --
NM_030884chr332207 2064 348 12159 21855 180 --
NM_030885chr351809 1511 1432 751 108 ----11817
NM_030911chr1321325 51 ------
NM_030912chr102589 313 1115 ----
NM_030915chr262411 1869 1862 859 826 492 1690 ----
NM_030918chr1115482 5380 5074 4931 4282 4109 3616 1681 1662 863 36 15403 --11782
NM_030920chr131908 807 342 1153 ----
NM_030937chr151185 1108 1074 368 355 ------
NM_030939chr621138 325 ------
NM_030948chr62212 81 ------
NM_030949chr631042 427 277 ------
NM_030952chr12396 350 --21306 435 11295
NM_030953chr51595 ----1104
NM_030959chr6--150 ----
NM_030963chr6175 ----1555
NM_030964chr532723 691 123 1518 ----
NM_030979chr131335 ------
NM_030980chr11481 1697 ----
NM_030981chr1161126 949 848 841 794 200 ------
NM_031157chr121142 1237 ----
NM_031216chr1832260 1708 688 1875 ----
NM_031226chr155982 502 389 99 24 1813 ----
NM_031243chr742019 1780 1723 315 ------
NM_031262chr921145 847 --172 --
NM_031263chr921202 904 --1129 --
NM_031266chr51148 ------
NM_031268chr1675063 4524 4389 3446 2077 1453 1367 24500 4212 11811 11234
NM_031283chr23645 295 101 ------
NM_031284chr15------1125
NM_031371chr111372 ------
NM_031371chr111372 ------
NM_031411chr52350 215 ------
NM_031417chr195738 725 595 325 149 ------
NM_031418chr1152759 2410 2013 1066 1042 --11940 --
NM_031419chr321320 33 ------
NM_031426chr93408 333 232 1548 12101 --
NM_031427chr1455706 5587 4816 4751 2037 45798 4381 4092 1771 14474 --
NM_031431chr1351687 1323 1277 538 419 1438 ----
NM_031442chrX52666 2642 2169 2096 91 23130 2907 1557 1541
NM_031445chr283424 3376 2944 2388 2086 851 693 672 --12399 --
NM_031459chr1------1406
NM_031461chr841937 1863 1849 549 --2773 667 --
NM_031468chr777099 6370 2727 2574 1258 893 388 45170 4985 1325 169 16549 --
NM_031483chr2063477 773 681 546 440 341 33165 2775 2367 ----
NM_031492chr113587 419 209 1536 ----
NM_031844chr153636 3599 2662 1540 346 13993 --2482 93
NM_031845chr293511 3312 2638 2598 2328 2289 1478 1427 327 ----13146
NM_031847chr293511 3312 2638 2598 2328 2289 1478 1427 327 ----13146
NM_031849chr52350 215 ------
NM_031857chr52350 215 ------
NM_031860chr52350 215 ------
NM_031886chr1912313 22116 1703 12140 --
NM_031911chr421980 1731 --131 --
NM_031922chr62507 78 ------
NM_031935chr1----1123 --
NM_031953chr41363 ------
NM_031989chr121128 ------
NM_031990chr1921491 1095 151 11335 --
NM_031991chr1921491 1095 151 11335 --
NM_031992chr771709 1700 1538 601 415 174 91 ------
NM_032012chr964311 3729 3553 3427 811 528 11677 ----
NM_032013chr2031693 663 193 154 --1215
NM_032017chr131597 614 37 1332 11955 --
NM_032037chr19124 ------
NM_032041chr842447 2384 2166 526 --12263 --
NM_032042chr522028 900 --11896 1536
NM_032047chr332106 2059 1678 ------
NM_032050chr221390 1136 ----
NM_032088chr511743 21093 374 ----
NM_032092chr511743 21093 374 ----
NM_032102chr114750 418 122 60 12263 ----
NM_032104chr1128 2568 45 1248 1285
NM_032105chr198078 7668 6275 3156 2054 1786 1112 956 28 77798 7369 2939 2428 2217 568 45 1248 36792 1098 285
NM_032108chr191701 ------
NM_032109chr551228 589 577 571 24 --1449 --
NM_032121chrX22644 2584 11731 ----
NM_032124chr1821181 249 ------
NM_032153chr351083 1065 812 774 35 1929 --2660 646
NM_032160chr18104128 4116 3937 3919 3597 3573 2820 1331 790 463 14015 1947 14096
NM_032177chr51509 --1360 --
NM_032182chr1021602 1119 11404 ----
NM_032192chr171227 166 ----
NM_032199chr1053767 2603 1332 255 52 ------
NM_032205chr8131 ------
NM_032208chr243493 3448 2638 111 1398 ----
NM_032211chr1021163 1066 ------
NM_032217chr41180 ------
NM_032221chr2021272 778 3246 179 76 11292 --
NM_032228chr1122914 1012 --22810 1344 --
NM_032229chr1311000 ------
NM_032239chr41267 --1444 --
NM_032246chr151295 11071 1133 --
NM_032250chr92625 290 ------
NM_032256chr122415 198 ------
NM_032271chr1651544 1528 1343 1155 501 ------
NM_032272chr8------1330
NM_032281chr192252 160 --23079 1152 --
NM_032289chr561856 1744 1437 1349 789 589 ------
NM_032291chr141767 1628 299 276 1257 ----
NM_032293chr92278 52 ------
NM_032294chr1731610 117 38 ------
NM_032316chr342437 2369 422 131 2934 93 1311 1248
NM_032320chr11182 ------
NM_032352chr1441296 1189 1008 952 ------
NM_032375chr193786 121 65 ------
NM_032403chr511743 21093 374 ----
NM_032408chr71129 21170 219 1453 --
NM_032420chr52619 77 165 ----
NM_032424chr1121022 434 ------
NM_032438chr611636 ------
NM_032439chr102462 239 ------
NM_032440chr1032741 2159 101 ------
NM_032441chrX1124 2416 116 ----
NM_032445chr15--1814 ----
NM_032449chr162877 2097 1973 1043 650 567 12726 1561 --
NM_032452chr142980 221 ------
NM_032457chr463834 1287 704 627 239 130 22587 1552 ----
NM_032458chrX2777 688 --23331 259 11172
NM_032466chr831419 587 473 --1220 157
NM_032468chr831419 587 473 --1220 157
NM_032491chr1241313 946 830 327 ------
NM_032510chr181884 1735 --1212
NM_032512chrX3717 286 62 ------
NM_032523chr2135 ------
NM_032532chr62616 174 ------
NM_032538chr642449 1791 888 341 ----1387
NM_032560chr142453 128 ------
NM_032574chr2182 ------
NM_032575chr161234 1687 --11891
NM_032578chr1031450 1223 551 11517 ----
NM_032582chr1721824 1657 ------
NM_032590chr1251113 827 758 426 182 --1258 1351
NM_032595chr17--21407 1214 --1333
NM_032623chr42273 75 ------
NM_032626chr161126 ------
NM_032632chr1421983 1245 ------
NM_032645chr11277 38 ------
NM_032667chr11------128
NM_032682chr343598 2432 1081 479 3972 867 779 33454 2372 826 --
NM_032687chr8144 ------
NM_032689chr191446 11564 ----
NM_032711chr1763095 1237 1118 585 431 391 12815 24127 3229 --
NM_032737chr194569 227 189 178 ----12727
NM_032741chr64921 779 223 170 2936 413 --1314
NM_032765chr51785 1998 ----
NM_032778chr342811 2457 670 622 ------
NM_032784chr61247 --1125 --
NM_032787chr31276 ------
NM_032790chr122383 259 ------
NM_032808chr152988 72 ------
NM_032810chr1031022 431 125 ------
NM_032813chr132904 167 ------
NM_032826chr7114486 4142 4102 3749 3724 3692 3556 3526 1645 1163 991 55177 4017 3382 3353 1764 --24539 4324
NM_032833chr11166 --22498 827 --
NM_032836chr192423 406 --1797 --
NM_032838chr1941271 1020 375 158 ------
NM_032842chr721297 289 ------
NM_032857chr151183 ------
NM_032859chr1323652 2923 ------
NM_032873chr1194126 3524 3506 3114 1367 1204 1010 722 131 ----188
NM_032875chr175693 674 648 564 255 2307 184 2716 47 --
NM_032884chr11322 ------
NM_032892chr15160 ------
NM_032905chr1021039 243 ------
NM_032918chr12----140 1219
NM_032961chr41528 ------
NM_032971chrY3958 330 55 1851 ----
NM_032972chrY3958 330 55 1851 ----
NM_032975chr1853257 2227 1240 912 766 12332 125 --
NM_032980chr1853257 2227 1240 912 766 12332 125 --
NM_032982chr722566 1975 1879 1601 --
NM_032995chr241651 1466 456 105 --11310 --
NM_032998chr14920 908 776 325 --1744 --
NM_033020chr133448 1112 180 --1743 --
NM_033023chr731091 197 134 --154 --
NM_033027chr31752 1925 1127 --
NM_033030chr231146 560 136 1283 ----
NM_033044chr131285 1163 955 ------
NM_033055chr131085 865 749 ----175
NM_033058chr82691 662 1123 ----
NM_033089chr2011090 2429 155 --11057
NM_033102chr131001 995 59 --1475 --
NM_033102chr131001 995 59 --1475 --
NM_033103chr191383 --11159 --
NM_033116chr14159 ------
NM_033117chr91284 ------
NM_033119chr161658 1124 1938 --
NM_033129chr2061969 1768 727 676 400 178 31342 815 214 ----
NM_033133chr1753725 3595 3516 2755 2355 1819 1195 13536
NM_033135chr1142375 2212 1898 1824 11982 ----
NM_033136chr51337 2661 211 11568 --
NM_033137chr51337 2661 211 11568 --
NM_033138chr732211 2191 463 12241 ----
NM_033139chr732211 2191 463 12241 ----
NM_033140chr732211 2191 463 12241 ----
NM_033143chr433368 1736 1373 --21469 541 --
NM_033147chr21268 --198 --
NM_033148chr21268 --198 --
NM_033150chr12--175 ----
NM_033157chr732211 2191 463 12241 ----
NM_033181chr663387 3113 3026 2671 2616 1180 ----13259
NM_033201chr162817 299 1810 ----
NM_033207chr1031937 1085 132 --22286 502 --
NM_033211chr531510 1403 307 ------
NM_033222chr931145 496 30 ------
NM_033224chr728021 5122 37265 5322 2998 17779 26243 5851
NM_033225chr85531 458 295 94 82 1207 21285 771 1260
NM_033226chr163619 455 159 ------
NM_033240chr1571726 1572 1399 596 581 566 222 21529 342 11227 --
NM_033244chr1571246 1092 919 411 116 101 86 11049 ----
NM_033247chr151322 1125 ----
NM_033272chr2--122 ----
NM_033281chr51145 ------
NM_033285chr883851 1480 1437 1149 868 822 413 212 ------
NM_033290chrX43690 2683 1082 925 ----13533
NM_033300chr131043 989 228 --155 2933 473
NM_033326chr1142362 2314 914 372 1954 11627 --
NM_033360chr1274634 4541 4070 1790 1494 1270 700 12946 ----
NM_033375chr1731293 1143 546 --11496 --
NM_033389chr1733835 3205 1124 --14126 --
NM_033394chr221582 603 ------
NM_033396chr11150 ------
NM_033419chr1711222 --1599 --
NM_033420chr19--11170 ----
NM_033425chr1133094 361 42 22913 2350 13267 --
NM_033426chr1482744 2316 2148 1975 624 582 332 63 ------
NM_033429chr1593277 3088 2609 2240 2216 1086 535 365 330 13076 12854 --
NM_033430chr464075 3569 3118 1172 540 431 23731 644 ----
NM_033437chr464075 3569 3118 1172 540 431 23731 644 ----
NM_033448chr122142 76 131 ----
NM_033450chr62304 85 --1114 --
NM_033480chr612814 1410 23033 2971 1894
NM_033481chr612814 1410 23033 2971 1894
NM_033495chrX2978 927 ------
NM_033496chr10139 ------
NM_033497chr10139 ------
NM_033498chr10139 ------
NM_033500chr10139 ------
NM_033503chr1533734 3259 159 1893 12538 --
NM_033540chr311044 ------
NM_033542chr2041293 357 277 32 21800 1765 ----
NM_033547chr11--177 ----
NM_033551chr583497 3274 2530 2309 1311 670 647 339 12600 ----
NM_033624chr122781 279 31602 336 117 1310 --
NM_033631chr173935 3328 3051 2581 1036 971 647 2928 426 ----
NM_033632chr41632 --21060 46 --
NM_033637chr1073195 3140 1526 866 773 664 433 13953 --12624
NM_033644chr532575 2553 2209 ----11676
NM_033645chr532575 2553 2209 ----11676
NM_033656chr2165855 4884 2036 2020 1271 1216 34870 4735 1254 12385 --
NM_052821chr941943 1847 1708 488 ------
NM_052827chr122857 117 ------
NM_052840chr1541166 579 564 331 1154 ----
NM_052849chr151755 1163 ----
NM_052851chr1352062 1740 1661 834 683 ------
NM_052872chr62172 46 ------
NM_052879chr1232771 727 32 22833 869 23272 3137 --
NM_052880chr2221203 108 1901 ----
NM_052885chr1233977 1658 1197 13222 ----
NM_052886chr832008 1807 444 ----199
NM_052897chr122697 111 --1881 --
NM_052898chr821324 1201 ----175
NM_052900chr841740 1718 210 91 2584 469 ----
NM_052901chr931629 1475 225 11636 ----
NM_052905chr231656 1164 572 --21590 1374 --
NM_052907chr1234333 1060 389 1669 --13364
NM_052910chr1342182 1768 1623 1431 21986 545 ----
NM_052918chr1053169 902 741 368 288 12920 32401 1184 425 --
NM_052932chr1122267 377 ----1564
NM_052937chr812129 ------
NM_052954chr211250 ----2913 598
NM_052966chr193886 3766 3255 3090 1563 1439 1004 333 61 32973 2685 745 ----
NM_052978chr14----145 --
NM_052996chr1651598 1391 1340 1315 576 --21106 631 --
NM_053002chr32911 251 ------
NM_053016chr997642 7140 7058 5596 5583 1824 1348 1069 255 47247 6833 6143 996 12857 --
NM_053023chr1152226 2208 2177 452 277 ------
NM_053024chr331379 997 271 1223 --11048
NM_053025chr311126 1462 --11274
NM_053026chr311126 1462 --11274
NM_053027chr311126 1462 --11274
NM_053028chr311126 1462 --11274
NM_053031chr311126 1462 --11274
NM_053032chr311126 1462 --11274
NM_053043chr7116443 6265 5667 5578 5028 4450 2028 1253 977 884 219 36001 5746 5567 46078 4803 3975 677 --
NM_053056chr112876 814 22411 1006 ----
NM_053064chr1452807 1874 1243 1114 257 --12110 --
NM_053067chr91219 ------
NM_053279chr811917 2245 84 ----
NM_054016chr131271 171 107 1734 ----
NM_054016chr131271 171 107 1734 ----
NM_054016chr131271 171 107 1734 ----
NM_054035chr172681 79 ------
NM_057089chr71168 1408 ----
NM_057164chr23640 468 125 --1274 --
NM_057165chr23640 468 125 --1274 --
NM_057166chr23640 468 125 --1274 --
NM_057167chr23640 468 125 --1274 --
NM_057175chr411670 11752 ----
NM_057178chr171421 22434 643 ----
NM_057749chr82976 236 --1435 --
NM_058172chr431836 705 181 11142 ----
NM_058187chr21------1174
NM_058229chr8------277 24
NM_058240chr1431113 442 61 ------
NM_058241chr232310 817 519 ----1671
NM_058241chr232310 817 519 ----1671
NM_078469chr10--1415 ----
NM_078470chr1062528 2426 691 677 633 398 11910 ----
NM_078471chr1721036 987 1818 --1373
NM_078481chr191578 191 ----
NM_078626chr11353 ------
NM_079421chr192191 70 ------
NM_080391chr12129 118 ------
NM_080392chr12178 167 --1432 --
NM_080415chr171927 ------
NM_080422chr182294 77 ------
NM_080423chr182294 77 ------
NM_080546chr91214 21417 504 --22061 37
NM_080552chr201444 ------
NM_080591chr921009 552 2372 51 ----
NM_080597chr184965 840 803 116 ------
NM_080611chr20130 ------
NM_080616chr201168 ----2524 137
NM_080671chr232226 748 478 ------
NM_080672chr202156 57 --1189 --
NM_080677chr171132 ------
NM_080717chr1251295 318 297 287 138 ------
NM_080723chr631049 411 144 ------
NM_080743chr652167 947 721 553 540 --12189 --
NM_080759chr1352426 1926 524 445 56 1737 ----
NM_080760chr1352426 1926 524 445 56 1737 ----
NM_080829chr2041002 415 96 74 1217 ----
NM_080872chr853468 3226 3116 2751 1535 33051 1353 641 ----
NM_080874chr41596 ----1535
NM_080927chr322807 1032 1279 1607 --
NM_100264chr101684 ------
NM_100486chr101684 ------
NM_130385chr1142207 145 137 40 ------
NM_130391chr9--12697 --33283 1235 776
NM_130392chr9--12697 --33283 1235 776
NM_130393chr9--12697 --33283 1235 776
NM_130434chr1531028 835 121 ------
NM_130435chr1042987 2647 2470 902 12165 ----
NM_130436chr2132087 1824 504 ------
NM_130438chr2142664 2401 2101 1081 2404 248 ----
NM_130439chr1011695 ------
NM_130439chr1011695 ------
NM_130440chr121528 274 11269 --11498
NM_130442chr71224 1810 31154 761 124 --
NM_130459chr9156 ------
NM_130768chr72259 96 ------
NM_130781chr51538 ------
NM_130798chr1531005 95 36 --11388 11510
NM_130808chr3175 ----1341
NM_130811chr201805 ----1367
NM_130838chr1521856 1152 ------
NM_130839chr1521856 1152 ------
NM_130846chr121370 ------
NM_133171chr2031297 66 60 2512 218 11222 --
NM_133172chr52275 89 ------
NM_133173chr52275 89 ------
NM_133174chr52275 89 ------
NM_133177chr121014 34 --1102 --
NM_133178chr121014 34 --1102 --
NM_133264chr1763958 3360 1243 857 356 71 ----13701
NM_133265chrX52336 2270 2258 673 469 ----12364
NM_133266chr1131029 972 319 ------
NM_133329chr2----11604 132
NM_133330chr441271 1106 260 240 1296 ----
NM_133331chr441271 1106 260 240 1296 ----
NM_133334chr4105660 5483 5244 4921 4904 4409 2008 1751 203 54 42239 2096 1798 1286 14779 --
NM_133335chr441271 1106 260 240 1296 ----
NM_133369chr51215 --128 --
NM_133370chr453629 3206 2675 900 221 12604 --13429
NM_133372chr552909 2759 2363 1833 1089 ----1711
NM_133378chr23617 29 22 ------
NM_133432chr23617 29 22 ------
NM_133433chr53792 213 71 ------
NM_133437chr23617 29 22 ------
NM_133445chr973659 3546 3336 471 370 180 59 13665 12510 --
NM_133457chr731329 1284 229 1391 ----
NM_133462chr32463 365 ------
NM_133473chr1951838 1462 1358 1259 633 1286 --1557
NM_133478chr211565 32170 975 50 ----
NM_133486chrX1383 ------
NM_133496chr154476 3773 3376 2931 441 11654 ----
NM_133499chrX4949 669 201 81 1308 1341 --
NM_133503chr121525 ------
NM_133504chr121525 ------
NM_133505chr121525 ------
NM_133506chr121525 ------
NM_133633chr2241067 806 454 157 ----1302
NM_133646chr255248 5101 3481 1358 292 1646 1389 14034
NM_133647chr15183 13438 11072 12450
NM_134260chr15121 ------
NM_134261chr15121 ------
NM_134262chr15121 ------
NM_134428chr92382 254 ------
NM_134442chr22481 195 11760 ----
NM_138270chrX43131 2967 2933 2473 ------
NM_138286chr1943873 838 762 43 14326 --1640
NM_138288chr1411950 ------
NM_138316chr101489 11291 ----
NM_138323chr153664 658 281 --1698 --
NM_138328chr1743363 2738 2405 889 22626 694 ----
NM_138335chr41371 1732 --1145
NM_138338chr2232750 531 152 1800 13013 --
NM_138340chr18----1431 --
NM_138357chr1061574 1555 1500 1131 615 560 ------
NM_138376chr14----1143 --
NM_138385chr431244 1014 541 ------
NM_138426chr721594 606 --12091 2907 653
NM_138444chr1344986 4201 3803 280 2265 26 14081 --
NM_138458chr22357 43 21060 275 ----
NM_138459chr653466 2844 2794 2386 307 --12298 --
NM_138468chr276368 4895 2033 1966 1528 937 810 33966 1605 22 1643 12433
NM_138473chr1275001 4206 4127 3887 3163 787 700 23997 751 21221 274 --
NM_138565chr11----1224 --
NM_138576chr1463850 3180 1703 695 525 491 1135 13460 13087
NM_138578chr2021418 450 123 1178 --
NM_138703chrX1172 125 ----
NM_138713chr16118248 7913 7259 6832 6346 6058 5301 3185 1150 608 542 25829 2224 17387 11322
NM_138714chr16118248 7913 7259 6832 6346 6058 5301 3185 1150 608 542 25829 2224 17387 11322
NM_138727chr141888 1660 953 359 12054 ----
NM_138728chr141888 1660 953 359 12054 ----
NM_138731chr1431715 1271 609 11340 --32590 131 120
NM_138732chr112893 799 ------
NM_138734chr112893 799 ------
NM_138735chr241191 1173 576 24 --11180 --
NM_138766chr51127 ------
NM_138771chr71614 ------
NM_138773chr53648 246 220 ------
NM_138774chr192221 135 ------
NM_138782chr51478 ------
NM_138804chr23719 588 166 ------
NM_138821chr51127 ------
NM_138822chr51127 ------
NM_138927chr211696 ------
NM_138931chr32988 69 ------
NM_138959chr1156634 5942 5566 5499 5008 4769 4486 4318 2206 2111 1679 1567 1473 1162 243 ----21588 1203
NM_138962chr173155 128 28 ------
NM_138966chr18--1103 ----
NM_138970chr142309 274 1721 ----
NM_138971chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138971chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138972chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138972chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138973chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138973chr11113161 2526 2480 2391 2367 1454 1117 1016 308 235 218 12786 ----
NM_138995chr251064 474 433 178 43 ------
NM_139012chr621723 1431 21805 33 ----
NM_139014chr621803 1511 21885 113 ----
NM_139062chr171405 ------
NM_139067chr121301 ------
NM_139070chr5----1213 --
NM_139071chr1231176 616 394 1425 1677 --
NM_139072chr22566 43 ------
NM_139135chr12490 222 -