TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1225-5p
miRNA Sequence: GUGGGUACGGCCCAGUGGGGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX53475 2885 2346 1297 429 12933 ----
NM_000084chrX117011 6764 6168 6078 5789 4261 1884 1839 1091 913 684 --12588 21302 74
NM_000110chr11393 ----1419
NM_000138chr1542579 2357 1956 1743 --1413 --
NM_000165chr621049 154 ----1106
NM_000176chr543774 2845 2672 403 22953 1116 --2940 321
NM_000232chr453004 2596 2415 1131 777 2978 767 ----
NM_000259chr1546097 3985 1977 754 ------
NM_000267chr1742694 2664 2518 1330 33379 2970 733 12787 --
NM_000332chr636697 5366 1477 11581 150 --
NM_000337chr556343 4733 1460 1249 260 46555 6331 6128 4321 12493 --
NM_000461chr344154 3797 3217 901 44535 1526 1302 1256 21403 1343 --
NM_000495chrX51074 853 411 294 169 ------
NM_000555chrX56823 5213 5164 437 329 37496 6532 2605 26054 833 --
NM_000609chr1042175 1976 1927 1100 ----13158
NM_000618chr1265893 5588 2194 2077 1313 488 25908 1511 26054 2244 --
NM_000618chr1265893 5588 2194 2077 1313 488 25908 1511 26054 2244 --
NM_000633chr1844461 1761 929 780 11972 1653 --
NM_000724chr1041768 1443 703 456 11815 --1335
NM_000814chr1543785 3091 2913 737 21686 890 1222 --
NM_000826chr442435 2225 2012 777 --22211 944 --
NM_000829chr1162291 2220 2158 2123 1953 1487 --22066 937 --
NM_000868chrX32595 2333 960 11766 --12262
NM_000891chr1753485 3013 1047 877 310 1707 12587 --
NM_000899chr1224033 139 23222 2765 ----
NM_000950chrX53201 851 836 377 174 1351 ----
NM_000965chr33453 178 37 1402 ----
NM_001001419chr554986 3480 1872 1735 941 1723 23593 3408 --
NM_001001420chr554986 3480 1872 1735 941 1723 23593 3408 --
NM_001001890chr2142710 1722 1197 947 --14194 11586
NM_001001971chr101539 11249 --1347
NM_001002814chr863314 3223 2633 532 377 254 23272 1455 13721 --
NM_001002838chrX21895 1497 31762 1718 1594 ----
NM_001003407chr1075113 4147 1138 523 514 359 50 34226 3519 1874 ----
NM_001003408chr1075113 4147 1138 523 514 359 50 34226 3519 1874 ----
NM_001003652chr1888193 3357 2432 2372 2318 1670 1608 1175 37486 882 93 --1435
NM_001004342chr144581 3819 1671 1232 25031 4037 15973 --
NM_001005375chrY61835 1668 1590 1454 1167 489 1628 ----
NM_001005502chr1275256 4941 1531 1132 1107 1070 649 34118 3423 221 --13406
NM_001006623chr261932 1832 1032 668 624 196 161 12316 --
NM_001007237chr162783 2512 1956 707 346 285 1516 ----
NM_001007466chr694200 4123 3650 3545 3155 3140 1462 1413 33 --14550 --
NM_001008408chr775910 5221 3997 2367 1796 1280 1254 --21933 1766 --
NM_001008491chr221994 129 11932 12043 --
NM_001008492chr221994 129 11932 12043 --
NM_001008707chr1451788 1383 1208 582 121 11644 ----
NM_001008738chr531842 1795 556 --22094 578 --
NM_001008925chr4--1916 32581 1387 1091 12559
NM_001009554chr484684 3993 3555 1807 1230 846 548 351 ------
NM_001009554chr484684 3993 3555 1807 1230 846 548 351 ------
NM_001010867chr165355 5177 1886 581 349 149 14149 34335 2222 612 14934
NM_001010891chr5126829 5716 5502 5473 4806 4597 2655 2537 1509 863 845 641 1412 ----
NM_001010895chr931703 387 164 --11814 --
NM_001011658chrX32102 1442 49 11624 --1541
NM_001011708chr232662 382 162 ----12463
NM_001012393chr11104584 2021 1533 1162 1156 967 877 832 618 558 34153 3967 841 14915 --
NM_001012751chr1021970 37 11194 198 1629
NM_001014797chr1036888 1984 1760 18143 21688 51 --
NM_001014812chr15------2447 437
NM_001017395chr352984 2645 2634 1088 74 2795 186 ----
NM_001017923chr1441610 536 280 39 11276 --187
NM_001017995chr594618 4472 4381 4148 3790 3209 1043 848 51 21635 795 24455 3638 23747 972
NM_001018054chr14439 330 324 249 ------
NM_001018067chr175262 4839 4747 4212 3485 1748 1602 24281 1925 ----
NM_001018068chr175262 4839 4747 4212 3485 1748 1602 24281 1925 ----
NM_001018069chr175262 4839 4747 4212 3485 1748 1602 24281 1925 ----
NM_001018074chr543774 2845 2672 403 22953 1116 --2940 321
NM_001018075chr543774 2845 2672 403 22953 1116 --2940 321
NM_001018076chr543774 2845 2672 403 22953 1116 --2940 321
NM_001018077chr543774 2845 2672 403 22953 1116 --2940 321
NM_001024094chr543774 2845 2672 403 22953 1116 --2940 321
NM_001024647chr1297693 7452 7334 6439 3027 2695 1781 1714 1176 14938 27363 414 11651
NM_001024688chr851588 1501 893 689 355 1551 12014 --
NM_001024855chr331910 1402 368 1561 ----
NM_001025076chr10116077 5699 5570 5425 4295 2152 2093 1965 1447 728 662 --24624 1323 --
NM_001025077chr10107435 7057 6928 6783 5653 2805 2086 2020 410 170 --35982 5103 2681 1936
NM_001025252chr852969 2635 2098 2057 26 11199 --13224
NM_001025253chr852969 2635 2098 2057 26 11199 --13224
NM_001025266chr383857 1619 1499 1406 1223 210 98 51 11938 ----
NM_001029863chr662271 1002 646 603 463 102 ------
NM_001030055chr1443927 3335 1740 564 24756 1022 ----
NM_001030287chr13354 322 97 158 1942 11121
NM_001032296chr1362797 2534 2164 1091 687 368 12731 22560 1168 --
NM_001033578chr8--1327 12302 11649
NM_001035511chr151441 642 613 128 43 11913 ----
NM_001035512chr151548 749 720 235 150 12020 ----
NM_001035513chr151548 749 720 235 150 12020 ----
NM_001037535chrX21359 1012 --21504 429 --
NM_001037536chrX21359 1012 --21504 429 --
NM_001037540chrX21359 1012 --21504 429 --
NM_001039547chr397535 7285 6479 6247 5268 2652 1818 999 915 23141 532 ----
NM_001039618chr1155961 5384 5053 4833 4814 11760 1532 --
NM_001039690chr1642231 2206 1852 926 ----11551
NM_001039693chr253388 2967 1444 1051 805 13705 11214 --
NM_001039840chrX75734 5252 5002 4949 4595 1682 336 24442 2319 ----
NM_001040144chr1642231 2206 1852 926 ----11551
NM_001040146chr1642231 2206 1852 926 ----11551
NM_001040152chr7104336 1621 1143 1028 968 914 850 838 593 509 --21085 989 21917 960
NM_001040284chr1644284 3677 2187 1824 1679 ----
NM_001040441chr144624 4066 1802 1145 --21462 161 --
NM_001040619chr11547 2508 420 11392 11571
NM_001040712chr973318 3273 2829 2547 2394 906 48 22379 1141 1801 --
NM_001042406chr64927 894 452 55 1839 ----
NM_001042492chr1742694 2664 2518 1330 33379 2970 733 12787 --
NM_001042494chr1563650 3294 2545 1115 524 152 1621 --12808
NM_001042495chr1563650 3294 2545 1115 524 152 1621 --12808
NM_001042496chr1563650 3294 2545 1115 524 152 1621 --12808
NM_001042497chr1563650 3294 2545 1115 524 152 1621 --12808
NM_001042533chr353274 2826 2707 2372 448 22674 624 ----
NM_001042537chrX42486 2478 1779 1600 170 ----
NM_001042555chr1274653 3074 2907 1265 1259 651 170 33493 3226 735 --14668
NM_001042599chr277736 7605 6137 5484 2846 2532 1069 21547 157 27017 1258 --
NM_001042603chr1284383 4134 4043 3894 3726 1966 1085 81 --13542 --
NM_001042604chr333337 3262 3148 1717 --24430 3682
NM_001042749chrX1646 ----11928
NM_001042750chrX1646 ----11928
NM_001042751chrX1646 ----11928
NM_001043318chr1453275 3000 1441 1428 1091 13582 14108 --
NM_001044385chr283598 3303 2883 2496 1584 938 772 585 1930 ----
NM_001083620chr442433 2223 2010 776 --22209 943 --
NM_001099678chr354906 1484 1247 286 155 55688 4485 2020 1968 1154 ----
NM_001100108chr177836 7004 5149 3344 2540 1092 125 33059 2498 412 17718 --
NM_001106chr387745 6519 6497 3851 2897 2154 1039 420 18997 ----
NM_001113490chrX53035 2804 2704 1160 199 12240 ----
NM_001173chr1443927 3335 1740 564 24756 1022 ----
NM_001186chr2133242 2167 2087 13234 ----
NM_001198chr61330 22311 681 --1511
NM_001204chr256501 6249 5249 2594 1891 13068 21961 413 --
NM_001241chr222159 620 11730 11931 185
NM_001241chr222159 620 11730 11931 185
NM_001256chr1732675 2117 616 ----12573
NM_001259chr736373 5212 858 45980 4323 2170 1338 25334 1112 --
NM_001304chr1783310 3059 2918 2673 2444 1480 720 185 ----23657 2597
NM_001310chr1232911 1959 98 ----1916
NM_001364chr1174664 4003 3456 1653 1589 1212 400 1273 14432 --
NM_001412chrX43344 3253 2481 406 ------
NM_001419chr1944811 3416 1733 1627 --11814 13967
NM_001432chr433822 3415 2394 13458 11547 13072
NM_001455chr653919 3699 3571 3478 3251 14176 --13105
NM_001527chr664092 3652 3402 1436 1413 891 14601 13465 --
NM_001542chr162783 2512 1956 707 346 285 1516 ----
NM_001616chr273205 2801 2632 2589 2360 1114 860 1887 ----
NM_001650chr1863692 3578 2718 2667 244 129 43452 2522 627 577 ----
NM_001674chr13354 322 97 158 1942 11121
NM_001754chr2142710 1722 1197 947 --14194 11586
NM_001759chr1235059 4917 4037 1631 11742 14761
NM_001821chr194561 4541 4306 4291 1430 1230 1172 849 613 2988 370 21953 1370 --
NM_001858chr675052 3600 1796 1657 876 337 242 24473 4050 24115 921 --
NM_001859chr943332 3259 2563 682 21448 462 13356 11493
NM_001874chr1275256 4941 1531 1132 1107 1070 649 34118 3423 221 --13406
NM_001918chr147715 3572 3319 1963 1783 28635 450 11305
NM_002006chr474238 1864 1724 766 238 224 130 24951 4041 1564 14912
NM_002025chrX88837 6824 3612 1815 1508 1024 473 431 36805 6656 310 27940 6185 --
NM_002035chr1863756 3657 3305 2824 2508 2442 ------
NM_002092chr454926 4681 3994 1224 314 11366 ----
NM_002126chr1723778 371 1797 --1722
NM_002128chr1352124 1644 1595 909 532 1742 --12585
NM_002137chr721781 767 --11634 12234
NM_002203chr563779 3628 3365 3335 2855 220 24065 2919 ----
NM_002210chr253014 2879 2862 1437 307 13432 ----
NM_002214chr774022 1994 1791 1664 869 315 148 14166 11319 --
NM_002228chr141177 916 907 401 ----1128
NM_002241chr172204 2036 1229 925 643 300 74 12746 1877 --
NM_002264chr353682 3310 1328 45 25 --14399 --
NM_002267chr1342042 1496 924 335 21865 706 ----
NM_002270chr585410 4752 3750 1780 1511 967 615 303 ------
NM_002313chr1075113 4147 1138 523 514 359 50 34226 3519 1874 ----
NM_002350chr84976 829 179 141 21226 1069 ----
NM_002387chr5124055 4037 3916 3672 1819 1806 1567 1528 369 201 141 29 33364 961 779 1192 --
NM_002480chr1211111 1414 --11063
NM_002485chr851588 1501 893 689 355 1551 12014 --
NM_002519chr1131184 619 371 ------
NM_002526chr661463 1273 1085 390 304 164 11298 ----
NM_002545chr11104584 2021 1533 1162 1156 967 877 832 618 558 34153 3967 841 14915 --
NM_002581chr965514 5325 4325 2179 1440 144 14265 22030 325 --
NM_002594chr2031964 1919 661 1821 ----
NM_002645chr1143023 2569 2339 2000 --1961 --
NM_002657chr2072969 2797 1406 1374 1278 1016 724 1386 2889 56 12744
NM_002709chr252689 2608 1256 826 237 1797 12696 12731
NM_002719chr1442132 1518 1510 658 ----1631
NM_002731chr163177 2932 2914 2823 268 96 --12157 --
NM_002737chr1795933 4806 4717 4126 4102 2517 1949 853 665 --26173 5864 --
NM_002740chr362850 2800 2272 1085 448 30 12577 ----
NM_002745chr2263613 1489 1372 1225 442 106 23505 3054 24571 4159 11155
NM_002839chr973318 3273 2829 2547 2394 906 48 22379 1141 1801 --
NM_002855chr11113405 3345 3305 3012 2569 2456 2372 719 315 108 66 33089 867 117 12848 --
NM_002874chr952176 2011 819 389 89 --11537 --
NM_002886chr364164 3631 1943 782 194 171 15146 --1669
NM_003001chr151548 749 720 235 150 12020 ----
NM_003099chr1566039 5029 1834 1569 1477 478 21940 194 25166 1015 --
NM_003108chr255741 5735 5360 5024 310 25871 4877 ----
NM_003137chr662102 2093 1676 1569 828 270 --1810 --
NM_003189chr163295 2852 2816 2532 2231 467 12730 --1457
NM_003246chr1532010 1354 684 1481 1290 11610
NM_003298chr335461 4889 3821 36228 4411 1657 25153 3762 14139
NM_003350chr84786 367 248 46 11039 ----
NM_003390chr112416 401 ----1337
NM_003410chrX52282 1042 887 852 325 --11216 --
NM_003412chr343130 2915 989 905 12515 --1233
NM_003413chrX41896 1486 1249 610 ------
NM_003463chr642700 2643 2491 360 12295 --12927
NM_003478chr1122537 1260 21222 884 1283 --
NM_003482chr1282579 2458 2372 2255 1082 1076 310 40 ------
NM_003559chr17123782 3622 3572 3339 2910 2808 1161 974 886 461 409 290 ------
NM_003574chr1875176 4282 3971 3748 1619 1468 68 --14710 --
NM_003576chr1362797 2534 2164 1091 687 368 12731 22560 1168 --
NM_003583chr1263611 2798 867 594 531 109 13504 ----
NM_003590chr273652 3406 3344 2910 843 567 39 --1760 --
NM_003617chr143239 694 153 110 13544 --13264
NM_003671chr943140 2747 774 635 1265 21191 280 1541
NM_003774chr1243079 2567 2364 621 --1172 --
NM_003822chr153196 2502 2121 732 89 12241 1474 --
NM_003966chr5117323 5457 5388 4863 4843 2475 1907 1742 1294 67 55 21050 491 ----
NM_003994chr1224033 139 23222 2765 ----
NM_004024chr11456 2417 329 11301 11480
NM_004028chr1863692 3578 2718 2667 244 129 43452 2522 627 577 ----
NM_004079chr142965 1977 978 388 --175 --
NM_004081chrY61835 1668 1590 1454 1167 489 1628 ----
NM_004094chr1442541 2459 2087 861 21857 1202 12936 --
NM_004109chr1141654 733 312 39 12253 ----
NM_004171chr1189085 8610 8459 7949 2838 2818 2230 46 38890 3233 1084 ----
NM_004232chr1831554 877 313 13784 12739 --
NM_004274chr1443024 2932 2611 1297 21129 493 ----
NM_004404chr221994 129 11932 12043 --
NM_004423chr362745 2551 2378 1872 225 93 12427 ----
NM_004434chr1451788 1383 1208 582 121 11644 ----
NM_004464chr452658 1186 1126 1089 440 ------
NM_004480chr141209 --1232 1683
NM_004500chr1431705 1535 46 1818 ----
NM_004501chr163783 3763 3530 2663 765 320 ------
NM_004586chrX75212 3630 3454 3348 1654 1472 429 24180 1998 35384 1792 116 --
NM_004598chr522946 367 21065 121 --12794
NM_004631chr14439 330 324 249 ------
NM_004655chr1721155 1149 ----11274
NM_004745chr886277 5974 5662 5583 2609 2027 954 683 56550 5812 1985 1973 1427 ----
NM_004748chr1533997 1601 545 21373 583 ----
NM_004768chr13961 785 141 ------
NM_004772chr541204 646 466 459 ----11562
NM_004775chr1852383 1958 825 670 98 11730 ----
NM_004788chr1142270 2214 960 782 12083 ----
NM_004815chr124698 3120 33595 3024 1533 ----
NM_004857chr1444751 3722 1052 77 14350 13522 --
NM_004859chr1772657 2487 2125 1904 685 667 57 22951 885 ----
NM_004866chr563399 3348 1718 1541 196 40 2770 172 13050 --
NM_004898chr442514 2355 2214 61 ------
NM_004956chr753382 1803 1659 1422 410 23777 989 11032 --
NM_004975chr202931 615 --1973 1666
NM_004976chr11133972 3788 3742 3349 3332 3178 1852 1792 1461 1260 1106 551 179 14460 ----
NM_004985chr1243950 3150 1778 1578 33358 247 95 ----
NM_004992chrX128475 7702 7318 6920 6433 5339 5263 2994 2689 2103 1781 414 16899 13381 11328
NM_004992chrX128475 7702 7318 6920 6433 5339 5263 2994 2689 2103 1781 414 16899 13381 11328
NM_005056chr1284627 4378 4287 4138 3970 2210 1329 325 --13786 --
NM_005076chr1104033 3983 3808 3666 3535 2690 1399 1099 135 120 1568 ----
NM_005079chr852969 2635 2098 2057 26 11199 --13224
NM_005121chr1712400 --22634 303 12953
NM_005135chr1563650 3294 2545 1115 524 152 1621 --12808
NM_005164chr1242174 1932 1620 759 22588 803 --1718
NM_005188chr1187731 7551 7406 7212 6949 6795 5641 1908 57136 6133 5325 514 57 ----
NM_005207chr2253124 2946 2484 1247 1036 --11358 13367
NM_005235chr277736 7605 6137 5484 2846 2532 1069 21547 157 27017 1258 --
NM_005359chr1852223 2118 1852 1391 1276 1889 12554 --
NM_005374chr1762234 2022 269 231 218 199 --32167 1599 207 --
NM_005399chr123960 3507 34030 2978 2861 ----
NM_005436chr1052722 2561 774 652 132 33149 2772 58 --1525
NM_005494chr71262 ----1116
NM_005497chr1795426 4394 4377 2445 2324 2083 1911 1824 931 11031 24987 4632 --
NM_005502chr952894 2649 440 255 249 12469 22509 900 --
NM_005504chr12106015 5200 4980 2515 1995 1575 775 693 436 227 26024 5352 1721 --
NM_005509chr531213 370 34 --11594 --
NM_005669chr542294 1456 739 38 ------
NM_005746chr722513 2479 ----12734
NM_005789chr1732033 1963 767 --31709 1434 821 --
NM_005813chr241884 1674 982 898 12415 --12515
NM_005828chr1775064 4129 3983 3109 1297 863 344 34305 1524 366 ----
NM_005840chrX147596 7530 7434 7407 7274 6765 6611 6231 5947 5139 2887 2673 2399 816 27603 2741 17617 --
NM_005880chr1611502 ----11578
NM_005898chr1132696 2305 244 ------
NM_005901chr1888193 3357 2432 2372 2318 1670 1608 1175 37486 882 93 --1435
NM_005903chr554986 3480 1872 1735 941 1723 23593 3408 --
NM_005909chr564174 3472 2825 1694 454 232 ------
NM_005941chr864128 4077 2992 1464 1004 273 --14180 --
NM_006033chr1831939 1790 337 32321 1799 52 ----
NM_006037chr244717 4559 4019 432 --23274 3266 11492
NM_006055chr221168 1131 ----2552 190
NM_006060chr764004 3747 3304 1773 1660 1092 --23590 531 12969
NM_006094chr831741 404 344 --1386 --
NM_006155chr221994 129 11932 12043 --
NM_006203chr565019 4911 4211 1314 1072 140 ------
NM_006212chr165166 5035 4083 3736 1005 114 --24508 3971 --
NM_006283chr854931 4709 3270 1599 75 34452 3447 3033 ----
NM_006306chrX104658 4370 3932 1977 1881 1368 1254 940 348 310 24690 1443 24321 480 --
NM_006359chrX42486 2478 1779 1600 170 ----
NM_006378chr961259 1094 1076 1063 1052 82 ----11444
NM_006393chr1053311 3035 1115 112 40 2854 471 14179 --
NM_006482chr1263611 2798 867 594 531 109 13504 ----
NM_006520chrX31584 1049 54 ----1307
NM_006544chr1415122 35667 5521 2311 --24864 3893
NM_006547chr742090 1723 113 87 2559 487 12055 --
NM_006561chr10116077 5699 5570 5425 4295 2152 2093 1965 1447 728 662 --24624 1323 --
NM_006599chr16107538 7260 7159 6714 5516 5302 2605 2520 1517 577 ----17447
NM_006603chrX1646 ----11928
NM_006609chr222078 31 1320 --1489
NM_006618chr121588 514 ----2379 97
NM_006621chr141404 1287 330 304 21624 144 21766 437 --
NM_006624chr1021339 804 --11541 11569
NM_006654chr1274653 3074 2907 1265 1259 651 170 33493 3226 735 --14668
NM_006670chr6------1419
NM_006691chr112827 456 11100 1325 --
NM_006699chr122547 2193 1684 1551 --
NM_006720chr1075113 4147 1138 523 514 359 50 34226 3519 1874 ----
NM_006746chrX21359 1012 --21504 429 --
NM_006750chr16107660 7153 7103 7093 7033 6513 6383 4910 3071 2092 32736 1111 348 17592 --
NM_006838chr1221867 121 1292 11313 --
NM_006896chr761097 461 395 346 309 157 --1354 --
NM_006956chr742335 1517 814 611 ------
NM_007007chr1264458 4010 3282 3207 1605 704 --14218 11452
NM_007106chr1322346 2031 32556 2410 2238 ----
NM_007114chr352832 2598 2546 2258 668 12439 22097 679 --
NM_007249chr1389092 8426 6377 6089 5706 2140 934 203 --28822 8377 --
NM_007250chrX1393 ----1417
NM_007375chr132508 2473 1078 22253 2240 ----
NM_012104chr1153297 3015 953 403 185 --32776 1474 826 --
NM_012104chr1153297 3015 953 403 185 --32776 1474 826 --
NM_012157chr32978 320 1934 1286 --
NM_012164chr997478 6886 6432 5719 5227 2108 1996 1821 716 35704 5422 2589 14925 14842
NM_012193chr1144685 2024 1849 1502 11076 32012 658 641 11459
NM_012199chr174559 4126 3618 3471 3358 1363 821 23202 2837 23581 284 --
NM_012288chr685588 5486 4596 4477 4352 4107 3584 1949 --15232 --
NM_012334chr5113903 3644 3605 3497 3413 3128 2919 1515 1295 105 80 ------
NM_012382chr543583 3366 1771 946 ----11597
NM_012405chr173583 3511 2801 2527 1447 576 404 11535 ----
NM_013231chr1454388 3753 3732 3195 1258 ------
NM_013238chr1331802 713 385 11764 --11727
NM_013257chr8--1327 12302 11649
NM_013316chr731034 751 115 ------
NM_013341chr232662 382 162 ----12463
NM_013374chr352400 1137 928 154 102 1980 22481 2188 --
NM_014048chr1664740 3872 3385 1042 681 284 --14211 1845
NM_014106chr1522344 2308 1365 22337 997 --
NM_014112chr845425 1206 701 634 23506 117 1751 --
NM_014155chr11107361 5912 5338 4705 2885 2763 2255 2193 1286 874 11946 26933 1455 --
NM_014181chr222123 186 22748 545 --11792
NM_014231chr1271922 1665 1540 1463 541 346 256 21626 211 2376 334 --
NM_014240chr3133574 3552 3504 3466 3297 2831 2631 1495 783 664 573 430 233 21059 437 ----
NM_014331chr475580 5126 5101 2646 1590 554 248 36110 2032 34 ----
NM_014372chr121753 1326 --11609 11360
NM_014388chr1125947 5758 5640 4792 4484 4379 2219 2158 1953 1442 1409 685 --14845 --
NM_014423chr574608 4543 4458 2167 1888 1378 1333 25225 445 --11241
NM_014563chrX32102 1442 49 11624 --1541
NM_014572chr1351704 486 360 284 62 11635 11526 --
NM_014607chr241861 1344 454 292 11368 ----
NM_014701chr1532213 1071 973 12915 --1928
NM_014702chr643300 2803 403 335 --1482 --
NM_014721chr685045 4789 4674 4579 2299 1856 1445 219 1711 ----
NM_014751chr821867 133 11500 1874 --
NM_014752chr1121596 1339 11606 1293 11203
NM_014757chr551969 1461 869 813 229 2362 276 11654 --
NM_014774chr152934 1046 819 590 75 43037 2571 1181 50 ----
NM_014803chr1042538 2203 229 102 22904 1161 ----
NM_014810chr173083 2770 2515 1375 809 767 192 12909 ----
NM_014829chr52693 167 ----1902
NM_014839chr122234 1905 22071 150 ----
NM_014844chr1454154 2581 807 763 269 --22571 1387 12594
NM_014877chr1747163 5468 2065 977 27520 1912 12741 --
NM_014906chr1753602 3073 2729 2564 808 13469 ----
NM_014912chr1043097 2752 974 257 22402 909 ----
NM_014942chr652062 1973 1789 1615 161 21886 73 ----
NM_014953chr1343875 3709 1542 228 --13367 --
NM_014982chr1464878 4774 4729 3401 1924 1288 --11583 21567 1081
NM_014988chr441880 1127 1111 643 32854 733 106 ----
NM_014991chr473308 2739 2603 2178 771 650 337 ------
NM_014997chr752909 2599 2515 1072 286 --1235 --
NM_015008chr352984 2645 2634 1088 74 2795 186 ----
NM_015035chr20145748 5437 4638 4275 4127 2488 2036 1636 1143 644 567 538 472 178 22452 1190 15693 12649
NM_015049chr233278 3207 3122 12460 1526 12982
NM_015068chr733188 1057 473 1959 --1769
NM_015071chr575732 5183 4439 2440 2107 1349 277 14754 142 --
NM_015074chr184641 3700 3634 3223 1702 1523 880 177 ------
NM_015076chr624276 3589 11027 --13987
NM_015090chr175939 5596 5467 5377 4593 4343 871 14052 43787 2268 1591 1286 --
NM_015132chr731888 1472 1255 ----1713
NM_015208chr18187 ----23531 2539
NM_015271chr463379 3287 2847 1579 930 21 1168 13629 --
NM_015277chr1841445 1280 640 515 11255 ----
NM_015288chr593746 3737 2472 1547 727 622 501 486 262 13159 2790 669 --
NM_015313chr1183812 3803 3680 3522 1670 1580 1132 211 --2651 150 --
NM_015315chr583121 2835 2656 2298 2114 487 455 171 1948 22213 69 11110
NM_015321chr19114904 4650 4563 4529 4211 3830 3797 3444 3356 2981 1021 --24748 4410 --
NM_015352chr2043763 3178 2415 956 22464 858 --1435
NM_015393chr482820 1474 972 933 661 598 77 58 11078 13802 --
NM_015535chr241657 638 529 250 11547 22549 1168 --
NM_015550chr753473 3323 1157 679 415 22807 435 12797 --
NM_015553chr694533 4388 4223 4073 3888 3398 1567 840 362 34440 906 751 11548 --
NM_015569chr164106 3128 1521 1143 1001 456 --14819 --
NM_015571chr621904 92 ----1266
NM_015575chr253346 2567 2480 2417 78 13680 --21236 503
NM_015640chr175262 4839 4747 4212 3485 1748 1602 24281 1925 ----
NM_015879chr18117819 7683 7472 6240 6196 3242 2891 2826 1060 1035 44 --36286 2117 1109 --
NM_015886chr865347 4089 3671 3617 1486 521 15618 ----
NM_015888chr132982 531 70 11034 1665 --
NM_015906chr184441 3965 3449 3372 3206 1645 1230 613 23318 1944 ----
NM_015982chr17384 78 72 ------
NM_016021chr623052 389 1370 11972 --
NM_016040chr142012 1808 1110 359 22029 442 ----
NM_016152chr33453 178 37 1402 ----
NM_016169chr1053111 2956 2467 2218 318 1446 22592 1134 --
NM_016206chr368818 7776 3590 2736 1851 1819 12023 18337 --
NM_016221chr542322 1567 1464 775 --1105 --
NM_016248chr1323479 3328 ----1318
NM_016257chr182662 2617 2583 2169 2151 799 572 205 1132 ----
NM_016260chr232927 2800 1318 15791 --15886
NM_016315chr221485 1334 11189 11207 --
NM_016396chr1532481 1023 104 12965 12609 21079 134
NM_016472chr1411525 ----1367
NM_016526chr1162479 2443 1856 1597 907 252 --1867 --
NM_016531chr443624 967 885 838 22800 1021 1379 --
NM_016603chr511692 ----11800
NM_017415chr553414 1775 1020 729 177 ----12766
NM_017423chr461381 805 791 773 642 30 ------
NM_017522chr14439 330 324 249 ------
NM_017563chr356375 4899 1668 1471 846 14878 ----
NM_017582chr121603 330 ----1200
NM_017628chr465236 4208 3938 3765 3441 1492 13697 ----
NM_017633chr6--2753 224 --12755
NM_017634chr841711 1269 724 624 ------
NM_017637chr989227 8700 7789 3428 3418 2137 1261 267 27004 1769 23138 394 --
NM_017643chr1742157 2060 2049 408 ------
NM_017644chr384702 3199 1164 900 889 663 492 245 ------
NM_017650chr743903 3734 1402 575 35797 1004 871 ----
NM_017658chr1444523 4441 4183 718 ------
NM_017709chr143857 2871 2617 245 13487 1150 --
NM_017848chrX53313 1747 772 515 385 11125 13992 --
NM_017849chr2103076 2516 2432 1273 1252 836 550 392 209 165 ------
NM_017902chr1085370 4674 4304 3773 1823 1776 1176 214 --1884 --
NM_017938chrX21553 617 21704 1667 ----
NM_017944chr1122519 2058 ----21208 157
NM_017952chr264298 3942 1377 917 892 681 --23536 2773 --
NM_018098chr31829 21225 51 1364 --
NM_018155chr353281 3148 2982 1220 872 1355 11348 --
NM_018241chr431023 966 55 2725 231 ----
NM_018246chr872000 1852 1744 882 260 159 121 ------
NM_018263chr262447 2050 1743 1733 878 535 ------
NM_018266chr34930 716 310 153 1960 1944 --
NM_018314chr113679 243 216 1190 ----
NM_018351chr1274278 4254 3786 3620 3554 1593 597 44105 4039 3780 2917 12887 --
NM_018373chr1466329 4641 4092 1448 442 119 ------
NM_018374chr734973 3229 407 1625 1991 13679
NM_018375chr144603 415 327 73 1591 ----
NM_018433chr21127 ----1112
NM_018440chr8128562 8498 7386 7149 6311 5268 3221 2114 1310 980 562 202 25734 5279 ----
NM_018490chr111317 1425 11873 --
NM_018566chr173710 3262 3110 2037 1728 726 581 ------
NM_018710chr831371 1119 875 21030 849 11285 --
NM_018945chr633345 2944 478 32553 1001 692 --1590
NM_019001chr333337 3262 3148 1717 --24430 3682
NM_019036chr64927 894 452 55 1839 ----
NM_019067chrX74719 3239 3077 1795 1487 1146 1044 --24281 1740 --
NM_019072chr543573 3341 1649 74 14230 1944 14109
NM_019083chr141651 1527 1294 228 11232 ----
NM_019555chr321279 142 1516 11224 1251
NM_019590chr1031176 225 189 1219 11027 --
NM_019600chr153658 556 30 1310 --138
NM_020116chr431355 1164 200 11506 ----
NM_020117chr51900 ----1356
NM_020119chr753928 1057 901 459 187 13502 --23839 2510
NM_020338chr1083734 3260 2851 1485 1248 836 251 85 156 ----
NM_020340chr641908 1668 648 334 --1734 --
NM_020420chrY61835 1668 1590 1454 1167 489 1628 ----
NM_020432chr73815 793 253 1868 ----
NM_020443chr175573 5554 4654 4373 2507 218 166 --25689 1545 --
NM_020466chr654487 4178 3855 1405 798 13679 11723 --
NM_020647chr811857 ----12159
NM_020718chr1696304 5591 5148 4369 4257 1203 582 265 113 --23994 1876 --
NM_020727chr2153755 3538 3390 2957 21 11338 11555 --
NM_020739chr1533997 1601 545 21373 583 ----
NM_020751chr1321317 981 31273 885 409 ----
NM_020772chr17108603 8398 8104 7834 5385 5333 5235 2722 1945 1446 37716 6565 6261 1851 --
NM_020787chr1751030 992 525 477 236 ------
NM_020803chr462351 2106 2084 2078 1677 254 --1414 1791
NM_020858chr1542231 2016 899 73 --41786 638 616 303 1798
NM_020921chr1432986 2710 178 1636 ----
NM_020922chrX21895 1497 31762 1718 1594 ----
NM_020948chr143581 1365 882 325 11461 ----
NM_020956chr19154755 4520 4019 3950 3862 3848 3769 3701 3207 2902 1573 1460 1388 1127 1118 33384 3009 1698 11178 23087 1518
NM_020964chr1874287 4004 3772 3060 639 406 239 24074 1272 ----
NM_021038chr31311 12346 23159 2224 --
NM_021116chr778923 7004 6670 6601 2636 1221 424 13177 --17120
NM_021132chr101902 ----1940
NM_021148chr742122 1810 872 320 21554 653 12328 --
NM_021183chrX12480 3876 380 360 1853 --
NM_021202chr2072259 2183 2107 1230 896 604 216 --12032 --
NM_021255chr1444073 3016 1450 740 ------
NM_021629chr344884 4236 837 774 34800 3565 1807 1263 14406
NM_021638chr495021 4053 3795 3763 3482 533 520 85 54 --14811 --
NM_021647chr484684 3993 3555 1807 1230 846 548 351 ------
NM_021813chr695756 5474 4751 4105 1802 1397 476 211 153 ------
NM_021912chr1543785 3091 2913 737 21686 890 1222 --
NM_021961chr1187321 7147 5933 2240 1928 1504 1414 117 15685 --16007
NM_021964chr366359 5410 2396 1760 1685 358 14147 34093 4022 1131 14757
NM_021977chr683898 3316 3243 2848 997 890 142 35 ------
NM_022048chr1585713 5705 2259 2016 1365 498 246 53 21741 112 ----
NM_022091chr662747 2121 2015 1979 1817 848 12169 ----
NM_022351chr842958 2542 993 583 ------
NM_022456chr1297693 7452 7334 6439 3027 2695 1781 1714 1176 14938 27363 414 11651
NM_022459chr1396292 5279 5074 4139 4132 2148 2119 1209 1087 --25063 4359 --
NM_022831chr151659 1640 1525 1222 598 --21653 110 --
NM_022912chr232780 1906 35 11925 12033 12316
NM_024052chr1772729 2303 2197 725 462 304 73 11069 12502 --
NM_024408chr161341 1184 1155 1005 600 361 --13009 --
NM_024569chr152496 1077 601 540 88 12468 2316 200 --
NM_024834chr1021687 1223 ----11335
NM_024930chr582381 1949 1812 1707 1066 990 313 68 22543 2318 ----
NM_024947chr3128378 7444 7339 7259 6543 6458 3741 3538 2281 2205 2016 1174 37736 6507 2817 ----
NM_024989chr297560 7466 6799 6697 6229 2854 1394 1264 426 21529 1306 47482 5484 5089 1407 --
NM_025054chr853120 2708 1262 1161 183 ------
NM_025073chr194562 3594 3588 3353 1618 1189 1135 1086 631 11031 14006 --
NM_025138chr1331480 913 472 11298 1484 --
NM_025146chr332566 2386 1995 1953 ----
NM_025208chr1132037 1759 620 31798 584 197 ----
NM_030623chr241546 1529 1450 134 ----11727
NM_030627chr531511 1146 961 11590 ----
NM_030647chr765842 5238 4935 4770 1612 682 --12272 --
NM_030674chr1292080 1936 1882 1648 1371 1238 1116 408 275 35306 1922 567 --1997
NM_030786chr141809 694 81 68 ------
NM_030791chr1431477 1194 581 2346 53 1220 --
NM_030816chr163502 2945 2374 1306 1158 663 --23302 2389 --
NM_031243chr721781 767 --11634 12234
NM_031314chr1431705 1535 46 1818 ----
NM_031442chrX63082 2801 2667 2643 994 746 1432 ----
NM_031461chr821987 760 1582 1903 --
NM_031483chr2043478 3446 2954 166 ------
NM_031844chr163783 3763 3530 2663 765 320 ------
NM_031890chr225850 652 645 281 262 12280 --12188
NM_031954chr1232723 2472 2015 22805 2258 12001 --
NM_032012chr963484 3428 1600 1265 830 277 ------
NM_032153chr372554 2544 2140 1879 1854 1048 756 --12188 1340
NM_032160chr1854036 3912 3851 3649 394 23592 3025 ----
NM_032189chr1354426 3869 1730 1497 483 1405 14778 --
NM_032217chr431303 490 176 ----11355
NM_032226chr93603 250 154 1751 ----
NM_032231chr151103 ----2323 313
NM_032291chr141899 1768 1627 249 ----11788
NM_032321chr232965 979 729 1381 ----
NM_032436chr131965 ----1312
NM_032446chr562957 2801 2466 2439 389 239 ----11111
NM_032449chr132459 1779 931 41045 403 63 51 11061 22781 2116
NM_032457chr443639 1547 1242 628 --1976 --
NM_032778chr353274 2826 2707 2372 448 22674 624 ----
NM_032826chr764890 4358 3810 667 324 95 12101 ----
NM_032859chr1333381 3352 88 --1974 --
NM_032869chr852002 1450 604 337 51 --1370 --
NM_032968chrX44126 3436 1390 449 1412 ----
NM_032969chrX44126 3436 1390 449 1412 ----
NM_032973chrY34118 3432 449 1412 ----
NM_033020chr184441 3965 3449 3372 3206 1645 1230 613 23318 1944 ----
NM_033135chr1132037 1759 620 31798 584 197 ----
NM_033143chr482989 2912 1517 1457 1420 771 165 45 ------
NM_033211chr522055 71 ----1382
NM_033224chr7137655 7442 6750 6269 6082 5715 2462 2183 1966 1267 1062 531 365 --17762 --
NM_033300chr14439 330 324 249 ------
NM_033331chr943140 2747 774 635 1265 21191 280 1541
NM_033360chr1234071 3271 1699 33479 368 216 ----
NM_033380chrX51074 853 411 294 169 ------
NM_033381chrX51074 853 411 294 169 ------
NM_033551chr583121 2835 2656 2298 2114 487 455 171 1948 22213 69 11110
NM_033631chr153861 660 648 457 421 22454 442 1894 --
NM_033656chr2145774 5752 2394 1349 14082 25372 500 --
NM_052885chr1255001 4615 1778 751 302 1886 1284 13642
NM_052900chr831566 1172 226 --11356 --
NM_052954chr2151949 1540 1474 531 65 ------
NM_053016chr997133 6972 5602 2396 2226 1825 1488 674 40 17201 15968 --
NM_053024chr351147 423 344 221 134 1454 ----
NM_053043chr775910 5221 3997 2367 1796 1280 1254 --21933 1766 --
NM_058241chr232059 935 520 11630 11831 --
NM_058241chr232059 935 520 11630 11831 --
NM_078469chr1031246 524 339 ----11275
NM_080546chr922138 213 ----1373
NM_080669chr1783935 3594 3565 1570 1503 570 454 281 --13789 13165
NM_080867chr1454925 3851 1924 1466 1312 14065 11961 11000
NM_130391chr973318 3273 2829 2547 2394 906 48 22379 1141 1801 --
NM_130392chr973318 3273 2829 2547 2394 906 48 22379 1141 1801 --
NM_130393chr973318 3273 2829 2547 2394 906 48 22379 1141 1801 --
NM_130809chr532899 2333 70 ----1226
NM_133265chrX53035 2804 2704 1160 199 12240 ----
NM_133372chr531842 1795 556 --22094 578 --
NM_133496chr164579 3495 3257 832 560 339 14057 174 1613
NM_133647chr1563650 3294 2545 1115 524 152 1621 --12808
NM_138381chr352244 1833 615 572 44 --11550 11670
NM_138459chr633107 1090 561 1938 ----
NM_138468chr2115980 5351 4874 4795 4588 2356 2127 2034 1834 1263 907 15428 ----
NM_138492chr54578 465 390 304 11180 21005 24 --
NM_138713chr16107538 7260 7159 6714 5516 5302 2605 2520 1517 577 ----17447
NM_138714chr16107538 7260 7159 6714 5516 5302 2605 2520 1517 577 ----17447
NM_138731chr1411319 1196 11427 14263
NM_138971chr1153297 3015 953 403 185 --32776 1474 826 --
NM_138971chr1153297 3015 953 403 185 --32776 1474 826 --
NM_138972chr1153297 3015 953 403 185 --32776 1474 826 --
NM_138972chr1153297 3015 953 403 185 --32776 1474 826 --
NM_138973chr1153297 3015 953 403 185 --32776 1474 826 --
NM_138973chr1153297 3015 953 403 185 --32776 1474 826 --
NM_139207chr1242078 1820 1369 161 ------
NM_139283chr1242245 969 954 458 1785 ----
NM_144567chr162828 2670 2486 2102 1876 785 12615 --1486
NM_144578chr1464289 3771 3725 3686 2209 904 24310 3539 11463 --
NM_144599chr1554029 3704 1403 1376 1293 ----24454 1820
NM_144628chr2043069 3009 2740 583 12868 12456 12006
NM_145037chr321166 182 1197 --11493
NM_145259chr246285 5655 4761 4545 16459 1128 --
NM_145320chr753473 3323 1157 679 415 22807 435 12797 --
NM_145321chr753473 3323 1157 679 415 22807 435 12797 --
NM_145322chr753473 3323 1157 679 415 22807 435 12797 --
NM_145912chr2273650 3340 3113 1266 488 311 214 1910 44073 1401 1179 956 --
NM_147156chr1041488 1305 1114 455 21086 1027 ----
NM_148955chr1566039 5029 1834 1569 1477 478 21940 194 25166 1015 --
NM_152388chr283598 3303 2883 2496 1584 938 772 585 1930 ----
NM_152424chrX104589 3714 3402 3278 3143 1860 1853 1235 475 204 12955 23908 3848 --
NM_152520chr221242 94 ----1432
NM_152527chr22657 40 32054 1480 854 --12352
NM_152556chr742331 2086 1846 261 2820 665 ----
NM_152624chr537250 7243 5016 21022 412 21332 1152 12680
NM_152641chr1212098 32185 2069 394 11008 11828
NM_152699chr343683 3059 2721 1296 --12663 13741
NM_152733chr6116259 5750 4874 4803 4603 4093 2074 1960 1857 967 758 26359 200 15571 11024
NM_152758chr81780 ----13024
NM_152787chrX33920 3314 1537 23740 3189 ----
NM_152826chr1566039 5029 1834 1569 1477 478 21940 194 25166 1015 --
NM_152873chr1021139 357 ----1690
NM_152877chr1021139 357 ----1690
NM_153182chr353274 2826 2707 2372 448 22674 624 ----
NM_153188chr585410 4752 3750 1780 1511 967 615 303 ------
NM_153207chr1263012 2573 1365 743 396 219 23449 2946 13207 --
NM_153240chr3133 ----1218
NM_153456chr1365739 5350 4778 1929 154 68 44478 1956 1552 1521 ----
NM_153616chr1542231 2016 899 73 --41786 638 616 303 1798
NM_153617chr1542231 2016 899 73 --41786 638 616 303 1798
NM_153618chr1542231 2016 899 73 --41786 638 616 303 1798
NM_153619chr1563469 3254 1311 1023 987 520 --13024 --
NM_153705chr1161950 1026 987 929 157 30 12017 --11932
NM_170709chr8--1327 12302 11649
NM_170710chr432450 2384 1976 ------
NM_170719chr1331480 913 472 11298 1484 --
NM_172071chr167286 6575 2804 2233 1624 398 12917 14969 --
NM_173214chr16107538 7260 7159 6714 5516 5302 2605 2520 1517 577 ----17447
NM_173491chr541055 388 71 63 --1398 --
NM_173495chrX41670 1030 1016 639 21763 344 ----
NM_173496chr1042881 2588 1929 636 --12292 --
NM_173536chr444300 1724 921 225 24954 1718 23421 3336 --
NM_173595chr12145207 4894 4044 3624 3432 3338 1996 1666 1535 912 637 584 408 218 11640 35065 4735 1069 --
NM_173602chr1263653 3354 2770 2414 1041 447 --11281 11424
NM_173642chr199085 8909 8801 3024 2021 1706 1452 1100 1059 26862 1436 18022 1351
NM_173694chrX32281 2203 579 11595 ----
NM_175623chr1297693 7452 7334 6439 3027 2695 1781 1714 1176 14938 27363 414 11651
NM_175736chr12127847 7671 6997 6617 6580 5475 5138 3047 2797 1087 555 499 47062 6810 6246 5466 ----
NM_175854chr1322641 2587 22472 179 ----
NM_175861chr1245884 4735 3829 1069 15577 23712 1864 --
NM_175876chr162683 2636 2294 520 472 122 --12303 --
NM_176863chr1732033 1963 767 --31709 1434 821 --
NM_178151chrX56823 5213 5164 437 329 37496 6532 2605 26054 833 --
NM_178152chrX56823 5213 5164 437 329 37496 6532 2605 26054 833 --
NM_178153chrX56823 5213 5164 437 329 37496 6532 2605 26054 833 --
NM_178154chr141209 --1232 1683
NM_178155chr141209 --1232 1683
NM_178156chr141209 --1232 1683
NM_178157chr141209 --1232 1683
NM_178539chr1251610 1395 760 590 370 ------
NM_178585chr473308 2739 2603 2178 771 650 337 ------
NM_178586chr1442132 1518 1510 658 ----1631
NM_181265chr432450 2384 1976 ------
NM_181504chr573732 2831 2699 1618 1598 1222 855 23689 2669 --13492
NM_181523chr573732 2831 2699 1618 1598 1222 855 23689 2669 --13492
NM_181524chr573732 2831 2699 1618 1598 1222 855 23689 2669 --13492
NM_181672chrX52007 1632 1505 1399 99 ------
NM_181673chrX52007 1632 1505 1399 99 ------
NM_181714chr62623 586 --21983 569 --
NM_181836chr522093 108 12056 1774 --
NM_181846chr1952825 2805 1111 606 449 12965 --13002
NM_182643chr831741 404 344 --1386 --
NM_182767chr1261948 1816 1751 1588 694 258 ------
NM_182907chr61330 22311 681 --1511
NM_182948chr163177 2932 2914 2823 268 96 --12157 --
NM_182972chr142817 2357 2112 1901 22472 87 ----
NM_194278chr1453275 3000 1441 1428 1091 13582 14108 --
NM_194434chr1875176 4282 3971 3748 1619 1468 68 --14710 --
NM_198081chr672750 2687 2443 2373 2044 860 434 2823 321 12586 1794
NM_198123chr831566 1172 226 --11356 --
NM_198124chr831566 1172 226 --11356 --
NM_198215chr101539 11249 --1347
NM_198270chrX43486 1266 1138 45 11194 ----
NM_198273chr522792 2046 21153 69 ----
NM_198320chr1275256 4941 1531 1132 1107 1070 649 34118 3423 221 --13406
NM_198465chrX52871 2821 2364 516 202 21900 912 ----
NM_198578chr1211122 --2285 91 1273
NM_198595chr495021 4053 3795 3763 3482 533 520 85 54 --14811 --
NM_198715chr186297 5927 5408 4595 4081 2124 1596 801 25955 659 ----
NM_198889chr431303 490 176 ----11355
NM_198900chr12127847 7671 6997 6617 6580 5475 5138 3047 2797 1087 555 499 47062 6810 6246 5466 ----
NM_199131chr1042990 2473 2310 2222 --13648 --
NM_199245chr1272328 2071 1946 1869 947 752 662 22032 617 2782 740 --
NM_199421chr1454925 3851 1924 1466 1312 14065 11961 11000
NM_201559chr653919 3699 3571 3478 3251 14176 --13105
NM_201570chr1041768 1443 703 456 11815 --1335
NM_201571chr1041768 1443 703 456 11815 --1335
NM_201572chr1041768 1443 703 456 11815 --1335
NM_201590chr1041768 1443 703 456 11815 --1335
NM_201593chr1041768 1443 703 456 11815 --1335
NM_201596chr1041768 1443 703 456 11815 --1335
NM_201597chr1041768 1443 703 456 11815 --1335
NM_203282chr1911693 21422 362 --1112
NM_203390chr831779 1564 1543 1381 ----
NM_203458chr163827 2445 1420 1056 198 129 --12941 --
NM_203463chr274922 4766 4562 4102 1607 1549 315 --1486 --
NM_205846chr54578 465 390 304 11180 21005 24 --
NM_205860chr153196 2502 2121 732 89 12241 1474 --
NM_206866chr2133242 2167 2087 13234 ----
NM_206876chr252689 2608 1256 826 237 1797 12696 12731
NM_207015chr321821 246 12259 12115 --
NM_207292chr31311 12346 23159 2224 --
NM_207293chr31311 12346 23159 2224 --
NM_207294chr31311 12346 23159 2224 --
NM_207295chr31311 12346 23159 2224 --
NM_207296chr31311 12346 23159 2224 --
NM_207297chr31336 12371 23184 2249 --
NM_207406chr486274 5536 5303 5098 4161 2427 1080 362 12086 15312 1135
NM_212558chr954095 3223 2623 1344 305 34279 3069 864 13328 1142
NM_213589chr274560 4267 4098 3955 3717 1460 1034 11730 24185 2207 --