TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1225-3p
miRNA Sequence: UGAGCCCCUGUGCCGCCCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000025chr81449 ------
NM_000044chrX1160 ------
NM_000068chr1911541 --2986 450 --
NM_000069chr1--127 ----
NM_000080chr171823 1201 ----
NM_000084chrX66244 6238 5608 5554 4439 4294 --1443 --
NM_000092chr253701 3100 2914 396 50 13461 --1946
NM_000097chr321166 27 ------
NM_000109chrX12201 ------
NM_000112chr524462 314 24284 1863 ----
NM_000138chr1531949 953 274 ------
NM_000168chr733268 2167 417 --1652 --
NM_000192chr1221176 331 ------
NM_000208chr1933040 1072 219 11905 24427 34 --
NM_000210chr212296 --11663 --
NM_000214chr2021706 43 ------
NM_000248chr342612 2542 2512 78 11861 ----
NM_000252chrX--1320 ----
NM_000260chr11--155 ----
NM_000304chr171142 ------
NM_000314chr1022252 851 --12979 --
NM_000321chr13--11596 ----
NM_000332chr656499 4544 1749 821 238 22354 2212 2506 271 1484
NM_000340chr311025 ------
NM_000353chr16--2817 125 ----
NM_000362chr221157 ------
NM_000376chr1262775 2553 698 185 67 34 --11124 1108
NM_000399chr101122 ------
NM_000430chr171415 ------
NM_000448chr1121250 65 --199 --
NM_000449chr121183 195 ------
NM_000462chr1511712 ------
NM_000476chr941459 1440 1375 428 --1549 1396
NM_000520chr151495 --1466 --
NM_000530chr12424 32 ------
NM_000555chrX47681 7206 5111 2828 --16201 --
NM_000587chr52990 52 11240 ----
NM_000598chr711533 ------
NM_000599chr253796 3663 1605 944 492 1167 ----
NM_000611chr1165247 4341 1913 1859 636 303 15717 36099 2727 152 25880 4998
NM_000615chr1131944 1138 1005 ------
NM_000633chr1844955 1559 535 511 ------
NM_000678chr202250 36 ------
NM_000682chr251425 344 160 92 27 ----1551
NM_000719chr1244742 1103 56 23 --12287 --
NM_000723chr173573 140 33 --2442 271 167
NM_000738chr112279 67 ------
NM_000739chr71290 ------
NM_000767chr191410 ------
NM_000782chr201327 189 ----
NM_000794chr5----164 --
NM_000801chr201388 ------
NM_000806chr511517 ------
NM_000814chr1533470 3221 572 ----13048
NM_000827chr521721 41 --1554 --
NM_000831chr1115706 5083 4683 4204 1985 1691 959 531 186 92 35 11745 11350 --
NM_000836chr192883 264 ----1302
NM_000844chr31325 1191 ----
NM_000859chr521267 41 ------
NM_000868chrX1178 ------
NM_000870chr52398 146 ------
NM_000875chr1556488 5586 5261 4873 1006 ------
NM_000883chr71107 ------
NM_000883chr71107 ------
NM_000891chr1733547 2923 1065 ------
NM_000901chr4--21932 365 ----
NM_000917chr101168 ------
NM_000918chr172644 44 1664 1236 --
NM_000945chr221523 261 1763 ----
NM_000950chrX23089 2299 ------
NM_000964chr1731372 1323 1022 --1458 --
NM_000966chr122669 32 --139 --
NM_000983chr13575 368 126 ------
NM_001001330chr101122 ------
NM_001001331chr331030 386 375 --12413 22026 232
NM_001001395chr121644 ------
NM_001001396chr173519 3475 3229 2761 1321 1252 482 1675 ----
NM_001001522chr111394 ------
NM_001001664chr223570 2498 --12987 --
NM_001001852chr221773 --1869 --
NM_001001890chr2133984 1514 1320 ------
NM_001001995chrX21802 1269 ------
NM_001002838chrX31819 1275 87 1681 ----
NM_001002860chr1431268 1012 611 ----13518
NM_001002914chr173971 809 298 11021 ----
NM_001003406chr2273007 2783 2187 2151 1313 933 834 22275 990 2783 365 --
NM_001003678chr11----188 --
NM_001003681chr2221304 304 1569 1312 --
NM_001003698chr621377 65 ------
NM_001003699chr621377 65 ------
NM_001003800chr932373 1103 931 --1893 22929 873
NM_001003940chr1573663 3161 2848 2736 556 483 270 1590 1496 13452
NM_001003942chr1573663 3161 2848 2736 556 483 270 1590 1496 13452
NM_001003943chr1573667 3165 2852 2740 560 487 274 1594 1500 13456
NM_001004106chr51709 --1239 --
NM_001004304chr1253044 2410 2163 2147 925 --13268 --
NM_001004342chr146028 2342 1370 299 --15229 --
NM_001004419chr121734 --2856 487 13964
NM_001005209chr22616 470 ------
NM_001005473chr535145 4673 2647 ------
NM_001005505chr33724 506 256 ----21314 698
NM_001005609chrX53692 3643 2942 643 403 11476 ----
NM_001005611chrX1474 ------
NM_001005861chr3------149
NM_001005914chr3--1163 ----
NM_001005920chr1621010 270 --2401 257 --
NM_001006115chr34623 568 431 274 1884 1455 --
NM_001006600chr5--1535 ----
NM_001006626chr71290 ------
NM_001006627chr71290 ------
NM_001006628chr71290 ------
NM_001006629chr71290 ------
NM_001006630chr71290 ------
NM_001006631chr71290 ------
NM_001006632chr71290 ------
NM_001006636chr21638 ------
NM_001006665chr11694 1787 ----
NM_001006932chr633149 845 503 150 3480 279 177 --
NM_001007024chr1722970 348 --13653 --
NM_001007025chr1722970 348 --13653 --
NM_001007097chr943496 794 120 32 ------
NM_001007156chr1521650 1562 --11362 --
NM_001007226chr1711375 ------
NM_001007227chr1711375 ------
NM_001007228chr1711375 ------
NM_001007229chr1711375 ------
NM_001007230chr1711375 ------
NM_001007246chr2111925 ------
NM_001007257chr111327 --11437 --
NM_001007466chr644593 3800 3175 1678 ------
NM_001007471chr9----1328 --
NM_001007538chr132607 21 ------
NM_001007553chr1165 ------
NM_001008220chr523560 774 --32559 542 137 --
NM_001008222chrX2449 349 --11164 --
NM_001008392chr343266 2590 2526 2331 ------
NM_001008541chr101376 179 ----
NM_001008541chr101376 179 ----
NM_001008701chr19112613 2450 2139 2133 2041 1015 837 779 357 61 23 1186 11947 --
NM_001008726chr1421590 1193 ------
NM_001009554chr421651 43 --13409 --
NM_001009554chr421651 43 --13409 --
NM_001009899chr345903 4128 2165 1519 34460 2069 1423 ----
NM_001009955chr11373 ------
NM_001009955chr11373 ------
NM_001010854chr14163 ------
NM_001010867chr185597 4763 2578 2170 488 439 381 250 45905 5380 5233 687 25340 433 1919
NM_001010888chrX23342 2886 1507 ----
NM_001010911chr102932 902 --1208 --
NM_001010923chr611639 ------
NM_001010924chr101948 11077 ----
NM_001010926chr12243 100 ----1550
NM_001010942chr1211264 ------
NM_001010971chr11925 ------
NM_001011645chrX1160 ------
NM_001011658chrX11941 1677 ----
NM_001011666chr721079 988 --16295 --
NM_001012393chr114656 204 182 88 1521 ----
NM_001012426chr643260 2734 2156 1295 22285 237 21359 704 21215 368
NM_001012427chr643260 2734 2156 1295 22285 237 21359 704 21215 368
NM_001013398chr711533 ------
NM_001013632chr1------160
NM_001013635chr121973 --11001 --
NM_001013690chr1252386 2253 1960 633 96 --12042 11556
NM_001013693chr142705 1162 541 387 --32672 2231 793 --
NM_001013693chr142705 1162 541 387 --32672 2231 793 --
NM_001014435chr162234 50 ------
NM_001014839chr13714 706 403 ------
NM_001014841chr13714 706 403 ------
NM_001014987chr16----1162 1377
NM_001014988chr16----1162 1377
NM_001014989chr16----1162 1377
NM_001015053chr1751219 1143 1101 1055 27 ------
NM_001017368chr171109 159 ----
NM_001017395chr322690 1243 1407 ----
NM_001017440chr736419 6303 161 --1486 --
NM_001017535chr1262775 2553 698 185 67 34 --11124 1108
NM_001017916chr171728 11477 2769 25 --
NM_001017917chr171728 11477 2769 25 --
NM_001017923chr14161 ------
NM_001017924chr10136 ----1142
NM_001017926chr81314 1553 ----
NM_001017928chr3194 ------
NM_001017962chr101168 ------
NM_001017992chr51154 125 ----
NM_001018050chr2252722 2681 2119 806 486 23206 2430 ----
NM_001018052chr2252722 2681 2119 806 486 23206 2430 ----
NM_001018064chr911526 11712 ----
NM_001018065chr925931 541 14864 25818 3998 --
NM_001018066chr925931 541 14864 25818 3998 --
NM_001018108chr1561963 1859 1731 819 315 206 12082 --1242
NM_001023567chr1522240 62 1761 ----
NM_001023587chr31978 --1140 --
NM_001024372chr821964 1821 1872 ----
NM_001024808chr1232522 693 239 --1380 --
NM_001024809chr1731372 1323 1022 --1458 --
NM_001024858chr1452919 2182 836 635 576 --3567 394 228 --
NM_001024937chr17193 ------
NM_001024948chr122720 2231 ------
NM_001025076chr1055731 5129 4333 4215 1883 14607 ----
NM_001025077chr1067089 6487 5691 5573 1232 1005 25965 596 ----
NM_001025108chr222611 29 22954 2813 ----
NM_001025266chr363904 1771 889 842 707 619 ------
NM_001025579chr1721068 40 --1111 --
NM_001025580chrX2908 676 ------
NM_001025603chr121183 195 ------
NM_001025778chr191256 ------
NM_001029863chr622187 703 ------
NM_001030001chr141449 1151 ----
NM_001030006chr1732663 535 258 ------
NM_001030007chr1623498 3430 ------
NM_001030055chr14--170 14713 --
NM_001031677chr52455 73 ------
NM_001031690chr752577 2489 2016 498 269 23026 2320 ----
NM_001031695chr2245176 4787 3306 2141 --14173 --
NM_001031702chr3126 ------
NM_001031711chr51454 11839 ----
NM_001031717chr35894 810 716 172 113 ------
NM_001031732chr4----12986 --
NM_001031804chr1623127 69 ------
NM_001032282chr81166 1105 ----
NM_001032288chr2021300 1122 --1438 --
NM_001032289chrX183 ----1308
NM_001032296chr1342694 2240 2108 22 ------
NM_001032380chr10--1746 --11412
NM_001033049chr2131853 322 33 ------
NM_001033117chr314156 --23879 1587 --
NM_001033723chr812531 ----124
NM_001034845chr4--1479 ----
NM_001034850chr51267 ------
NM_001035chr1--1955 ----
NM_001037132chr711687 ------
NM_001037133chr711687 ------
NM_001037582chr4--21580 603 ----
NM_001037954chr1123537 1317 2212 25 ----
NM_001038493chr221180 105 188 ----
NM_001038640chr15--1828 --1140
NM_001038707chr131678 495 154 ------
NM_001038707chr131678 495 154 ------
NM_001039350chr74670 652 531 490 --11506 --
NM_001039465chr142172 128 ------
NM_001039479chr1411774 ----1317
NM_001039538chr253564 2568 1180 919 63 1225 ----
NM_001039618chr1145589 5107 1463 257 12072 ----
NM_001039690chr1611631 11688 22073 402 --
NM_001039711chr13941 190 70 ------
NM_001039712chr13941 190 70 ------
NM_001039877chr192242 63 ------
NM_001039888chr11713 --1569 --
NM_001040144chr1611631 11688 22073 402 --
NM_001040146chr1611631 11688 22073 402 --
NM_001040152chr714679 --1360 --
NM_001040172chr52398 146 ------
NM_001040173chr52398 146 ------
NM_001040202chr4--1332 1881 --
NM_001040424chr2152905 2041 1949 1876 313 12049 32705 928 224 --
NM_001040429chr1313014 11134 ----
NM_001040446chr52638 314 ------
NM_001040708chr811014 ------
NM_001040876chr41153 ------
NM_001042357chr10188 ------
NM_001042358chr10188 ------
NM_001042360chr10188 ------
NM_001042363chr10188 ------
NM_001042389chr10188 ------
NM_001042390chr10188 ------
NM_001042392chr10188 ------
NM_001042395chr10188 ------
NM_001042404chr11604 ------
NM_001042453chrX21755 1180 ------
NM_001042473chr1011404 ------
NM_001042476chr1631914 821 796 1346 1100 --
NM_001042494chr1523227 2695 12601 ----
NM_001042495chr1523227 2695 12601 ----
NM_001042496chr1523227 2695 12601 ----
NM_001042497chr1523227 2695 12601 ----
NM_001042498chrX2443 220 ------
NM_001042510chr832085 154 115 ----12157
NM_001042511chr832085 154 115 ----12157
NM_001042539chr162749 116 ------
NM_001042599chr236491 6432 2523 ------
NM_001042601chr31899 ------
NM_001042603chr1263578 3510 3452 3394 3336 1076 --11296 --
NM_001042663chr141389 1313 382 274 ------
NM_001042664chr141389 1313 382 274 ------
NM_001042665chr141389 1313 382 274 ------
NM_001042681chr132413 2052 283 ------
NM_001042682chr132413 2052 283 ------
NM_001042682chr132413 2052 283 ------
NM_001042728chr122669 32 --139 --
NM_001043318chr1443174 1157 965 649 --23616 223 --
NM_001043351chr111586 ------
NM_001044385chr21750 12794 ----
NM_001045478chr1133 ----1784
NM_001049chr1421865 138 --52133 973 966 959 21 --
NM_001080418chr1----2575 460 --
NM_001095chr1221919 1333 ------
NM_001096chr171535 ------
NM_001099678chr3----14810 --
NM_001100108chr145455 2682 2528 2417 22691 2144 1373 15138
NM_001106chr389648 8159 7998 7497 6300 3319 2946 793 39034 8959 3225 --12182
NM_001116chr1612072 1164 32815 1137 679 --
NM_001117chr1822224 599 ------
NM_001128chr1623498 3430 ------
NM_001135chr154801 634 562 321 ------
NM_001144chr162895 97 1503 ----
NM_001146chr81246 ------
NM_001173chr14--170 14713 --
NM_001188chr62925 223 1871 ----
NM_001189chr42328 262 ------
NM_001199chr8----169 --
NM_001200chr201827 1267 ----
NM_001206chr912160 ------
NM_001241chr212032 ------
NM_001241chr212032 ------
NM_001259chr711955 ------
NM_001263chr4--1476 ----
NM_001265chr132777 257 ------
NM_001277chr112874 292 ------
NM_001282chr1732663 535 258 ------
NM_001295chr341080 587 385 272 --2175 157 --
NM_001304chr1732458 1521 563 ------
NM_001319chr19----11103 --
NM_001331chr1111933 129 12042 --
NM_001332chr5----1448 --
NM_001343chr511174 --1417 --
NM_001347chr42267 26 --11604 --
NM_001356chrX1515 ------
NM_001364chr1121641 264 13382 11782 --
NM_001383chr171200 1309 ----
NM_001386chr831819 531 441 ------
NM_001389chr211462 ------
NM_001390chr1833007 2768 2644 ------
NM_001396chr211276 ------
NM_001397chr152613 2460 2355 2254 42 12478 ----
NM_001399chrX53692 3643 2942 643 403 11476 ----
NM_001400chr12536 82 1305 ----
NM_001407chr341296 532 525 285 --21650 574 --
NM_001408chr121181 510 --11252 --
NM_001415chrX31435 478 69 1383 ----
NM_001418chr111498 ------
NM_001418chr111498 ------
NM_001419chr1953672 3133 3095 1769 533 13817 13698 --
NM_001420chr193937 767 541 1761 42877 2853 2575 370 12923
NM_001423chr1221986 1474 --1502 --
NM_001429chr221882 ------
NM_001431chr621038 274 ------
NM_001438chr133465 2956 2787 ------
NM_001453chr6----11639 --
NM_001493chrX3205 155 57 ------
NM_001495chr831196 468 434 --21208 978 --
NM_001497chr912724 22300 1715 12620 12408
NM_001543chr5114783 4617 4375 3918 3152 1669 1233 1182 1067 891 140 --14871 --
NM_001567chr112535 477 ------
NM_001620chr111538 --1656 --
NM_001635chr7139 ------
NM_001650chr18----12544 --
NM_001654chrX----1351 --
NM_001655chr1121957 542 21346 448 ----
NM_001659chr1222323 547 --12304 --
NM_001660chr31562 ------
NM_001662chr71344 ------
NM_001664chr31403 ------
NM_001665chr111187 --3363 180 117 --
NM_001668chr152206 2182 2086 1772 1732 --1452 --
NM_001670chr225658 333 326 114 44 ------
NM_001683chr331030 386 375 --12413 22026 232
NM_001699chr191217 ----11834
NM_001706chr32431 133 ------
NM_001742chr711704 ------
NM_001754chr2133984 1514 1320 ------
NM_001755chr1611961 ------
NM_001782chr9----178 --
NM_001798chr1231020 421 54 ------
NM_001800chr192219 40 ------
NM_001810chr203736 521 169 1242 ----
NM_001895chr201406 ------
NM_001903chr51738 1703 137 --
NM_001915chr171728 11477 2769 25 --
NM_001918chr139050 7091 200 26997 2773 ----
NM_001927chr21542 --2712 476 --
NM_001936chr74670 652 531 490 --11506 --
NM_001949chr642050 1309 1172 1142 --11048 --
NM_001954chr63746 694 517 ------
NM_001956chr1170 ------
NM_001964chr52368 92 ------
NM_001977chr4--1529 ----
NM_001987chr1234207 1694 195 13786 --1493
NM_001995chr431423 1323 342 --1136 --
NM_002010chr13167 ------
NM_002017chr11------1358
NM_002032chr112351 73 ------
NM_002048chr92950 423 ------
NM_002062chr611504 --3596 392 320 --
NM_002063chrX21264 203 ------
NM_002076chr1253115 2789 2693 1112 900 11305 ----
NM_002082chr51672 --1202 --
NM_002090chr41154 ------
NM_002092chr425072 4340 14619 ----
NM_002126chr1721605 910 ------
NM_002128chr1322269 233 ------
NM_002137chr721474 25 11788 ----
NM_002189chr102465 93 ------
NM_002199chr4----133 --
NM_002205chr121890 ------
NM_002247chr1012323 ------
NM_002252chr2177 ------
NM_002264chr344206 3485 3417 928 ------
NM_002265chr17--1391 ----
NM_002267chr13--12436 ----
NM_002268chr32636 532 ------
NM_002270chr534405 1470 734 --15084 --
NM_002283chr12122 ------
NM_002285chr222611 29 22954 2813 ----
NM_002296chr111156 ------
NM_002309chr2282842 2299 2274 2125 875 776 456 114 11192 ----
NM_002319chr72922 353 --1398 --
NM_002347chr8183 --124 --
NM_002359chr1784093 4087 3782 2986 1451 577 506 483 --11402 --
NM_002373chr1531217 155 78 ------
NM_002374chr253564 2568 1180 919 63 1225 ----
NM_002375chr331511 427 203 ----11788
NM_002387chr51838 1393 ----
NM_002390chr174611 422 152 140 --22074 813 --
NM_002401chr1752471 811 789 257 52 165 22179 1707 1157
NM_002419chr111438 1394 ----
NM_002444chrX21986 1940 11675 ----
NM_002499chr1572166 1697 1541 830 808 801 532 ------
NM_002522chr171465 --1584 22902 1252
NM_002524chr11259 --1843 --
NM_002537chr152682 82 1328 --1115
NM_002545chr114656 204 182 88 1521 ----
NM_002569chr1531018 444 399 11091 11148 11165
NM_002577chr333458 863 85 23236 2581 ----
NM_002581chr933949 2099 703 13857 14801 --
NM_002586chr621072 383 --133 --
NM_002588chr541567 1437 258 187 --11234 --
NM_002608chr221333 --11576 --
NM_002609chr541752 245 164 81 --1745 --
NM_002611chr172884 101 ------
NM_002616chr171162 --1428 --
NM_002623chr201719 --1230 --
NM_002629chr101612 ------
NM_002636chr61119 ------
NM_002651chr1----1209 --
NM_002655chr814716 --11888 --
NM_002657chr2023535 1536 1106 21460 766 1157
NM_002660chr20167 11138 ----
NM_002667chr621118 200 ------
NM_002698chr1952899 2861 2508 2068 764 ----1862
NM_002699chr13543 468 374 ------
NM_002714chr62153 144 ------
NM_002715chr51910 ------
NM_002738chr161799 ------
NM_002745chr2214106 14391 ----
NM_002751chr223473 384 366 --41228 842 307 40 --
NM_002753chr42643 307 ------
NM_002755chr151226 --1595 --
NM_002758chr171489 ------
NM_002787chr71635 ------
NM_002811chr162495 75 ------
NM_002822chr1211316 1207 ----
NM_002824chr122430 23 ------
NM_002827chr2031603 501 318 --1302 --
NM_002828chr18166 ------
NM_002842chr193173 125 92 ------
NM_002843chr1153054 2660 2442 182 172 ------
NM_002858chr11276 ------
NM_002859chr1231730 1500 1151 --21238 266 --
NM_002867chr11494 --2466 159 --
NM_002868chr1232282 1538 788 --1218 --
NM_002881chr211420 ------
NM_002886chr324714 578 ------
NM_002892chr1421414 432 ------
NM_002895chr201728 ------
NM_002897chr21725 ------
NM_002928chr121459 292 --1262 --
NM_002940chr41153 ------
NM_002953chr11694 1787 ----
NM_002955chr621377 65 ------
NM_002956chr12127 ------
NM_002957chr963639 3297 2787 1392 933 273 --42749 1328 364 304 11038
NM_002958chr3------149
NM_002959chr143269 2883 428 276 12996 ----
NM_002977chr222879 1328 12706 ----
NM_002994chr411384 ------
NM_003010chr171424 ------
NM_003011chr91512 21072 402 ----
NM_003028chr943786 1060 780 167 --1477 --
NM_003039chr1----141 --
NM_003043chr314219 1972 11733 --
NM_003045chr1343278 1866 647 616 ------
NM_003047chr141186 917 233 59 --170 --
NM_003054chr101195 ------
NM_003069chrX1598 ------
NM_003071chr321621 471 ------
NM_003077chr172800 547 1210 ----
NM_003108chr242795 2694 1720 49 --22877 1989 --
NM_003113chr21225 ------
NM_003131chr631762 353 242 --2618 500 11786
NM_003137chr622016 220 ------
NM_003139chr111657 --1126 --
NM_003145chr11465 ------
NM_003156chr1151350 1287 901 500 372 1851 --1306
NM_003161chr1722599 717 13424 ----
NM_003164chr112216 33 ------
NM_003186chr111394 ------
NM_003188chr61535 ------
NM_003189chr162179 822 749 348 163 61 12414 ----
NM_003194chr61458 ------
NM_003204chr1711199 11107 ----
NM_003214chr621359 430 1210 ----
NM_003215chr421130 453 ------
NM_003216chr2252791 2479 2468 2107 602 --33125 596 59 --
NM_003221chr642563 1656 1351 1045 ------
NM_003236chr223033 182 11012 --1836
NM_003246chr15171 ------
NM_003255chr172946 923 --21052 239 --
NM_003269chr62962 272 ------
NM_003286chr202961 719 ------
NM_003334chrX166 ------
NM_003337chr51467 ------
NM_003339chr51601 ------
NM_003341chr3--1273 ----
NM_003345chr161114 ------
NM_003349chr2021300 1122 --1438 --
NM_003356chr1111016 ------
NM_003387chr221898 849 21076 453 ----
NM_003390chr111343 ------
NM_003394chr123634 465 22 ------
NM_003404chr201290 ------
NM_003410chrX1594 ------
NM_003418chr31310 ------
NM_003453chr132500 481 ------
NM_003458chr342552 1298 623 516 --1489 --
NM_003466chr252376 2166 1987 1971 1556 --12513 --
NM_003468chr2----2993 315 --
NM_003470chr1621834 537 --1562 --
NM_003477chr111542 ------
NM_003478chr11----1322 --
NM_003482chr1241947 1854 1787 110 --12196 --
NM_003488chr172182 51 ------
NM_003559chr1763352 3003 1279 759 317 122 --1276 --
NM_003563chr1711375 ------
NM_003564chr1----1641 1128
NM_003566chr121704 33258 517 188 ----
NM_003569chr61140 ------
NM_003576chr1342694 2240 2108 22 ------
NM_003583chr1223039 2386 --13561 --
NM_003586chr162557 158 ------
NM_003607chr172888 2736 1398 1262 1186 391 109 ------
NM_003615chr321393 472 ------
NM_003618chr21369 ------
NM_003629chr142693 1122 326 261 ----12641
NM_003633chr532392 1681 978 ------
NM_003644chr17106067 6050 5712 4787 1813 569 407 382 50 44 14542 1166 14801
NM_003656chr3142 ------
NM_003660chr192653 529 ------
NM_003670chr32435 295 1446 ----
NM_003671chr932908 2889 2582 ------
NM_003707chr3288 82 ------
NM_003709chr2169 ----1402
NM_003716chr31930 ------
NM_003735chr541567 1437 258 187 --11234 --
NM_003736chr541567 1437 258 187 --11234 --
NM_003737chr111369 ------
NM_003758chr151193 ------
NM_003758chr151193 ------
NM_003768chr141717 267 235 222 ------
NM_003774chr12--11179 --1140
NM_003779chr13465 163 47 ------
NM_003800chr611576 ------
NM_003818chr201873 2354 150 ----
NM_003872chr232170 233 49 12158 2845 831 --
NM_003884chr31288 ------
NM_003893chr101357 --1399 --
NM_003924chr451201 569 333 292 273 11458 1658 --
NM_003934chr911237 ------
NM_003947chr3--21076 184 1196 --
NM_003953chr1--21025 398 ----
NM_003958chr643492 2816 2794 493 23695 2927 13598 --
NM_003971chr171591 ------
NM_003980chr611365 ------
NM_003982chr142245 36 ------
NM_003983chr1633973 1408 380 31705 1558 621 1197 1126
NM_003988chr1042229 1858 730 557 --137 --
NM_004006chrX12201 ------
NM_004007chrX12201 ------
NM_004009chrX12201 ------
NM_004010chrX12201 ------
NM_004011chrX12201 ------
NM_004012chrX12201 ------
NM_004013chrX12201 ------
NM_004014chrX12201 ------
NM_004015chrX12201 ------
NM_004016chrX12115 ------
NM_004017chrX12201 ------
NM_004018chrX12115 ------
NM_004020chrX12201 ------
NM_004021chrX12115 ------
NM_004022chrX12115 ------
NM_004023chrX12115 ------
NM_004028chr18----12544 --
NM_004050chr1472458 2187 1932 1794 796 672 22 --1416 11903
NM_004097chr21134 1905 ----
NM_004100chr61876 ------
NM_004114chrX21086 24 ------
NM_004117chr62338 55 1180 ----
NM_004119chr131631 ------
NM_004124chr141680 ------
NM_004161chr221442 1278 --11404 --
NM_004162chr31382 --21027 800 --
NM_004169chr171127 ------
NM_004171chr1139266 7680 3081 18525 --17695
NM_004187chrX51199 1029 926 556 296 ------
NM_004200chr1122827 2336 1120 23014 209 --
NM_004215chr81454 ------
NM_004227chr722544 766 --1808 --
NM_004242chr6122 ------
NM_004272chr511394 ------
NM_004311chr1021187 330 23015 825 12166 --
NM_004319chr11254 ------
NM_004321chr233205 2987 569 --22903 274 --
NM_004326chr11395 ------
NM_004331chr81260 ------
NM_004342chr7--1104 ----
NM_004364chr1921299 243 1444 11178 --
NM_004380chr1642267 2190 956 273 --1233 --
NM_004381chr61126 ------
NM_004393chr322072 754 21946 1922 11457 --
NM_004395chr52710 495 --1670 --
NM_004397chr1113179 11018 14206 11125
NM_004405chr211023 1425 172 --
NM_004418chr22580 65 --1146 --
NM_004420chr1141919 665 638 475 --2708 694 --
NM_004423chr332032 2014 912 ------
NM_004430chr811966 ------
NM_004433chr13675 446 220 --2616 394 --
NM_004437chr132444 958 266 22729 1395 13468 11224
NM_004438chr21477 ----1175
NM_004442chr121319 310 --1663 --
NM_004450chr14236 25 ------
NM_004451chr112533 281 --127 --
NM_004454chr322155 393 --12146 --
NM_004457chr2----1404 --
NM_004458chrX1456 ------
NM_004459chr17--11936 ----
NM_004463chrX1177 --165 --
NM_004474chr12209 181 --1275 --
NM_004486chr931116 943 39 --1898 --
NM_004491chr1973528 3419 1142 1136 1100 936 402 --24103 1512 --
NM_004494chr121248 426 --21055 1027 --
NM_004501chr143096 2684 249 116 ------
NM_004504chr21170 --12232 --
NM_004515chr1167 ------
NM_004535chr2021489 712 ------
NM_004537chr121971 ------
NM_004556chr63815 221 31 ------
NM_004560chr91119 --122 --
NM_004588chr1162871 2730 961 784 401 243 --53112 3005 926 798 658 --
NM_004598chr511071 ------
NM_004602chr201193 ------
NM_004626chr111710 --1282 --
NM_004630chr1151137 1012 869 734 210 ------
NM_004636chr3--1163 ----
NM_004643chr143671 315 223 ------
NM_004647chr191124 --1243 --
NM_004650chrX11287 1571 ----
NM_004655chr1711226 11198 ----
NM_004713chr141700 ------
NM_004723chr12401 54 ------
NM_004730chr511744 --1814 --
NM_004737chr2261071 935 844 401 393 322 ------
NM_004739chr112449 140 ------
NM_004742chr311757 --1419 --
NM_004745chr824394 1399 16076 ----
NM_004747chr1031496 1189 474 1253 11085 --
NM_004758chr174995 196 156 42 --11060 --
NM_004774chr1723082 2277 42228 2090 832 661 12517 --
NM_004798chr2043495 3449 3288 2659 --23580 371 --
NM_004807chr242031 889 715 159 --1177 --
NM_004822chr1773937 1503 1153 1082 797 334 100 --42547 1133 702 278 --
NM_004834chr221260 137 12654 22699 612 --
NM_004841chr1----1758 --
NM_004857chr1423337 1670 21824 1574 ----
NM_004859chr1722041 242 ------
NM_004871chr1722970 348 --13653 --
NM_004888chr9----1403 --
NM_004904chr721079 988 --16295 --
NM_004911chr71238 1576 ----
NM_004922chr103868 804 289 1154 --1399
NM_004949chr182309 145 ------
NM_004958chr11723 1770 ----
NM_004965chr211295 ------
NM_004968chr72571 57 ------
NM_004976chr1194151 3879 3398 3227 3166 1626 1469 842 487 --34526 1067 280 14126
NM_004978chr11406 1355 21256 1210 --
NM_004979chrX2320 232 --1954 --
NM_004985chr1232742 764 461 --1266 --
NM_004992chrX127950 7582 7013 6930 6029 5716 5392 3388 1940 1431 1151 78 27760 1138 27827 1671 11927
NM_004992chrX127950 7582 7013 6930 6029 5716 5392 3388 1940 1431 1151 78 27760 1138 27827 1671 11927
NM_004995chr14----31239 1160 308 --
NM_005010chr711687 ------
NM_005017chr31251 ------
NM_005022chr171214 ------
NM_005028chr1032202 693 154 ------
NM_005030chr161188 ------
NM_005055chr11123 ------
NM_005056chr1263822 3754 3696 3638 3580 1320 --11540 --
NM_005067chr32288 187 ------
NM_005068chr621457 1290 ------
NM_005076chr174091 2935 1521 1346 1168 827 305 --32666 1485 556 13449
NM_005080chr22----2825 271 --
NM_005095chr1----1870 --
NM_005096chrX2878 217 ------
NM_005112chr4------1387
NM_005116chr2034412 4360 1305 --32778 1783 370 --
NM_005119chr12975 241 ------
NM_005124chr6182 ------
NM_005126chr31733 ------
NM_005135chr1523227 2695 12601 ----
NM_005137chr2252096 858 683 206 130 1355 1610 --
NM_005155chr61139 --1501 --
NM_005156chr954031 3400 1348 1327 1124 13501 ----
NM_005182chr162234 50 ------
NM_005194chr202437 37 --1211 --
NM_005197chr1434287 4142 1655 1463 --11954
NM_005219chr521433 361 --21650 437 --
NM_005229chrX11178 21135 1118 1849 --
NM_005234chr192353 305 ------
NM_005235chr236491 6432 2523 ------
NM_005238chr111897 12847 ----
NM_005240chr11544 ------
NM_005252chr14195 ------
NM_005269chr122126 46 ------
NM_005273chr73289 236 75 ------
NM_005277chr411689 ----11590
NM_005281chr1167 ------
NM_005313chr151254 ------
NM_005329chr1631967 775 283 12103 ----
NM_005359chr1876317 6156 6051 6032 5508 4682 2269 12174 25376 4198 --
NM_005380chr161250 1031 959 913 234 169 21022 401 ----
NM_005381chr22358 52 ------
NM_005382chr8182 --196 --
NM_005392chr911165 1703 --1426
NM_005399chr153762 3489 3293 483 418 13411 21443 1206 11408
NM_005415chr21206 ------
NM_005433chr1812231 ------
NM_005436chr1033411 2794 2532 --12649 --
NM_005465chr131986 1717 1287 ------
NM_005474chr1751219 1143 1101 1055 27 ------
NM_005477chr1531744 427 297 11817 ----
NM_005477chr1531744 427 297 11817 ----
NM_005487chr2221304 304 1569 1312 --
NM_005497chr1724721 153 11849 ----
NM_005498chr19----3257 35 22 --
NM_005502chr92831 346 ------
NM_005506chr452730 2619 2168 628 207 12073 ----
NM_005513chr311365 1345 ----
NM_005523chr7----132 --
NM_005529chr12987 667 ------
NM_005539chr101412 --1344 --
NM_005574chr112178 91 ------
NM_005575chr52537 57 ------
NM_005578chr353738 3602 3589 3367 757 ------
NM_005595chr11203 ------
NM_005596chr911825 15229 ----
NM_005599chr11204 --2292 225 --
NM_005603chr1821293 346 11282 ----
NM_005607chr8--1181 ----
NM_005631chr731046 884 355 ------
NM_005647chrX1626 12928 1950 --
NM_005649chr51485 ------
NM_005652chr161276 1180 ----
NM_005655chr81166 1105 ----
NM_005656chr212485 50 ------
NM_005665chr134069 686 62 ------
NM_005668chr512894 12976 ----
NM_005678chr151803 ------
NM_005704chr121076 830 --1694 --
NM_005721chr2125 ------
NM_005725chr122020 1868 ------
NM_005730chr1242754 2591 1064 876 ------
NM_005746chr7167 ------
NM_005748chr1223422 2586 ------
NM_005779chr533348 1250 408 11458 ----
NM_005780chr13----149 --
NM_005785chr1241683 1351 691 676 ------
NM_005808chr343266 2590 2526 2331 ------
NM_005814chr131214 1196 383 --11138 143
NM_005826chr11206 ------
NM_005828chr1724871 755 --134 --
NM_005839chr12326 267 ------
NM_005840chrX67024 5625 4735 2781 2660 1359 --27481 324 --
NM_005842chr131728 ------
NM_005871chr10136 ------
NM_005880chr161472 ------
NM_005904chr181212 ------
NM_005909chr5--1212 ----
NM_005911chr21178 ------
NM_005920chr152766 2573 720 473 79 --33702 2987 264 --
NM_005933chr1122238 588 --12460 --
NM_005934chr1992291 2222 2041 1878 1063 857 683 240 231 --3916 780 649 --
NM_005935chr434643 4065 3628 --15081 --
NM_005937chr1761447 1428 1138 1017 571 332 --14005 13074
NM_005938chrX21335 1102 --11255 --
NM_005955chr144677 2032 790 656 1532 13390 --
NM_005962chr101376 179 ----
NM_005962chr101376 179 ----
NM_005964chr171595 --1543 --
NM_005967chr122648 267 --1156 --
NM_006007chr913437 13722 ----
NM_006011chr1521470 1449 1365 ----
NM_006022chr133975 379 343 ------
NM_006026chr3135 1421 ----
NM_006030chr33724 506 256 ----21314 698
NM_006035chr14----11219 --
NM_006037chr233351 3076 869 --34547 1868 99 --
NM_006040chr1631097 449 398 --1371 --
NM_006092chr731018 734 26 ------
NM_006095chr441351 1003 319 271 ------
NM_006106chr1142841 2350 760 270 ------
NM_006129chr82528 210 ------
NM_006133chr1132055 564 541 12073 ----
NM_006135chr11105 ------
NM_006136chr711359 ------
NM_006141chr1632217 2169 263 ------
NM_006145chr191110 ----1761
NM_006148chr1772881 2837 2411 2348 1165 493 176 --42013 583 520 404 --
NM_006161chr51468 ------
NM_006180chr911526 11712 ----
NM_006191chr122947 887 ------
NM_006201chrX31178 1172 1000 ------
NM_006202chr1981881 1802 1796 527 467 219 204 133 11471 ----
NM_006212chr175192 1490 1014 922 905 885 301 ------
NM_006224chr1732313 1962 880 ------
NM_006228chr81353 ------
NM_006237chr132324 298 --162 --
NM_006245chr631006 897 736 ------
NM_006251chr553090 2115 684 424 295 1588 ----
NM_006257chr10174 ------
NM_006268chr11--1310 ----
NM_006277chr2278 47 --1131 --
NM_006278chr111476 --1520 --
NM_006306chrX44984 4607 926 834 1665 ----
NM_006310chr172395 117 11022 ----
NM_006320chr411060 --1219 --
NM_006325chr121150 ------
NM_006352chr111396 ------
NM_006369chr12300 52 1370 1353 --
NM_006375chrX31827 1695 1543 ------
NM_006379chr71566 --1359 --
NM_006380chr1753534 3367 1706 1408 86 ----11430
NM_006383chr152537 106 ------
NM_006386chr2212203 --11553 --
NM_006389chr112515 85 ------
NM_006390chr122586 87 --1574 --
NM_006400chr123145 128 29 ------
NM_006411chr61842 ------
NM_006421chr8----1945 --
NM_006449chr2172 --11616 --
NM_006454chr462597 2361 1031 1006 883 587 --32521 2177 865 2935 346
NM_006459chr1031820 691 48 ------
NM_006465chr1551916 1546 684 447 278 ------
NM_006482chr1223039 2386 --13561 --
NM_006526chr2011876 11337 ----
NM_006532chr1961923 1818 1715 1481 699 217 ----1264
NM_006544chr14--14393 ----
NM_006548chr321631 242 ------
NM_006549chr1272529 1982 1924 618 442 357 51 --11844 --
NM_006561chr1055731 5129 4333 4215 1883 14607 ----
NM_006562chr102288 33 ------
NM_006565chr1611243 ------
NM_006570chr9198 ------
NM_006575chr1411244 ------
NM_006595chr1111255 ------
NM_006599chr1637714 2156 690 ------
NM_006609chr222349 455 ------
NM_006614chr3--13449 ----
NM_006621chr121873 207 ------
NM_006628chr1513624 23529 881 1478 --
NM_006644chr131446 ------
NM_006650chr523560 774 --32559 542 137 --
NM_006651chr41391 --1451 --
NM_006653chr6--191 ----
NM_006662chr16----1321 --
NM_006696chr5165 ------
NM_006703chr61205 --1175 --
NM_006717chr942958 2371 1281 817 ------
NM_006722chr342612 2542 2512 78 11861 ----
NM_006729chrX25420 4767 13781 ----
NM_006732chr1942091 1994 1883 851 ------
NM_006734chr6--11100 ----
NM_006766chr8--1177 ----
NM_006772chr621481 1151 ----1540
NM_006775chr612945 ------
NM_006795chr1121368 509 ------
NM_006801chr191626 ----1609
NM_006805chr531737 1236 376 11618 ----
NM_006807chr17--11031 ----
NM_006819chr11----1333 --
NM_006826chr21427 ------
NM_006827chr143370 306 268 12579 ----
NM_006839chr2169 ------
NM_006852chr1722489 991 11810 12725 --
NM_006861chr1261975 1627 1495 812 800 476 --31858 1848 1754 --
NM_006874chr41348 ------
NM_006875chrX1155 ------
NM_006876chr112555 540 ------
NM_006885chr1623065 1598 ------
NM_006888chr1442771 2211 1216 403 ------
NM_006896chr7------11121
NM_006897chr121577 1182 ----
NM_006912chr12463 246 ------
NM_006920chr221858 312 ------
NM_006922chr212034 ------
NM_006924chr1721784 552 11425 ----
NM_006925chr142172 128 ------
NM_006941chr223856 788 264 --2741 136 --
NM_006965chr1811121 ------
NM_006981chr92246 203 ------
NM_006990chr122539 1750 --2327 210 --
NM_006991chr31146 ------
NM_006996chr121217 391 ------
NM_007011chr1525970 903 --15029 --
NM_007024chr31414 --1114 --
NM_007033chr142271 2166 1882 1819 --1493 --
NM_007034chr1--1117 ----
NM_007039chr141184 ------
NM_007050chr2077377 6020 2589 2335 2020 1472 794 36592 6271 83 46326 6310 590 153 --
NM_007067chr1721490 512 ------
NM_007078chr1052004 865 656 644 489 ------
NM_007118chr51823 --1669 --
NM_007124chr611438 --1326 --
NM_007126chr91156 ------
NM_007144chr1721220 1200 ------
NM_007146chr1732745 2481 2109 ------
NM_007158chr1165 ------
NM_007174chr1211980 ------
NM_007182chr31728 ------
NM_007185chr13868 298 105 ------
NM_007197chr12--1853 ----
NM_007213chrX----1268 --
NM_007222chr81314 1553 ----
NM_007238chr2094809 4714 4565 3726 3708 3503 672 363 118 14265 ----
NM_007245chr162291 266 --2709 104 --
NM_007249chr1346342 6305 1664 929 --12769 --
NM_007278chr17------1319
NM_007282chr31682 ------
NM_007353chr712259 --22883 986 --
NM_007359chr1721218 102 11180 ----
NM_012072chr2044072 1531 747 314 --1323 --
NM_012081chr512938 13007 13692 --
NM_012090chr121032 495 --11043 --
NM_012095chr1012967 ------
NM_012099chr195878 781 299 197 154 1490 ----
NM_012102chr132413 2052 283 ------
NM_012104chr1142413 1377 990 171 1781 ----
NM_012104chr1142413 1377 990 171 1781 ----
NM_012105chr21----1270 --
NM_012111chr14--1167 164 --
NM_012156chr2021121 218 11131 ----
NM_012164chr962397 2016 458 176 159 43 32301 1251 276 15768 --
NM_012175chr111134 ------
NM_012193chr1124963 4115 24021 470 ----
NM_012199chr123533 1714 1554 1423 --
NM_012215chr1041615 1437 1234 223 1270 ----
NM_012218chr191459 22503 2181 22637 1041 1778
NM_012223chr211059 11091 --176
NM_012232chr1752171 1821 1760 756 313 ------
NM_012234chr31815 ------
NM_012249chr223114 251 --12852 --
NM_012259chr611170 ------
NM_012286chrX--1113 ----
NM_012290chr211174 ------
NM_012297chr4------11934
NM_012300chr521701 453 1877 ----
NM_012301chr71512 --1226 --
NM_012307chr181807 ------
NM_012308chr1152201 1864 704 294 86 ------
NM_012323chr2211137 ------
NM_012330chr1011408 ------
NM_012384chr2032217 916 312 11854 12082 --
NM_012414chr1--1585 ----
NM_012416chr911176 1865 ----
NM_012425chr1031673 789 274 ----12126
NM_012428chr151216 ------
NM_012448chr1712053 ------
NM_012465chr1042319 826 684 344 ------
NM_012478chr17160 --2246 72 --
NM_012479chr71666 --11925 --
NM_013227chr154801 634 562 321 ------
NM_013231chr1434301 3585 657 ------
NM_013269chr121661 --2783 414 13891
NM_013279chr1151936 1693 1591 623 550 --21841 437 11709
NM_013282chr192400 51 186 ----
NM_013312chr19278 30 ------
NM_013323chr1761149 932 903 851 793 226 --11209 --
NM_013368chr192432 135 --193 --
NM_013390chr91636 --1331 --
NM_013403chr192242 63 ------
NM_013433chr1941957 803 263 102 --11252 --
NM_013443chr941133 1038 944 488 --1973 --
NM_013446chr721208 900 ------
NM_013449chr1242206 2195 623 371 --22799 1979 --
NM_013951chr252376 2166 1987 1971 1556 --12513 --
NM_013952chr252453 2243 2064 2048 1633 --12590 --
NM_013953chr252453 2243 2064 2048 1633 --12590 --
NM_013992chr252453 2243 2064 2048 1633 --12590 --
NM_013993chr63746 694 517 ------
NM_013994chr63746 694 517 ------
NM_013995chrX31787 1707 548 ------
NM_014023chr1021949 418 1876 ----
NM_014079chr33343 227 206 --1705 --
NM_014106chr1512913 ----1762
NM_014112chr814959 14416 ----
NM_014117chr1621857 841 ------
NM_014154chr31101 ------
NM_014155chr1114925 11342 ----
NM_014157chr1643195 2558 969 74 1333 12971 --
NM_014159chr3--1239 ----
NM_014170chr32397 323 ------
NM_014213chr23593 488 231 ------
NM_014233chr1721761 161 --21507 1467 --
NM_014240chr333012 915 47 23491 3353 ----
NM_014243chr412065 ------
NM_014250chr2221304 304 1569 1312 --
NM_014278chr41416 ------
NM_014284chr13714 706 403 ------
NM_014289chrX----1266 --
NM_014292chr2241659 440 271 143 1775 126 --
NM_014299chr1932091 1843 1376 --11816 --
NM_014309chr2245166 4777 3296 2131 --14163 --
NM_014316chr1631914 821 796 1346 1100 --
NM_014319chr12--1522 ----
NM_014331chr457463 6193 2353 617 260 ------
NM_014335chr15--169 ----
NM_014351chr2221340 1160 ------
NM_014360chr143639 348 24 ------
NM_014372chr12748 568 ------
NM_014382chr3----1387 --
NM_014397chr9--2422 110 ----
NM_014415chr31162 ------
NM_014423chr544935 3774 2176 338 ----25325 4870
NM_014426chr201248 ------
NM_014445chr332429 2270 820 ------
NM_014470chr122310 127 ------
NM_014491chr7--1319 ----
NM_014494chr1611733 --22314 66 --
NM_014502chr111383 --1100 --
NM_014521chr2----11750 --
NM_014554chr122709 292 11456 ----
NM_014563chrX11941 1677 ----
NM_014564chr93162 74 65 --1843 --
NM_014574chr141383 ------
NM_014575chr31533 ------
NM_014584chr1421562 1436 ------
NM_014591chr1041319 1043 527 114 ------
NM_014603chr1751398 1255 1079 1040 476 --11148 --
NM_014613chr52989 638 ------
NM_014614chr231134 1058 440 ------
NM_014615chr161911 32597 1456 506 11264 --
NM_014620chr121288 ------
NM_014634chr2233511 2809 983 1475 11183 --
NM_014636chr93422 313 160 --14242 --
NM_014646chr1832443 222 29 12067 ----
NM_014653chr1241619 869 396 302 1324 21545 246 --
NM_014663chr151009 953 847 231 55 ------
NM_014665chr853198 2667 501 396 229 --11383 --
NM_014667chr311716 --12299 --
NM_014670chr21117 ------
NM_014680chr171404 --177 --
NM_014682chr8--11506 --11697
NM_014690chr752577 2489 2016 498 269 23026 2320 ----
NM_014701chr151407 ------
NM_014705chr71517 ------
NM_014711chr1611364 ------
NM_014729chr831644 1411 519 ------
NM_014739chr624051 868 ------
NM_014740chr17190 ------
NM_014742chr201140 21699 1356 ----
NM_014743chr421984 781 ------
NM_014747chr184705 4617 4473 4220 2096 1223 1149 758 44409 939 685 131 44734 3756 3698 1089 --
NM_014751chr81323 ------
NM_014755chr254095 2953 2757 2608 976 ------
NM_014761chr162820 144 ------
NM_014765chr122715 792 11792 ----
NM_014766chr732777 608 454 21118 1055 13127 --
NM_014767chr1032270 1472 1347 --11396 --
NM_014770chr121303 --1271 --
NM_014772chr1842228 1399 1300 437 --23532 1126 --
NM_014774chr122794 619 12928 ----
NM_014779chr31232 ------
NM_014784chr11783 ------
NM_014786chr1151159 1019 817 312 126 ------
NM_014812chr11604 ------
NM_014819chr51708 ------
NM_014820chr321923 322 ------
NM_014824chr1131948 1543 684 ------
NM_014826chr172888 2736 1398 1262 1186 391 109 ------
NM_014828chr143412 291 82 11007 ----
NM_014830chr1233504 3048 2490 13354 11282 --
NM_014832chr1331778 1722 1517 ------
NM_014836chr10--1746 --11412
NM_014840chr1252428 1378 1317 1042 177 164 ----
NM_014847chr1296 43 ------
NM_014849chr11403 --2410 321 --
NM_014850chr314156 --23879 1587 --
NM_014851chr162274 1954 1913 1715 1633 596 195 --1521
NM_014868chr121129 ------
NM_014872chr942192 2168 230 80 ----12011
NM_014877chr1766943 6834 6613 6155 6094 2160 ------
NM_014891chr721670 439 ------
NM_014893chrY1550 ------
NM_014897chr1712652 12557 ----
NM_014901chr5----21827 666 --
NM_014903chr123764 460 385 ------
NM_014912chr10--176 ----
NM_014920chr6--11350 1344 --
NM_014921chr19112613 2450 2139 2133 2041 1015 837 779 357 61 23 1186 11947 --
NM_014923chr13------1528
NM_014925chr122953 56 1354 ----
NM_014932chr31142 ------
NM_014934chr1323288 3071 ------
NM_014935chr153115 2842 1003 531 333 ------
NM_014939chr18--11378 ----
NM_014945chr521977 1329 ------
NM_014947chr111102 32652 1007 871 ----
NM_014949chr1----1150 --
NM_014950chr141348 11339 ----
NM_014974chr101376 --21409 1158 11443
NM_014977chr14150 ------
NM_015000chr1212255 ------
NM_015002chr122877 393 --12035 --
NM_015008chr322690 1243 1407 ----
NM_015017chr11411 1317 ----
NM_015020chr1643106 477 439 297 33762 1518 200 ----
NM_015024chr821080 445 ------
NM_015027chr1611820 ------
NM_015042chr152736 558 --22705 717 --
NM_015044chr1633025 2790 230 ------
NM_015051chr932688 2624 2230 ------
NM_015060chr71204 ------
NM_015061chr92713 73 ------
NM_015068chr713531 ------
NM_015075chrX62203 1934 1394 526 399 105 --22171 726 22226 1697
NM_015076chr623238 2926 ------
NM_015077chr1774677 4287 3295 3077 2979 1520 104 44306 3840 3704 1469 23376 1667 --
NM_015080chr114908 335 311 212 ----1666
NM_015090chr185070 4636 4239 4223 4075 3925 1779 646 ------
NM_015091chr14--2806 554 ----
NM_015092chr1611457 ----23573 114
NM_015093chr621478 564 ------
NM_015094chr22114411 4245 3895 3473 3430 3293 3137 2934 1757 1692 683 13812 1967 --
NM_015100chr111711 --11882 165
NM_015107chrX32183 2110 1964 --11536 --
NM_015138chr153520 243 233 ------
NM_015144chr1633930 3463 965 --13187 --
NM_015157chr1131153 358 95 --2350 37 --
NM_015172chr111267 ------
NM_015176chr111423 ------
NM_015185chrX22349 841 12540 22336 2047 11148
NM_015186chr91381 ------
NM_015191chr1112631 1981 11993 --
NM_015193chr82206 77 11248 ----
NM_015199chr312980 ------
NM_015205chr1353994 3930 1329 1124 745 --11599 --
NM_015215chr122603 413 1505 ----
NM_015221chr10157 --1219 --
NM_015225chr932848 2220 580 ------
NM_015236chr4----11169 --
NM_015245chr632716 1967 596 12219 1674 1949
NM_015246chr163295 289 58 12014 2773 436 --
NM_015250chr91675 --1304 --
NM_015260chr1931309 1080 1016 --11543 1223
NM_015270chr1232289 1461 184 ------
NM_015278chr622676 2133 1419 ----
NM_015282chr212462 --22920 869 --
NM_015284chr121512 461 1555 ----
NM_015299chr1441526 899 578 262 ------
NM_015305chr1451929 1792 1540 670 526 --1259 --
NM_015310chr832952 2352 954 15127 ----
NM_015315chr542323 1013 617 527 --123 12857
NM_015326chr132607 861 715 1318 21964 723 11177
NM_015327chr131000 329 29 --11160 --
NM_015335chr1221836 498 --11906 --
NM_015347chr1221836 112 ------
NM_015349chr622855 646 ----12081
NM_015355chr1721602 153 ------
NM_015365chrX2908 676 ------
NM_015374chr2241198 1067 1003 327 ------
NM_015382chr14--1237 ----
NM_015388chr6199 ------
NM_015397chr921579 359 ------
NM_015404chr9295 89 ------
NM_015419chrX149 1195 1242 --
NM_015446chr111132 ------
NM_015455chr513635 14091 ----
NM_015457chr1121044 993 --183 --
NM_015464chr71327 ------
NM_015481chr122678 64 --2172 137 1341
NM_015483chr71940 ------
NM_015508chr321367 1008 ------
NM_015534chr1--1980 ----
NM_015537chr941116 871 157 61 --2952 850 1307
NM_015541chr311055 180 ----
NM_015545chr72315 273 ------
NM_015548chr61187 ------
NM_015553chr634209 3655 171 13520 1272 --
NM_015557chr162908 2771 2535 2312 1204 427 12588 11098 --
NM_015564chr522858 1026 ------
NM_015567chr1321268 253 ------
NM_015568chr2042948 1714 273 109 1410 21320 41 23551 429
NM_015570chr71623 ------
NM_015576chr312293 ------
NM_015609chr162944 2168 2119 690 538 259 1962 ----
NM_015635chr921693 186 ------
NM_015646chr1211264 ------
NM_015659chr1633091 3057 2878 22893 2757 ----
NM_015678chr1321354 635 ------
NM_015686chrX31964 708 293 --175 1267
NM_015691chrX42744 1998 454 183 12101 2774 738 --
NM_015695chr651554 853 333 319 127 --1273 --
NM_015704chr22137 ------
NM_015713chr81106 11120 --13219
NM_015716chr17193 ------
NM_015719chr191169 --1176 --
NM_015726chr12316 32 --21157 208 --
NM_015833chr2131853 322 33 ------
NM_015866chr111327 --11437 --
NM_015872chr141369 1181 1130 396 --1355 --
NM_015878chr841702 1621 599 305 ------
NM_015898chr1942322 1982 429 294 --2714 283 --
NM_015913chr11539 ------
NM_015975chrX--11766 ----
NM_015995chr1545049 1709 1320 549 14929 25116 2092 --
NM_016022chr1--2757 191 ----
NM_016032chrX2449 349 --11164 --
NM_016037chr11975 2874 309 ----
NM_016045chr201229 ------
NM_016061chr21383 ------
NM_016076chr142832 2523 2108 563 ------
NM_016083chr622497 194 ------
NM_016096chr832085 154 115 ----12157
NM_016131chr212247 ------
NM_016132chr1522687 2279 1401 ----
NM_016169chr1043187 2966 2911 2739 ------
NM_016224chr631985 589 283 --1494 --
NM_016231chr172436 306 ------
NM_016250chr14----2742 710 --
NM_016252chr22793 352 ------
NM_016260chr21550 --15069 --
NM_016281chr121777 ------
NM_016284chr161944 ------
NM_016289chr21200 1270 ----
NM_016322chr911249 12961 1464 --
NM_016339chr171730 --11203 --
NM_016358chr5----1128 --
NM_016376chr17--1591 --14109
NM_016396chr1512167 ------
NM_016418chr2283694 3018 2503 1527 886 741 479 163 --12614 --
NM_016422chr11--138 13087 --
NM_016424chr17167 ------
NM_016440chr191256 ------
NM_016442chr51876 --1850 --
NM_016451chr11--151 ----
NM_016453chr3----159 --
NM_016472chr142293 26 ----1405
NM_016506chr11----1161 --
NM_016513chr6--11350 1344 --
NM_016522chr1111634 1327 ----
NM_016525chr92347 110 ------
NM_016526chr1132368 630 237 --21850 1714 12421
NM_016539chr194438 164 132 105 --127 --
NM_016542chrX21755 1180 ------
NM_016577chr344288 4069 730 652 14451 ----
NM_016588chr62673 608 ------
NM_016603chr5--1900 ----
NM_016604chr5174 --1283 --
NM_016605chr531944 381 114 12394 1896 --
NM_016621chr1174251 4189 3975 3466 2811 2793 453 ------
NM_016622chr21478 12116 ----
NM_016639chr162428 400 1158 127 --
NM_016830chr122430 70 ------
NM_016836chr21725 ------
NM_016839chr21725 ------
NM_016936chr1632130 2063 2054 1665 2405 271 --
NM_016938chr111385 ------
NM_017420chr1413773 ------
NM_017449chr121319 310 --1663 --
NM_017452chr201193 ------
NM_017453chr201193 ------
NM_017454chr201193 ------
NM_017455chr151216 ------
NM_017491chr4------1387
NM_017519chr61220 ----1528
NM_017548chr331936 753 484 ------
NM_017551chr104904 858 713 566 ------
NM_017575chr1721495 1284 --1388 --
NM_017594chr922351 2192 --12759 --
NM_017596chr133433 3139 1682 --11636 --
NM_017599chr122517 212 ------
NM_017610chr151284 ------
NM_017628chr423825 1818 11679 ----
NM_017634chr821340 264 ------
NM_017637chr968787 8624 8608 7713 7359 1532 ------
NM_017641chr12--11172 ----
NM_017643chr172759 80 ------
NM_017650chr7--34065 3788 1023 1708 --
NM_017660chr1982484 1368 1117 901 307 244 188 30 --1405 --
NM_017664chr131811 1181 ----
NM_017676chr521633 1396 ------
NM_017686chr111064 ------
NM_017694chr221437 718 ------
NM_017709chr163549 3177 1535 1215 302 51 ------
NM_017714chr20160 ------
NM_017724chr31325 ------
NM_017730chr31289 ------
NM_017736chr1632134 2126 2114 --263 42 --
NM_017739chr15403 154 105 99 26 ------
NM_017744chr132356 281 272 ------
NM_017749chr111688 2308 241 ----
NM_017770chr622110 692 --12853 --
NM_017772chr621655 1230 --21336 1309 --
NM_017778chr81337 ------
NM_017780chr81626 ------
NM_017786chr81494 ------
NM_017799chr1411327 11588 11493 --
NM_017805chr19146 1168 ----
NM_017824chr101611 22133 1880 ----
NM_017848chrX33715 1451 1241 ------
NM_017873chr952117 1270 1014 487 259 --1356 1735
NM_017893chr101367 21440 387 ----
NM_017993chr13184 ------
NM_018010chr311602 ------
NM_018018chr12----1692 --
NM_018028chr1921133 69 ----11173
NM_018032chr162988 93 1100 ----
NM_018050chr12--1225 ----
NM_018063chr101342 ------
NM_018070chr11373 ------
NM_018095chr11----1161 --
NM_018110chr1651070 197 86 52 37 ------
NM_018113chr12----1442 --
NM_018126chr4168 ------
NM_018128chr17--11028 ----
NM_018133chr311539 ------
NM_018150chr12744 278 --1674 --
NM_018157chr1262543 2360 1262 1142 219 210 ------
NM_018171chr12----1824 --
NM_018178chr11149 ------
NM_018179chr121209 ------
NM_018182chr1712251 --11895 --
NM_018184chr321585 788 ------
NM_018193chr15----135 --
NM_018198chr121400 269 ------
NM_018275chr72437 231 ------
NM_018293chr332564 430 381 ------
NM_018320chr112371 178 --21095 196 1426
NM_018362chr1113360 ----11267
NM_018367chr111284 ------
NM_018371chr82416 154 ------
NM_018373chr1446105 5606 2047 2039 15511 ----
NM_018416chr1221844 1681 ------
NM_018429chr51358 11028 ----
NM_018433chr21507 ------
NM_018445chr153431 146 107 ------
NM_018449chr91769 --1597 --
NM_018462chr31150 2671 110 ----
NM_018469chr17----21059 55 --
NM_018489chr11182 ------
NM_018557chr211344 ------
NM_018640chr121644 ------
NM_018660chr862611 2500 2357 616 520 121 ------
NM_018667chr1682691 1895 1867 1840 1084 597 349 308 ------
NM_018688chr81311 --1233 --
NM_018695chr5--1535 ----
NM_018711chr1221177 51 --1206 --
NM_018715chr112030 11880 ----
NM_018717chr431835 1763 768 --12072 --
NM_018719chr721279 286 ------
NM_018912chr541567 1437 258 187 --11234 --
NM_018913chr541567 1437 258 187 --11234 --
NM_018914chr541567 1437 258 187 --11234 --
NM_018915chr541567 1437 258 187 --11234 --
NM_018916chr541567 1437 258 187 --11234 --
NM_018917chr541567 1437 258 187 --11234 --
NM_018918chr541567 1437 258 187 --11234 --
NM_018919chr541567 1437 258 187 --11234 --
NM_018920chr541567 1437 258 187 --11234 --
NM_018921chr541567 1437 258 187 --11234 --
NM_018922chr541567 1437 258 187 --11234 --
NM_018923chr541567 1437 258 187 --11234 --
NM_018924chr541567 1437 258 187 --11234 --
NM_018925chr541567 1437 258 187 --11234 --
NM_018926chr541567 1437 258 187 --11234 --
NM_018927chr541567 1437 258 187 --11234 --
NM_018928chr541567 1437 258 187 --11234 --
NM_018929chr541567 1437 258 187 --11234 --
NM_018945chr622398 2291 --1116 1608
NM_018959chr192627 497 ------
NM_018963chr212393 142 ------
NM_018976chr1211869 12444 ----
NM_018979chr1242519 2153 2072 441 ------
NM_019000chr51267 ------
NM_019006chr151255 ------
NM_019024chr2188 ------
NM_019027chr41892 ----1720
NM_019050chr421796 558 ------
NM_019063chr222184 2030 ------
NM_019074chr152829 657 --2303 291 --
NM_019084chr1012462 ------
NM_019096chr621005 696 ------
NM_019105chr6----1158 --
NM_019106chr222579 414 --22416 526 --
NM_019114chr962415 2383 2197 1995 309 64 ------
NM_019593chr20196 ------
NM_019595chr2278 47 --1131 --
NM_019606chr71508 ------
NM_019613chr1731054 102 56 --1312 --
NM_019843chr22186 ------
NM_019857chrX1639 --21263 573 --
NM_019884chr192179 51 ------
NM_019885chr262502 2156 1165 500 369 184 --1263 --
NM_020039chr1221919 1333 ------
NM_020122chr255028 4836 4505 1274 1181 ------
NM_020123chr1051131 1089 1052 516 97 ------
NM_020148chr181102 --12995 1482
NM_020159chr421704 84 11736 ----
NM_020163chr351764 1522 825 169 163 1679 ----
NM_020177chr512182 12197 ----
NM_020180chr18----1388 --
NM_020182chr2052267 1109 777 583 27 13164 12869 --
NM_020198chr173190 158 151 ------
NM_020199chr511155 ------
NM_020205chr163320 2552 1385 869 200 181 --12801 --
NM_020211chr15130 1143 1505 --
NM_020226chr41292 ------
NM_020228chr1121634 149 ------
NM_020239chr131678 495 154 ------
NM_020245chr644499 3706 3081 1584 ------
NM_020309chr191279 ----1903
NM_020310chr172868 727 --1596 --
NM_020336chr2063564 2974 2682 2628 735 189 ----1956
NM_020338chr1013236 12373 ----
NM_020341chr20--1142 ----
NM_020342chr212144 ------
NM_020348chr101624 --11828 --
NM_020362chr1----1132 --
NM_020373chr122537 444 ------
NM_020381chr61720 1626 ----
NM_020418chr32467 49 ------
NM_020438chr931031 454 314 1997 --11276
NM_020440chr152484 1219 1087 547 339 --12891 --
NM_020443chr155546 4334 2168 957 316 --15298 21055 332
NM_020456chr1311820 ------
NM_020463chr21205 ------
NM_020465chr1621907 593 --1112 1180
NM_020475chr852097 1839 398 324 290 12091 1765 --
NM_020476chr852097 1839 398 324 290 12091 1765 --
NM_020477chr852097 1839 398 324 290 12091 1765 --
NM_020478chr852160 1902 461 387 353 12154 1828 --
NM_020480chr852097 1839 398 324 290 12091 1765 --
NM_020631chr141389 1313 382 274 ------
NM_020640chr31190 ------
NM_020651chr2--11587 ----
NM_020689chr2031654 621 572 ------
NM_020699chr185097 4361 4352 3944 2069 1948 695 654 1794 ----
NM_020713chr2032340 724 295 --21124 207 --
NM_020717chrX51930 1499 760 735 417 --1834 --
NM_020728chr723126 2535 1647 ----
NM_020732chr61220 ----1528
NM_020747chr51621 ------
NM_020748chr1721601 1370 ------
NM_020755chr6--2657 252 ----
NM_020764chr1641302 929 887 186 --1177 --
NM_020772chr1712457 ------
NM_020774chr1845991 4696 2483 872 ------
NM_020795chr1741899 1660 1545 1482 11582 ----
NM_020801chr521968 35 ------
NM_020804chr662095 2053 1980 1883 1003 271 --22426 202 --
NM_020808chr11391 1304 ----
NM_020830chr243263 2080 654 396 ------
NM_020831chr223955 232 33 ------
NM_020832chr11545 ------
NM_020839chr321422 576 ------
NM_020845chr121968 22163 1841 11943 --
NM_020854chr1831499 1211 989 ------
NM_020858chr151268 2726 339 ----
NM_020860chr41358 --1115 --
NM_020870chr422149 508 ------
NM_020871chrX12034 ------
NM_020886chr1111002 1907 ----
NM_020922chrX31819 1275 87 1681 ----
NM_020927chr1621890 259 ------
NM_020946chr941665 1472 685 490 ------
NM_020948chr1--1636 ----
NM_020949chr3--1182 ----
NM_020952chr9----1328 --
NM_020956chr19134530 4218 3885 3633 3550 3359 3145 3124 3058 2892 1399 1159 1030 13762 44547 1307 638 524 14575
NM_020981chr21103 ------
NM_020983chr1232289 1461 184 ------
NM_020993chr1232522 693 239 --1380 --
NM_021020chr843298 2840 273 52 --13011 --
NM_021033chr1322775 2320 21111 176 ----
NM_021047chr191504 ------
NM_021061chr823863 1301 ------
NM_021090chr2251196 950 764 745 674 14877 14821 --
NM_021096chr2273007 2783 2187 2151 1313 933 834 22275 990 2783 365 --
NM_021116chr7127705 7152 6987 6820 5998 3386 2254 2145 2139 1716 1636 552 37751 3244 2809 ----
NM_021132chr10----1232 --
NM_021135chr633149 845 503 150 3480 279 177 --
NM_021145chr71976 ------
NM_021155chr1921162 760 1664 12132 --
NM_021174chr82737 166 ------
NM_021190chr11116 ------
NM_021202chr2032424 1018 54 2886 556 ----
NM_021218chr91962 ------
NM_021238chr121266 1172 ----
NM_021242chrX4853 303 150 122 ------
NM_021249chr1411281 ------
NM_021252chr1011368 ------
NM_021255chr1443111 939 605 113 1379 1548 --
NM_021614chr51105 ------
NM_021647chr421651 43 --13409 --
NM_021648chr642144 2138 561 403 ------
NM_021649chr5------1688
NM_021728chr14----1674 --
NM_021813chr635393 5021 788 ------
NM_021905chr62448 133 --159 --
NM_021912chr1533470 3221 572 ----13048
NM_021913chr191217 ----11834
NM_021943chr621348 160 --12007 --
NM_021945chr622431 941 12732 21125 24 --
NM_021951chr92378 64 ------
NM_021956chr62230 210 ------
NM_021961chr1156989 6896 5906 2609 2274 --12900 --
NM_021977chr623529 3113 --23287 631 --
NM_021988chr2021300 1122 --1438 --
NM_021999chr131117 ------
NM_022041chr161104 --11726 --
NM_022048chr1556046 4538 4463 2063 822 ----1573
NM_022054chr141782 ------
NM_022060chr1431376 1006 358 --11242 --
NM_022085chr6182 ------
NM_022114chr121340 1209 --13226 --
NM_022123chr141589 ------
NM_022129chr10172 --1210 --
NM_022130chr5----11339 --
NM_022143chr71633 ----11495
NM_022152chr25973 299 221 82 35 ------
NM_022166chr1685237 4991 4842 4392 2372 1462 508 59 1555 ----
NM_022170chr751423 1214 697 181 35 11188 2466 295 --
NM_022307chr72571 57 ------
NM_022336chr232053 1515 55 ------
NM_022343chr921237 851 ----11070
NM_022356chr1148 1425 ----
NM_022442chr2021300 1122 --1438 --
NM_022465chr1232110 1166 1094 --11039 --
NM_022477chr20--11189 11645 --
NM_022552chr251215 1056 985 317 167 ------
NM_022574chr722066 193 ------
NM_022648chr234196 3963 1141 --23576 43 11866
NM_022719chr2293472 2913 2480 1225 1097 621 579 270 142 122 1346 --
NM_022730chr21292 --1215 --
NM_022735chr11186 ------
NM_022737chr191988 --11198 11015
NM_022739chr1711138 --1745 --
NM_022745chr132351 1907 420 12281 ----
NM_022748chr732572 1123 456 12486 ----
NM_022755chr921666 1007 21618 295 ----
NM_022756chr131057 1048 485 ------
NM_022758chr6158 23038 2504 22225 72 12715
NM_022780chr221536 190 ------
NM_022781chr912722 ----12463
NM_022841chr15--1565 1533 11978
NM_022843chr1311427 ------
NM_022845chr1611915 ------
NM_022893chr222550 2026 ------
NM_022894chr21267 ------
NM_022898chr1433963 2965 831 ------
NM_022910chr1621907 593 --1112 1180
NM_022977chrX1456 ------
NM_023000chr1421414 432 ------
NM_023001chr1421414 432 ------
NM_023035chr191808 --1253 --
NM_023037chr132129 27 ------
NM_023079chr1741541 1472 482 416 11659 1208 --
NM_023112chr1462892 2707 2523 2476 714 476 ------
NM_023929chr8----1494 --
NM_024017chr1741643 1305 1256 535 ------
NM_024019chr42197 41 ------
NM_024046chr3----3929 312 64 --
NM_024060chr11--1253 1275 --
NM_024077chr9--1789 165 --
NM_024090chr411894 --11623 --
NM_024102chr12403 166 ------
NM_024294chr6158 23038 2504 22225 72 12715
NM_024423chr1844204 3647 3170 929 --11144 --
NM_024493chr63344 174 94 ------
NM_024519chr16--152 1232 --
NM_024528chrX156 ------
NM_024541chr104745 451 259 82 1650 ----
NM_024546chr131257 ------
NM_024551chr1231596 271 121 --12514 --
NM_024551chr1231596 271 121 --12514 --
NM_024569chr1--21102 475 ----
NM_024586chr11485 ------
NM_024615chr5--147 ----
NM_024617chr91591 ------
NM_024624chr211225 1331 ----
NM_024659chr21638 ------
NM_024676chr12891 344 11161 1936 --
NM_024698chr112574 50 ----11263
NM_024704chr202327 55 ------
NM_024713chr1521224 655 ------
NM_024742chr1621325 701 11370 11595 --
NM_024757chr931019 366 106 ------
NM_024770chr241614 1371 981 686 11510 ----
NM_024787chr82390 141 ------
NM_024807chr64608 540 290 52 1463 ----
NM_024808chr131759 1146 ----
NM_024812chr821858 1715 1766 ----
NM_024828chr911585 ------
NM_024830chr541682 669 143 81 ------
NM_024871chr32568 76 ----11312
NM_024887chr151842 1734 1655 1611 49 ------
NM_024922chr1641641 1477 1427 1305 ------
NM_024953chr1222684 960 ------
NM_024971chr9----1328 --
NM_024979chr132562 40 --2610 188 --
NM_024989chr237341 2768 2367 ------
NM_025048chr6--138 1470 --
NM_025074chr41421 --11128 --
NM_025083chr1531304 559 192 11371 ----
NM_025134chr162649 258 1866 ----
NM_025138chr131395 ------
NM_025146chr311671 ------
NM_025160chr122733 1638 ------
NM_025164chr1131497 293 165 ----11866
NM_025182chr93964 722 700 ------
NM_025191chr11413 ------
NM_025212chr41129 ------
NM_025219chr203823 790 383 --1246 --
NM_025235chr1022067 1831 ------
NM_025237chr172328 129 ------
NM_025250chr752945 2040 1868 932 832 --22968 182 22402 2152
NM_025264chr2--127 --1314
NM_030567chr5----157 --
NM_030594chr151884 ------
NM_030629chr1621605 278 ------
NM_030630chr171226 ----123
NM_030640chr12----1623 --
NM_030647chr71263 ------
NM_030648chr444958 4590 2199 329 --13429 --
NM_030650chr213663 11531 ----
NM_030661chr721173 640 --21077 467 --
NM_030753chr17----1243 --
NM_030766chr122281 203 ------
NM_030790chr161205 ------
NM_030795chr82440 100 ------
NM_030806chr177955 7381 7095 6973 2277 1360 874 23307 2649 26982 6745 --
NM_030808chr171982 --125 --
NM_030810chr6182 ------
NM_030816chr1------12851
NM_030881chr2212203 --11553 --
NM_030884chr331511 427 203 ----11788
NM_030885chr331664 454 22 ------
NM_030914chr92658 253 ------
NM_030915chr222104 260 --11801 --
NM_030918chr155228 4709 4021 1617 467 11918 ----
NM_030925chr1321972 1900 ------
NM_030940chr9------159
NM_030962chr111143 ----1546
NM_030964chr51798 --32922 2873 205 --
NM_030981chr114913 344 299 127 ------
NM_031212chr10----1114 128
NM_031243chr721474 25 11788 ----
NM_031407chrX127 ------
NM_031445chr222442 929 22358 281 2249 233 --
NM_031450chr11148 --1199 --
NM_031468chr736419 6303 161 --1486 --
NM_031476chr1662241 1968 1884 1843 49 42 12146 ----
NM_031478chr164270 76 63 56 ------
NM_031483chr2053211 2757 2433 2276 472 ------
NM_031492chr111457 ------
NM_031844chr143096 2684 249 116 ------
NM_031845chr253564 2568 1180 919 63 1225 ----
NM_031847chr253564 2568 1180 919 63 1225 ----
NM_031953chr4--180 ----
NM_031992chr751423 1214 697 181 35 11188 2466 295 --
NM_032012chr945134 3450 1408 453 --14729 --
NM_032013chr20--11189 11645 --
NM_032023chr101925 ------
NM_032028chr53530 472 462 --1562 --
NM_032048chr182601 93 ------
NM_032052chr2241322 949 470 215 ------
NM_032088chr541567 1437 258 187 --11234 --
NM_032092chr541567 1437 258 187 --11234 --
NM_032102chr111535 ------
NM_032109chr511111 1161 ----
NM_032121chrX11085 1871 ----
NM_032124chr1821114 280 ------
NM_032182chr1021275 566 ------
NM_032199chr1021207 970 ------
NM_032236chr111080 ------
NM_032239chr4--11368 1365 --
NM_032246chr151471 ------
NM_032281chr193937 767 541 1761 42877 2853 2575 370 12923
NM_032287chr2222567 1433 11448 ----
NM_032294chr1741336 1298 210 97 --2600 513 --
NM_032316chr332420 2254 2214 ----1157
NM_032317chr71464 --21338 261 --
NM_032320chr11--1531 ----
NM_032325chr1131450 116 58 11354 ----
NM_032352chr142561 254 ------
NM_032353chr17148 ------
NM_032364chr121306 1202 1875 --
NM_032368chr1165 ------
NM_032370chr19----125 --
NM_032403chr541567 1437 258 187 --11234 --
NM_032420chr53908 276 257 --1231 --
NM_032429chr103492 444 142 ------
NM_032434chr211386 ------
NM_032440chr1011892 11995 ----
NM_032452chr142383 273 ------
NM_032470chr6----1158 --
NM_032521chr2022645 1054 3967 716 581 --12548
NM_032538chr622563 2187 --1871 --
NM_032547chr421275 562 ------
NM_032560chr141285 ------
NM_032590chr12268 34 ------
NM_032595chr1741397 393 361 241 1164 21142 368 --
NM_032596chr91117 ------
NM_032645chr11123 ------
NM_032682chr332996 2968 561 ------
NM_032701chr192431 138 --1624 --
NM_032711chr1784093 4087 3782 2986 1451 577 506 483 --11402 --
NM_032737chr1972604 2453 2328 1736 1719 582 296 11877 ----
NM_032741chr61842 ------
NM_032775chr224403 385 344 41 ------
NM_032786chr122150 99 --1225 --
NM_032833chr141787 749 448 408 21689 351 ----
NM_032840chr122788 285 ------
NM_032871chr1151591 721 639 501 325 ----1755
NM_032876chr1452042 836 589 366 259 ------
NM_032918chr121116 ------
NM_032975chr1833007 2768 2644 ------
NM_032980chr1833007 2768 2644 ------
NM_032983chr72650 442 22513 2099 ----
NM_032998chr13941 190 70 ------
NM_033008chr32467 49 ------
NM_033009chr32467 49 ------
NM_033010chr32467 49 ------
NM_033016chr221333 --11576 --
NM_033018chrX31178 1172 1000 ------
NM_033025chr191264 --1839 --
NM_033027chr31907 --2207 64 --
NM_033044chr121032 495 --11043 --
NM_033088chr12681 145 ------
NM_033102chr151262 274 238 173 77 --1932 --
NM_033102chr151262 274 238 173 77 --1932 --
NM_033132chr132265 192 ------
NM_033133chr1792867 2791 1470 1068 990 829 660 486 420 22463 601 ----
NM_033138chr7--1104 ----
NM_033139chr7--1104 ----
NM_033140chr7--1104 ----
NM_033157chr7--1104 ----
NM_033181chr622497 194 ------
NM_033201chr161104 ------
NM_033224chr756784 4958 2479 1467 823 26688 545 ----
NM_033225chr831015 358 218 ------
NM_033226chr165272 193 187 135 75 ------
NM_033272chr2------196
NM_033309chr161130 --2899 412 --
NM_033316chr3126 ------
NM_033326chr111364 --11898 --
NM_033331chr932908 2889 2582 ------
NM_033343chr1----1292 --
NM_033360chr1232863 885 582 --1387 --
NM_033387chr922207 803 --12231 22163 346
NM_033401chr161106 --157 --
NM_033425chr1123537 1317 2212 25 ----
NM_033429chr1551213 1169 828 449 277 --22108 791 --
NM_033449chr591965 1604 1399 1382 1341 768 664 372 273 --12005 --
NM_033503chr1573663 3161 2848 2736 556 483 270 1590 1496 13452
NM_033551chr542323 1013 617 527 --123 12857
NM_033624chr122877 393 --12035 --
NM_033626chrX11478 --11749 --
NM_033642chrX21086 24 ------
NM_033644chr521701 453 1877 ----
NM_033645chr521701 453 1877 ----
NM_033656chr2115049 ------
NM_052827chr1231020 421 54 ------
NM_052828chr6137 ------
NM_052840chr1541602 536 283 142 ------
NM_052854chr111507 ------
NM_052876chr1961071 1004 906 855 512 312 --21965 425 --
NM_052879chr1223363 741 1320 13481 --
NM_052880chr224984 907 382 278 11038 11287 --
NM_052885chr121793 ------
NM_052896chr12968 233 ------
NM_052898chr811765 11273 ----
NM_052899chr51107 1765 --1700
NM_052906chr22124960 4871 4217 3608 3348 1967 1420 1334 1161 694 363 308 34859 1985 1934 54744 1833 1428 1219 792 14367
NM_052937chr811680 ------
NM_053016chr987632 6816 5675 5228 4875 3206 2959 350 --17694 --
NM_053023chr113912 754 718 ------
NM_053025chr31393 ------
NM_053026chr31393 ------
NM_053027chr31393 ------
NM_053028chr31393 ------
NM_053031chr31393 ------
NM_053032chr31393 ------
NM_053046chr194346 197 191 133 ------
NM_053064chr1421916 34 ------
NM_053279chr83273 41 27 12149 --12689
NM_054016chr111884 ------
NM_054016chr111884 ------
NM_054016chr111884 ------
NM_054027chr511974 ------
NM_057175chr41472 12266 1443 --
NM_057178chr171109 159 ----
NM_058164chr192133 46 ------
NM_058167chr13997 215 165 ------
NM_058241chr211932 ------
NM_058241chr211932 ------
NM_078487chr931071 837 161 ------
NM_079421chr192219 40 ------
NM_080430chr221129 ------
NM_080476chr202279 38 ------
NM_080489chr201109 --134 --
NM_080546chr91925 11521 ----
NM_080607chr2021018 839 ------
NM_080666chr1421590 1193 ------
NM_080669chr1754236 1789 1296 770 647 --1500 23683 3625
NM_080671chr242012 1709 804 614 --1275 --
NM_080678chr21217 ------
NM_080686chr61144 --133 --
NM_080717chr1221176 331 ------
NM_080732chr194346 197 191 133 ------
NM_080743chr622319 1784 22542 1748 ----
NM_080832chrX273 56 ------
NM_080872chr823414 207 ------
NM_080881chr52710 495 --1670 --
NM_130436chr211276 ------
NM_130438chr212853 514 ------
NM_130439chr101376 179 ----
NM_130439chr101376 179 ----
NM_130468chr152768 556 --2103 96 --
NM_130469chr142669 326 ------
NM_130781chr52455 73 ------
NM_130797chr74670 652 531 490 --11506 --
NM_130838chr1511712 ------
NM_130839chr1511712 ------
NM_133170chr2077377 6020 2589 2335 2020 1472 794 36592 6271 83 46326 6310 590 153 --
NM_133177chr121076 830 --1694 --
NM_133178chr121076 830 --1694 --
NM_133329chr211576 ------
NM_133369chr51968 ------
NM_133370chr4----12986 --
NM_133642chr2261071 935 844 401 393 322 ------
NM_133647chr1523227 2695 12601 ----
NM_134428chr9--155 ----
NM_138288chr1421416 372 12221 ----
NM_138300chr131162 485 304 --1646 --
NM_138316chr101346 ------
NM_138338chr2252722 2681 2119 806 486 23206 2430 ----
NM_138350chr111392 --133 --
NM_138357chr1011308 1204 ----
NM_138385chr441366 1200 938 322 ------
NM_138396chr122619 368 ------
NM_138415chr2231333 1227 275 --167 --
NM_138423chr1512328 1504 ----
NM_138444chr1343863 3027 482 448 13110 ----
NM_138457chr643260 2734 2156 1295 22285 237 21359 704 21215 368
NM_138471chr112368 126 ------
NM_138473chr1244546 3764 1189 466 --23539 1065 --
NM_138485chr32397 323 ------
NM_138576chr1433963 2965 831 ------
NM_138689chr111176 ------
NM_138694chr641227 937 662 325 ------
NM_138713chr1637714 2156 690 ------
NM_138714chr1637714 2156 690 ------
NM_138717chr61139 --1501 --
NM_138727chr132356 281 272 ------
NM_138728chr132356 281 272 ------
NM_138730chr6147 ------
NM_138732chr114908 335 311 212 ----1666
NM_138734chr114908 335 311 212 ----1666
NM_138811chr711138 ------
NM_138931chr32431 133 ------
NM_138967chr1531688 1612 89 ----153
NM_138971chr1142413 1377 990 171 1781 ----
NM_138971chr1142413 1377 990 171 1781 ----
NM_138972chr1142413 1377 990 171 1781 ----
NM_138972chr1142413 1377 990 171 1781 ----
NM_138973chr1142413 1377 990 171 1781 ----
NM_138973chr1142413 1377 990 171 1781 ----
NM_138980chr42512 176 ------
NM_138981chr42643 307 ------
NM_138982chr42512 176 ------
NM_138991chr21----1270 --
NM_138992chr21----1467 --
NM_138994chr161106 --157 --
NM_139035chrX1598 ------
NM_139072chr21698 ------
NM_139159chr1921107 853 --21100 347 --
NM_139239chr192301 117 ------
NM_139280chr174287 203 183 115 ------
NM_139283chr12------1534
NM_139316chr7139 ------
NM_139321chr2023387 593 --22948 1331 --
NM_139323chr201290 ------
NM_144567chr121974 519 31814 842 681 ----
NM_144571chr435957 2474 1798 ------
NM_144578chr1414963 ------
NM_144581chr14124 ------
NM_144582chr231764 1752 683 12520 --1159
NM_144605chr16230 21 ------
NM_144635chr35476 336 226 177 113 178 1216 --
NM_144664chr1112163 ------
NM_144671chr121760 11424 1630 11754
NM_144963chr81712 --11662 --
NM_144973chr1242069 1469 395 325 ------
NM_145025chr61152 ------
NM_145056chr193586 566 22 ------
NM_145063chr61178 ------
NM_145065chr111422 ------
NM_145113chr1411034 --1202 --
NM_145166chr342838 1847 658 395 --32710 2459 2390 --
NM_145185chr192735 601 ------
NM_145206chr1012777 ----13219
NM_145296chr193921 602 107 ------
NM_145331chr61535 ------
NM_145350chr173599 592 539 11197 ----
NM_145644chr2--1358 ----
NM_145686chr221260 137 12654 22699 612 --
NM_145687chr221260 137 12654 22699 612 --
NM_145698chr1011404 ------
NM_145716chr11373 ------
NM_145733chr22----1205 --
NM_145753chr32468 170 ------
NM_145799chrX3954 855 50 ------
NM_145800chrX1116 --1962 --
NM_145802chrX165 --1911 --
NM_145804chr1121063 102 --21236 392 --
NM_145891chr162472 356 ----1453
NM_145892chr162472 356 ----1453
NM_145893chr162594 478 ----1575
NM_145912chr2271675 1281 1060 802 674 539 289 --24574 4215 --
NM_147156chr101465 ------
NM_147168chr91117 ------
NM_147175chrX1218 ------
NM_147189chr82704 239 ------
NM_147202chr912414 --32235 431 366 12284
NM_147223chr2--11887 1604 --
NM_148174chr841702 1621 599 305 ------
NM_148898chr7--1319 ----
NM_148899chr7--1319 ----
NM_148904chr11485 ------
NM_148905chr11485 ------
NM_148906chr11485 ------
NM_148907chr11485 ------
NM_148908chr11485 ------
NM_148909chr11485 ------
NM_148918chr171127 ------
NM_148977chr101346 ------
NM_148978chr101346 ------
NM_152222chr1151591 721 639 501 325 ----1755
NM_152227chr201248 ------
NM_152233chr1411281 ------
NM_152244chr1761149 932 903 851 793 226 --11209 --
NM_152271chr81335 --1816 --
NM_152272chr84990 960 906 408 ------
NM_152280chr122942 745 ------
NM_152309chr102201 153 ------
NM_152344chr1711415 ------
NM_152346chr174999 860 354 212 ------
NM_152383chr23180 113 83 ------
NM_152388chr21750 12794 ----
NM_152409chr52293 100 ------
NM_152417chr821032 380 ------
NM_152424chrX114637 3989 3376 1841 1699 1562 1382 1073 1067 87 60 24743 3195 --1558
NM_152437chr1221822 833 ------
NM_152440chr123746 298 23 ------
NM_152441chr122701 138 ------
NM_152470chr1863858 3646 3396 2605 962 171 2908 828 2891 689 --
NM_152493chr111244 --11262 --
NM_152542chr41819 ------
NM_152594chr1511432 ------
NM_152622chr51816 ------
NM_152682chr4--155 11633 --
NM_152704chr1321058 206 ------
NM_152716chr112629 144 ------
NM_152722chr1131796 552 67 ------
NM_152724chr1031673 789 274 ----12126
NM_152734chr631589 1526 97 ----14958
NM_152743chr7------129
NM_152745chr71316 ------
NM_152754chr72574 241 ------
NM_152756chr511464 ----1214
NM_152758chr812704 ------
NM_152787chrX--13182 12956 --
NM_152793chr723921 216 --13995 --
NM_152835chr112547 --12606 --
NM_152860chr123520 307 147 --1112 --
NM_152878chr2211137 ------
NM_152890chr11870 ------
NM_152902chr12431 64 ------
NM_152924chr1525970 903 --15029 --
NM_152995chr41277 1729 ----
NM_153029chr1633853 1232 792 --23190 3023 --
NM_153050chr2251196 950 764 745 674 14877 14821 --
NM_153051chr2251196 950 764 745 674 14877 14821 --
NM_153188chr534405 1470 734 --15084 --
NM_153207chr1223716 710 ------
NM_153211chr18190 ------
NM_153244chr101165 ------
NM_153260chr1521317 163 ------
NM_153270chrX177 ------
NM_153273chr34623 568 431 274 1884 1455 --
NM_153280chrX166 ------
NM_153321chr171142 ------
NM_153322chr171142 ------
NM_153347chr1142449 2379 1008 39 1390 1990 --
NM_153350chr1651226 1146 1072 510 469 --2366 349 --
NM_153360chr201545 ----11374
NM_153367chr1053725 3442 642 123 78 13740 2225 136 --
NM_153371chr1321708 657 1561 ----
NM_153464chr191195 ------
NM_153499chr1272627 2080 2022 716 540 455 149 --11942 --
NM_153500chr1272627 2080 2022 716 540 455 149 --11942 --
NM_153607chr51698 ------
NM_153616chr151268 2726 339 ----
NM_153617chr151268 2726 339 ----
NM_153618chr151268 2726 339 ----
NM_153631chr721173 640 --21077 467 --
NM_153632chr721173 640 --21077 467 --
NM_153633chr121288 ------
NM_153649chr111586 ------
NM_153756chr151927 1863 1413 1280 369 ------
NM_153759chr251215 1056 985 317 167 ------
NM_153809chr91522 ------
NM_153810chr1035060 4577 82 --11006 --
NM_153825chr4------11764
NM_153827chr17193 ------
NM_153831chr8--1181 ----
NM_153836chr21725 1101 ----
NM_170663chr17193 ------
NM_170692chr1----1758 --
NM_170707chr12754 306 --195 --
NM_170708chr12754 306 --195 --
NM_170711chr195803 673 613 158 40 ------
NM_170712chr31728 ------
NM_170713chr31728 ------
NM_170714chr31728 ------
NM_170719chr131395 ------
NM_170721chr172418 31 ------
NM_170775chr51105 ------
NM_171998chrX2763 291 ------
NM_172103chr61876 ------
NM_172105chr61876 ------
NM_172200chr102465 93 ------
NM_172206chr1741336 1298 210 97 --2600 513 --
NM_172216chr1272529 1982 1924 618 442 357 51 --11844 --
NM_172226chr1272627 2080 2022 716 540 455 149 --11942 --
NM_172337chr14----1674 --
NM_172344chr211576 ------
NM_172373chr1311102 ------
NM_173084chr311625 2837 32 ----
NM_173172chr22220 148 166 ----
NM_173191chr1041319 1043 527 114 ------
NM_173192chr1041319 1043 527 114 ------
NM_173193chr1041319 1043 527 114 ------
NM_173194chr1041319 1043 527 114 ------
NM_173195chr1041319 1043 527 114 ------
NM_173198chr92246 203 ------
NM_173200chr92246 203 ------
NM_173201chr16----1195 --
NM_173214chr1637714 2156 690 ------
NM_173354chr2121555 313 ------
NM_173468chr42438 129 --1119 --
NM_173475chr1621106 139 ------
NM_173500chr1531169 932 333 ------
NM_173508chr111054 ------
NM_173515chr61352 1643 ----
NM_173552chr312384 ------
NM_173587chr114569 154 97 30 1206 ----
NM_173595chr1245309 4436 4410 1263 --34687 3923 1214 --
NM_173602chr1233005 1106 427 ------
NM_173808chr123173 787 ------
NM_173822chr21863 ------
NM_173832chr832835 2519 1387 --22852 1515 1293
NM_173851chr812683 1894 ----
NM_174911chr832636 394 343 ------
NM_174934chr11123064 2959 2828 2680 1433 1333 1232 1151 666 486 267 182 ----22913 714
NM_174937chr10132 ------
NM_175058chr112468 132 1320 ----
NM_175069chr92830 803 ------
NM_175624chr1247211 7187 6210 831 ----24909 2392
NM_175625chr1247211 7187 6210 831 ----24909 2392
NM_175629chr251215 1056 985 317 167 ------
NM_175630chr22714 257 ------
NM_175709chr22142 --22182 1041 11955
NM_175736chr1266737 5637 1508 1412 1042 920 35714 2506 81 22527 2351 12041
NM_175747chr62942 889 ------
NM_175748chr1431888 1623 759 --1551 --
NM_175854chr1322089 2077 ------
NM_175859chrX1639 --21263 573 --
NM_175863chr61220 ----1528
NM_175866chr11211 ------
NM_175898chr1521360 465 ------
NM_175907chr18--12683 12843 1816
NM_175920chr52537 57 ------
NM_176871chr863258 3079 3049 2912 799 486 12743 --1340
NM_177559chr201406 ------
NM_177560chr201406 ------
NM_177968chr232228 1552 558 ------
NM_177974chr1512328 1504 ----
NM_177990chr20--1142 ----
NM_177996chr2021121 218 11131 ----
NM_177999chr942680 2438 1050 822 --1919 11298
NM_178026chr20----1569 --
NM_178126chr171627 ------
NM_178138chr93162 74 65 --1843 --
NM_178151chrX47681 7206 5111 2828 --16201 --
NM_178152chrX47681 7206 5111 2828 --16201 --
NM_178153chrX47681 7206 5111 2828 --16201 --
NM_178426chr152306 2282 2186 1872 1832 --1552 --
NM_178427chr152206 2182 2086 1772 1732 --1452 --
NM_178450chr5143 ------
NM_178500chr17----1146 1161
NM_178554chr342621 1207 1034 61 ------
NM_178565chr8130 ------
NM_178568chr1711356 --31649 1235 339 --
NM_178830chr191123 --1299 --
NM_180976chr631006 897 736 ------
NM_180977chr631006 897 736 ------
NM_181077chr15162 2824 761 ----
NM_181351chr1131944 1138 1005 ------
NM_181358chr133569 3208 2625 23399 3379 ----
NM_181486chr1221176 331 ------
NM_181492chr2211200 ------
NM_181504chr521525 67 ------
NM_181521chr1676935 5533 2005 1690 1601 332 206 27041 1819 16464 15715
NM_181523chr521525 67 ------
NM_181524chr521525 67 ------
NM_181656chr17--1819 ----
NM_181715chr12301 153 ------
NM_181828chr2283694 3018 2503 1527 886 741 479 163 --12614 --
NM_181829chr2283694 3018 2503 1527 886 741 479 163 --12614 --
NM_181830chr2283694 3018 2503 1527 886 741 479 163 --12614 --
NM_181832chr2283709 3033 2518 1542 901 756 494 178 --12629 --
NM_181836chr522622 575 ------
NM_181838chr51601 ------
NM_181842chr62210 58 ------
NM_182314chrX31827 1695 1543 ------
NM_182498chr193259 70 55 ------
NM_182507chr122905 549 ----1134
NM_182509chr1451664 1563 670 600 501 11303 ----
NM_182527chr2221992 1594 11782 2891 282 11658
NM_182540chrX1169 --1131 --
NM_182557chr1121791 211 11366 1123 --
NM_182565chr172502 100 ------
NM_182577chr194171 92 75 35 ------
NM_182580chr152406 1986 1779 891 316 1987 ----
NM_182620chr172114 101 --11666 --
NM_182641chr17--11936 ----
NM_182666chr3--1273 ----
NM_182700chr7----1607 --
NM_182744chr161250 1031 959 913 234 169 21022 401 ----
NM_182762chr725332 1903 --15310 1553
NM_182811chr20167 11138 ----
NM_182830chr14--1701 ----
NM_182854chr161359 --2423 72 1394
NM_182898chr721079 988 --16295 --
NM_182899chr721079 988 --16295 --
NM_182925chr51517 --11334 137
NM_182970chr2053233 3152 2877 2603 976 1434 33051 100 21 1640
NM_183078chr643398 2722 2700 399 23601 2833 13504 --
NM_183243chr71107 ------
NM_183243chr71107 ------
NM_183376chr1522619 903 11687 ----
NM_183380chr61187 ------
NM_183381chr31682 ------
NM_183383chr31682 ------
NM_183384chr31682 ------
NM_183393chr31930 ------
NM_183394chr31930 ------
NM_183397chr20105033 4938 4789 3950 3932 3727 896 587 342 82 14489 ----
NM_183422chr133975 379 343 ------
NM_184231chr3----159 --
NM_194259chr161114 ------
NM_194260chr161114 ------
NM_194261chr161114 ------
NM_194278chr1443174 1157 965 649 --23616 223 --
NM_194282chr411133 ------
NM_194286chr1266185 2358 1653 1274 1189 99 25607 670 45277 2061 1167 156 15318
NM_194313chr921555 54 ------
NM_194314chr144656 3463 2148 78 ------
NM_194315chr13997 215 165 ------
NM_194328chr912722 ----12463
NM_194329chr912722 ----12463
NM_194330chr912722 ----12463
NM_194332chr912722 ----12463
NM_194358chr1241683 1351 691 676 ------
NM_194359chr1241683 1351 691 676 ------
NM_194442chr111156 ------
NM_194449chr18183 ------
NM_194452chr112371 178 --21095 196 1426
NM_194453chr112371 178 --21095 196 1426
NM_194457chr13997 215 165 ------
NM_194458chr13997 215 165 ------
NM_197968chr132500 481 ------
NM_198086chr1452042 836 589 366 259 ------
NM_198120chr81454 ------
NM_198158chr342612 2542 2512 78 11861 ----
NM_198159chr342612 2542 2512 78 11861 ----
NM_198177chr342612 2542 2512 78 11861 ----
NM_198178chr342612 2542 2512 78 11861 ----
NM_198225chr10--1746 --11412
NM_198236chr11783 ------
NM_198240chr12127 ------
NM_198268chr133569 3208 2625 23399 3379 ----
NM_198269chr133569 3208 2625 23399 3379 ----
NM_198270chrX32449 2419 2174 ------
NM_198334chr113869 844 164 ------
NM_198335chr113869 844 164 ------
NM_198390chr1621605 278 ------
NM_198446chr1----1180 --
NM_198513chr8--1639 ----
NM_198516chr11179 ------
NM_198560chr353281 3078 2866 2383 268 --12970 --
NM_198597chr103868 804 289 1154 --1399
NM_198681chr141389 1313 382 274 ------
NM_198794chr1411244 ------
NM_198830chr171535 ------
NM_198859chr335067 4164 4152 11451 11111 --
NM_198880chr31289 ------
NM_198900chr1266737 5637 1508 1412 1042 920 35714 2506 81 22527 2351 12041
NM_198956chr7----1607 --
NM_198963chr22535 97 ------
NM_198968chr1323288 3071 ------
NM_198990chr733190 2316 279 ------
NM_199054chr193835 535 271 --2745 655 --
NM_199138chr1321058 206 ------
NM_199141chr191280 ------
NM_199144chr2021300 1122 --1438 --
NM_199168chr103611 553 262 ------
NM_199169chr2052267 1109 777 583 27 13164 12869 --
NM_199170chr2052267 1109 777 583 27 13164 12869 --
NM_199171chr2052267 1109 777 583 27 13164 12869 --
NM_199188chr1223363 741 1320 13481 --
NM_199190chr1223363 741 1320 13481 --
NM_199192chr2--135 ----
NM_199193chr2--135 ----
NM_199203chr2021300 1122 --1438 --
NM_199205chr82737 166 ------
NM_199245chr1252474 2114 830 230 77 ------
NM_199262chr1731767 275 177 --1162 --
NM_199320chr42964 34 ----11804
NM_199320chr42964 34 ----11804
NM_199324chr413396 1495 ----
NM_199355chr16--1337 --139
NM_199423chr163522 394 305 ------
NM_199437chr1121634 149 ------
NM_199438chr1121634 149 ------
NM_199439chr1121634 149 ------
NM_199454chr121340 1209 --13226 --
NM_201266chr232170 233 49 12158 2845 831 --
NM_201279chr232170 233 49 12158 2845 831 --
NM_201280chr61624 ------
NM_201432chr17106067 6050 5712 4787 1813 569 407 382 50 44 14542 1166 14801
NM_201433chr17106067 6050 5712 4787 1813 569 407 382 50 44 14542 1166 14801
NM_201535chr14----2742 710 --
NM_201536chr14----2742 710 --
NM_201537chr14----2742 710 --
NM_201538chr14----2742 710 --
NM_201539chr14----2742 710 --
NM_201540chr14----2742 710 --
NM_201541chr14----2742 710 --
NM_201542chr11108 ------
NM_201548chr21379 11113 1986 --
NM_201591chr411689 ----11590
NM_201592chr411689 ----11590
NM_201599chrX2878 217 ------
NM_201624chr11411 1317 ----
NM_201995chr114708 583 305 224 ------
NM_201998chr113773 648 289 ------
NM_201999chr41348 ------
NM_203301chr141203 ------
NM_203327chr2034412 4360 1305 --32778 1783 370 --
NM_203329chr1165247 4341 1913 1859 636 303 15717 36099 2727 152 25880 4998
NM_203330chr1165247 4341 1913 1859 636 303 15717 36099 2727 152 25880 4998
NM_203331chr1165247 4341 1913 1859 636 303 15717 36099 2727 152 25880 4998
NM_203342chr132444 958 266 22729 1395 13468 11224
NM_203343chr132444 958 266 22729 1395 13468 11224
NM_203344chr192432 135 --193 --
NM_203351chr1752471 811 789 257 52 165 22179 1707 1157
NM_203372chr2----1404 --
NM_203434chr92108 40 --11100 --
NM_203446chr211451 ------
NM_203504chr4------11934
NM_203505chr4------11934
NM_205768chr111396 ------
NM_205861chr151842 1734 1655 1611 49 ------
NM_206594chr133465 2956 2787 ------
NM_206595chr133465 2956 2787 ------
NM_206853chr623396 1180 ------
NM_206854chr614657 --1642 --
NM_206855chr625622 136 --11607 --
NM_206907chr553090 2115 684 424 295 1588 ----
NM_206909chr832952 2352 954 15127 ----
NM_206914chr121139 --11509 --
NM_206944chr9----1328 --
NM_206945chr9----1328 --
NM_206946chr9----1328 --
NM_206947chr9----1328 --
NM_207012chr1012967 ------
NM_207113chr711025 --156 --
NM_207171chr111711 --11882 165
NM_207303chr102635 48 13728 ----
NM_207313chr1731000 678 219 --1409 --
NM_207343chr11--159 ----
NM_207371chr1021303 1058 ------
NM_207387chr1721735 1214 ------
NM_207396chr131183 585 281 1185 ----
NM_207429chr11--1481 ----
NM_207645chr112979 941 1545 ----
NM_212469chr112874 292 ------
NM_212551chr11834 ------
NM_213606chr1022672 759 ------
NM_213654chr31101 ------
NM_213662chr1722135 1961 22129 2089 ----