TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1226-3p
miRNA Sequence: UCACCAGCCCUGUGUUCCCUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr11367 ------
NM_000084chrX46466 1379 768 680 25706 1280 --16362
NM_000092chr223874 3658 11429 ----
NM_000104chr21380 ------
NM_000138chr151420 ------
NM_000142chr431417 1164 253 --158 --
NM_000161chr142656 26 ------
NM_000163chr542286 956 653 610 ------
NM_000176chr543261 2839 2389 980 --2682 398 --
NM_000192chr121397 ------
NM_000208chr1943901 1312 1098 849 14003 1362 --
NM_000210chr222237 911 ------
NM_000214chr2021387 540 ------
NM_000216chrX22629 823 1192 ----
NM_000217chr1234223 3500 1491 ------
NM_000248chr311029 11967 ----
NM_000264chr942980 2566 1233 568 ----1759
NM_000276chrX42054 1545 1458 221 --11842 --
NM_000280chr112332 251 ------
NM_000310chr1----11206 1435
NM_000314chr101680 ------
NM_000319chr121273 --1773 --
NM_000332chr644879 4560 861 166 ------
NM_000345chr411032 ------
NM_000362chr2221437 240 22639 2321 --1731
NM_000368chr974289 3763 1720 1351 757 740 482 13673 2780 261 --
NM_000378chr113849 267 178 ------
NM_000390chrX11221 --12940 13271
NM_000391chr11----11682 --
NM_000396chr1----183 --
NM_000399chr102860 127 ------
NM_000408chr233093 1289 764 --1150 --
NM_000411chr2122461 168 --1603 --
NM_000430chr1733337 2689 880 --1367 --
NM_000434chr61369 ----1399
NM_000439chr531739 649 562 ------
NM_000448chr1132120 2077 25 13028 ----
NM_000451chrX21847 399 11699 ----
NM_000462chr15196 11434 ----
NM_000476chr931462 1334 310 ------
NM_000478chr11706 ------
NM_000503chr82734 442 1113 ----
NM_000533chrX41431 1343 447 216 11263 ----
NM_000555chrX56847 2233 1756 618 93 37588 1913 1015 15785 --
NM_000594chr6--1698 ----
NM_000601chr71344 ------
NM_000602chr7--11212 --1470
NM_000615chr1132965 1141 381 11149 ----
NM_000618chr1225505 210 11465 ----
NM_000618chr1225505 210 11465 ----
NM_000633chr1844889 4675 4347 612 ------
NM_000682chr211277 --131 --
NM_000684chr1011281 ----11215
NM_000719chr1245335 4178 2527 1669 12304 --16200
NM_000722chr71290 ------
NM_000726chr2--11404 ----
NM_000780chr8--1162 ----
NM_000801chr203920 374 59 11042 ----
NM_000814chr1543559 3541 3473 1357 23700 565 ----
NM_000817chr211016 ----1430
NM_000818chr102375 193 ------
NM_000826chr41796 ------
NM_000829chr112725 49 ----143
NM_000833chr16----11291 --
NM_000838chr622503 1079 12519 1457 --
NM_000841chr62728 126 1889 ----
NM_000857chr4----1462 --
NM_000859chr51521 ----11245
NM_000868chrX3653 599 77 ------
NM_000875chr1532358 890 668 14805 25017 4272 --
NM_000891chr1722410 50 ------
NM_000919chr5----1553 --
NM_000926chr1118693 27599 6844 19388 --
NM_000933chr201301 ------
NM_000944chr421714 195 ------
NM_000945chr211555 ------
NM_000964chr171508 ----1428
NM_000965chr32919 377 ------
NM_001001323chr1212087 13004 ----
NM_001001331chr332567 2473 856 ------
NM_001001419chr534702 3955 1897 13975 ----
NM_001001420chr534702 3955 1897 13975 ----
NM_001001484chr1011816 12364 ----
NM_001001549chr722125 1856 ----173
NM_001001550chr722125 1856 ----173
NM_001001555chr722125 1856 ----173
NM_001001557chr83802 784 490 ------
NM_001001668chr1944300 3891 3418 1577 12763 ----
NM_001001740chr11239 ------
NM_001001740chr11239 ------
NM_001001890chr2133790 3261 1706 --14042 --
NM_001001936chr101342 31158 396 48 ----
NM_001001974chr101140 22124 798 ----
NM_001002243chr22290 124 ------
NM_001002258chr241757 1704 792 90 ------
NM_001002264chr13128 ------
NM_001002762chr1042071 813 637 598 21794 127 22054 1071 --
NM_001002838chrX1563 ------
NM_001002860chr1453053 1448 1348 1292 656 13939 ----
NM_001002909chr1721782 1440 1513 ----
NM_001002919chr21491 ------
NM_001003652chr1898456 8335 6864 6244 5780 5774 5585 2542 1652 16423 ----
NM_001003688chr42853 342 ------
NM_001003696chr21--1134 ----
NM_001003697chr21--1134 ----
NM_001003698chr61360 --11381 --
NM_001003699chr61360 --11381 --
NM_001003701chr21--1134 ----
NM_001003703chr21--1134 ----
NM_001003712chr1242720 820 708 69 ------
NM_001003792chr31844 ------
NM_001003793chr31844 ------
NM_001003794chr372873 2335 1154 845 708 433 336 ------
NM_001003800chr933527 3145 1335 11279 ----
NM_001003810chr41565 ------
NM_001003895chrY2256 127 ------
NM_001003927chr17160 ------
NM_001003940chr1532861 2467 1389 22876 2521 13484 --
NM_001003942chr1532861 2467 1389 22876 2521 13484 --
NM_001003943chr1532865 2471 1393 22880 2525 13488 --
NM_001004051chrX165 ------
NM_001004317chr633569 1357 1011 --22978 1566 --
NM_001004360chr21229 11390 ----
NM_001004419chr1254413 4153 3790 2801 494 --1738 --
NM_001005353chr15798 455 299 195 64 ------
NM_001005353chr15798 455 299 195 64 ------
NM_001005386chr242381 2010 894 138 ------
NM_001005404chr1754362 3179 3051 1737 1213 1153 24505 623 --
NM_001005463chr1021931 701 ------
NM_001005473chr556166 4945 4282 1213 118 15977 --16439
NM_001005476chr21649 1239 1453 --
NM_001005505chr31296 --21427 728 --
NM_001005609chrX199 --12821 --
NM_001005743chr1411088 11196 ----
NM_001005744chr1411088 11196 ----
NM_001005745chr1411088 11196 ----
NM_001005746chr2--11404 ----
NM_001005747chr2--11404 ----
NM_001005782chr2--1184 ----
NM_001006656chr1921690 1385 ------
NM_001007024chr1743428 3161 2907 1551 --13494 --
NM_001007025chr1743428 3161 2907 1551 --13494 --
NM_001007097chr934055 3115 47 --14211 --
NM_001007237chr131148 1108 187 ------
NM_001007246chr2131949 1314 622 ------
NM_001007257chr1--11007 ----
NM_001007277chr1121113 281 --1900 --
NM_001007466chr644957 4925 1423 105 ------
NM_001007553chr12951 265 158 ----
NM_001007565chr3----1133 --
NM_001008225chr71474 ------
NM_001008239chr1833781 1404 925 1271 ----
NM_001008401chr1911380 ------
NM_001008407chr721363 1264 2536 406 ----
NM_001008408chr755113 4648 3980 2192 899 --1201 --
NM_001008495chr831861 1756 694 ------
NM_001008539chr835102 4729 22 --24507 307 --
NM_001008660chr11--1246 ----
NM_001008738chr532014 2005 28 1689 ----
NM_001008895chr131960 ------
NM_001008925chr413028 ------
NM_001009552chr81584 ------
NM_001009554chr424695 1464 64628 3628 1685 1556 799 286 ----
NM_001009554chr424695 1464 64628 3628 1685 1556 799 286 ----
NM_001009566chr141298 1145 913 146 ------
NM_001009958chr7----1169 --
NM_001009959chr252439 2115 2044 1957 720 ------
NM_001009993chr2103668 3435 3225 3062 1734 1674 1641 678 646 188 --21739 63 13400
NM_001010862chrX52981 2488 1114 758 688 ------
NM_001010924chr101794 ------
NM_001010932chr71344 ------
NM_001010971chr11990 ------
NM_001010984chr131709 756 76 ------
NM_001010989chr161370 1178 ----
NM_001010990chr161370 1178 ----
NM_001011537chr332311 2247 2083 --1642 --
NM_001011666chr745106 4214 1552 225 --11815 --
NM_001011708chr242643 839 488 428 ------
NM_001011713chr1411515 ------
NM_001011718chr202251 110 ------
NM_001011885chr1521490 708 ------
NM_001012329chr142246 1673 434 354 1942 ----
NM_001012415chr9----197 --
NM_001012420chr151333 1593 12917 --
NM_001012423chr151333 1593 12917 --
NM_001012426chr612747 --11159 --
NM_001012427chr612747 --11159 --
NM_001012456chr7--141 ----
NM_001012755chrX63337 1667 1394 1385 708 53 --13447 --
NM_001012756chr1942892 2674 2547 517 ------
NM_001012761chr512403 ------
NM_001012989chrX--2418 134 ----
NM_001013031chr1033361 2825 510 ------
NM_001013399chr61843 ------
NM_001013415chr421490 1201 ------
NM_001013620chr1258240 5963 3037 854 612 13174 --13395
NM_001013622chr47449 388 326 264 202 141 79 ------
NM_001013699chr12--163 ----
NM_001014283chr1331781 1400 508 ------
NM_001014434chr12257 140 ------
NM_001014797chr1037312 1039 220 --28123 2686 --
NM_001017368chr1722253 671 22328 589 11133 --
NM_001017371chr221221 338 --1369 --
NM_001017523chr1211886 1434 ----
NM_001017926chr8----1184 --
NM_001017977chr11328 ------
NM_001018065chr935510 2039 303 15183 ----
NM_001018066chr935510 2039 303 15183 ----
NM_001018067chr164934 3777 2117 1702 1056 816 1789 22027 1663 --
NM_001018068chr164934 3777 2117 1702 1056 816 1789 22027 1663 --
NM_001018069chr164934 3777 2117 1702 1056 816 1789 22027 1663 --
NM_001018072chr1211886 1434 ----
NM_001018074chr543261 2839 2389 980 --2682 398 --
NM_001018075chr543261 2839 2389 980 --2682 398 --
NM_001018076chr543261 2839 2389 980 --2682 398 --
NM_001018077chr543261 2839 2389 980 --2682 398 --
NM_001018108chr1532315 1628 898 ------
NM_001020658chr12346 243 ------
NM_001020658chr12346 243 ------
NM_001020825chr51314 ------
NM_001023567chr152980 333 1596 12309 --
NM_001024094chr543261 2839 2389 980 --2682 398 --
NM_001024226chr131069 384 378 ------
NM_001024227chr131069 384 378 ------
NM_001024228chr131069 384 378 ------
NM_001024401chr1652712 2313 2275 2255 1020 1199 --1164
NM_001024808chr1222776 460 11988 1969 --
NM_001024809chr171508 ----1428
NM_001025076chr1035549 3980 443 --1787 13999
NM_001025077chr1066907 5338 4874 1801 496 407 --12145 15357
NM_001025105chr52301 124 1171 ----
NM_001025108chr252936 2728 2719 2591 1635 ------
NM_001025242chrX--11312 ----
NM_001025243chrX--11312 ----
NM_001025266chr343302 884 238 61 ------
NM_001025366chr631746 588 462 ------
NM_001025366chr631746 588 462 ------
NM_001025367chr631746 588 462 ------
NM_001025367chr631746 588 462 ------
NM_001025368chr631746 588 462 ------
NM_001025368chr631746 588 462 ------
NM_001025369chr631762 604 478 ------
NM_001025369chr631762 604 478 ------
NM_001025370chr631746 588 462 ------
NM_001025370chr631746 588 462 ------
NM_001025579chr172906 310 ------
NM_001025580chrX23807 717 23976 3623 ----
NM_001029858chr622592 523 ------
NM_001029870chr4192 ------
NM_001030006chr1722495 1970 ------
NM_001030007chr1633607 2850 321 ------
NM_001030055chr1424233 1188 13617 ----
NM_001031680chr132495 2241 2033 11848 1140 --
NM_001031684chr231413 1243 354 --2975 525 --
NM_001031695chr2224288 420 11152 ----
NM_001031710chr7192 174 ----
NM_001031717chr3189 ------
NM_001031748chr12----1566 --
NM_001031804chr1623426 466 ------
NM_001032288chr2041295 1219 1002 296 ------
NM_001032293chr17--1417 ----
NM_001032296chr1352769 2598 2445 889 416 ------
NM_001032380chr1031949 783 639 ------
NM_001033057chr321765 640 ------
NM_001033059chr652014 1990 1414 835 661 ------
NM_001033087chr2042702 1079 364 211 --12445 --
NM_001033112chr5123 ------
NM_001033117chr354880 4751 4670 560 65 --11191 --
NM_001033557chr21456 ------
NM_001033564chr621428 590 164 ----
NM_001033756chr631680 522 396 ------
NM_001033756chr631680 522 396 ------
NM_001033925chr1011718 1148 1630 --
NM_001034845chr431431 453 110 ------
NM_001035511chr111647 1353 --1293
NM_001035512chr111754 1460 11407 1400
NM_001035513chr111754 1460 11407 1400
NM_001037132chr71885 1489 ----
NM_001037133chr71885 1489 ----
NM_001037164chr72677 599 ------
NM_001037174chr212058 11538 --12290
NM_001037290chr11----1646 --
NM_001037533chr13780 611 343 1580 ----
NM_001037553chr2123933 1011 1115 ----
NM_001038640chr154769 401 249 95 ------
NM_001038707chr122217 2036 --1499 --
NM_001038707chr122217 2036 --1499 --
NM_001039457chr1297 47 ------
NM_001039538chr233624 1131 878 ------
NM_001039570chr2274257 4159 4097 1873 1789 1315 495 ------
NM_001039571chr2274257 4159 4097 1873 1789 1315 495 ------
NM_001039590chrX33495 974 525 23212 563 ----
NM_001039591chrX33495 974 525 23212 563 ----
NM_001039618chr1124264 455 14440 ----
NM_001039690chr1632342 345 174 --22359 264 11993
NM_001039693chr223643 1307 13939 13806 --
NM_001039762chr1011810 ------
NM_001039840chrX55772 4354 4153 2289 143 14269 1283 --
NM_001040020chr721445 107 ------
NM_001040110chr7--1197 ----
NM_001040142chr2------12133
NM_001040143chr2------12133
NM_001040144chr1632342 345 174 --22359 264 11993
NM_001040146chr1632342 345 174 --22359 264 11993
NM_001040202chr411644 122 ----
NM_001040284chr161348 25546 5041 ----
NM_001040402chr4--1223 1131 --
NM_001040429chr1312912 172 12812 --
NM_001040697chr111481 ------
NM_001040708chr82977 150 --1739 --
NM_001040712chr913538 1790 1383 --
NM_001040875chr822424 873 ------
NM_001040876chr41599 ------
NM_001042355chr1634320 2028 219 ------
NM_001042399chr12------143
NM_001042406chr61942 ------
NM_001042412chr1634320 2028 219 ------
NM_001042453chrX41443 639 545 447 ------
NM_001042459chr3--1303 ----
NM_001042473chr1021417 581 ------
NM_001042506chrX1459 ------
NM_001042555chr1231869 862 273 --1610 --
NM_001042573chr1731998 211 164 12065 ----
NM_001042599chr257109 2368 925 236 72 --16725 --
NM_001042603chr1264984 4410 4229 1681 313 294 11009 ----
NM_001042604chr354348 4188 3088 1361 896 ------
NM_001042724chr191138 ------
NM_001044305chr61144 ------
NM_001044385chr223927 3106 12530 ----
NM_001048183chr143694 2802 2793 437 ------
NM_001049chr1432077 594 504 ------
NM_001071775chr1311952 ------
NM_001077628chr11238 ------
NM_001079874chr12650 174 ------
NM_001083620chr41795 ------
NM_001099678chr325401 1418 ------
NM_001121chr1011603 ------
NM_001128chr1633607 2850 321 ------
NM_001149chr101308 11301 ----
NM_001160chr1221084 269 --11970 --
NM_001167chrX45816 2066 1014 483 --25158 453 --
NM_001172chr141554 1157 ----
NM_001173chr1424233 1188 13617 ----
NM_001191chr201307 --11305 --
NM_001197chr222399 312 ------
NM_001198chr611730 21665 47 11478 --
NM_001204chr215273 11160 17422 --
NM_001206chr921183 399 ------
NM_001219chr7------12156
NM_001220chr7----136 --
NM_001222chr1021946 689 --11590 --
NM_001241chr212303 ------
NM_001241chr212303 ------
NM_001256chr1712065 --12358 --
NM_001257chr1631559 355 293 ------
NM_001275chr14--1325 ----
NM_001282chr1722495 1970 ------
NM_001293chr11155 ------
NM_001316chr201170 ------
NM_001326chr111121 ------
NM_001329chr10------1431
NM_001351chr331578 354 38 11198 ----
NM_001358chr4187 ------
NM_001364chr1111544 13831 --23853 3819
NM_001380chr102941 713 ------
NM_001383chr171278 --155 --
NM_001387chr543042 3015 1081 816 ------
NM_001390chr1852969 2938 2659 2217 1167 178 ----
NM_001396chr2132326 1714 320 ------
NM_001399chrX199 --12821 --
NM_001401chr921243 326 ------
NM_001402chr642013 1399 1390 1357 ------
NM_001407chr33596 535 135 --1673 --
NM_001419chr1934276 4036 1843 --11374 --
NM_001421chrX2420 142 21532 249 ----
NM_001427chr731930 1721 544 1469 ----
NM_001430chr251803 1351 672 652 346 ------
NM_001431chr621057 368 ------
NM_001440chr832159 721 302 11127 196 --
NM_001447chr5--11211 1420 --
NM_001448chrX1199 1670 ----
NM_001463chr2--1834 ----
NM_001482chr151351 1245 ----
NM_001497chr942740 414 290 78 --11824 12496
NM_001527chr654819 4265 3409 1687 737 --12945 --
NM_001530chr142852 39 ------
NM_001542chr131148 1108 187 ------
NM_001543chr52965 135 --13122 1846
NM_001569chrX--11312 ----
NM_001587chrX42054 1545 1458 221 --11842 --
NM_001604chr112332 251 ------
NM_001616chr211172 ------
NM_001620chr111588 ------
NM_001621chr721215 491 ------
NM_001621chr721215 491 ------
NM_001634chr652014 1990 1414 835 661 ------
NM_001649chrX62307 2288 2069 1888 1866 410 ------
NM_001658chr131069 384 378 ------
NM_001660chr32594 557 ------
NM_001663chr1412749 12517 11911 --
NM_001664chr31304 1385 ----
NM_001665chr11158 ------
NM_001681chr121732 --1617 --
NM_001682chr1211801 22718 1015 ----
NM_001683chr332567 2473 856 ------
NM_001685chr21--1134 ----
NM_001689chr241757 1704 792 90 ------
NM_001694chr161110 ------
NM_001730chr1311014 ------
NM_001730chr1311014 ------
NM_001744chr51139 ------
NM_001753chr72384 57 ------
NM_001754chr2133790 3261 1706 --14042 --
NM_001755chr1631772 1765 738 ------
NM_001759chr1244416 1126 910 194 --11294 --
NM_001789chr331662 1394 1195 ------
NM_001795chr1621557 403 --1231 1393
NM_001846chr13132 ------
NM_001854chr12278 47 --1202 --
NM_001855chr91215 ------
NM_001858chr674350 3638 1902 1625 1257 847 413 ------
NM_001892chr52301 124 1171 ----
NM_001895chr2031239 815 409 ------
NM_001896chr161285 ------
NM_001904chr32386 88 ------
NM_001918chr168579 8180 7113 3256 1766 1623 12612 ----
NM_001938chr12609 101 ----1450
NM_001964chr51771 ------
NM_001969chr1411167 ------
NM_001970chr17--1223 ----
NM_001981chr11472 ------
NM_002006chr415466 22008 1633 --1595
NM_002015chr1343295 2141 2084 316 ------
NM_002017chr1121031 157 ------
NM_002018chr17--130 ----
NM_002025chrX69250 9058 6893 1538 943 71 22761 2378 39243 9142 2039 --
NM_002048chr91147 ------
NM_002069chr721719 1490 11831 ----
NM_002092chr435090 4362 122 45045 3982 3395 3272 ----
NM_002103chr19--11027 ----
NM_002106chr41345 ----165
NM_002126chr1744109 3411 1318 134 1568 13141 --
NM_002128chr1322110 188 --1273 --
NM_002136chr121491 ------
NM_002137chr722244 620 --11999 --
NM_002138chr41565 ------
NM_002140chr9----1304 --
NM_002141chr71175 1126 1217 --
NM_002148chr2--1571 ----
NM_002160chr9--1112 ----
NM_002165chr201292 ------
NM_002188chr51207 ----1822
NM_002222chr3----21291 436 --
NM_002223chr1232961 1178 445 ----13192
NM_002247chr1011593 --159 --
NM_002254chr232068 464 82 ------
NM_002267chr132522 266 1931 ----
NM_002268chr311283 ------
NM_002270chr545052 4996 1829 1562 13817 11498 --
NM_002285chr252936 2728 2719 2591 1635 ------
NM_002296chr111463 ------
NM_002336chr1244861 4786 4545 1744 ------
NM_002346chr81594 ------
NM_002356chr61751 --12599 --
NM_002359chr1754176 3499 3202 3181 625 53768 3440 3239 1213 1175 21203 289 --
NM_002373chr1531203 854 289 ------
NM_002374chr233624 1131 878 ------
NM_002382chr14170 ------
NM_002397chr511403 11521 ----
NM_002401chr1721853 1632 ------
NM_002430chr221145 ------
NM_002444chrX--11816 ----
NM_002480chr121189 ------
NM_002489chr71337 ------
NM_002499chr1531893 811 450 ------
NM_002500chr221212 269 ------
NM_002516chr19192 ------
NM_002522chr1721515 1155 --22832 469 1290
NM_002524chr111067 ----1399
NM_002547chrX54208 3327 1477 554 535 13286 13876 --
NM_002556chr112398 175 ------
NM_002569chr1531510 1441 1239 1478 11463 --
NM_002618chr21161 1168 ----
NM_002636chr61122 ------
NM_002646chr12879 207 --137 --
NM_002655chr8--14225 ----
NM_002657chr2042926 2573 728 436 --11102 --
NM_002670chr32371 162 ------
NM_002709chr221067 806 ------
NM_002711chr7--163 ----
NM_002715chr51227 --1894 --
NM_002716chr1143134 2769 2384 2328 ------
NM_002717chr81530 ------
NM_002729chr101141 ------
NM_002736chr711876 1525 ----
NM_002745chr22--2847 229 33594 3359 924 --
NM_002752chr51451 ------
NM_002758chr17142 ------
NM_002787chr71583 --1594 --
NM_002823chr21527 ------
NM_002834chr1223527 3062 --12775 --
NM_002839chr913538 1790 1383 --
NM_002840chr111506 ------
NM_002843chr1173391 2957 2853 2843 2805 2663 2435 13177 ----
NM_002844chr61270 1954 ----
NM_002858chr11205 ------
NM_002866chr191516 ------
NM_002890chr51250 ----1157
NM_002892chr14--1422 ----
NM_002894chr18169 ------
NM_002895chr201731 ------
NM_002906chr1131846 890 699 --1602 --
NM_002922chr11578 ------
NM_002940chr41599 ------
NM_002941chr321355 613 --11464 --
NM_002942chr3--1454 ----
NM_002943chr15--1129 ----
NM_002955chr61360 --11381 --
NM_002957chr9113087 2964 2717 2541 2407 1219 1106 996 751 458 394 13286 23053 521 --
NM_002998chr831694 1461 368 ------
NM_003001chr111754 1460 11407 1400
NM_003010chr172207 121 ------
NM_003016chr1722030 1630 --11445 --
NM_003017chr63988 535 100 ------
NM_003028chr923522 1199 13607 2491 448 --
NM_003030chr311368 ------
NM_003034chr1268047 7962 6567 5289 1784 256 12611 --22555 244
NM_003039chr13398 242 28 ------
NM_003043chr314142 13074 ----
NM_003045chr1354849 4637 3534 1823 945 --33834 3461 972 --
NM_003046chr835102 4729 22 --24507 307 --
NM_003048chr212393 1322 1879 --
NM_003051chr1------11986
NM_003070chr9----1851 --
NM_003076chr121115 ------
NM_003081chr201223 ------
NM_003106chr31800 ------
NM_003108chr221087 213 36140 2483 572 1531 --
NM_003110chr1721068 66 ------
NM_003111chr221221 338 --1369 --
NM_003128chr252229 2209 1026 418 321 ------
NM_003131chr612101 ------
NM_003137chr61779 11900 ----
NM_003144chr61253 ------
NM_003150chr1741821 951 921 375 11473 --11592
NM_003155chr821779 1719 12799 ----
NM_003161chr17--1643 1604 11442
NM_003170chr171124 ------
NM_003178chr341900 1605 615 93 --11544 --
NM_003199chr1854969 4418 3749 1643 468 ------
NM_003201chr101100 ------
NM_003203chr21262 --173 --
NM_003216chr2232185 2069 207 --23291 2300 --
NM_003221chr633879 725 404 11359 1384 --
NM_003222chr202912 432 ------
NM_003236chr223024 1137 --1297 --
NM_003239chr141873 ------
NM_003244chr181426 ------
NM_003246chr1541891 1348 773 45 ------
NM_003247chr621398 430 1234 ----
NM_003253chr2131784 1368 582 ------
NM_003257chr151216 ------
NM_003274chr2112217 --1224 12874
NM_003275chr911549 ----11318
NM_003286chr201367 ------
NM_003304chr311150 ------
NM_003319chr21294 ------
NM_003320chr1183914 3414 1711 1675 1212 1044 738 492 --1652 --
NM_003337chr5----1258 --
NM_003340chr411277 ------
NM_003341chr3189 ------
NM_003342chr17----13095 --
NM_003348chr12--2419 134 ----
NM_003349chr2041295 1219 1002 296 ------
NM_003352chr2--1184 ----
NM_003369chr1122765 742 ------
NM_003375chr102177 166 ------
NM_003376chr631746 588 462 ------
NM_003376chr631746 588 462 ------
NM_003392chr334166 2755 463 ------
NM_003404chr201163 11305 ----
NM_003409chr1821063 212 1466 ----
NM_003410chrX12140 ------
NM_003411chrY11517 11699 ----
NM_003412chr311923 --12803 --
NM_003413chrX11928 --1347 --
NM_003442chr11----2816 752 --
NM_003453chr131608 ----1635
NM_003457chr17--1417 ----
NM_003458chr313122 ------
NM_003459chr21560 --1667 --
NM_003468chr243843 3139 2999 806 13823 --1829
NM_003473chr104913 851 716 21 ------
NM_003477chr111256 --123 --
NM_003478chr1153031 2397 2206 634 488 ------
NM_003482chr1242596 2439 2355 1858 ------
NM_003483chr1212671 ------
NM_003489chr2133293 2318 2184 22660 141 ----
NM_003498chr1612265 11955 1954 --
NM_003575chr711105 1545 11211 --
NM_003576chr1352769 2598 2445 889 416 ------
NM_003583chr122323 22 ------
NM_003589chr131960 ------
NM_003591chr10153 ------
NM_003597chr221841 133 --1400 --
NM_003607chr134114 3089 817 13747 ----
NM_003615chr311609 --11132 --
NM_003620chr172951 63 ------
NM_003622chr121622 2597 193 12640 --
NM_003626chr1111231 ------
NM_003628chr21649 1239 1453 --
NM_003631chr1021053 164 ------
NM_003633chr532319 585 207 ------
NM_003663chr333034 998 787 ------
NM_003671chr91294 12624 ----
NM_003692chr91794 --1879 --
NM_003716chr31333 ------
NM_003744chr1411088 11196 ----
NM_003759chr453982 3542 3346 2776 1221 --11318 --
NM_003774chr1213172 ------
NM_003787chr1811689 ----11565
NM_003806chr12192 ----164
NM_003816chr81325 ------
NM_003818chr201317 --172 --
NM_003825chr15--11377 ----
NM_003829chr92837 313 11082 ----
NM_003848chr31350 ------
NM_003861chr1432725 1918 1035 ------
NM_003870chr151328 --1762 --
NM_003872chr272798 2619 2555 2261 1872 851 822 ------
NM_003873chr1051788 1781 841 548 216 --1242 1812
NM_003885chr1732481 1766 697 --2930 677 --
NM_003887chr221854 1733 ----1369
NM_003913chr631331 559 435 ------
NM_003941chr732530 2161 1759 ------
NM_003958chr621110 498 ------
NM_003966chr557594 2880 2172 1459 1199 23097 2595 2662 656 26465 5289
NM_003968chr31170 --1176 --
NM_003975chr1--2259 109 ----
NM_004047chr1297 47 ------
NM_004073chr1179 ------
NM_004075chr12140 ------
NM_004093chr1342892 2658 2614 2204 1189 ----
NM_004096chr1041812 1784 1316 413 ------
NM_004100chr642348 2206 1737 251 ------
NM_004103chr8172 ------
NM_004124chr1432985 2555 659 31298 975 859 ----
NM_004133chr81110 ------
NM_004136chr1522736 383 ------
NM_004156chr81584 ------
NM_004161chr231088 288 225 11223 ----
NM_004165chr16----147 --
NM_004167chr17----1227 --
NM_004171chr1158514 6485 6401 1358 850 ----17282
NM_004183chr111697 1561 ----
NM_004186chr33889 195 138 --1245 --
NM_004193chr101421 ------
NM_004202chrY------1223
NM_004228chr191151 ------
NM_004232chr1823446 2931 ------
NM_004273chr1041348 1236 576 399 13289 14269 --
NM_004274chr142803 211 1656 ----
NM_004280chr61304 ------
NM_004281chr10190 ------
NM_004295chr173534 273 165 11327 ----
NM_004296chr1424024 1497 13307 --11535
NM_004316chr1221057 27 ------
NM_004319chr1166 ------
NM_004321chr263200 2235 1213 706 661 223 --12752 --
NM_004342chr71626 ------
NM_004349chr811083 ----11209
NM_004350chr132495 2241 2033 11848 1140 --
NM_004364chr191180 ------
NM_004380chr1611868 ----1307
NM_004385chr5195 ------
NM_004392chr1332278 911 797 11005 ----
NM_004393chr341973 1765 894 722 22012 1937 --12258
NM_004395chr52675 237 ------
NM_004397chr1133131 2659 244 23660 152 ----
NM_004408chr9------1161
NM_004432chr932296 882 376 ------
NM_004436chr11471 --1153 --
NM_004438chr242751 1187 564 148 --12805 --
NM_004443chr31542 ------
NM_004450chr141267 ------
NM_004454chr331491 1466 771 ------
NM_004466chr131792 ------
NM_004474chr111040 ------
NM_004481chr122698 2464 157 1787 --
NM_004491chr1942763 1093 948 434 --34128 1259 1146 --
NM_004497chr192644 201 176 ----
NM_004500chr14------11371
NM_004501chr134050 1627 324 13678 ----
NM_004520chr5----1788 --
NM_004529chr911396 11267 ----
NM_004560chr931011 902 281 1645 ----
NM_004561chr111736 ------
NM_004575chr421563 1153 ------
NM_004580chr1521658 636 ------
NM_004586chrX54273 4070 4049 3853 111 --15222 --
NM_004588chr1163575 3483 3158 956 387 84 ------
NM_004593chr32185 142 ------
NM_004595chrX1427 ------
NM_004602chr2021400 277 ------
NM_004612chr91288 --13141 --
NM_004654chrY1933 --1497 --
NM_004655chr17--123 ----
NM_004680chrY2256 127 ------
NM_004687chr172316 81 2620 190 --1258
NM_004690chr6------1496
NM_004709chrX----11410 1193
NM_004711chr2223342 375 23631 3124 --12355
NM_004725chr1021168 403 ------
NM_004726chrX2477 437 ------
NM_004730chr522162 1694 ------
NM_004736chr112265 ------
NM_004738chr2021808 35 12468 1369 --
NM_004742chr331626 472 376 ------
NM_004745chr856624 5763 5069 1229 74 ----12469
NM_004747chr103538 422 344 --1502 --
NM_004756chr1911375 ------
NM_004762chr172620 22 ------
NM_004772chr51642 ------
NM_004774chr1721993 537 --12455 12665
NM_004779chr521281 1172 ------
NM_004781chr1------1530
NM_004781chr1------1530
NM_004783chr161681 ------
NM_004788chr111876 1380 ----
NM_004796chr1441894 1605 832 134 --1895 --
NM_004798chr2022567 1298 13357 1769 11173
NM_004834chr243331 2614 1263 386 --1233 --
NM_004842chr621602 106 1556 ----
NM_004849chr641620 1406 167 85 ------
NM_004862chr1661597 1157 1002 361 92 75 ------
NM_004863chr1445248 3933 1021 861 35201 3640 794 ----
NM_004867chrX1451 ------
NM_004871chr1743428 3161 2907 1551 --13494 --
NM_004879chr112991 159 --1778 --
NM_004904chr745106 4214 1552 225 --11815 --
NM_004921chr122288 254 ------
NM_004956chr723688 729 11344 ----
NM_004973chr611491 ------
NM_004976chr1144182 289 206 176 --13798 --
NM_004985chr1224392 272 --1321 --
NM_004999chr611621 1142 ----
NM_005010chr71885 1489 ----
NM_005011chr7--1197 ----
NM_005023chr5--11291 ----
NM_005045chr71625 1110 ----
NM_005054chr22678 22 ------
NM_005056chr1265228 4654 4473 1925 557 538 11253 ----
NM_005065chr1434905 1835 1821 1609 --13938
NM_005067chr31962 --1883 1200
NM_005076chr143651 836 695 108 11495 ----
NM_005095chr111570 ------
NM_005113chr141460 ------
NM_005119chr111240 --1266 160
NM_005121chr1713375 ------
NM_005153chr162835 516 ------
NM_005156chr944927 2100 1240 1233 14388 ----
NM_005180chr1011356 ------
NM_005188chr1157424 6274 5061 965 645 191 17601 --
NM_005190chr61843 ------
NM_005197chr1446056 4413 3910 2431 13862 ----
NM_005219chr521794 1319 ------
NM_005222chr71862 ------
NM_005229chrX1890 ----11183
NM_005235chr257109 2368 925 236 72 --16725 --
NM_005238chr1122830 58 11262 ----
NM_005241chr321120 279 ------
NM_005245chr4--1101 ----
NM_005257chr1811066 ------
NM_005261chr81252 ------
NM_005277chr421260 41 ------
NM_005311chr722125 1856 ----173
NM_005327chr42801 253 ------
NM_005339chr4----21059 384 --
NM_005342chrX----1292 --
NM_005354chr192487 458 ------
NM_005359chr1886333 6278 4807 4112 2290 1499 1282 794 25040 1911 15709 --
NM_005375chr62875 736 ------
NM_005378chr22785 89 ----1249
NM_005381chr22438 169 ------
NM_005385chr33769 752 491 ------
NM_005392chr921654 1542 --1650 --
NM_005398chr101466 --1430 --
NM_005399chr164144 4074 3901 2888 1703 825 ------
NM_005400chr231925 563 473 1180 --12500
NM_005430chr121987 ------
NM_005431chr71434 --11624 11586
NM_005435chr71181 --1522 --
NM_005455chr1----1173 --
NM_005494chr71589 --1654 --
NM_005497chr1744826 3920 2451 1831 ------
NM_005504chr1236501 4355 1296 11922 14320 --
NM_005506chr422892 284 ----1725
NM_005520chr51669 ------
NM_005522chr73511 231 181 ------
NM_005536chr8--150 ----
NM_005539chr1021383 1300 ------
NM_005563chr14791 542 267 211 ------
NM_005576chr151223 ------
NM_005585chr151379 ------
NM_005594chr12126 ------
NM_005596chr956317 5110 4306 1764 1088 12323 ----
NM_005603chr181350 ------
NM_005614chr71959 ------
NM_005627chr6168 --1735 --
NM_005638chrX11200 --1497 --
NM_005639chr121577 ------
NM_005656chr2141260 624 230 53 ------
NM_005664chr15--1203 ----
NM_005665chr153865 1924 999 859 708 --11260 --
NM_005686chr131124 1008 91 ------
NM_005688chr341210 1174 1157 907 --1493 --
NM_005717chr131225 315 46 ------
NM_005722chr242381 2010 894 138 ------
NM_005730chr1223305 2268 --2993 987 --
NM_005737chr262827 2200 2091 952 719 504 1180 ----
NM_005738chr72677 599 ------
NM_005746chr72933 106 ------
NM_005748chr1243190 2340 498 490 ------
NM_005756chrX1235 ----1370
NM_005759chr234022 3782 774 --24629 3412 --
NM_005779chr523170 1061 1958 ----
NM_005786chr181234 ------
NM_005789chr1731693 1680 361 1503 1834 --
NM_005828chr1743612 1050 690 601 ------
NM_005832chr31206 --1211 --
NM_005840chrX47352 4998 2085 159 ------
NM_005842chr13--1223 ----
NM_005850chr11174 ------
NM_005859chr5----21438 1259 --
NM_005860chr1931356 366 27 --21604 192 --
NM_005862chr3------1189
NM_005871chr10----1951 --
NM_005872chr11191 ------
NM_005880chr1621181 114 --1640 --
NM_005898chr1122509 1159 ------
NM_005899chr1711294 --11040 11172
NM_005900chr42853 342 ------
NM_005901chr1898456 8335 6864 6244 5780 5774 5585 2542 1652 16423 ----
NM_005902chr1524005 255 --14144 --
NM_005903chr534702 3955 1897 13975 ----
NM_005904chr1821432 128 ------
NM_005907chr631685 1299 641 ------
NM_005911chr2----41346 1312 1285 1007 --
NM_005920chr113528 ------
NM_005933chr1142274 496 429 312 ------
NM_005955chr184789 4261 3726 3417 2054 2045 874 779 15241 1569 --
NM_005966chr2------12379
NM_005969chr1131046 772 312 1416 11066 --
NM_005990chr532205 2197 33 --2805 286 --
NM_005999chr141483 1040 374 241 ------
NM_006007chr934425 4035 3440 ------
NM_006015chr111014 ----1956
NM_006016chr611601 131 ----
NM_006030chr31296 --21427 728 --
NM_006036chr212497 1270 ----
NM_006047chr2042771 1262 1061 624 12691 ----
NM_006054chr111132 ------
NM_006064chrX1424 ------
NM_006070chr3----1133 --
NM_006076chr723128 454 166 21283 606 12138
NM_006094chr82400 380 12080 ----
NM_006106chr1133159 763 678 ------
NM_006110chr16124 ------
NM_006113chr12650 174 ------
NM_006135chr1------1279
NM_006141chr1612659 ------
NM_006145chr191358 --1942 --
NM_006167chr811713 1151 11812 --
NM_006202chr1911596 ------
NM_006204chr101217 ------
NM_006206chr422058 1819 1304 22262 1907 --
NM_006224chr1742425 1682 954 190 --1884 --
NM_006241chr312270 ------
NM_006251chr523276 706 ------
NM_006258chr101508 ------
NM_006265chr81281 ------
NM_006267chr22442 202 ------
NM_006279chr12316 128 ------
NM_006281chr8--1465 ----
NM_006281chr8--1465 ----
NM_006283chr821971 1690 ------
NM_006310chr1721229 468 1371 ----
NM_006312chr122667 236 ------
NM_006313chr1221561 347 --143 --
NM_006315chr454409 3883 3055 1163 772 --33861 1011 938 --
NM_006324chr161218 ------
NM_006328chr111515 ------
NM_006329chr14------1260
NM_006352chr112051 ----12060
NM_006367chr121006 897 --1421 --
NM_006371chr344493 3637 1869 422 14649 13876 14356
NM_006378chr911367 --125 --
NM_006379chr722096 672 ------
NM_006386chr2212328 --1390 --
NM_006389chr1121329 88 1387 ----
NM_006459chr1011479 ------
NM_006464chr223109 413 1240 1276 --
NM_006469chr121490 1028 ------
NM_006482chr122323 22 ------
NM_006496chr141934 1859 1692 1329 --11647 --
NM_006509chr191364 ------
NM_006517chrX21763 558 ------
NM_006526chr2022209 32 ------
NM_006534chr2022494 846 1494 ----
NM_006546chr1731897 1105 1051 --24329 2581 --
NM_006561chr1035549 3980 443 --1787 13999
NM_006595chr1111569 ------
NM_006599chr1647339 2693 1650 836 ------
NM_006614chr323113 351 22475 404 23280 2623 --
NM_006618chr131525 1014 572 11433 1627 --
NM_006621chr11739 ------
NM_006624chr1031755 492 449 ------
NM_006625chr12434 338 ------
NM_006625chr12434 338 ------
NM_006625chr12434 338 ------
NM_006626chr91843 --12084 --
NM_006628chr1554391 3939 3871 3646 577 23022 190 ----
NM_006629chr1842141 1991 1969 1932 ------
NM_006634chr2169 ------
NM_006646chr132480 357 ------
NM_006654chr1231869 862 273 --1610 --
NM_006675chr1263322 3032 2963 2171 970 792 ------
NM_006690chr201452 1762 12021 --
NM_006698chr2021444 912 ------
NM_006699chr11787 --12683 --
NM_006700chr121307 ------
NM_006703chr61159 ------
NM_006706chr5--1287 ----
NM_006711chr161174 ------
NM_006717chr912436 32800 2309 758 ----
NM_006722chr311029 11967 ----
NM_006726chr41961 ------
NM_006729chrX35162 1980 1068 ------
NM_006749chr8144 ----1922
NM_006754chr71115 ------
NM_006761chr172579 140 ------
NM_006766chr822043 1728 1912 11070 --
NM_006769chr11165 ------
NM_006775chr622250 1067 22061 493 1953 --
NM_006788chr1841741 775 750 536 11411 ----
NM_006800chrX--2644 547 ----
NM_006806chr21----123 --
NM_006818chr1----1110 --
NM_006819chr111283 ------
NM_006824chr1----183 --
NM_006827chr1432861 2696 138 1506 ----
NM_006832chr141967 ------
NM_006833chr71162 --1128 --
NM_006854chr721692 579 ------
NM_006884chr311368 ------
NM_006885chr1624027 852 --13459 --
NM_006888chr1452843 2549 615 595 440 --1182 --
NM_006897chr121199 ------
NM_006915chrX31922 1913 621 ----11577
NM_006916chr21172 ------
NM_006922chr212372 ------
NM_006924chr1744142 2842 1397 948 --24184 793 --
NM_006931chr1211589 ------
NM_006940chr1211262 ------
NM_006941chr22183 --1352 --
NM_006952chr3152 ------
NM_006991chr31150 ------
NM_006999chr531443 1367 635 ------
NM_007010chr1731422 693 232 1138 ----
NM_007017chr51324 ------
NM_007031chr211195 2473 28 ----
NM_007038chr2114565 25289 4015 ----
NM_007040chr192839 409 ------
NM_007045chr62363 106 ------
NM_007050chr2057215 6410 1857 834 130 17005 15142 --
NM_007054chr522857 857 1200 ----
NM_007067chr1721179 172 ------
NM_007107chr331845 1811 721 ----11951
NM_007124chr611760 ------
NM_007129chr131402 ------
NM_007137chrX34336 1428 256 23724 429 11731 --
NM_007150chrX1412 ----11872
NM_007158chr12951 265 158 ----
NM_007166chr11--1246 ----
NM_007174chr121387 ------
NM_007185chr121019 676 ------
NM_007217chr32368 302 ------
NM_007218chr8--1194 ----
NM_007222chr8----1184 --
NM_007236chr1521686 165 1745 ----
NM_007238chr2054655 3873 3803 3675 104 --1373 --
NM_007246chr42805 705 ------
NM_007249chr1348484 8062 7076 2261 22800 1229 19263 11669
NM_007275chr31176 --2882 203 --
NM_007280chr151335 ------
NM_007283chr372873 2335 1154 845 708 433 336 ------
NM_007345chr18--21972 1824 ----
NM_007358chr121339 1307 ------
NM_007363chrX1996 ------
NM_007373chr1021368 588 ------
NM_007375chr132229 865 24 1926 ----
NM_012081chr511153 ----12337
NM_012082chr81179 1901 ----
NM_012096chr323236 1211 13512 --1406
NM_012097chr212058 11538 --12290
NM_012104chr1121481 517 13786 ----
NM_012104chr1121481 517 13786 ----
NM_012155chr191197 ------
NM_012156chr2052464 2383 1175 987 296 --12285 --
NM_012157chr32974 714 1158 ----
NM_012161chr421155 278 ------
NM_012186chr11746 --1672 --
NM_012193chr1134137 1251 363 13838 ----
NM_012197chr921609 132 ------
NM_012199chr144307 3263 381 280 --34107 3774 764 --
NM_012214chr222245 1623 25884 1056 14083 --
NM_012223chr231198 467 457 ------
NM_012233chr21447 --124 --
NM_012234chr312308 --23554 538 --
NM_012238chr1041088 639 250 127 ------
NM_012244chr1431811 1724 133 ----11534
NM_012247chr10----1355 --
NM_012249chr243059 2196 1175 839 ------
NM_012250chr1121050 79 ------
NM_012252chr755306 4896 3821 644 313 --149 --
NM_012262chr144703 4495 3528 1486 --13380 1220
NM_012272chr121166 ------
NM_012281chr72850 119 --12255 --
NM_012287chr321445 457 136 13668 --
NM_012288chr6113781 3765 2065 1298 1074 1065 958 541 483 471 34 15651 15483 --
NM_012293chr231520 513 283 --21726 132 --
NM_012294chr743499 2501 1417 258 ------
NM_012302chr12835 123 ------
NM_012308chr1122347 532 12565 ----
NM_012309chr1111746 14541 ----
NM_012316chr1167 32153 1440 1007 11822 --
NM_012325chr2031379 615 222 ------
NM_012329chr17----11264 --
NM_012330chr102668 97 1698 ----
NM_012333chr11339 --11472 --
NM_012338chr7--1498 ----
NM_012382chr534220 3629 1266 ------
NM_012383chr9181 ------
NM_012399chr2241752 1253 583 440 ------
NM_012416chr9--1201 ----
NM_012421chr11182 ------
NM_012433chr2--166 ----
NM_012458chr191374 ------
NM_012479chr742518 895 698 201 ------
NM_013229chr1221084 269 --11970 --
NM_013261chr423614 3185 1283 ----
NM_013269chr1244340 4080 3717 421 --1665 --
NM_013309chr151949 ------
NM_013322chr71299 ------
NM_013333chr19--1363 ----
NM_013341chr242643 839 488 428 ------
NM_013351chr172249 127 ------
NM_013357chr81822 ------
NM_013374chr323071 2141 ------
NM_013390chr91430 --1222 11194
NM_013399chr1651532 1488 642 255 245 ------
NM_013410chr15798 455 299 195 64 ------
NM_014028chr632676 2552 1243 ------
NM_014043chr31573 ------
NM_014048chr1644821 1449 750 587 ------
NM_014071chr201188 ------
NM_014106chr1512497 136 ----
NM_014112chr835442 1084 863 14131 14003 --
NM_014117chr1611862 1561 12014 --
NM_014155chr1166107 5452 2717 1859 1462 159 27134 6969 ----
NM_014157chr1673437 2580 2446 1084 873 432 101 22922 2802 11305 --
NM_014186chr1121767 1660 --11695 --
NM_014210chr17160 ------
NM_014212chr121976 ------
NM_014213chr22162 78 ------
NM_014233chr1731677 1511 517 --21955 1623 --
NM_014240chr343817 1290 1044 755 ----1826
NM_014243chr42790 263 ------
NM_014253chrX12396 ------
NM_014282chr911286 1936 ----
NM_014302chr7--141 ----
NM_014309chr2224278 410 11142 ----
NM_014325chr12268 60 --11628 --
NM_014331chr427690 1500 1100 14949 --
NM_014333chr1112353 ------
NM_014342chr111134 ------
NM_014372chr121992 44 ------
NM_014393chr821884 346 ------
NM_014397chr9--1557 ----
NM_014405chr1722353 597 ------
NM_014415chr3----1217 --
NM_014423chr544938 4289 1416 123 --14766 --
NM_014452chr62991 225 ------
NM_014454chr61403 ------
NM_014488chr111628 ------
NM_014489chr111263 ------
NM_014496chrX1228 ------
NM_014552chr231426 188 162 ------
NM_014562chr21752 ------
NM_014574chr142987 138 1109 ----
NM_014586chr2164405 4324 3890 1745 1059 947 21659 1325 14716 --
NM_014588chr201234 ------
NM_014606chr411566 ------
NM_014614chr21121 11286 ----
NM_014636chr932678 2671 59 34258 2854 1633 ----
NM_014637chr82481 194 ------
NM_014644chr13946 863 176 1985 ----
NM_014646chr1843240 2111 877 124 12477 ----
NM_014647chr1621655 421 ------
NM_014665chr843006 2700 579 77 ------
NM_014671chr721404 1005 ----1330
NM_014676chr12346 243 ------
NM_014682chr852332 1440 936 910 878 ------
NM_014685chr161370 1178 ----
NM_014705chr732117 1414 1334 ------
NM_014707chr7----12060 --
NM_014711chr1611943 ------
NM_014715chr11--1897 ----
NM_014721chr645639 5217 5021 582 ------
NM_014723chr2022100 1048 ------
NM_014729chr81252 ------
NM_014730chr1244773 3209 1356 916 ------
NM_014730chr1244773 3209 1356 916 ------
NM_014738chr173953 768 676 ------
NM_014739chr653911 3266 2769 2618 871 ------
NM_014747chr145014 4986 948 435 1243 11374 --
NM_014751chr811449 ------
NM_014755chr214074 ------
NM_014757chr532254 1783 233 1684 ----
NM_014761chr1621159 957 ------
NM_014764chr122836 129 ------
NM_014767chr1021046 330 ------
NM_014779chr341159 298 267 62 ------
NM_014819chr512439 ------
NM_014820chr31570 11452 11709 --
NM_014822chr42155 57 ------
NM_014826chr134114 3089 817 13747 ----
NM_014827chr111071 ------
NM_014828chr1442509 1934 1735 307 ------
NM_014829chr522162 33 ------
NM_014830chr1282520 1419 1248 1194 1030 869 258 70 --2543 284 12589
NM_014836chr1031949 783 639 ------
NM_014840chr1243262 3248 2471 73 1704 ----
NM_014850chr354880 4751 4670 560 65 --11191 --
NM_014873chr154869 4750 3073 1621 448 --14174 --
NM_014888chr721445 107 ------
NM_014890chr3--1303 ----
NM_014897chr1722674 452 ------
NM_014899chr532689 2630 1073 --22414 2403 --
NM_014900chr2----11034 --
NM_014903chr1252345 1835 1538 859 450 ------
NM_014904chr1043025 994 370 266 ------
NM_014905chr2--21606 606 ----
NM_014906chr172726 216 23901 2569 ----
NM_014912chr1033112 2887 2567 ------
NM_014918chr1511363 ------
NM_014920chr632830 1101 66 ------
NM_014924chr1452825 2390 2075 403 354 --1249 --
NM_014932chr31640 ------
NM_014938chr1232173 1667 299 11584 1314 --
NM_014944chr141298 1145 913 146 ------
NM_014949chr1------1251
NM_014961chr4--1607 ----
NM_014962chr2012299 11839 --12204
NM_014969chr1----1265 --
NM_014989chr631927 1733 455 ----1222
NM_014990chr1421109 932 ------
NM_014991chr423135 2814 1997 12387 --
NM_014994chr152592 264 ------
NM_014996chr3--1177 ----
NM_014997chr732032 1094 686 ------
NM_015000chr1232948 2834 1006 --1470 --
NM_015001chr11637 ------
NM_015002chr1232066 1898 131 ------
NM_015017chr11184 ------
NM_015020chr1623163 3041 23651 3148 1320 --
NM_015023chr1--11497 ----
NM_015025chr212345 ------
NM_015026chr121381 ----1278
NM_015027chr1621386 1248 ------
NM_015032chr131468 1142 ----
NM_015042chr1543599 3310 872 216 --24117 763 --
NM_015045chr1011937 11743 ----
NM_015051chr932655 2302 391 --11138 --
NM_015063chr19------1255
NM_015071chr566558 6490 4211 4089 1169 152 --24982 1904 11374
NM_015075chrX11525 ------
NM_015080chr112646 306 ------
NM_015092chr1643608 3340 3031 1130 ------
NM_015093chr6--11234 ----
NM_015100chr131808 1530 646 ------
NM_015110chr942519 2112 1583 178 12255 ----
NM_015115chr4--1223 1131 --
NM_015116chr1311644 11564 ----
NM_015132chr731731 269 212 --123 --
NM_015144chr1623566 199 ----1236
NM_015149chr122111 1864 1102 1624 --
NM_015150chr34177 88 78 66 ------
NM_015155chr103543 131 87 --2990 218 --
NM_015156chr1441031 850 829 27 ------
NM_015163chr141128 1350 ----
NM_015170chr81106 --11492 --
NM_015185chrX22113 240 ------
NM_015187chr42133 52 ------
NM_015191chr1132481 1764 613 22747 358 ----
NM_015196chr4192 ------
NM_015206chr1553854 3754 3552 851 816 ----1466
NM_015215chr122088 2026 ------
NM_015216chr511081 ------
NM_015225chr92305 112 1386 --1676
NM_015230chr4--31708 1295 1206 ----
NM_015234chr621359 1117 ------
NM_015246chr1662022 1930 808 729 558 391 21375 742 ----
NM_015247chr1634320 2028 219 ------
NM_015250chr931829 1447 469 ------
NM_015252chr21387 ------
NM_015254chr852937 1160 1046 593 356 1295 22823 1144 1144
NM_015263chr15--1885 1156 --
NM_015268chr31235 ------
NM_015270chr1222257 2081 --11708 --
NM_015271chr423534 1201 1114 ----
NM_015277chr1821825 1421 --11185 --
NM_015278chr61783 ------
NM_015285chr181305 21741 533 ----
NM_015286chr1542401 2187 1983 873 11933 ----
NM_015294chr172368 306 --162 --
NM_015299chr1453635 3121 1442 1174 990 --1114 --
NM_015310chr857823 6950 5731 3266 28 --16628 --
NM_015313chr1154771 3613 3144 1577 1358 ------
NM_015315chr562692 2410 2249 2122 1266 481 12951 12404 --
NM_015316chr143910 885 307 ------
NM_015317chr212051 12091 ----
NM_015326chr142560 2309 931 765 --12770 --
NM_015329chr1912722 --12843 --
NM_015335chr1232551 2020 412 11786 --12059
NM_015339chr20------2236 25
NM_015344chr821488 605 ----11852
NM_015349chr622001 607 --11989 --
NM_015355chr171678 ----11758
NM_015365chrX23807 717 23976 3623 ----
NM_015428chr1921690 1385 ------
NM_015446chr1--21530 1216 ----
NM_015455chr51216 ------
NM_015460chr3----11623 --
NM_015483chr71466 ------
NM_015509chr1221649 152 --1660 --
NM_015511chr2031107 422 231 ----1428
NM_015535chr272785 2773 2642 1376 1088 829 432 ------
NM_015550chr712665 12476 1511 --
NM_015553chr675157 4230 3835 3540 3267 1152 634 ------
NM_015568chr2034023 1590 1472 11270 23636 960 --
NM_015569chr1--14319 ----
NM_015571chr622312 2190 ------
NM_015575chr253353 2665 2584 601 425 --12673 1183
NM_015576chr322456 467 ------
NM_015577chr511526 ------
NM_015609chr111139 22565 643 22899 2052 --
NM_015626chr17--11116 ----
NM_015640chr164934 3777 2117 1702 1056 816 1789 22027 1663 --
NM_015652chr101620 ------
NM_015690chr21691 --1217 --
NM_015695chr611742 ------
NM_015850chr841895 1708 732 402 12195 --1199
NM_015866chr1--11007 ----
NM_015872chr111264 ------
NM_015878chr821495 1431 ------
NM_015879chr1835973 5660 3363 28469 5274 1401 --
NM_015885chr111834 ------
NM_015886chr845452 4347 4004 3588 --15398 13770
NM_015888chr112155 ------
NM_015906chr123026 327 --14683 --
NM_015912chr811928 ----1294
NM_015981chr553183 3020 2693 1947 71 1645 1343 --
NM_015986chr171309 ------
NM_015995chr1565232 5025 4112 2062 913 384 15134 11315 --
NM_016025chr1621920 1470 ------
NM_016061chr241472 1278 1181 613 ------
NM_016107chr521155 998 ------
NM_016121chr1--11046 ----
NM_016122chr12------143
NM_016152chr32919 377 ------
NM_016231chr1731658 1632 1331 ------
NM_016248chr1333052 2790 1398 ------
NM_016260chr235759 4809 401 ------
NM_016263chr1921299 423 --22720 2625 --
NM_016271chr18------1813
NM_016300chr32166 122 ------
NM_016319chr122720 192 ------
NM_016322chr943255 2607 2340 859 1363 12714 --
NM_016339chr172582 217 ------
NM_016377chr621602 106 1556 ----
NM_016396chr1542546 1016 374 129 ------
NM_016424chr171404 --21298 643 --
NM_016427chr181109 ------
NM_016441chr232072 1465 885 ------
NM_016467chr21130 11406 11436 --
NM_016480chr5123 ------
NM_016485chr621795 761 ------
NM_016507chr1712191 ------
NM_016513chr632830 1101 66 ------
NM_016530chr1533338 1106 944 ------
NM_016542chrX41443 639 545 447 ------
NM_016544chr243762 2540 741 441 13658 ----
NM_016577chr334520 4056 3478 ------
NM_016603chr542104 640 608 75 ----12123
NM_016620chr11225 ------
NM_016621chr1173554 3513 3295 1840 1694 1567 1488 1732 11668 --
NM_016626chr181639 1696 ----
NM_016656chrX1424 ------
NM_016824chr1011603 ------
NM_016929chr654616 2788 1533 1004 128 --23718 3286 --
NM_016936chr1631810 315 99 --12159 --
NM_016946chr142928 2304 2295 1285 21110 478 1927 --
NM_017420chr1422911 2660 ------
NM_017423chr422061 259 1413 ----
NM_017450chr1721219 88 11018 11128 1141
NM_017452chr2021400 277 ------
NM_017453chr2021400 277 ------
NM_017454chr2021400 277 ------
NM_017456chr172620 22 ------
NM_017457chr191151 ------
NM_017544chrX3861 834 714 ------
NM_017545chr201431 1499 ----
NM_017610chr151632 ------
NM_017629chr111283 --21694 598 --
NM_017632chr4--1325 ----
NM_017633chr623332 2697 22901 1317 1594 12500
NM_017637chr959202 8915 8790 2474 1709 11099 --18834
NM_017643chr1712269 11222 ----
NM_017650chr755205 3767 1913 952 351 ------
NM_017657chr22290 124 ------
NM_017658chr1434122 4047 3761 13479 ----
NM_017679chr17----1702 --
NM_017693chr1321397 1275 11373 ----
NM_017699chr3143 ------
NM_017704chr111290 ------
NM_017709chr114041 --23932 3418 --
NM_017714chr202179 76 ------
NM_017719chr332572 2491 419 ------
NM_017730chr31103 ------
NM_017736chr1612571 --12389 2969 618
NM_017738chr921243 834 ------
NM_017739chr12557 92 ------
NM_017742chr1811419 21290 360 1260 --
NM_017769chr1422275 1000 1206 ----
NM_017787chr1072822 2712 2049 681 674 572 226 22242 367 ----
NM_017789chr21176 ------
NM_017799chr1411500 ------
NM_017813chr875643 5052 2154 2145 1478 597 78 ------
NM_017831chr1854179 3975 3525 2966 1870 11432 ----
NM_017848chrX34050 3675 118 --23831 3157 --
NM_017896chr2053132 2820 1389 1224 628 --12152 --
NM_017913chr91452 ------
NM_017921chr1742106 507 452 195 ------
NM_017945chr321388 501 ------
NM_017955chr142970 821 ------
NM_017966chr1121360 1315 --2457 100 --
NM_017988chr121333 ------
NM_017993chr13187 ------
NM_018009chr121164 ------
NM_018011chr131532 ----1418
NM_018026chr112268 254 11452 ----
NM_018027chr102829 358 22845 2071 ----
NM_018028chr1911330 ----1933
NM_018030chr18--1170 ----
NM_018061chr12310 175 ------
NM_018078chr42700 127 1242 ----
NM_018084chr212569 ------
NM_018098chr3--195 ----
NM_018121chr1022805 146 ------
NM_018128chr1721140 591 11236 ----
NM_018133chr352156 1573 1484 530 73 ------
NM_018155chr342861 2804 2526 1309 ------
NM_018157chr1232470 1145 420 --1936 --
NM_018176chr411447 2646 554 ----
NM_018178chr11265 ----142
NM_018195chr1121332 470 ------
NM_018221chr2----1161 --
NM_018227chr412275 12590 ----
NM_018244chr20169 ------
NM_018245chr101162 ------
NM_018247chr622940 1086 ------
NM_018254chr121935 833 ------
NM_018270chr201637 1305 ----
NM_018293chr323006 384 ------
NM_018313chr312521 ------
NM_018314chr111633 ------
NM_018315chr421490 1201 ------
NM_018323chr4--1598 ----
NM_018325chr931567 402 46 1631 ----
NM_018330chr1021239 342 ------
NM_018351chr1244580 3153 1124 364 ------
NM_018364chr112540 1988 ----
NM_018367chr112814 313 12251 ----
NM_018371chr8--1987 11503 --
NM_018374chr7--1340 ----
NM_018416chr1212334 12533 ----
NM_018425chr1061996 1856 1839 1061 274 40 ------
NM_018439chr1821751 898 1645 1759 --
NM_018442chr11328 ------
NM_018482chr8--12209 ----
NM_018555chr191572 1271 --1367
NM_018566chr154655 4174 3655 3129 1037 11617 ----
NM_018571chr2----1110 --
NM_018602chr1521725 1609 11478 ----
NM_018638chr1221835 1255 --1576 --
NM_018649chr101437 --1387 --
NM_018652chr153769 401 249 ------
NM_018657chr31709 ------
NM_018689chr1532586 386 163 11720 --1998
NM_018697chr71240 ------
NM_018708chr193608 602 177 --11664 --
NM_018710chr8--11222 ----
NM_018711chr1241449 1438 1025 24 ------
NM_018836chr111182 1822 --2916 73
NM_018841chr123513 2490 --13531 --
NM_018846chr7192 174 ----
NM_018898chr522359 194 11655 ----
NM_018899chr522359 194 11655 ----
NM_018900chr522359 194 11655 ----
NM_018901chr522359 194 11655 ----
NM_018902chr522359 194 11655 ----
NM_018903chr522359 194 11655 ----
NM_018904chr522359 194 11655 ----
NM_018905chr522359 194 11655 ----
NM_018906chr522359 194 11655 ----
NM_018907chr522359 194 11655 ----
NM_018908chr522359 194 11655 ----
NM_018909chr522359 194 11655 ----
NM_018910chr522359 194 11655 ----
NM_018911chr522359 194 11655 ----
NM_018945chr622673 1423 --11434 --
NM_018948chr11996 --11160 --
NM_018951chr74346 192 155 44 ------
NM_018972chr822424 873 ------
NM_018976chr1221763 123 ------
NM_018977chrX2981 354 1817 ----
NM_018979chr1222304 2003 ------
NM_018992chr162490 339 ------
NM_018999chr1033012 1563 1056 --11547 --
NM_019001chr354348 4188 3088 1361 896 ------
NM_019027chr4--12321 1857 --
NM_019036chr61942 ------
NM_019041chr612130 --2888 877 1432
NM_019045chrX1956 ------
NM_019072chr531264 431 351 1570 ----
NM_019083chr1--1276 ----
NM_019095chr20191 ------
NM_019098chr831753 1372 619 ------
NM_019106chr2212110 ----13238
NM_019555chr31739 11654 ----
NM_019605chr11677 ------
NM_019843chr223139 121 76 ------
NM_019854chr12--1135 ----
NM_019903chr1011603 ------
NM_020116chr431328 630 123 ------
NM_020122chr224840 1857 184 13834 15377
NM_020123chr1011026 --11509 --
NM_020132chr2123933 1011 1115 ----
NM_020145chr91592 --1480 183
NM_020150chr1011746 --1210 1536
NM_020159chr4147 ----1273
NM_020177chr522876 587 ------
NM_020180chr181843 ------
NM_020182chr2033412 1456 1139 12340 11078 --
NM_020185chr61397 --150 --
NM_020193chr1111292 ------
NM_020204chr12257 140 ------
NM_020205chr122980 329 ------
NM_020239chr122217 2036 --1499 --
NM_020245chr634863 4831 1329 ------
NM_020248chr142246 1673 434 354 1942 ----
NM_020309chr1911111 ------
NM_020310chr1732408 1757 554 22098 385 ----
NM_020338chr1033161 1477 712 --1507 --
NM_020341chr202675 115 ------
NM_020342chr21718 --1151 --
NM_020344chr9--1128 ----
NM_020346chr1111495 ------
NM_020357chr321356 1326 ------
NM_020381chr621816 733 ------
NM_020383chr10--1267 ----
NM_020403chr1311290 ------
NM_020429chr732044 968 394 --22049 172 11134
NM_020432chr711430 ------
NM_020438chr911210 ------
NM_020443chr132500 1431 158 14987 15781 --
NM_020452chr131340 133 86 --1564 --
NM_020465chr1641744 1498 1422 538 --21914 558 --
NM_020466chr645011 4704 3290 436 2660 114 1700 --
NM_020529chr141449 ------
NM_020640chr322100 626 ------
NM_020644chr112729 386 ------
NM_020647chr842341 2088 2027 1905 ------
NM_020666chr5--1689 ----
NM_020673chr2056178 5248 5084 1950 845 22954 2195 --22134 1433
NM_020698chr1223101 877 33073 1906 310 ----
NM_020699chr1195 25074 4866 14805 --
NM_020708chr2012433 ------
NM_020711chr252439 2115 2044 1957 720 ------
NM_020713chr2052750 2404 2266 1980 284 1398 12698 1419
NM_020714chr1953955 2909 1133 576 567 ----14327
NM_020717chrX13208 14027 11917 --
NM_020734chr1222906 574 --12348 13253
NM_020740chr171337 ------
NM_020742chrX22276 692 --1186 --
NM_020752chr1012661 12113 12014 --
NM_020766chrX24548 87 12800 22948 646 --
NM_020772chr1737565 6571 5493 17542 ----
NM_020794chr121379 230 ------
NM_020796chr542737 2703 2126 1849 1186 ----
NM_020801chr532558 2093 1793 ------
NM_020803chr432074 786 474 11791 ----
NM_020809chr111655 ------
NM_020819chr611212 1975 ----
NM_020824chr102796 114 ------
NM_020832chr11548 ------
NM_020841chr1242720 820 708 69 ------
NM_020850chr164670 363 236 80 12675 --1402
NM_020858chr1521781 217 ------
NM_020859chr453114 2935 2684 811 106 --21281 366 --
NM_020868chr21229 11390 ----
NM_020870chr422051 1368 11826 ----
NM_020922chrX1563 ------
NM_020935chr214205 --1709 --
NM_020948chr12765 41 ----13191
NM_020951chr1911528 ------
NM_020960chr923639 3521 --1373 --
NM_020964chr1833584 3116 1388 1733 13838 --
NM_020981chr2163 196 ----
NM_020987chr101308 11301 ----
NM_020993chr1222776 460 11988 1969 --
NM_021007chr2------12133
NM_021012chr1732195 2049 371 --23006 2201 --
NM_021072chr511901 ----11953
NM_021079chr17173 ------
NM_021097chr212101 12077 --12463
NM_021100chr20128 1298 ----
NM_021116chr737828 7079 2109 13392 --17671
NM_021132chr1011245 ------
NM_021136chr141602 ------
NM_021141chr21977 --1236 --
NM_021145chr711128 --1846 --
NM_021151chr72332 66 ------
NM_021155chr1941908 782 773 151 --1201 --
NM_021159chr41432 ------
NM_021165chr11264 ------
NM_021177chr6--139 ----
NM_021205chr152815 2523 2199 2030 735 ------
NM_021215chr2052218 1980 831 793 269 ------
NM_021224chr91394 ------
NM_021238chr1221879 288 ------
NM_021242chrX----1251 --
NM_021249chr1431698 1502 1398 ------
NM_021252chr101828 ------
NM_021253chr631435 1098 226 ------
NM_021622chr101140 22124 798 ----
NM_021627chr311178 --133 --
NM_021637chrX11249 ------
NM_021643chr221866 460 ----11835
NM_021647chr424695 1464 64628 3628 1685 1556 799 286 ----
NM_021728chr141855 ------
NM_021813chr634406 2335 110 14370 ----
NM_021814chr611398 ------
NM_021912chr1543559 3541 3473 1357 23700 565 ----
NM_021940chr61144 ------
NM_021956chr6--11295 ----
NM_021961chr1144821 2805 2404 1516 --15340 --
NM_021964chr321797 727 12090 ----
NM_021988chr2041295 1219 1002 296 ------
NM_022041chr1622697 125 12068 ----
NM_022044chr221118 ------
NM_022048chr1546218 4620 3920 1517 11222 11879 --
NM_022075chr12709 200 ------
NM_022085chr631339 1106 478 1362 ----
NM_022114chr144084 1836 841 381 11528 1329 14430
NM_022143chr71120 11095 ----
NM_022152chr22216 178 ------
NM_022154chr4--11286 ----
NM_022340chr312272 ----13544
NM_022366chr1123 ------
NM_022371chr12270 141 --1530 --
NM_022442chr2041295 1219 1002 296 ------
NM_022457chr11239 ------
NM_022458chr732942 2746 277 ------
NM_022459chr1355177 4451 4405 1893 968 15800 --1440
NM_022461chr321328 168 ------
NM_022465chr1212862 12193 ----
NM_022473chr1543721 3671 2741 861 34157 1528 90 ----
NM_022483chr521441 1206 --11799 --
NM_022566chr152474 244 ------
NM_022648chr234547 4052 777 --1713 --
NM_022650chr51250 ----1157
NM_022716chr122712 562 22432 1266 --12740
NM_022719chr2273852 3295 3108 3044 1524 1326 601 ------
NM_022726chr621201 1179 1647 --1610
NM_022730chr22341 139 ------
NM_022745chr122225 106 ------
NM_022753chr122757 235 ------
NM_022758chr622036 933 --22936 972 --
NM_022763chr31149 1880 ----
NM_022781chr963326 3035 2758 2642 749 564 ----1429
NM_022802chr10------1431
NM_022824chr52751 605 ------
NM_022826chr211188 ------
NM_022828chr511718 ------
NM_022845chr1631726 1719 692 ------
NM_022893chr222621 2039 1970 ----
NM_022898chr1434425 3499 3006 --1896 13299
NM_022910chr1641744 1498 1422 538 --21914 558 --
NM_022912chr231213 902 313 ------
NM_022913chr51223 ------
NM_022918chr1121857 1649 ------
NM_022965chr431417 1164 253 --158 --
NM_023000chr14--1422 ----
NM_023001chr14--1422 ----
NM_023016chr212317 ------
NM_023034chr81187 --1158 --
NM_023071chr121232 ------
NM_023079chr1731899 1536 1197 ------
NM_023105chr841895 1708 732 402 12195 --1199
NM_023106chr841895 1708 732 402 12195 --1199
NM_023110chr841895 1708 732 402 12195 --1199
NM_023111chr841895 1708 732 402 12195 --1199
NM_023923chr143694 2802 2793 437 ------
NM_023927chr541158 978 944 92 ------
NM_023940chr41808 ------
NM_024007chr52836 201 12599 ----
NM_024019chr41367 ------
NM_024034chr2021016 21 ------
NM_024050chr192240 204 ------
NM_024060chr111216 ------
NM_024061chr7----1169 --
NM_024092chr1131219 1058 324 ------
NM_024094chr81636 ------
NM_024111chr151655 --1217 --
NM_024294chr622036 933 --22936 972 --
NM_024306chr163953 479 205 1224 ----
NM_024345chr934627 366 35 ------
NM_024421chr18----1432 --
NM_024423chr1824292 109 ------
NM_024424chr113849 267 178 ------
NM_024425chr113849 267 178 ------
NM_024426chr113849 267 178 ------
NM_024496chr142288 225 ------
NM_024522chr141821 1375 684 90 --11683 --
NM_024524chr31312 ------
NM_024527chr19--130 ----
NM_024545chr2----2717 299 --
NM_024546chr131260 ------
NM_024551chr1242386 1868 885 655 --1348 --
NM_024551chr1242386 1868 885 655 --1348 --
NM_024590chr421539 1518 1501 11304 --
NM_024595chr11434 ------
NM_024646chr143349 3259 1416 715 ------
NM_024665chr323808 749 1803 1648 --
NM_024721chr811033 ------
NM_024744chr21828 136 ----
NM_024753chr23200 171 25 1238 ----
NM_024761chr9148 24933 3996 ----
NM_024771chr1162137 2026 1783 1739 987 428 ------
NM_024798chr1522731 671 --12307 --
NM_024834chr1011762 ------
NM_024875chr10----11524 --
NM_024881chr1933399 3147 661 22562 1359 --22759 31
NM_024899chr18--1461 ----
NM_024900chr452110 2101 729 132 111 ----1441
NM_024900chr452110 2101 729 132 111 ----1441
NM_024947chr399288 9191 8908 5847 3836 3380 2563 1680 767 16842 37347 7236 6158 --
NM_024989chr248193 8164 2875 2389 --15139 16877
NM_025057chr142533 144 ------
NM_025073chr134071 551 523 --11870 --
NM_025076chr21576 ------
NM_025099chr1741135 356 154 146 --1894 --
NM_025133chr2--11020 1291 --
NM_025134chr1612342 ------
NM_025146chr342695 2312 1711 673 --1593 1744
NM_025147chr211049 1915 ----
NM_025160chr153341 1273 1037 985 71 23228 1538 ----
NM_025164chr1141834 830 809 771 --1270 --
NM_025191chr121303 21 13420 ----
NM_025222chr352963 2920 1001 763 200 ------
NM_025248chr17--21150 1141 33065 2668 172 --
NM_025250chr722472 738 --12280 --
NM_025263chr651282 723 511 310 176 ------
NM_030576chr171992 11968 1654 --
NM_030621chr1411404 ----1607
NM_030625chr1031670 404 287 ------
NM_030627chr51867 12664 13512 --
NM_030634chr121676 1530 ----1279
NM_030640chr121306 ------
NM_030647chr775185 5172 4767 4314 4237 284 192 12454 ----
NM_030648chr434334 2096 261 14175 ----
NM_030650chr221142 894 13537 12877 --
NM_030664chr1011816 12364 ----
NM_030751chr101392 ------
NM_030751chr101392 ------
NM_030780chr821693 285 ------
NM_030786chr111463 1770 --11271
NM_030799chr511896 ------
NM_030802chr173887 259 47 ------
NM_030806chr147460 3236 2450 312 12689 27901 2617 --
NM_030808chr172820 224 ------
NM_030810chr631339 1106 478 1362 ----
NM_030816chr122979 944 ------
NM_030881chr2212328 --1390 --
NM_030915chr252055 1923 585 354 150 ------
NM_030927chr1031524 1035 620 11281 1160 --
NM_030937chr141190 331 164 22 --11301 --
NM_030939chr62890 354 ------
NM_030958chr8133 ------
NM_031157chr121491 ------
NM_031216chr1811583 ------
NM_031231chr202555 118 ------
NM_031232chr202555 118 ------
NM_031243chr722244 620 --11999 --
NM_031262chr91450 --1247 --
NM_031263chr9----1304 --
NM_031314chr14------11371
NM_031369chr41565 ------
NM_031370chr41565 ------
NM_031372chr411387 ------
NM_031411chr522359 194 11655 ----
NM_031427chr1444764 2166 1912 1667 45723 4562 1982 888 25338 4905 --
NM_031442chrX32148 655 452 ------
NM_031445chr242328 1297 974 860 --11061 --
NM_031452chr15174 ------
NM_031469chr61458 22948 539 13328 --
NM_031476chr1652620 2263 675 532 212 --1334 --
NM_031483chr2023321 616 1953 ----
NM_031844chr134050 1627 324 13678 ----
NM_031845chr233624 1131 878 ------
NM_031847chr233624 1131 878 ------
NM_031849chr522359 194 11655 ----
NM_031857chr522359 194 11655 ----
NM_031858chr1711294 --11040 11172
NM_031860chr522359 194 11655 ----
NM_031862chr1711294 --11040 11172
NM_031899chr31104 --11077 --
NM_031938chr11----1646 --
NM_032042chr522451 1127 ------
NM_032047chr352313 2183 740 589 434 ------
NM_032102chr1121007 611 ------
NM_032121chrX21089 853 ------
NM_032139chr191298 ------
NM_032186chr11225 ------
NM_032199chr1033348 3201 1319 23610 3429 13238 1202
NM_032208chr233036 2891 516 --13093 --
NM_032221chr201621 1275 1467 --
NM_032228chr1123444 425 ------
NM_032236chr12701 377 ------
NM_032242chr3----13086 --
NM_032271chr1621426 477 --1423 --
NM_032288chr332311 2247 2083 --1642 --
NM_032295chr7----1250 --
NM_032348chr13820 176 105 --1873 --
NM_032433chr1931299 469 380 ------
NM_032446chr511080 --11410 --
NM_032449chr131834 1825 890 ------
NM_032466chr8--1345 ----
NM_032482chr1942610 2308 817 413 11683 11816 --
NM_032505chr321715 796 --1720 --
NM_032547chr421305 458 ------
NM_032550chr101342 31158 396 48 ----
NM_032552chr911224 --21908 613 --
NM_032575chr1621874 1670 ------
NM_032590chr121443 ------
NM_032632chr14--1123 ----
NM_032638chr321086 376 --1569 --
NM_032646chr1711360 --1618 1649
NM_032682chr332604 1340 1228 ------
NM_032689chr1931074 1030 142 ------
NM_032701chr192564 141 ------
NM_032711chr1754176 3499 3202 3181 625 53768 3440 3239 1213 1175 21203 289 --
NM_032810chr104343 280 178 41 ------
NM_032842chr721547 592 ------
NM_032846chr1421442 591 ------
NM_032859chr131800 32738 2574 628 ----
NM_032876chr1411382 ------
NM_032883chr201878 ------
NM_032884chr11302 ------
NM_032975chr1852969 2938 2659 2217 1167 178 ----
NM_032980chr1852969 2938 2659 2217 1167 178 ----
NM_032995chr22579 58 1149 1199 --
NM_033020chr123026 327 --14683 --
NM_033030chr221213 225 11326 ----
NM_033036chr112520 243 ----1249
NM_033081chr2011219 ------
NM_033089chr20--1179 ----
NM_033119chr161819 ------
NM_033132chr13--11670 ----
NM_033133chr1722870 1030 1906 1994 --
NM_033138chr71626 ------
NM_033139chr71626 ------
NM_033140chr71626 ------
NM_033157chr71626 ------
NM_033224chr746806 6345 2482 1963 --18014 --
NM_033225chr8168 ------
NM_033226chr162196 182 ------
NM_033274chr542722 1127 783 454 1845 ----
NM_033285chr8124 21295 993 11349 --
NM_033290chrX53422 3112 2756 2565 1099 ------
NM_033326chr1112182 --22507 1001 --
NM_033331chr91294 12624 ----
NM_033360chr1224513 393 --1442 --
NM_033389chr1754766 4350 3006 1898 124 --24382 775 --
NM_033449chr531667 803 725 ------
NM_033503chr1532861 2467 1389 22876 2521 13484 --
NM_033505chr221220 750 11589 ----
NM_033535chr421155 278 ------
NM_033551chr562692 2410 2249 2122 1266 481 12951 12404 --
NM_033624chr1232066 1898 131 ------
NM_033631chr143676 2400 2385 345 ------
NM_033632chr421490 1201 ------
NM_052834chr181305 21741 533 ----
NM_052840chr15----1133 21236 231
NM_052869chr1711360 --1618 1649
NM_052879chr1224015 3551 ------
NM_052880chr2231338 565 38 ------
NM_052885chr1211059 164 13399 --
NM_052886chr842102 1918 1885 651 ------
NM_052898chr81162 --21692 1468 --
NM_052905chr2--11277 ----
NM_052906chr2224102 3838 122 33519 1822 1399 --
NM_052910chr13----11516 --
NM_052918chr1033560 3024 709 ------
NM_052927chr512036 ------
NM_052932chr111545 ------
NM_053002chr321080 287 ------
NM_053016chr927814 2319 --17819 17746
NM_053023chr1122727 1046 --12559 --
NM_053024chr3----1145 --
NM_053043chr755113 4648 3980 2192 899 --1201 --
NM_053064chr1432116 733 250 ------
NM_054016chr11285 1273 ----
NM_054016chr11285 1273 ----
NM_054016chr11285 1273 ----
NM_057159chr921243 326 ------
NM_057161chr61219 ------
NM_057175chr432474 2243 646 ------
NM_057178chr1722253 671 22328 589 11133 --
NM_058170chr111423 --1134 --
NM_058172chr411682 --11687 --
NM_058241chr212203 ------
NM_058241chr212203 ------
NM_078629chrX--2644 547 ----
NM_078630chrX--2644 547 ----
NM_079834chr1931433 520 294 ------
NM_080392chr1----1507 --
NM_080546chr911614 ------
NM_080594chr161174 ------
NM_080597chr18--1170 ----
NM_080616chr202602 81 ------
NM_080629chr12278 47 --1202 --
NM_080630chr12278 47 --1202 --
NM_080671chr232136 1909 1731 ------
NM_080676chr2042702 1079 364 211 --12445 --
NM_080717chr121397 ------
NM_080742chr61187 ------
NM_080759chr1332278 911 797 11005 ----
NM_080760chr1332278 911 797 11005 ----
NM_080792chr2012035 21795 557 ----
NM_080867chr1423773 592 33220 1934 1374 ----
NM_080872chr833937 1528 1437 ------
NM_080881chr52675 237 ------
NM_080927chr31678 ------
NM_130391chr913538 1790 1383 --
NM_130392chr913538 1790 1383 --
NM_130393chr913538 1790 1383 --
NM_130436chr2132326 1714 320 ------
NM_130438chr2132903 2291 897 ------
NM_130440chr111506 ------
NM_130798chr15--11377 ----
NM_130808chr3--1130 ----
NM_130811chr201223 ------
NM_130838chr15196 11434 ----
NM_130839chr15196 11434 ----
NM_130847chr1135794 5605 541 ------
NM_133170chr2057215 6410 1857 834 130 17005 15142 --
NM_133171chr2041055 980 112 71 ------
NM_133372chr532014 2005 28 1689 ----
NM_133378chr21294 ------
NM_133432chr21294 ------
NM_133437chr21294 ------
NM_133446chr10133 ------
NM_133468chr732020 1949 610 2519 37 ----
NM_133477chr42736 511 ------
NM_133486chrX1389 ------
NM_133631chr321355 613 --11464 --
NM_133646chr224537 1455 --35532 4312 1253 --
NM_134260chr15--1129 ----
NM_134261chr15--1129 ----
NM_134262chr15--1129 ----
NM_134265chr17--11116 ----
NM_134428chr91343 ------
NM_138316chr102445 328 ------
NM_138357chr101711 ------
NM_138369chr5--139 ----
NM_138370chr21765 ------
NM_138391chr11256 ------
NM_138396chr12--1339 1897 1652
NM_138415chr2221691 409 ------
NM_138426chr7--12165 ----
NM_138437chrX165 ------
NM_138457chr612747 --11159 --
NM_138468chr245346 4634 4436 202 ------
NM_138473chr1235100 4812 3588 --1226 --
NM_138576chr1434425 3499 3006 --1896 13299
NM_138578chr201307 --11305 --
NM_138633chr621602 106 1556 ----
NM_138713chr1647339 2693 1650 836 ------
NM_138714chr1647339 2693 1650 836 ------
NM_138731chr1444162 4153 3485 329 143 ----
NM_138732chr112646 306 ------
NM_138734chr112646 306 ------
NM_138736chr1654158 3931 3119 504 454 1985 11018 --
NM_138766chr5----1553 --
NM_138775chr111778 ----156
NM_138821chr5----1553 --
NM_138822chr5----1553 --
NM_138970chr1441894 1605 832 134 --1895 --
NM_138971chr1121481 517 13786 ----
NM_138971chr1121481 517 13786 ----
NM_138972chr1121481 517 13786 ----
NM_138972chr1121481 517 13786 ----
NM_138973chr1121481 517 13786 ----
NM_138973chr1121481 517 13786 ----
NM_139014chr61913 ------
NM_139015chr1211145 ------
NM_139045chr9----1851 --
NM_139070chr51451 ------
NM_139071chr121115 ------
NM_139135chr111014 ----1956
NM_139168chr521846 450 ------
NM_139182chr4--31708 1295 1206 ----
NM_139243chr4145 ------
NM_139276chr1741821 951 921 375 11473 --11592
NM_139283chr1242576 2220 490 337 ------
NM_139323chr201163 11305 ----
NM_144571chr466781 6042 5249 2549 1023 645 ------
NM_144578chr1434333 3571 82 ------
NM_144579chr272756 2583 2192 2025 466 455 449 --22812 1809 --
NM_144580chr11236 ------
NM_144586chr221242 487 ------
NM_144590chr1032595 2478 405 1657 ----
NM_144599chr1534658 3931 131 14168 13415 --
NM_144642chr31408 ------
NM_144664chr112917 116 ------
NM_144723chr51665 ------
NM_144732chr192839 409 ------
NM_144778chr1311679 ------
NM_144963chr8------11807
NM_144967chrX2742 198 ------
NM_145005chr91182 ------
NM_145055chr1833781 1404 925 1271 ----
NM_145112chr14170 ------
NM_145113chr141342 ------
NM_145117chr111525 22451 974 ----
NM_145165chr142281 40 22682 2428 ----
NM_145176chr622797 260 12258 ----
NM_145185chr1921686 690 ------
NM_145203chr131300 --1123 1170
NM_145206chr1032770 2228 185 ------
NM_145307chr1013252 11559 14018 --
NM_145320chr712665 12476 1511 --
NM_145321chr712665 12476 1511 --
NM_145322chr712665 12476 1511 --
NM_145332chr61633 ------
NM_145333chr61633 ------
NM_145686chr243331 2614 1263 386 --1233 --
NM_145687chr243331 2614 1263 386 --1233 --
NM_145698chr1021417 581 ------
NM_145727chr62388 46 ------
NM_145728chr1542401 2187 1983 873 11933 ----
NM_145753chr321547 667 1304 ----
NM_145800chrX1745 ------
NM_145802chrX1694 ------
NM_145808chr71798 ----22863 527
NM_145859chr32368 302 ------
NM_145860chr32368 302 ------
NM_145909chr61912 --1216 --
NM_147156chr10------11140
NM_147175chrX12140 ------
NM_147223chr211877 ------
NM_148174chr821495 1431 ------
NM_148894chr4166 ------
NM_148977chr102445 328 ------
NM_148978chr102445 328 ------
NM_152233chr1431698 1502 1398 ------
NM_152253chr2241307 553 462 29 --11077 --
NM_152265chr12285 219 ------
NM_152267chr2231867 870 67 2716 45 ----
NM_152300chr1731422 693 232 1138 ----
NM_152380chr111414 ------
NM_152388chr223927 3106 12530 ----
NM_152400chr421925 707 ------
NM_152409chr533123 2520 1450 22770 762 ----
NM_152414chr81278 ------
NM_152422chr91219 ------
NM_152423chrX21577 541 ------
NM_152446chr141155 ------
NM_152470chr181536 --22583 142 --
NM_152493chr11207 --1367 --
NM_152519chr21806 ------
NM_152522chr21862 ------
NM_152556chr732395 1960 723 1557 12009 1981
NM_152574chr91156 ------
NM_152594chr15--12006 ----
NM_152624chr5136940 6672 5817 5543 5297 5250 5150 4595 2486 1924 1742 1540 477 ------
NM_152638chr1221238 266 ------
NM_152653chr31496 ------
NM_152671chr21105 ------
NM_152678chr342543 1703 1694 341 --12287 --
NM_152699chr363689 2894 2885 2309 591 316 ----12606
NM_152716chr112624 211 ------
NM_152721chr181707 ------
NM_152734chr645514 3378 2019 100 --1322 --
NM_152756chr534101 2649 493 ------
NM_152758chr831908 645 617 ------
NM_152787chrX23096 2594 11460 12677 --
NM_152792chr2136 ------
NM_152793chr744365 3399 2017 1490 ------
NM_152835chr132703 2623 369 ----2783 525
NM_152838chr2042771 1262 1061 624 12691 ----
NM_152857chr6----1966 --
NM_152858chr6----1966 --
NM_152890chr11521 ------
NM_152910chr13148 ------
NM_152989chr1211262 ------
NM_153029chr1643033 1345 582 514 --24027 3215 --
NM_153035chr131018 575 439 --1205 1908
NM_153184chr311275 ------
NM_153188chr545052 4996 1829 1562 13817 11498 --
NM_153207chr1234112 942 686 ------
NM_153252chrX1115 ------
NM_153367chr1073433 3014 2915 2432 1589 1127 859 1687 ----
NM_153371chr1342115 780 321 107 22240 459 ----
NM_153453chr61324 ------
NM_153607chr522715 2137 --11158 --
NM_153616chr1521781 217 ------
NM_153617chr1521781 217 ------
NM_153618chr1521781 217 ------
NM_153619chr1523019 1455 ------
NM_153689chr211632 1367 ----
NM_153715chr74346 192 155 44 ------
NM_153756chr121613 602 ------
NM_153810chr1055055 4488 3126 501 395 ------
NM_153812chr141737 812 669 97 --32170 797 601 --
NM_153836chr2125 --2525 282 --
NM_170606chr711586 ------
NM_170665chr1234567 3687 1826 --14452 1109
NM_170695chr181426 ------
NM_170721chr171939 11200 1405 --
NM_171825chr553183 3020 2693 1947 71 1645 1343 --
NM_172016chr631435 1098 226 ------
NM_172020chr721609 687 ------
NM_172058chr82734 442 1113 ----
NM_172059chr82734 442 1113 ----
NM_172060chr82734 442 1113 ----
NM_172069chr22912 744 ----12011
NM_172070chr222129 515 11938 ----
NM_172071chr136511 1690 850 ------
NM_172078chr7----136 --
NM_172079chr7----136 --
NM_172080chr7----136 --
NM_172081chr7----136 --
NM_172082chr7----136 --
NM_172083chr7----136 --
NM_172084chr7----136 --
NM_172103chr642348 2206 1737 251 ------
NM_172105chr642348 2206 1737 251 ------
NM_172115chr41106 ------
NM_172127chr42618 505 1727 ----
NM_172128chr42574 461 1683 ----
NM_172169chr1021946 689 --11590 --
NM_172170chr1021946 689 --11590 --
NM_172171chr1021946 689 --11590 --
NM_172173chr1021946 689 --11590 --
NM_172337chr141855 ------
NM_173054chr71625 1110 ----
NM_173065chr123612 3123 --2950 224 --
NM_173075chr41526 ------
NM_173078chrX----1402 --
NM_173083chr111219 ------
NM_173156chr112032 --1578 --
NM_173163chr16--1457 ----
NM_173165chr16--1338 ----
NM_173172chr21257 ------
NM_173174chr8172 ------
NM_173175chr8172 ------
NM_173176chr8172 ------
NM_173207chr181426 ------
NM_173208chr181426 ------
NM_173209chr181426 ------
NM_173210chr181426 ------
NM_173211chr181426 ------
NM_173214chr1647339 2693 1650 836 ------
NM_173468chr433679 2342 478 ------
NM_173472chr3--154 ----
NM_173473chr103719 666 26 ------
NM_173495chrX2969 769 ------
NM_173510chr2232923 1029 240 ------
NM_173511chr232924 2849 490 ------
NM_173515chr63396 371 329 ------
NM_173557chr181103 ------
NM_173562chr652551 2491 792 496 249 ------
NM_173595chr1235270 1787 691 --15038 --
NM_173602chr1211277 --1753 --
NM_173626chr17--1537 ----
NM_173683chr841334 1282 1121 403 1530 ----
NM_173808chr111054 ------
NM_173822chr21855 ------
NM_173825chr322724 2566 ------
NM_173829chr556038 5240 4365 2458 750 ------
NM_174886chr181426 ------
NM_174890chr10--1177 ----
NM_174911chr823345 1083 11370 11160 31393 554 141
NM_174916chr1532179 359 331 ------
NM_174921chr4----11066 --
NM_174934chr1131315 1207 270 ----11327
NM_174937chr101611 ------
NM_174963chr12316 128 ------
NM_174964chr12316 128 ------
NM_174965chr12335 147 ------
NM_174966chr12316 128 ------
NM_174967chr12335 147 ------
NM_174968chr12316 128 ------
NM_174969chr12316 128 ------
NM_174970chr12335 147 ------
NM_174971chr12316 128 ------
NM_174976chr1431984 398 106 --21991 161 --
NM_175061chr7----11744 --
NM_175610chr151216 ------
NM_175624chr1246682 5300 1551 1439 12698 ----
NM_175625chr1246682 5300 1551 1439 12698 ----
NM_175634chr811083 ----11209
NM_175635chr811083 ----11209
NM_175636chr811083 ----11209
NM_175733chr1112140 2334 165 ----
NM_175736chr1247002 6108 2865 183 11632 ----
NM_175748chr142842 305 ----11594
NM_175852chr142788 2474 1959 609 1963 ----
NM_175854chr1322567 866 --12282 --
NM_175856chr5154 ------
NM_175866chr1--1369 ----
NM_175907chr1831743 1073 87 ------
NM_176814chr7163 ------
NM_176863chr1731693 1680 361 1503 1834 --
NM_177438chr1411404 ----1607
NM_177559chr2031239 815 409 ------
NM_177560chr2031239 815 409 ------
NM_177925chr121255 12660 --1158
NM_177966chr321303 538 ------
NM_177972chr1183914 3414 1711 1675 1212 1044 738 492 --1652 --
NM_177985chr212058 11538 --12290
NM_177990chr202675 115 ------
NM_177995chr91219 ------
NM_177996chr2052464 2383 1175 987 296 --12285 --
NM_177999chr942696 1045 618 189 ------
NM_178010chr1211262 ------
NM_178151chrX56847 2233 1756 618 93 37588 1913 1015 15785 --
NM_178152chrX56847 2233 1756 618 93 37588 1913 1015 15785 --
NM_178153chrX56847 2233 1756 618 93 37588 1913 1015 15785 --
NM_178424chr5161 ------
NM_178539chr1211529 ----1275
NM_178568chr1721413 111 ------
NM_178585chr423135 2814 1997 12387 --
NM_178812chr81485 ------
NM_180989chr131891 ------
NM_181054chr142998 185 ------
NM_181332chrX22276 692 --1186 --
NM_181349chr732044 968 394 --22049 172 11134
NM_181351chr1132965 1141 381 11149 ----
NM_181353chr201549 ------
NM_181361chr31206 --1211 --
NM_181442chr20------2236 25
NM_181443chr2012299 11839 --12204
NM_181458chr21172 ------
NM_181486chr121397 ------
NM_181491chr932416 873 90 --22589 2189 --
NM_181504chr564024 3456 3392 3285 1671 1661 ------
NM_181523chr564024 3456 3392 3285 1671 1661 ------
NM_181524chr564024 3456 3392 3285 1671 1661 ------
NM_181659chr2022494 846 1494 ----
NM_181659chr2022494 846 1494 ----
NM_181670chr12------11422
NM_181702chr81252 ------
NM_181746chr12709 200 ------
NM_181782chr6----12052 --
NM_181783chr1241675 1374 1244 360 ------
NM_181787chr823109 2554 ------
NM_181836chr5--22436 1940 ----
NM_181844chr1731593 1572 193 ------
NM_181861chr1221084 269 --11970 --
NM_181868chr1221084 269 --11970 --
NM_181869chr1221169 354 --12055 --
NM_181886chr411277 ------
NM_181887chr411277 ------
NM_181888chr411277 ------
NM_181889chr411277 ------
NM_181890chr411277 ------
NM_181891chr411277 ------
NM_181892chr411324 ------
NM_181893chr411277 ------
NM_182485chr411126 ------
NM_182487chr954211 3114 1313 1044 497 --1559 13353
NM_182501chr21713 13042 --22423 330
NM_182502chr4188 ------
NM_182503chr655475 3414 1514 1181 849 14344 ----
NM_182511chr1831251 992 960 ------
NM_182515chr1932537 1926 1481 34496 4098 491 12156 --
NM_182526chr1473140 3092 2577 1029 528 414 256 --12542 167
NM_182580chr122175 115 162 21990 277 --
NM_182603chr111922 --193 --
NM_182620chr1711687 ----1106
NM_182643chr82400 380 12080 ----
NM_182645chr61324 ------
NM_182646chr411126 ------
NM_182666chr3189 ------
NM_182700chr71611 ------
NM_182715chr71115 ------
NM_182717chr1031082 998 977 --11336 --
NM_182720chr1031082 998 977 --11336 --
NM_182721chr1031082 998 977 --11336 --
NM_182722chr1031082 998 977 --11336 --
NM_182723chr1031082 998 977 --11336 --
NM_182728chr1431811 1724 133 ----11534
NM_182758chr15--33145 2575 878 ----
NM_182764chr2041055 980 112 71 ------
NM_182797chr201321 ------
NM_182830chr1421516 365 ------
NM_182853chr1031082 998 977 --11336 --
NM_182894chr1431668 1640 143 ------
NM_182898chr745106 4214 1552 225 --11815 --
NM_182899chr745106 4214 1552 225 --11815 --
NM_182907chr611730 21665 47 11478 --
NM_182920chr31584 ----11048
NM_182964chr111525 22451 974 ----
NM_182972chr122151 749 1253 ----
NM_182976chr11268 ------
NM_183004chr1411167 ------
NM_183011chr1031082 998 977 --11336 --
NM_183012chr1031082 998 977 --11336 --
NM_183013chr1031082 998 977 --11336 --
NM_183061chr31126 ------
NM_183078chr621016 404 ------
NM_183234chr1521658 636 ------
NM_183235chr1521658 636 ------
NM_183236chr1521658 636 ------
NM_183393chr31333 ------
NM_183394chr31333 ------
NM_183397chr2064879 4097 4027 3899 3182 328 --2597 86 --
NM_194301chr142937 760 ------
NM_194313chr931297 487 113 ----11483
NM_194314chr144028 3584 3466 2074 11169 ----
NM_194328chr963326 3035 2758 2642 749 564 ----1429
NM_194329chr963326 3035 2758 2642 749 564 ----1429
NM_194330chr963326 3035 2758 2642 749 564 ----1429
NM_194332chr963326 3035 2758 2642 749 564 ----1429
NM_194429chr62363 106 ------
NM_194442chr111463 ------
NM_197968chr131608 ----1635
NM_197970chr221213 225 11326 ----
NM_198074chr12542 213 ------
NM_198081chr662794 2534 2224 2167 2038 259 11865 ----
NM_198086chr1411382 ------
NM_198128chr18------1813
NM_198158chr311029 11967 ----
NM_198159chr311029 11967 ----
NM_198177chr311029 11967 ----
NM_198178chr311029 11967 ----
NM_198182chr231426 188 162 ------
NM_198195chr31170 --1176 --
NM_198225chr1031949 783 639 ------
NM_198243chr154969 821 793 151 ------
NM_198503chr11347 ------
NM_198513chr81394 ------
NM_198560chr343688 2669 2495 492 --11472 --
NM_198581chr267096 5678 2357 2104 1264 1049 ------
NM_198715chr165798 5781 5702 5204 1654 1191 ------
NM_198859chr365060 4322 3232 1911 1436 970 ------
NM_198880chr31103 ------
NM_198900chr1247002 6108 2865 183 11632 ----
NM_198935chr2053244 2451 210 193 94 178 ----
NM_198956chr71611 ------
NM_198991chr18----1278 --
NM_199131chr1043271 2677 2307 446 --11140 --
NM_199144chr2041295 1219 1002 296 ------
NM_199169chr2033412 1456 1139 12340 11078 --
NM_199170chr2033412 1456 1139 12340 11078 --
NM_199171chr2033412 1456 1139 12340 11078 --
NM_199188chr1224015 3551 ------
NM_199190chr1224015 3551 ------
NM_199203chr2041295 1219 1002 296 ------
NM_199229chr21172 ------
NM_199290chr17126 ------
NM_199324chr442952 2652 2329 763 ------
NM_199355chr1621185 562 ------
NM_199421chr1423773 592 33220 1934 1374 ----
NM_199454chr144084 1836 841 381 11528 1329 14430
NM_199478chrX41431 1343 447 216 11263 ----
NM_199487chr20169 ------
NM_201266chr272798 2619 2555 2261 1872 851 822 ------
NM_201269chr11225 ------
NM_201279chr272798 2619 2555 2261 1872 851 822 ------
NM_201280chr6----21227 564 --
NM_201428chr111132 ------
NM_201429chr111132 ------
NM_201430chr11158 ------
NM_201567chr331662 1394 1195 ------
NM_201568chr112032 --1578 --
NM_201569chr112032 --1578 --
NM_201591chr421260 41 ------
NM_201592chr421260 41 ------
NM_201624chr11184 ------
NM_203291chr18169 ------
NM_203292chr18162 ------
NM_203349chr152640 212 ------
NM_203350chr1----168 --
NM_203351chr1721853 1632 ------
NM_203394chr1212209 22074 2055 12318 --
NM_203399chr14791 542 267 211 ------
NM_203401chr14791 542 267 211 ------
NM_203403chr9275 26 ------
NM_203437chr22290 124 ------
NM_203446chr211562 ------
NM_203464chr15798 455 299 195 64 ------
NM_203487chr1311290 ------
NM_205768chr112051 ----12060
NM_206832chr172332 268 ------
NM_206852chr141602 ------
NM_206853chr611183 13581 ----
NM_206854chr621160 140 14842 ----
NM_206855chr632125 1105 542 15807 ----
NM_206857chr141602 ------
NM_206876chr221067 806 ------
NM_206907chr523276 706 ------
NM_206909chr857823 6950 5731 3266 28 --16628 --
NM_207042chr11471 --1153 --
NM_207043chr112180 ----11779
NM_207044chr112180 ----11779
NM_207045chr11471 --1153 --
NM_207046chr11471 --1153 --
NM_207047chr112180 ----11779
NM_207171chr131808 1530 646 ------
NM_207349chr20--1289 ----
NM_207361chr1376174 5818 4853 4682 2191 1620 778 2822 461 --1811
NM_207371chr1021080 214 --11516 --
NM_207406chr432115 835 31 --14384 --
NM_207411chr833116 2795 2328 13202 1911 --
NM_207517chr15--11616 ----
NM_207578chr11610 ------
NM_212460chr72677 599 ------
NM_213589chr234359 4105 495 ------
NM_213662chr1721915 469 11567 --11686