TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1226-5p
miRNA Sequence: GUGAGGGCAUGCAGGCCUGGAUGGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr17138 144 --1125
NM_000037chr842519 2230 1726 927 1591 21612 536 --
NM_000044chrX1302 ------
NM_000051chr1142205 1228 752 700 ------
NM_000068chr193988 609 546 129 1228 --
NM_000080chr172626 247 --1213 --
NM_000084chrX66915 5418 4855 2470 2117 1036 11211 26512 5243 12648
NM_000088chr1741238 1160 498 356 2162 91 ----
NM_000092chr273961 3598 3551 3156 3012 1488 148 14208 13107 --
NM_000093chr932000 1773 539 32278 2143 424 ----
NM_000109chrX12050 ------
NM_000110chr11811 ------
NM_000111chr71288 ------
NM_000125chr684134 4024 1555 1384 1180 832 231 53 23599 1497 ----
NM_000127chr8157 ------
NM_000129chr62984 323 --21330 253 --
NM_000135chr162387 345 --1357 --
NM_000138chr1552457 2424 2292 846 812 ----21615 655
NM_000141chr1041051 966 305 245 ------
NM_000163chr51710 32375 1476 734 ----
NM_000167chrX1608 ------
NM_000176chr543086 2674 1370 1101 13520 13238 --
NM_000192chr121474 1534 ----
NM_000202chrX43303 3255 3242 1565 ------
NM_000210chr21904 12331 ----
NM_000217chr1264415 4059 3983 2032 1780 1600 11338 13601 --
NM_000222chr421671 1503 --1372 --
NM_000232chr422351 1220 ------
NM_000238chr71139 ------
NM_000244chr111613 --148 --
NM_000245chr721800 1676 --1798 --
NM_000248chr31683 22039 779 ----
NM_000252chrX1145 ------
NM_000253chr43813 798 76 1246 ----
NM_000258chr32242 166 ------
NM_000259chr1595543 4672 4436 4142 4040 2519 1660 979 536 --24640 1946 --
NM_000266chrX----1317 1265
NM_000276chrX42002 466 297 273 ----1522
NM_000278chr1062018 1989 1892 1790 212 157 1172 2806 585 --
NM_000280chr111700 ------
NM_000286chr173648 182 23 ------
NM_000291chrX--1138 ----
NM_000304chr1711036 --1869 --
NM_000314chr1013008 ------
NM_000319chr122823 265 ------
NM_000321chr133430 349 54 ------
NM_000322chr63265 239 71 11596 ----
NM_000325chr4157 --1184 --
NM_000329chr11372 1636 ----
NM_000332chr6136600 6505 6487 6287 6237 4618 4525 2325 1165 937 497 287 32 --15400 --
NM_000334chr1771970 1908 1787 1780 1747 436 335 21641 602 ----
NM_000345chr41304 1872 ----
NM_000346chr1731337 706 415 21788 1227 ----
NM_000353chr164414 390 180 68 ------
NM_000358chr53399 54 39 ------
NM_000361chr2061816 1784 518 439 314 50 --31825 1464 271 --
NM_000368chr943804 1914 268 221 ----1405
NM_000378chr11183 ----11261
NM_000389chr641121 525 263 126 11100 ----
NM_000391chr1171663 1576 1239 1211 566 531 61 31083 217 95 ----
NM_000399chr102334 49 1423 ----
NM_000403chr1148 ------
NM_000404chr31168 ------
NM_000408chr242688 2182 548 308 ------
NM_000411chr2172558 2390 2048 990 665 251 229 12150 ----
NM_000421chr171130 ------
NM_000424chr12125 ------
NM_000428chr1482444 1890 1777 1022 1014 603 435 187 21993 1830 1296 --
NM_000430chr1753694 3477 3060 2704 2506 12947 13723 --
NM_000434chr61185 --3209 48 34 --
NM_000435chr1951000 649 297 269 218 ------
NM_000449chr131317 1063 61 ------
NM_000450chr13389 222 94 ----1188
NM_000451chrX3537 463 192 12036 ----
NM_000458chr175915 676 635 321 166 ------
NM_000461chr394282 4132 3626 3272 3208 2896 2874 1232 582 33587 3032 1110 --34032 3163 1719
NM_000462chr15--1451 1665 --
NM_000484chr211319 ------
NM_000489chrX53321 3147 3043 2826 1099 2428 110 ----
NM_000500chr62478 170 1383 ----
NM_000503chr821544 1506 ------
NM_000508chr42919 824 ------
NM_000516chr201235 ------
NM_000522chr711265 ------
NM_000523chr21145 2876 869 2743 474 1759
NM_000530chr14921 823 409 367 1777 2719 298 1161
NM_000533chrX31905 410 106 ------
NM_000555chrX117292 7125 6992 6621 6459 5899 5843 5809 4995 4988 2294 ----17820
NM_000594chr62635 67 178 ----
NM_000598chr731352 1255 492 1531 ----
NM_000599chr274166 3446 1452 1329 1274 1088 26 13617 22893 874 --
NM_000609chr1072918 2303 1087 928 851 708 27 11104 22379 604 --
NM_000615chr1122898 2801 --22325 2059 --
NM_000618chr12105645 5114 4657 4226 2562 2465 2058 1280 1064 501 46021 766 535 298 25184 4256 --
NM_000618chr12105645 5114 4657 4226 2562 2465 2058 1280 1064 501 46021 766 535 298 25184 4256 --
NM_000627chr22681 134 ------
NM_000633chr1864795 3417 3201 3190 1260 1166 --11035 1699
NM_000634chr22374 363 1391 1345 --
NM_000638chr17278 28 ------
NM_000663chr1692823 2347 981 941 678 621 589 460 435 ------
NM_000665chr73186 146 24 ------
NM_000668chr441371 1364 1176 1152 ------
NM_000678chr202622 170 1636 ----
NM_000719chr12206561 6350 6331 6324 6225 5887 5204 5196 4702 4479 4456 4232 2382 2360 2242 2047 1852 839 248 163 56607 6571 6523 2540 1912 34314 2085 319 --
NM_000721chr172686 2090 2081 1986 1731 441 36 11679 ----
NM_000722chr71252 ----166
NM_000723chr1791625 1556 1424 1280 474 444 360 281 273 ----1179
NM_000725chr124833 638 317 184 --1301 --
NM_000726chr221064 166 11103 ----
NM_000738chr112996 76 ------
NM_000743chr1511120 ------
NM_000757chr16875 787 612 323 303 109 --1672 --
NM_000801chr203999 706 21 ------
NM_000806chr521256 32 ------
NM_000809chr428650 3348 58796 6933 6119 3560 392 ----
NM_000811chr5--1177 ----
NM_000813chr593725 3521 2105 1941 1898 1857 1165 807 363 143 ----
NM_000816chr52429 168 ------
NM_000817chr22995 321 ----1883
NM_000818chr10----148 --
NM_000826chr421863 119 ------
NM_000827chr592003 1805 1685 1598 857 627 556 419 65 21961 533 32039 2016 1849 --
NM_000829chr1162160 2018 1943 1904 1861 751 22074 1755 ----
NM_000831chr1126094 5860 5265 5257 4742 4426 4420 4390 3843 428 266 197 21071 289 2168 142 --
NM_000833chr1621126 555 31390 1338 1173 --11188
NM_000836chr195994 820 806 696 642 1188 ----
NM_000838chr672010 1755 977 586 559 330 235 11959 ----
NM_000840chr7--1512 ----
NM_000842chr11--1124 ----
NM_000860chr41114 --11301 11562
NM_000868chrX22028 254 22358 2280 ----
NM_000870chr541352 1309 651 382 ------
NM_000872chr1021320 1069 ------
NM_000875chr15114798 2159 2045 1938 1523 1322 813 613 389 297 127 1225 35127 1926 1595 --
NM_000883chr73629 517 164 --1250 --
NM_000883chr73629 517 164 --1250 --
NM_000891chr1733498 3338 1235 12831 ----
NM_000899chr1224426 4174 ------
NM_000902chr372896 2824 2636 2452 2395 2027 26 2700 474 --13123
NM_000919chr51238 ------
NM_000924chr1291345 1193 1135 1093 1085 881 546 418 256 ------
NM_000935chr31965 ------
NM_000941chr72351 51 --1251 --
NM_000944chr41672 11782 ----
NM_000945chr22823 82 21499 180 ----
NM_000960chr191497 1224 ----
NM_000964chr1741314 1266 365 103 --2182 29 --
NM_000965chr33994 162 40 ------
NM_000966chr125754 680 359 193 101 ------
NM_000971chr8------159
NM_000983chr131012 553 374 11379 ----
NM_000984chr172440 378 --1397 --
NM_001001132chr2151280 1250 546 134 26 ----21180 43
NM_001001323chr1242875 1994 161 107 1821 ----
NM_001001331chr362526 2520 2216 1876 1861 265 12076 22162 33 --
NM_001001394chr21247 ------
NM_001001395chr1222237 827 ------
NM_001001396chr1113879 3847 3736 3445 3316 1795 1367 1244 820 304 257 ------
NM_001001433chr2042666 699 476 200 12031 --12457
NM_001001436chr16174 ----1735
NM_001001438chr21177 --1127 148
NM_001001481chr823154 2819 1725 1300 --
NM_001001484chr101145 --11829 --
NM_001001522chr113319 97 32 ------
NM_001001549chr742009 1015 600 540 --1940 --
NM_001001550chr742009 1015 600 540 --1940 --
NM_001001552chr11315 ------
NM_001001555chr742009 1015 600 540 --1940 --
NM_001001556chr151156 2500 428 ----
NM_001001557chr871675 1591 1569 733 661 551 169 --1766 --
NM_001001661chr74748 725 661 602 1506 ----
NM_001001664chr232564 1206 1172 21118 511 ----
NM_001001787chr1185 ------
NM_001001890chr2134245 2949 44 12638 22608 225 --
NM_001001924chr821869 325 ------
NM_001001925chr821869 325 ------
NM_001001931chr821869 325 ------
NM_001001936chr1031144 952 27 --1473 --
NM_001001973chr10122 ------
NM_001001974chr10----2837 40 --
NM_001002233chr841589 1362 690 117 ----11561
NM_001002243chr21360 ------
NM_001002245chr173420 263 48 --1298 --
NM_001002246chr173420 263 48 --1298 --
NM_001002247chr173420 263 48 --1298 --
NM_001002248chr173420 263 48 --1298 --
NM_001002249chr173420 263 48 --1298 --
NM_001002252chr12163 ------
NM_001002255chr6----1355 --
NM_001002257chr241111 665 615 560 ------
NM_001002259chr12----176 --
NM_001002269chr91436 ------
NM_001002295chr10--1831 ----
NM_001002814chr883791 3386 3321 1362 1006 941 690 117 13672 --11561
NM_001002860chr1454033 3397 3367 1244 687 ----14393
NM_001002909chr1782117 1907 1839 1545 1386 640 431 203 1210 11663 --
NM_001003396chr61600 --142 --
NM_001003397chr61600 --142 --
NM_001003407chr1094865 4791 4258 3951 3899 1898 1665 1445 1338 1723 1362 --
NM_001003408chr1094865 4791 4258 3951 3899 1898 1665 1445 1338 1723 1362 --
NM_001003652chr1837286 3456 2449 38176 2229 1859 22304 760 17273
NM_001003674chr1876305 5806 5132 4689 2820 2293 1117 16276 22221 971 12490
NM_001003675chr1876305 5806 5132 4689 2820 2293 1117 16276 22221 971 12490
NM_001003676chr1181043 800 732 641 361 335 248 222 ------
NM_001003677chr114599 197 101 54 ------
NM_001003682chr141251 1101 587 539 --21420 1373 --
NM_001003688chr411151 ------
NM_001003698chr661992 1633 1553 1494 79 71 ------
NM_001003699chr661992 1633 1553 1494 79 71 ------
NM_001003792chr3--1421 ----
NM_001003793chr3--1421 ----
NM_001003800chr992833 1481 1309 1249 1138 860 352 226 200 1190 22724 217 13613
NM_001003805chr14164 ------
NM_001003940chr15113636 3465 3349 3028 2978 2821 2590 2376 1036 426 190 22542 662 ----
NM_001003942chr15113636 3465 3349 3028 2978 2821 2590 2376 1036 426 190 22542 662 ----
NM_001003943chr15113640 3469 3353 3032 2982 2825 2594 2380 1040 430 194 22546 666 ----
NM_001004106chr56948 806 675 213 149 140 1787 ----
NM_001004128chr13233 206 118 ----157
NM_001004196chr32800 204 ------
NM_001004317chr643241 3030 954 356 11282 ----
NM_001004354chr9--1826 1423 --
NM_001004360chr2----1320 --
NM_001004419chr1234158 3692 1816 24042 1231 ----
NM_001004441chr511373 1203 ----
NM_001004722chr21845 ------
NM_001005158chr32122 55 ------
NM_001005159chr32122 55 ------
NM_001005271chr1741059 167 84 21 2860 720 ----
NM_001005273chr1741059 167 84 21 2860 720 ----
NM_001005335chr191223 ------
NM_001005354chr12292 46 126 ----
NM_001005375chrY31378 1155 97 ------
NM_001005386chr222165 108 1824 11873 --
NM_001005404chr1752901 2798 1223 982 967 ------
NM_001005408chr17----1147 --
NM_001005417chr12210 21 ------
NM_001005463chr1012015 --12443 1661
NM_001005473chr566494 6450 5685 2461 1340 849 25518 2168 24168 1721 --
NM_001005474chr3------1264
NM_001005505chr341705 1660 324 103 ------
NM_001005611chrX1511 ------
NM_001005739chr22646 636 ------
NM_001005746chr221064 166 11103 ----
NM_001005747chr221064 166 11103 ----
NM_001005781chr21486 ------
NM_001005782chr22935 204 132 ----
NM_001005785chrY31378 1155 97 ------
NM_001005786chrY31378 1155 97 ------
NM_001005845chr82381 54 ------
NM_001005849chr17--1566 ----
NM_001005910chr32526 502 1214 ----
NM_001005911chr32526 502 1214 ----
NM_001005920chr1661117 974 912 360 316 110 --1965 --
NM_001006115chr3112624 2235 2170 2021 1933 1791 943 686 297 209 193 1835 22605 504 --
NM_001006600chr51381 --1398 --
NM_001006610chr161756 ------
NM_001006617chr931072 139 91 1283 ----
NM_001006619chr931072 139 91 1283 ----
NM_001006620chr931072 139 91 1283 ----
NM_001006621chr931072 139 91 1283 ----
NM_001006634chr164529 472 142 22 ------
NM_001006636chr21250 ------
NM_001006641chr981778 1586 1576 1508 629 471 406 377 ------
NM_001006642chr981778 1586 1576 1508 629 471 406 377 ------
NM_001006643chr981778 1586 1576 1508 629 471 406 377 ------
NM_001006665chr12768 164 ------
NM_001006938chrX2568 64 ------
NM_001006946chr221383 1293 ------
NM_001007024chr1733751 1720 1556 23885 3023 ----
NM_001007025chr1733751 1720 1556 23885 3023 ----
NM_001007026chr122527 76 ------
NM_001007067chr8182 ------
NM_001007068chr8182 ------
NM_001007069chr8182 ------
NM_001007070chr8182 ------
NM_001007075chr411071 ------
NM_001007098chr11301 2861 754 2286 276 --
NM_001007156chr1551885 1684 451 430 53 --1758 --
NM_001007214chr12463 116 ------
NM_001007226chr1721297 563 ------
NM_001007227chr1721297 563 ------
NM_001007228chr1721297 563 ------
NM_001007229chr1721297 563 ------
NM_001007230chr1721297 563 ------
NM_001007237chr132514 592 48 11814 ----
NM_001007246chr2121192 379 ------
NM_001007250chr1232 22 ------
NM_001007277chr112235 77 ------
NM_001007279chr222272 107 ------
NM_001007527chr51670 ------
NM_001007538chr1321382 275 ------
NM_001007553chr121007 381 ------
NM_001007559chr1821872 696 ------
NM_001007565chr31366 ------
NM_001008216chr1148 ------
NM_001008220chr5113864 3252 2880 2585 2495 707 403 258 170 153 147 1640 13132 --
NM_001008222chrX51103 998 929 891 317 11030 ----
NM_001008225chr71126 ------
NM_001008239chr18103298 2897 2503 2363 1378 793 564 298 219 47 ------
NM_001008393chr422280 1810 ------
NM_001008407chr741331 563 287 193 --11809 11516
NM_001008408chr7105582 5487 5307 4134 3999 3938 2532 1894 1691 761 15757 32148 1373 721 25914 477
NM_001008410chr221927 845 ----12238
NM_001008495chr832223 1693 1646 --11396 --
NM_001008529chr1741296 1176 1054 82 1207 1457 11135
NM_001008541chr1012121 11499 22143 723 --
NM_001008541chr1012121 11499 22143 723 --
NM_001008566chr222443 381 ------
NM_001008660chr11--1258 2454 313 --
NM_001008701chr1982837 2491 2282 1246 1227 860 148 124 12911 ----
NM_001008723chr102395 360 ------
NM_001008738chr532408 950 930 1998 --12223
NM_001008744chr1431392 634 108 189 ----
NM_001008895chr1341280 470 48 25 ------
NM_001008925chr463014 2677 2348 949 654 605 32791 2720 2637 22189 1047 --
NM_001008938chr11----157 --
NM_001009552chr81505 ------
NM_001009554chr464136 3165 1285 293 109 102 11587 21714 508 --
NM_001009554chr464136 3165 1285 293 109 102 11587 21714 508 --
NM_001009555chr421735 510 ------
NM_001009571chr7--21608 1117 ----
NM_001009880chr22114283 4155 4110 4006 3639 1904 1730 1506 1496 939 260 13921 21034 45 --
NM_001009899chr376114 5821 5741 4268 4208 1982 1082 14070 ----
NM_001009955chr11526 2229 124 ----
NM_001009955chr11526 2229 124 ----
NM_001009958chr72392 116 171 ----
NM_001009959chr241961 602 566 479 12640 11978 --
NM_001009993chr274382 4115 3658 3522 3188 938 109 ------
NM_001009996chr31157 1206 ----
NM_001010854chr141165 --1544 --
NM_001010861chr111037 --12362 --
NM_001010888chrX104544 4490 4121 4101 3972 3310 3287 3255 1411 264 ----13464
NM_001010895chr951487 640 473 390 52 1499 ----
NM_001010924chr104991 923 776 335 1459 ----
NM_001010926chr14659 456 112 77 ------
NM_001010971chr13837 299 217 ------
NM_001010986chrX178 1721 ----
NM_001011513chr453942 3869 3761 3245 1100 --12535 --
NM_001011537chr331497 422 267 ------
NM_001011538chr42716 162 --1264 --
NM_001011553chr71626 ------
NM_001011645chrX1302 ------
NM_001011666chr765046 4758 4495 1966 1261 102 ----14742
NM_001011708chr262658 1180 1173 1102 1075 271 ------
NM_001012264chr143737 667 227 ------
NM_001012267chr941981 465 371 149 21833 1568 2524 272 --
NM_001012300chr122261 28 ------
NM_001012329chr141912 1718 1574 342 --21641 609 --
NM_001012393chr1155003 4733 4586 2063 297 65049 4935 4646 3915 1360 1352 24446 1978 23687 2025
NM_001012398chr161897 ------
NM_001012420chr1522353 575 --1274 --
NM_001012423chr1522353 575 --1274 --
NM_001012426chr6173352 3160 3084 1361 1327 1306 1109 1073 936 909 896 794 465 339 323 306 249 22467 380 22843 1298 --
NM_001012427chr6173352 3160 3084 1361 1327 1306 1109 1073 936 909 896 794 465 339 323 306 249 22467 380 22843 1298 --
NM_001012642chr1542022 1552 818 644 --1739 --
NM_001012751chr102714 427 ------
NM_001012753chr191984 1296 3462 276 194 1111
NM_001012755chrX64552 4417 3571 1712 496 369 14394 13378 --
NM_001012968chrX61134 813 580 565 527 517 --1538 --
NM_001012977chrX61157 1104 921 521 479 79 ------
NM_001012989chrX1470 1609 1562 --
NM_001013031chr1053128 2667 2393 1340 966 22408 844 12147 --
NM_001013398chr731352 1255 492 1531 ----
NM_001013415chr4154 ------
NM_001013438chr31702 ------
NM_001013439chr31548 ------
NM_001013635chr1221147 1114 21126 140 2961 906 --
NM_001013693chr162472 1904 732 427 233 215 --21953 315 --
NM_001013693chr162472 1904 732 427 233 215 --21953 315 --
NM_001013839chr1782218 2193 2129 1634 1603 632 347 99 ------
NM_001014283chr1321451 411 ------
NM_001014435chr165507 412 246 181 115 ------
NM_001014443chr1132 145 ----
NM_001014797chr1077728 7495 5868 5834 5587 2671 1215 --16249 16513
NM_001015045chr482279 1927 1586 658 576 547 460 114 --1583 --
NM_001015053chr1721481 107 --21028 534 --
NM_001015877chrX33006 1975 125 2817 708 1167 --
NM_001015881chrX1513 ------
NM_001015882chr9--2159 113 ----
NM_001015887chr331514 599 453 --148 --
NM_001017371chr2--11091 ----
NM_001017395chr373448 3138 2765 2517 1012 802 675 22556 592 ----
NM_001017415chr11189 ------
NM_001017416chr11189 ------
NM_001017424chr111211 11859 ----
NM_001017425chr111211 11859 ----
NM_001017923chr14146 ------
NM_001017926chr831732 1410 643 --1339 1628
NM_001017930chrX61438 1429 1070 1018 176 127 ------
NM_001017970chr141241 1641 --22374 2330
NM_001017973chr5135 ------
NM_001017974chr5135 ------
NM_001017977chr1--1271 ----
NM_001017999chr141957 1428 644 476 --11938 --
NM_001017999chr141957 1428 644 476 --11938 --
NM_001018000chr141957 1428 644 476 --11938 --
NM_001018000chr141957 1428 644 476 --11938 --
NM_001018001chr141957 1428 644 476 --11938 --
NM_001018004chr152624 273 172 ----
NM_001018006chr152624 273 172 ----
NM_001018007chr152624 273 172 ----
NM_001018020chr152624 273 172 ----
NM_001018025chrX--1277 ----
NM_001018050chr22143307 3255 3087 2789 2762 2662 2604 2131 1283 1227 855 689 363 181 23428 3228 23219 672 --
NM_001018052chr22143307 3255 3087 2789 2762 2662 2604 2131 1283 1227 855 689 363 181 23428 3228 23219 672 --
NM_001018054chr121239 981 ------
NM_001018064chr951591 1399 143 99 41 11784 ----
NM_001018065chr985432 4336 3953 2123 1677 1262 730 602 35633 1079 207 23819 1625 --
NM_001018066chr985432 4336 3953 2123 1677 1262 730 602 35633 1079 207 23819 1625 --
NM_001018070chr112254 24 ------
NM_001018074chr543086 2674 1370 1101 13520 13238 --
NM_001018075chr543086 2674 1370 1101 13520 13238 --
NM_001018076chr543086 2674 1370 1101 13520 13238 --
NM_001018077chr543086 2674 1370 1101 13520 13238 --
NM_001018091chr1532623 672 97 ------
NM_001018108chr1591902 1509 1437 701 599 589 333 162 33 ------
NM_001018111chr763790 2548 1201 1054 430 295 13395 ----
NM_001020658chr141409 1385 451 25 ------
NM_001020658chr141409 1385 451 25 ------
NM_001020825chr52561 149 1995 ----
NM_001023567chr151187 --1274 1485
NM_001023587chr32760 44 --1919 --
NM_001024071chr14----1161 --
NM_001024094chr543086 2674 1370 1101 13520 13238 --
NM_001024226chr18942 899 762 725 345 48 35 21 ------
NM_001024227chr18942 899 762 725 345 48 35 21 ------
NM_001024228chr18942 899 762 725 345 48 35 21 ------
NM_001024401chr16142809 2794 2299 2178 2003 1985 1770 1086 968 959 773 619 584 399 ------
NM_001024455chrX92356 2309 1680 782 769 761 657 344 229 22698 2143 ----
NM_001024463chr153398 335 89 157 1229 --
NM_001024649chr562471 2315 2224 1885 896 779 1466 ----
NM_001024660chr311422 ------
NM_001024666chrX1646 ------
NM_001024668chr124791 721 245 178 1669 1684 --
NM_001024807chr194341 309 220 22 ------
NM_001024808chr12112489 2415 2319 1837 1029 984 800 730 535 491 432 ------
NM_001024809chr1741314 1266 365 103 --2182 29 --
NM_001024847chr361992 1660 1628 818 229 47 1752 2946 682 --
NM_001024858chr14122948 2770 2552 2381 1989 905 883 807 655 342 299 156 22049 891 2530 195 --
NM_001024937chr173605 196 43 1720 1637 --
NM_001024947chr5196 ------
NM_001024948chr133469 2392 326 --12924 --
NM_001024956chr1162190 2154 1740 1725 1626 975 14077 1346 14365
NM_001025068chr34692 378 165 92 184 21593 1464 --
NM_001025069chr34692 378 165 92 184 21593 1464 --
NM_001025070chr5----142 --
NM_001025071chr5----142 --
NM_001025076chr1085929 5225 5217 4976 4283 2440 2413 2007 --23837 28 24811 4488
NM_001025077chr1077287 6583 6575 6334 5641 1209 1173 11337 25195 28 26169 5846
NM_001025079chr331048 736 143 32903 2532 637 1601 --
NM_001025081chr1821248 480 --131 --
NM_001025090chr1821248 480 --131 --
NM_001025092chr1821248 480 --131 --
NM_001025101chr1821248 480 --131 --
NM_001025105chr5--11383 ----
NM_001025107chr172712 1797 1715 1686 1032 508 72 --22176 2082 --
NM_001025107chr172712 1797 1715 1686 1032 508 72 --22176 2082 --
NM_001025108chr273614 1113 1088 1081 1015 706 120 13194 ----
NM_001025205chr32342 111 ------
NM_001025233chr1242758 939 456 310 ------
NM_001025242chrX21208 442 --180 --
NM_001025243chrX21208 442 --180 --
NM_001025266chr394487 4396 3748 1651 1513 1323 1282 1050 374 ------
NM_001025366chr661485 1364 1354 602 52 28 ------
NM_001025366chr661485 1364 1354 602 52 28 ------
NM_001025367chr661485 1364 1354 602 52 28 ------
NM_001025367chr661485 1364 1354 602 52 28 ------
NM_001025368chr661485 1364 1354 602 52 28 ------
NM_001025368chr661485 1364 1354 602 52 28 ------
NM_001025369chr661501 1380 1370 618 68 44 ------
NM_001025369chr661501 1380 1370 618 68 44 ------
NM_001025370chr661485 1364 1354 602 52 28 ------
NM_001025370chr661485 1364 1354 602 52 28 ------
NM_001025579chr1771126 983 827 817 155 119 78 11179 ----
NM_001025580chrX74113 3478 3261 3165 1485 465 318 23268 3156 ----
NM_001025596chr111143 ------
NM_001025603chr131317 1063 61 ------
NM_001025780chr911155 --1109 --
NM_001029835chr75355 310 146 90 54 ------
NM_001029858chr62947 940 33014 2950 2847 ----
NM_001029859chr1162265 2177 1823 1662 873 173 ----11685
NM_001029863chr623170 2652 ------
NM_001029864chr2062453 2129 2085 1573 375 369 --2400 276 --
NM_001029875chr552596 2573 2032 1119 146 --12014 1784
NM_001029882chr12208 92 ------
NM_001029882chr12208 92 ------
NM_001029998chr431349 577 367 1552 11409 --
NM_001030006chr1722158 858 22135 24 22522 632 --
NM_001030007chr1673753 2952 2819 2472 1286 444 182 13635 22666 1013 --
NM_001030055chr1434420 3996 567 ----11011
NM_001030287chr13384 160 46 --135 --
NM_001031677chr51398 --1108 --
NM_001031680chr121966 546 31921 531 51 11894 --
NM_001031685chr12382 338 ------
NM_001031689chr9151 ------
NM_001031690chr782118 2062 1168 1067 960 945 131 25 ------
NM_001031695chr22115092 5073 4482 4378 4041 4000 3936 3300 1878 1382 1294 24130 3285 2881 711 --
NM_001031702chr32829 233 --136 1687
NM_001031709chr10--1289 ----
NM_001031732chr443190 2263 656 545 --13283 --
NM_001031740chr121295 519 1184 ----
NM_001031801chr222383 157 ------
NM_001031804chr1683661 3598 3461 3166 1143 767 572 451 ------
NM_001031812chr512093 ------
NM_001032221chr991596 1414 1303 1295 736 668 507 300 158 21353 1183 21199 520 --
NM_001032279chr11248 31 ------
NM_001032280chr641109 457 175 145 21525 1115 1254 --
NM_001032288chr2081244 989 640 590 423 385 377 25 ------
NM_001032289chrX3343 331 189 1793 ----
NM_001032293chr171495 ------
NM_001032296chr1352722 2498 854 188 82 ------
NM_001032363chr151591 1540 1468 379 54 ------
NM_001032363chr151591 1540 1468 379 54 ------
NM_001032380chr101213 ------
NM_001032394chr62718 113 ------
NM_001033044chr121453 1336 --1408 --
NM_001033045chr244370 3012 2719 328 14188 ----
NM_001033056chr121453 1336 --1408 --
NM_001033059chr621501 202 --1380 --
NM_001033081chr161911 722 692 683 453 189 ------
NM_001033082chr161911 722 692 683 453 189 ------
NM_001033087chr2042664 1086 1016 810 --23264 2635 --
NM_001033088chr151325 ------
NM_001033112chr5184 ------
NM_001033117chr3134785 4600 4393 4045 1864 1856 1687 1456 1443 1333 811 769 689 1709 ----
NM_001033507chr121776 725 1436 11387 --
NM_001033551chr17124052 3819 3710 3621 3429 3189 3133 1636 1432 1104 577 415 12672 11197 --
NM_001033554chr171243 ------
NM_001033557chr2----1466 --
NM_001033566chr173926 759 693 ------
NM_001033568chr173926 759 693 ------
NM_001033723chr842599 2203 1742 120 1248 ----
NM_001033756chr641419 1298 1288 536 ------
NM_001033756chr641419 1298 1288 536 ------
NM_001033859chr17138 144 --1125
NM_001033925chr1011894 ------
NM_001034837chr53626 264 73 --128 --
NM_001034838chr53626 264 73 --128 --
NM_001034841chr1663635 1665 1569 1482 1332 1065 14937 --11453
NM_001034845chr4--21370 496 ----
NM_001034850chr521322 1259 --11548 --
NM_001034915chr831359 471 26 ------
NM_001034954chr1032452 809 540 ------
NM_001034955chr1032452 809 540 ------
NM_001034956chr1032452 809 540 ------
NM_001034957chr1032452 809 540 ------
NM_001035chr13886 329 71 158 ----
NM_001035003chr42909 538 157 ----
NM_001035004chr42909 538 157 ----
NM_001035254chr992114 1883 1820 1636 894 723 660 332 83 --22108 969 --
NM_001035260chr1011511 ------
NM_001035521chr23228 202 85 1219 ----
NM_001037132chr73387 231 69 12230 1841 --
NM_001037133chr73387 231 69 12230 1841 --
NM_001037163chr7----195 --
NM_001037164chr721790 97 --11534 --
NM_001037174chr21250 22149 1503 ----
NM_001037317chr111037 --12362 --
NM_001037324chr32515 52 1154 1756 --
NM_001037332chr5102138 2084 1976 1619 778 770 586 376 168 23 1266 ----
NM_001037333chr5102138 2084 1976 1619 778 770 586 376 168 23 1266 ----
NM_001037334chr1822398 1741 --1480 --
NM_001037339chr121201 564 ------
NM_001037340chr121201 564 ------
NM_001037341chr121201 564 ------
NM_001037341chr121201 564 ------
NM_001037533chr13793 656 220 ------
NM_001037582chr431547 1256 69 --11434 --
NM_001037872chr22572 26 ------
NM_001038493chr23479 301 139 --2624 607 --
NM_001038640chr151804 --1341 --
NM_001038707chr182222 2019 1723 1445 827 694 447 272 1563 --1718
NM_001038707chr182222 2019 1723 1445 827 694 447 272 1563 --1718
NM_001039091chrX2958 392 ------
NM_001039140chr204475 178 138 32 --1150 --
NM_001039459chr75741 321 306 292 129 11159 ----
NM_001039465chr142471 213 ------
NM_001039479chr1452077 1850 1655 1497 36 1350 1414 --
NM_001039538chr21819 23317 2601 12594 --
NM_001039550chr2293 53 ------
NM_001039570chr22154383 4202 4180 4116 3825 3489 3368 3334 1760 1668 1229 604 574 476 246 --33753 3398 1269 --
NM_001039571chr22154383 4202 4180 4116 3825 3489 3368 3334 1760 1668 1229 604 574 476 246 --33753 3398 1269 --
NM_001039574chr16953 900 870 340 311 150 ------
NM_001039577chr1144488 4350 4039 3957 3925 3516 3385 3340 3120 3099 3071 1269 832 77 11356 23141 929 --
NM_001039583chr221137 ------
NM_001039584chr221137 ------
NM_001039585chr143444 716 655 47 --12724 --
NM_001039590chrX23124 1286 12883 ----
NM_001039591chrX23124 1286 12883 ----
NM_001039618chr11105935 5817 5480 5315 5149 4155 1780 1262 512 49 14837 ----
NM_001039670chr126679 594 308 238 151 137 --2247 33 --
NM_001039690chr1651973 1898 1789 960 588 11571 ----
NM_001039697chr941260 1236 319 31 1462 ----
NM_001039711chr11822 --11127 --
NM_001039712chr11822 --11127 --
NM_001039771chr1431021 895 56 ------
NM_001039802chr121189 1141 11042 --1510
NM_001039840chrX55682 4163 770 391 48 35069 4480 205 25332 4605 --
NM_001039877chr194805 560 178 146 ------
NM_001039888chr1------1618
NM_001039916chr1241038 391 191 140 1356 ----
NM_001039917chr1241038 391 191 140 1356 ----
NM_001039918chr1241038 391 191 140 1356 ----
NM_001039919chr1241038 391 191 140 1356 ----
NM_001039920chr1241038 391 191 140 1356 ----
NM_001039937chr1353876 3802 2752 1366 290 11150 ----
NM_001039960chr1251550 1108 454 382 81 --11167 --
NM_001040002chr174517 469 230 73 ------
NM_001040020chr711096 21503 1368 ----
NM_001040057chr761251 985 545 453 417 26 ------
NM_001040108chr1462584 2269 1206 468 421 138 12476 1930 --
NM_001040110chr731472 1313 558 ------
NM_001040113chr162877 301 ------
NM_001040118chr113495 65 48 ------
NM_001040134chr1951425 1411 1330 1046 1002 11398 ----
NM_001040144chr1651973 1898 1789 960 588 11571 ----
NM_001040146chr1651973 1898 1789 960 588 11571 ----
NM_001040152chr775018 3133 1853 1718 1385 1167 616 33302 2050 1340 --11183
NM_001040157chr412643 --1405 1605
NM_001040158chr53432 72 44 ------
NM_001040159chr4------1536
NM_001040172chr541352 1309 651 382 ------
NM_001040173chr541352 1309 651 382 ------
NM_001040181chr31397 2806 74 ----
NM_001040182chr31397 2806 74 ----
NM_001040183chr31397 2806 74 ----
NM_001040199chr31397 2806 74 ----
NM_001040200chr31397 2806 74 ----
NM_001040202chr432054 1683 1021 ------
NM_001040214chr632034 1746 286 12221 ----
NM_001040284chr1644933 4348 4164 2166 13959 ----
NM_001040402chr422866 2802 1869 22531 240 --
NM_001040429chr1332733 375 365 13076 ----
NM_001040431chr173311 108 44 ------
NM_001040439chr1651429 1353 1120 539 222 1111 21192 449 1273
NM_001040446chr542064 2044 946 132 --1152 --
NM_001040450chr1512636 1515 --1543
NM_001040453chr1512636 1515 --1543
NM_001040458chr561396 735 727 692 535 438 1115 ----
NM_001040619chr171182 610 496 350 215 206 112 --1485 --
NM_001040624chr821879 132 --22134 148 --
NM_001040625chr821879 132 --22134 148 --
NM_001040626chr821879 132 --22134 148 --
NM_001040627chr821879 132 --22134 148 --
NM_001040628chr821879 132 --22134 148 --
NM_001040629chr821879 132 --22134 148 --
NM_001040630chr821879 132 --22134 148 --
NM_001040653chr342566 1655 375 41 --11627 --
NM_001040694chr113919 139 87 1350 ----
NM_001040709chr1152458 2388 2145 1876 1681 969 891 828 643 620 537 477 424 279 167 1745 12021 --
NM_001040712chr923391 2676 142 ----
NM_001040876chr4----1412 --
NM_001042357chr103585 55 22 ------
NM_001042358chr103585 55 22 ------
NM_001042360chr103585 55 22 ------
NM_001042361chr103616 86 53 ------
NM_001042363chr103585 55 22 ------
NM_001042364chr103616 86 53 ------
NM_001042365chr103616 86 53 ------
NM_001042387chr103616 86 53 ------
NM_001042389chr103585 55 22 ------
NM_001042390chr103585 55 22 ------
NM_001042392chr103585 55 22 ------
NM_001042393chr103616 86 53 ------
NM_001042395chr103585 55 22 ------
NM_001042396chr103616 86 53 ------
NM_001042397chr103616 86 53 ------
NM_001042413chr963826 3806 3170 2533 425 71 22760 301 --13000
NM_001042424chr482571 2466 1156 1073 653 559 243 167 --22728 418 --
NM_001042425chr641109 457 175 145 21525 1115 1254 --
NM_001042427chr101248 ------
NM_001042430chr14----2491 159 --
NM_001042453chrX1687 ------
NM_001042472chr202230 39 1245 ----
NM_001042475chr61292 ------
NM_001042494chr1543523 3159 937 52 1211 --13351
NM_001042495chr1543523 3159 937 52 1211 --13351
NM_001042496chr1543523 3159 937 52 1211 --13351
NM_001042497chr1543523 3159 937 52 1211 --13351
NM_001042506chrX4921 521 479 79 --11115 --
NM_001042510chr82705 452 --11482 --
NM_001042511chr82705 452 --11482 --
NM_001042537chrX----11966 --
NM_001042539chr162730 402 --1152 --
NM_001042543chr4--11533 ----
NM_001042555chr1254777 4275 3554 1280 1036 11178 1561 --
NM_001042599chr297624 7058 6485 5507 5094 2636 2525 1741 863 56908 6447 2463 2198 2028 --15633
NM_001042601chr332324 2169 508 12010 --1699
NM_001042603chr1274699 4657 4195 1541 619 421 131 --1116 --
NM_001042632chr2062181 1984 1805 1577 853 532 21716 1674 22344 2125 --
NM_001042633chr2062181 1984 1805 1577 853 532 21716 1674 22344 2125 --
NM_001042681chr162458 2352 2312 2193 1874 345 12299 12002 --
NM_001042682chr162458 2352 2312 2193 1874 345 12299 12002 --
NM_001042682chr162458 2352 2312 2193 1874 345 12299 12002 --
NM_001042683chr611196 --21167 411 --
NM_001042728chr125754 680 359 193 101 ------
NM_001042749chrX21814 1372 ------
NM_001042750chrX21814 1372 ------
NM_001042751chrX21814 1372 ------
NM_001043318chr14113772 3710 3414 3391 1598 821 752 730 694 664 499 --23401 1531 --
NM_001043351chr141856 1626 748 715 ----12014
NM_001044305chr6--1287 ----
NM_001044385chr222581 417 33671 3067 132 1400 --
NM_001044722chr512093 ------
NM_001044723chr512093 ------
NM_001046chr52337 25 1853 --1406
NM_001048183chr173493 2888 1125 627 569 502 253 13442 ----
NM_001050chr17191 21154 205 ----
NM_001065chr122424 50 1133 1494 --
NM_001077628chr1249 38 1186 ----
NM_001079874chr151509 1443 739 730 556 --12089 --
NM_001080418chr14582 474 468 228 ------
NM_001083620chr421861 119 ------
NM_001092chr1772412 1887 1834 1706 623 467 220 --11605 --
NM_001095chr12121841 1718 1521 1297 1247 1241 703 552 487 365 160 75 1591 11476 --
NM_001100108chr1108302 7653 7469 7062 6351 2887 2790 1400 1210 1105 11616 26923 337 16535
NM_001106chr3128000 7398 7171 6608 3789 2965 2555 2400 2098 493 486 463 21207 982 23661 1948 29679 3570
NM_001111chr172712 1797 1715 1686 1032 508 72 --22176 2082 --
NM_001113490chrX33149 2459 1345 11164 ----
NM_001116chr1672342 2335 2289 2193 2031 768 96 12744 31244 934 257 --
NM_001117chr1842025 1667 815 684 ------
NM_001121chr104655 566 295 172 --1237 --
NM_001124chr111560 ------
NM_001127chr226871 751 402 387 56 29 ------
NM_001128chr1673753 2952 2819 2472 1286 444 182 13635 22666 1013 --
NM_001131chr61337 1283 ----
NM_001135chr153670 663 81 ------
NM_001140chr17179 ------
NM_001144chr161203 ------
NM_001147chr8190 ------
NM_001148chr441955 1940 1497 371 ------
NM_001149chr101924 ------
NM_001157chr103441 217 191 ------
NM_001160chr1212380 ------
NM_001167chrX54978 4665 2228 2107 1939 36290 4520 1504 15935 --
NM_001172chr141298 ------
NM_001173chr1434420 3996 567 ----11011
NM_001186chr2132607 2528 1135 ------
NM_001187chr212477 85 ------
NM_001188chr691251 1109 1086 1068 983 248 242 205 68 197 1803 --
NM_001191chr2041179 574 323 316 ------
NM_001198chr662228 842 362 308 126 102 ------
NM_001200chr20--1820 1918 --
NM_001201chr463748 3616 3145 1348 1230 594 --11538 --
NM_001204chr297384 7178 6744 5373 1993 1843 1461 1079 552 45320 2776 2013 800 11038 12122
NM_001206chr952810 2202 1218 474 456 ------
NM_001218chr1562626 2174 1832 623 210 66 ------
NM_001219chr722203 1887 2310 27 11619 --
NM_001221chr41101 ------
NM_001222chr1081956 1696 1654 1504 1307 299 176 164 11421 ----
NM_001225chr11129 ------
NM_001237chr42797 353 1392 ----
NM_001237chr42797 353 1392 ----
NM_001256chr1722111 428 1837 --1826
NM_001259chr756230 1557 1061 110 66 24826 4475 25389 606 --
NM_001265chr132871 73 --2311 127 --
NM_001270chr52806 285 ------
NM_001271chr1562800 2794 2522 2316 2146 2083 1553 12879 --
NM_001273chr123179 93 47 ------
NM_001277chr112816 689 --1901 --
NM_001278chr10----1292 --
NM_001282chr1722158 858 22135 24 22522 632 --
NM_001290chr4--1719 2894 217 --
NM_001304chr1722623 2486 --11509 13714
NM_001315chr661957 1878 1613 824 789 491 --1730 --
NM_001319chr192230 187 1418 2792 72 --
NM_001329chr101556 1413 ----
NM_001331chr1182506 1868 1791 1108 1036 621 504 146 1714 1125 --
NM_001332chr521284 572 ------
NM_001343chr541213 358 319 100 11344 ----
NM_001351chr321352 1125 ------
NM_001352chr19133 ------
NM_001356chrX11535 12227 1943 --
NM_001364chr11104177 3712 3371 3287 3041 956 922 390 337 296 23321 973 1986 --
NM_001365chr176760 556 320 251 79 52 ------
NM_001380chr103995 422 54 --1742 --
NM_001385chr8154 ------
NM_001387chr582868 2772 2581 2440 2237 2152 917 801 ------
NM_001390chr1843192 2679 1184 1125 131 11079 --
NM_001391chr1811102 ------
NM_001396chr212697 493 --12647 --
NM_001397chr192561 2306 2025 2019 1951 932 709 228 114 1830 --1162
NM_001400chr12472 384 2485 321 --11125
NM_001401chr93503 200 33 ------
NM_001406chr17121483 1304 583 565 538 374 361 308 192 140 119 37 ------
NM_001407chr361674 1443 1383 565 554 418 ------
NM_001408chr181501 1309 1261 1066 521 462 405 213 ------
NM_001412chrX73533 3165 3155 3046 2997 1377 1088 --21251 342 --
NM_001417chr1221725 1463 ------
NM_001418chr111610 ------
NM_001418chr111610 ------
NM_001419chr1964111 3518 3276 1885 1455 624 11080 24383 1589 14730
NM_001420chr1982944 2591 2577 2518 2509 1173 1156 384 1340 ----
NM_001421chrX51627 1289 1255 695 324 11401 --1201
NM_001423chr1241904 1569 696 449 ------
NM_001429chr221417 11002 ----
NM_001433chr171186 --1846 1809
NM_001438chr172880 2281 358 335 271 31 21 ------
NM_001453chr641518 1276 394 380 ------
NM_001455chr664089 3653 907 300 284 180 142 33210 829 89 --
NM_001460chr153236 3006 1168 408 148 33068 2918 2553 33298 3262 3165 --
NM_001478chr127948 864 817 688 341 241 123 --2663 610 --
NM_001489chr9122 ----1213
NM_001493chrX3708 511 181 ------
NM_001494chr101142 ------
NM_001497chr942466 1787 483 86 --32579 2292 1804 --
NM_001500chr6128 ----1315
NM_001508chr23738 63 38 1231 ----
NM_001518chr721083 924 ------
NM_001521chr23228 202 85 1219 ----
NM_001527chr664746 3686 3151 1742 1336 540 ------
NM_001533chr191223 ------
NM_001542chr132514 592 48 11814 ----
NM_001543chr5154785 4406 3956 3580 2963 1945 1472 1398 1281 1207 566 396 368 304 216 3907 628 529 44229 4083 1169 894 --
NM_001546chr6--11305 ----
NM_001555chrX1206 --147 --
NM_001569chrX21208 442 --180 --
NM_001587chrX42002 466 297 273 ----1522
NM_001604chr111700 ------
NM_001614chr171112 ------
NM_001614chr171112 ------
NM_001616chr253320 2978 2555 2537 267 1581 ----
NM_001634chr621501 202 --1380 --
NM_001635chr74790 425 196 51 ------
NM_001650chr1832987 1076 493 31526 837 620 148 --
NM_001654chrX2333 38 ------
NM_001658chr18942 899 762 725 345 48 35 21 ------
NM_001659chr12112416 2284 2265 2137 2046 1881 1818 1068 379 341 279 ------
NM_001661chr173532 203 83 1794 ----
NM_001662chr7288 76 ------
NM_001663chr1432195 1759 539 ------
NM_001664chr32925 219 1649 125 --
NM_001665chr112422 35 --2389 366 --
NM_001668chr152265 2122 2113 1792 109 --2867 411 --
NM_001674chr13384 160 46 --135 --
NM_001677chr11723 ------
NM_001678chr1761628 1620 1607 1204 486 76 11220 ----
NM_001679chr33275 199 167 ------
NM_001682chr1232589 1168 1061 1535 ----
NM_001683chr362526 2520 2216 1876 1861 265 12076 22162 33 --
NM_001693chr811043 2342 333 1205 --
NM_001694chr162335 54 --1418 --
NM_001699chr1951788 1372 494 240 29 11694 ----
NM_001701chr931354 1335 1297 160 11066 --
NM_001704chr61113 ------
NM_001706chr3----1827 --
NM_001707chr74771 605 578 121 --1635 --
NM_001709chr111336 ------
NM_001717chr153977 535 191 ------
NM_001723chr62669 330 1197 ----
NM_001731chr121664 1621 ----
NM_001743chr22243 154 ------
NM_001744chr5157 ------
NM_001745chr5196 ------
NM_001746chr562471 2315 2224 1885 896 779 1466 ----
NM_001753chr741764 1454 662 562 ------
NM_001754chr2134245 2949 44 12638 22608 225 --
NM_001755chr1622098 623 ------
NM_001759chr12115049 4945 4905 4510 3371 3321 2134 1869 1646 1186 604 24367 510 1552 --
NM_001760chr63799 372 117 --1339 --
NM_001761chr1621763 479 11311 ----
NM_001773chr141370 1305 1154 194 ------
NM_001777chr331048 736 143 32903 2532 637 1601 --
NM_001782chr9296 82 ------
NM_001783chr192265 92 ----1289
NM_001788chr71626 ------
NM_001789chr331389 1279 212 --11696 --
NM_001791chr121189 1141 11042 --1510
NM_001796chr16164 ------
NM_001806chr1922867 2402 ------
NM_001810chr201594 --1297 --
NM_001821chr143895 1098 139 39 11795 ----
NM_001826chr1187 ------
NM_001829chr43874 794 339 ------
NM_001830chrX83049 2907 2693 2457 1582 1384 1341 982 12827 13291 --
NM_001843chr121178 151 ----
NM_001844chr122324 130 ------
NM_001851chr62124 99 ------
NM_001859chr943524 3347 3127 3055 13541 ----
NM_001865chr6146 ------
NM_001892chr5--11383 ----
NM_001893chr171119 ------
NM_001894chr222776 234 --1185 1394
NM_001895chr2041205 1053 1022 297 ------
NM_001918chr175706 5675 5663 2982 2753 1008 989 37016 5988 3087 13192 --
NM_001923chr113608 587 57 ------
NM_001924chr1------1373
NM_001927chr26690 145 131 111 105 69 --247 35 --
NM_001932chr172670 62 --1622 --
NM_001933chr1451241 534 293 185 68 ------
NM_001938chr11367 ------
NM_001940chr122527 76 ------
NM_001945chr561449 1058 999 279 245 238 ----1175
NM_001946chr123913 774 41 ------
NM_001949chr652305 1174 617 425 291 ------
NM_001950chr163652 255 129 ------
NM_001951chr81500 ------
NM_001964chr52379 130 2966 337 ----
NM_001968chr41589 ------
NM_001970chr177590 537 459 416 247 233 176 1153 ----
NM_001978chr810869 721 652 286 273 215 202 178 113 32 1830 1790 --
NM_001981chr142188 707 316 223 ------
NM_001987chr1282952 2745 2668 682 648 602 283 277 --21655 1159 --
NM_001995chr42992 287 --166 --
NM_001999chr51148 11338 ----
NM_002009chr1511802 2774 307 ----
NM_002010chr13------130
NM_002015chr1332401 2056 1325 ------
NM_002023chr141344 1245 393 177 ------
NM_002025chrX139258 8332 7704 7583 6645 6502 6241 5699 3054 1705 1413 1403 764 11079 28619 2889 --
NM_002026chr221037 110 ------
NM_002031chr61213 ------
NM_002037chr6----1152 --
NM_002041chr15------1117
NM_002044chr151156 2500 428 ----
NM_002045chr31141 ------
NM_002051chr10--1831 ----
NM_002062chr641600 565 552 313 1512 ----
NM_002063chrX----1982 --
NM_002065chr121453 1336 --1408 --
NM_002068chr195680 469 198 163 149 ------
NM_002070chr35904 897 741 208 153 --1925 --
NM_002071chr182229 154 ------
NM_002072chr92690 30 ------
NM_002074chr171653 1643 1495 1366 1342 148 115 ------
NM_002076chr1263193 2540 2533 2439 2169 886 23237 2213 ----
NM_002077chr972061 2034 1938 1516 1509 664 389 2542 514 ----
NM_002080chr162864 717 ------
NM_002082chr56911 769 638 176 112 103 1750 1405 --
NM_002083chr142255 120 --2226 73 --
NM_002084chr53802 687 548 --2795 730 --
NM_002086chr1742047 2032 529 135 --11390 --
NM_002092chr444001 3258 3252 881 ------
NM_002094chr162335 71 ------
NM_002114chr61455 ------
NM_002135chr124396 363 160 38 --1179 --
NM_002137chr7----12005 --
NM_002141chr7271 34 ------
NM_002146chr17--1440 ----
NM_002147chr172804 700 ------
NM_002148chr21104 ------
NM_002156chr2165 ------
NM_002161chr92107 33 ------
NM_002168chr152242 57 ------
NM_002181chr2255 21 1513 1289 --
NM_002187chr5----2945 235 1218
NM_002193chr261824 1793 1311 1284 619 402 1201 ----
NM_002196chr2031002 405 37 ------
NM_002196chr2031002 405 37 ------
NM_002204chr1721354 194 ------
NM_002205chr124945 921 835 52 --1402 --
NM_002206chr124413 178 125 35 ------
NM_002210chr221075 313 21408 700 ----
NM_002211chr10----1986 --
NM_002221chr172865 2728 2434 2245 870 707 82 12208 12338 --
NM_002223chr1253715 3376 3081 647 615 12906 ----
NM_002226chr143819 742 352 --2806 37 --
NM_002230chr177893 861 429 338 324 165 76 ------
NM_002232chr151382 948 206 200 70 ------
NM_002235chr121465 --11202 --
NM_002240chr212166 59 --2418 226 --
NM_002246chr23482 113 82 --1311 --
NM_002247chr1021575 906 11748 12145 --
NM_002253chr431198 1017 891 1321 ----
NM_002254chr231823 939 620 --1228 1830
NM_002264chr3104551 1590 1295 714 623 617 346 178 148 56 14493 3984 630 77 --
NM_002267chr1322157 449 12007 ----
NM_002268chr321620 629 ------
NM_002270chr553941 1504 1398 571 43 25439 4014 ----
NM_002271chr132629 588 1641 ----
NM_002274chr171242 ------
NM_002282chr12----1220 --
NM_002285chr273614 1113 1088 1081 1015 706 120 13194 ----
NM_002293chr162707 1935 1772 1078 379 346 --12669 --
NM_002294chrX162 ------
NM_002313chr1094865 4791 4258 3951 3899 1898 1665 1445 1338 1723 1362 --
NM_002315chr111105 ------
NM_002319chr761076 319 264 218 121 23 --41089 932 236 88 --
NM_002332chr124571 311 86 61 --1224 --
NM_002333chr193821 492 101 11268 ----
NM_002334chr1141483 327 287 103 --31721 1709 140 --
NM_002336chr1254942 4295 4199 1421 631 14824 1454 --
NM_002355chr125995 164 102 91 31 ------
NM_002359chr1783938 3889 3820 3512 2681 1127 1078 717 23836 3008 13136 --
NM_002372chr51522 1289 ----
NM_002374chr21819 23317 2601 12594 --
NM_002375chr392108 1701 1603 1579 679 531 482 344 290 12143 1849 --
NM_002382chr142218 170 --31048 411 80 --
NM_002384chr183901 208 156 ------
NM_002385chr1821248 480 --131 --
NM_002390chr1731733 1510 166 1120 11389 --
NM_002399chr1511334 11077 ----
NM_002401chr1762114 1774 1736 782 295 33 --11798 --
NM_002403chr12278 31 --150 --
NM_002406chr54861 764 390 336 --1961 --
NM_002409chr2282631 2544 2360 1061 964 870 672 152 23189 2812 1237 --
NM_002430chr222990 35 167 31828 1594 699 --
NM_002442chr1271576 1324 1220 1168 1114 293 216 ------
NM_002448chr43195 110 97 ----1679
NM_002455chr1139 ------
NM_002465chr12129 ------
NM_002466chr202134 107 ------
NM_002473chr224863 283 277 124 11179 11067 --
NM_002479chr13480 268 148 --1195 --
NM_002480chr121129 --1396 --
NM_002481chr1267672 7268 6848 6216 5890 5357 4967 3180 3074 3027 2728 2550 1987 1977 1873 1656 1609 1506 727 634 623 561 496 403 377 76 66610 5584 5344 1926 923 298 13187 --
NM_002499chr152697 173 1411 ----
NM_002500chr2180 ------
NM_002501chr19183935 3907 3876 3672 3241 3154 3125 1390 1000 831 568 549 542 446 377 351 241 179 11414 1967 --
NM_002505chr621508 101 ------
NM_002507chr1771942 1695 764 670 575 482 187 ------
NM_002508chr15547 539 240 146 85 11582 11633 --
NM_002509chr203778 766 591 --1788 --
NM_002515chr1421375 799 --11628 --
NM_002519chr1121101 433 41305 1061 1037 50 ----
NM_002522chr1792927 2884 2761 2625 2527 844 671 586 227 12617 42894 710 152 34 1828
NM_002537chr15------11000
NM_002545chr1155003 4733 4586 2063 297 65049 4935 4646 3915 1360 1352 24446 1978 23687 2025
NM_002546chr82240 29 ------
NM_002553chr71369 ------
NM_002556chr1151993 1621 845 758 733 3833 436 100 ----
NM_002558chr1751052 820 353 311 109 ------
NM_002570chr152918 434 1203 ----
NM_002572chr11139 ------
NM_002576chr1151048 317 308 83 37 1129 ----
NM_002577chr352881 1485 989 813 415 1912 ----
NM_002578chrX2157 33 1390 ----
NM_002579chr1951425 1411 1330 1046 1002 11398 ----
NM_002583chr121388 ------
NM_002586chr651574 1439 1408 1089 1010 11292 136 --
NM_002589chr4180 ------
NM_002594chr2052082 808 313 55 30 --1707 --
NM_002595chr1241644 720 414 118 11871 ----
NM_002599chr114969 929 403 47 ------
NM_002600chr121201 564 ------
NM_002607chr72893 42 ------
NM_002608chr2271541 1523 1325 1271 1252 404 97 1267 ----
NM_002609chr561482 762 724 667 435 207 1420 1103 --
NM_002613chr16174899 4257 3951 3671 3664 3358 2019 2007 1950 1917 1858 1411 1154 1115 729 230 25 --31449 562 261 --
NM_002628chr32433 174 ------
NM_002633chr12452 171 ------
NM_002634chr174856 840 745 69 ------
NM_002636chr62401 384 ------
NM_002644chr161672 1594 1149 353 152 44 11184 41395 271 129 70 --
NM_002648chr651197 1093 448 330 21 ------
NM_002651chr16897 885 593 336 271 58 ----1675
NM_002655chr834766 1961 1492 24422 1157 ----
NM_002657chr20123461 3253 3238 3056 2522 2490 2473 1484 1345 1134 971 283 --22597 2531 --
NM_002660chr2031201 1169 96 --11035 --
NM_002687chr1421205 404 ------
NM_002698chr1972339 2036 1926 1031 643 208 193 32382 2355 1200 32799 1185 396 --
NM_002705chr164294 121 78 43 --1575 --
NM_002707chr23350 152 45 --1331 --
NM_002709chr222714 891 ------
NM_002710chr123736 119 55 ------
NM_002714chr65987 969 937 447 124 1312 ----
NM_002716chr1183531 3511 3273 2804 2546 1451 1114 292 197 23197 2947 --
NM_002717chr81495 ------
NM_002718chr371878 737 618 595 390 237 217 ------
NM_002719chr1451756 1557 551 300 221 1834 11929 --
NM_002721chr9138 ------
NM_002730chr1961256 972 273 267 207 198 ------
NM_002731chr12775 105 13181 1918 --
NM_002738chr1631077 239 26 --1151 --
NM_002745chr2284173 4130 3599 3481 1375 1332 937 471 ----22849 1147
NM_002746chr163398 204 186 --1523 --
NM_002747chr1851782 1597 1414 1327 79 --11800 --
NM_002748chr151276 ------
NM_002752chr5143 ------
NM_002753chr41821 --1637 --
NM_002755chr151572 ------
NM_002763chr13231 157 143 ------
NM_002765chrX2958 392 ------
NM_002779chr101541 ------
NM_002806chr141334 ------
NM_002811chr162489 123 1527 ----
NM_002819chr1971150 544 525 498 350 253 231 11025 1970 11000
NM_002821chr65630 568 172 166 86 ----2814 301
NM_002822chr1211807 ------
NM_002824chr124384 183 175 144 ------
NM_002826chr1------1361
NM_002827chr2031715 529 179 11336 ----
NM_002829chr93925 346 268 ------
NM_002833chr1521138 36 11228 11381 --
NM_002834chr1262969 1238 1104 1053 400 220 1376 --23392 1467
NM_002837chr1274536 4231 3526 1265 992 601 359 12879 --13941
NM_002838chr11483 ------
NM_002839chr923391 2676 142 ----
NM_002840chr15603 516 263 224 90 --21280 1192 --
NM_002841chr32637 468 1594 ----
NM_002843chr1132213 2118 643 ----11234
NM_002844chr611361 ------
NM_002847chr721331 119 --1113 --
NM_002849chr1211016 1877 1896 --
NM_002850chr193941 456 353 1159 --1218
NM_002851chr71717 ------
NM_002855chr11113596 3118 2667 2563 1444 1338 1037 764 655 281 206 12264 11303 --
NM_002858chr11360 ------
NM_002859chr1261252 1240 596 336 217 120 --11175 --
NM_002865chr8------1267
NM_002868chr1272262 2232 1844 1824 1690 748 72 --11569 --
NM_002869chr1161715 1707 1523 400 102 53 21488 455 ----
NM_002871chr151530 1264 769 678 93 ------
NM_002886chr334974 4915 3361 --15141 11052
NM_002892chr14------11168
NM_002893chrX----1275 --
NM_002897chr2--1191 ----
NM_002898chr123672 608 184 --1567 --
NM_002903chr17122 ------
NM_002906chr1142046 438 414 381 ----12428
NM_002911chr192318 302 11254 1517 --
NM_002912chr61203 ------
NM_002918chr194719 318 149 141 158 ----
NM_002928chr171542 1118 544 510 305 264 178 ------
NM_002930chr18230 23 ------
NM_002938chr461631 1402 1306 780 685 195 --11602 --
NM_002940chr4----1412 --
NM_002941chr341587 1290 218 206 ----1427
NM_002942chr32941 477 ------
NM_002945chr172593 137 --1261 --
NM_002953chr12768 164 ------
NM_002955chr661992 1633 1553 1494 79 71 ------
NM_002956chr1231022 308 157 11276 ----
NM_002957chr9143794 3695 3522 2867 2711 2698 1448 1410 1126 1004 676 418 225 91 --21192 276 1651
NM_002959chr174243 4171 4113 3413 3204 650 548 --33968 3686 400 13350
NM_002968chr161833 ------
NM_002971chr32419 77 ------
NM_002973chr121402 ------
NM_002996chr16121956 1781 1561 1450 1243 1226 775 581 390 357 61 55 ------
NM_002997chr221383 1293 ------
NM_003003chr172258 103 ------
NM_003010chr1731885 1688 466 ------
NM_003016chr1731472 775 747 --11412 --
NM_003017chr61509 1237 ----
NM_003026chr931335 1110 463 ----11007
NM_003027chr153308 128 94 --164 --
NM_003028chr993003 2541 2495 2437 2390 1541 1493 1062 282 12609 63208 2871 1406 1340 1272 838 --
NM_003029chr131108 240 34 1402 ----
NM_003031chr161756 ------
NM_003034chr12147373 7205 7046 6940 6772 6675 6277 5127 3190 2736 1831 727 479 105 ------
NM_003036chr141242 1157 874 256 --1806 --
NM_003042chr331515 1438 32 ------
NM_003045chr13104301 4245 3330 3179 921 751 361 254 164 115 14192 ----
NM_003047chr141323 328 81 33 ------
NM_003051chr12777 652 ------
NM_003060chr53891 112 83 1818 ----
NM_003071chr311361 ------
NM_003074chr321664 339 2859 74 1186 --
NM_003075chr12264 28 ------
NM_003076chr1291654 1605 1335 1098 612 582 509 448 363 11699 --11082
NM_003077chr171767 1589 ----
NM_003079chr171322 ----1224
NM_003081chr202438 53 1415 ----
NM_003091chr202189 55 ------
NM_003096chr2134 --1170 --
NM_003099chr15116185 4185 2616 2524 2268 1471 1141 943 868 808 57 22201 2184 11043 --
NM_003107chr621621 892 11911 ----
NM_003108chr266452 5640 2773 2628 1813 856 12086 12763 --
NM_003110chr176853 286 203 196 163 51 --1102 --
NM_003111chr2--11091 ----
NM_003112chr722937 2363 ------
NM_003113chr21313 1538 ----
NM_003118chr511988 ------
NM_003128chr232221 1967 26 31053 275 102 ----
NM_003131chr6131708 1506 531 521 508 473 393 368 344 266 248 188 143 --21588 834 --
NM_003137chr631784 1666 49 2100 58 ----
NM_003139chr115805 777 618 257 47 ------
NM_003145chr13375 310 116 --1149 --
NM_003146chr113124 81 33 ------
NM_003149chr341210 1106 589 520 ------
NM_003150chr1741879 944 317 66 --22166 1553 --
NM_003155chr821730 228 22453 126 ----
NM_003156chr1141182 280 166 151 21342 76 ----
NM_003161chr17--22913 1160 ----
NM_003164chr113472 193 178 --1366 --
NM_003165chr991695 1513 1402 1394 767 606 399 257 34 21452 1282 21298 619 --
NM_003173chrX41111 1081 238 71 11394 ----
NM_003174chr101285 1783 ----
NM_003178chr311668 --12064 --
NM_003179chrX21217 193 198 1179 --
NM_003180chr191319 191 ----
NM_003185chr204508 489 300 240 ------
NM_003186chr113319 97 32 ------
NM_003189chr162427 1304 1189 692 553 259 12158 32289 639 359 --
NM_003199chr1825522 1096 14471 --14780
NM_003200chr1931749 1521 937 --11740 --
NM_003202chr521323 38 11724 1126 --
NM_003204chr1721164 101 --31584 1438 229 --
NM_003216chr22113046 2883 2532 2356 2074 2056 1240 660 343 201 73 ------
NM_003220chr641109 457 175 145 21525 1115 1254 --
NM_003221chr683393 3074 2855 2745 594 575 527 471 23543 1215 23187 2761 --
NM_003224chr205860 814 728 360 268 ------
NM_003234chr331694 956 483 ------
NM_003235chr8--183 ----
NM_003236chr243016 2401 1226 678 31387 1305 533 11030 1150
NM_003239chr143773 725 709 2994 737 ----
NM_003242chr361992 1660 1628 818 229 47 1752 2946 682 --
NM_003255chr1772363 2316 2274 2044 996 621 456 11021 1199 1827
NM_003262chr375082 4386 4047 3804 2038 684 152 ----14063
NM_003269chr6187 --2530 119 1423
NM_003272chr12172 32 1615 ----
NM_003275chr921174 539 ------
NM_003285chr14556 367 360 191 1468 ----
NM_003289chr9131 ------
NM_003290chr191223 ------
NM_003292chr142103 1850 1739 527 12239 ----
NM_003299chr121181 ------
NM_003300chr14179 ------
NM_003317chr142713 583 ------
NM_003319chr21698 ------
NM_003320chr1183567 3272 3015 2972 1317 1136 840 97 1532 44089 3633 724 121 1510
NM_003334chrX1153 ------
NM_003336chrX1406 ------
NM_003337chr53485 128 55 ----11134
NM_003338chr1011515 1175 ----
NM_003339chr5--1637 ----
NM_003340chr42443 332 ------
NM_003342chr1742256 976 954 238 23032 488 12988 --
NM_003347chr2262171 1995 1985 1936 604 215 --22358 2107 --
NM_003348chr1211401 1599 21292 560 --
NM_003349chr2081244 989 640 590 423 385 377 25 ------
NM_003350chr8----1741 --
NM_003352chr22935 204 132 ----
NM_003359chr421282 939 ------
NM_003360chr4----1116 --
NM_003367chr191178 --167 --
NM_003368chr11189 ------
NM_003369chr1162621 1950 1749 682 363 318 32586 761 704 2715 387 --
NM_003372chrX1351 ------
NM_003373chr1041749 1282 608 332 --11613 --
NM_003374chr53607 120 55 1805 ----
NM_003376chr661485 1364 1354 602 52 28 ------
NM_003376chr661485 1364 1354 602 52 28 ------
NM_003387chr212103 2952 935 ----
NM_003390chr11------1409
NM_003392chr343315 2977 1545 1037 1630 ----
NM_003394chr123554 175 63 --1578 --
NM_003400chr21119 1671 1701 --
NM_003406chr831812 1624 1495 11890 --11433
NM_003407chr191492 ------
NM_003410chrX11942 12419 ----
NM_003412chr352013 1172 1113 1096 324 12193 ----
NM_003413chrX3408 263 176 1457 ----
NM_003417chr19157987 7275 7064 6565 6524 6504 6402 6312 6223 6203 6114 2498 2356 1725 140 18438 11487 13806
NM_003427chr62561 515 1260 ----
NM_003439chr733130 2223 811 --33381 2736 668 --
NM_003453chr131657 ------
NM_003457chr171495 ------
NM_003458chr3143930 3448 3371 3290 3194 3059 2968 2935 2542 584 527 444 310 279 32446 1381 298 ----
NM_003462chr13702 440 88 1381 ----
NM_003463chr632667 2645 2459 22779 447 11359 13304
NM_003468chr252897 1492 1303 222 91 13647 ----
NM_003470chr16101720 1649 1558 1499 527 506 423 353 176 80 21876 51 ----
NM_003472chr611485 ------
NM_003473chr10191 1153 ----
NM_003474chr1042240 1982 1611 1541 12396 ----
NM_003478chr1123194 186 ------
NM_003482chr1272658 2642 2494 2112 1016 771 491 11998 1215 12099
NM_003483chr121210 11862 ----
NM_003485chr1471225 943 876 351 202 128 84 --21215 44 --
NM_003489chr2121118 1073 ------
NM_003495chr6140 ------
NM_003498chr1672223 2028 1991 1096 502 369 180 --22414 875 --
NM_003502chr163531 220 39 ----1442
NM_003538chr6146 ------
NM_003542chr6164 ------
NM_003545chr6151 ------
NM_003548chr1142 ------
NM_003557chr161185 635 397 363 186 66 ------
NM_003558chr9----1507 --
NM_003559chr1763657 3535 1376 907 840 725 21492 446 32566 1399 435 1978
NM_003563chr1721297 563 ------
NM_003564chr13578 535 28 --1552 1100
NM_003566chr122910 808 --23007 897 --
NM_003571chr31205 2211 44 ----
NM_003575chr791465 1347 1203 1081 622 517 423 337 246 --41442 1436 260 80 --
NM_003576chr1352722 2498 854 188 82 ------
NM_003583chr1231045 856 394 1387 12801 --
NM_003586chr161458 ------
NM_003589chr1341280 470 48 25 ------
NM_003590chr232706 1149 951 --23797 2461 13148
NM_003591chr101285 ------
NM_003595chr222443 381 ------
NM_003607chr164331 3948 1379 159 56 30 23122 2823 24220 3451 1751
NM_003613chr15----132 --
NM_003615chr33928 623 180 ------
NM_003618chr2----1894 --
NM_003627chr111417 1178 ----
NM_003629chr163126 2846 2526 2292 1377 1095 2566 289 ----
NM_003632chr172669 209 ------
NM_003633chr522352 1020 1302 ----
NM_003644chr17196338 6192 6052 5858 5570 4484 4295 4183 2636 2466 2159 2136 2128 2053 2024 1232 784 494 211 --24956 1745 --
NM_003651chr122595 24 1574 ----
NM_003654chr112538 505 ------
NM_003655chr173711 235 225 ------
NM_003663chr323056 2497 ------
NM_003664chr52407 89 1543 ----
NM_003670chr311390 11055 ----
NM_003671chr992921 2910 2772 2302 1304 1068 951 747 271 12422 1347 1213
NM_003672chr121420 109 1149 ----
NM_003673chr17149 ------
NM_003679chr121095 265 21238 539 ----
NM_003684chr11459 --1319 --
NM_003685chr191378 --2171 127 --
NM_003711chr51214 ------
NM_003713chr151177 609 423 154 64 --1693 --
NM_003714chr562680 2496 2460 2056 1033 1005 ------
NM_003716chr32831 169 ------
NM_003722chr362273 2257 2128 764 317 81 2867 486 --1198
NM_003732chr5146 ----1196
NM_003737chr112155 130 ------
NM_003740chr651636 1439 154 134 48 --1665 --
NM_003743chr21474 12046 ----
NM_003749chr1362419 1917 912 548 371 304 ------
NM_003750chr101291 ------
NM_003759chr473507 3230 3224 1622 597 269 41 ------
NM_003760chr11553 ------
NM_003763chr2042666 699 476 200 12031 --12457
NM_003768chr141164 557 125 36 11579 ----
NM_003773chr3151 ------
NM_003779chr13141 73 65 ------
NM_003780chr12210 21 ------
NM_003782chr6--2251 218 170 --
NM_003782chr6--2251 218 170 --
NM_003782chr6--2251 218 170 --
NM_003787chr1831122 1085 616 ------
NM_003791chr161147 --141 --
NM_003795chr62508 188 --1107 --
NM_003800chr621873 183 ------
NM_003806chr121218 ------
NM_003816chr81399 ------
NM_003819chr1138 ------
NM_003822chr122274 736 11102 ----
NM_003831chr181199 ------
NM_003837chr9123 ------
NM_003840chr842066 2057 1988 33 ------
NM_003858chr142704 217 --1165 --
NM_003861chr1442850 2439 2324 1054 --1536 --
NM_003873chr101385 1747 12091 --
NM_003884chr3--1295 ----
NM_003885chr1762657 1993 1829 857 390 281 1719 ----
NM_003888chr1541623 1441 1176 394 1346 175 --
NM_003893chr10150 --1377 --
NM_003895chr2131773 761 356 1722 ----
NM_003908chr201315 11193 --11269
NM_003913chr643927 3872 1635 431 13498 2902 749 13340
NM_003921chr12338 315 --11252 --
NM_003924chr41326 1203 1173 --
NM_003927chr181809 ------
NM_003932chr2221529 25 ----1630
NM_003938chr193853 780 79 ------
NM_003941chr742303 2250 2011 1693 ----1673
NM_003947chr32883 190 ----11214
NM_003948chr442518 2411 206 145 ------
NM_003949chr1781983 1913 1615 1597 1379 448 309 116 21998 1934 21441 483 --
NM_003954chr1751053 501 396 388 44 11156 ----
NM_003966chr5187661 7579 6969 6302 5803 4904 2702 2671 2549 2528 2498 2218 1859 1848 1643 1253 1227 887 144 16234 --
NM_003980chr611004 ------
NM_003983chr1654274 4052 1410 983 497 ----13909
NM_003987chr1062018 1989 1892 1790 212 157 1172 2806 585 --
NM_003988chr1062095 2066 1969 1867 289 234 1249 2883 662 --
NM_003989chr1071954 1925 1828 1726 873 148 93 1108 2742 521 --
NM_003990chr1071954 1925 1828 1726 873 148 93 1108 2742 521 --
NM_003992chr152282 276 ------
NM_003993chr13237 225 115 ------
NM_003994chr1224426 4174 ------
NM_004006chrX12050 ------
NM_004007chrX12050 ------
NM_004009chrX12050 ------
NM_004010chrX12050 ------
NM_004011chrX12050 ------
NM_004012chrX12050 ------
NM_004013chrX12050 ------
NM_004014chrX12050 ------
NM_004015chrX12050 ------
NM_004017chrX12050 ------
NM_004020chrX12050 ------
NM_004024chr151091 519 405 259 112 --1394 --
NM_004028chr1832987 1076 493 31526 837 620 148 --
NM_004036chr22518 123 --3465 245 130 --
NM_004050chr1452468 2254 747 620 72 1537 --11860
NM_004061chr52527 86 ------
NM_004068chr32342 111 ------
NM_004081chrY31378 1155 97 ------
NM_004082chr2241 35 ------
NM_004087chr351594 1519 1402 1332 63 3576 452 159 ----
NM_004089chrX1513 ------
NM_004090chr1793018 2671 2547 2241 1098 1016 514 489 355 12201 22714 1259 --
NM_004093chr131672 ------
NM_004094chr142613 160 12946 ----
NM_004097chr22266 204 ------
NM_004098chr103805 244 227 --11314 --
NM_004099chr921643 23 ------
NM_004100chr6--1363 22078 785 --
NM_004113chr331766 1723 30 --11670 --
NM_004114chrX2332 76 2990 781 ----
NM_004116chr22450 314 ------
NM_004117chr641408 1398 714 630 31584 292 48 ----
NM_004132chr103905 378 156 ----1873
NM_004139chr20----1108 1323
NM_004156chr81505 ------
NM_004161chr2--11264 ----
NM_004162chr321123 187 ------
NM_004169chr171117 ------
NM_004171chr11129665 9333 8502 7274 6826 6516 6262 6092 3766 3192 2775 1172 27953 480 47744 6184 1005 843 13864
NM_004181chr42137 131 144 --1326
NM_004187chrX31081 1040 43 21098 1011 1593 11261
NM_004199chr5135 ------
NM_004200chr1182954 2817 2166 2062 1051 967 836 543 --155 --
NM_004202chrY1128 ------
NM_004205chr112475 367 ------
NM_004215chr8--1371 ----
NM_004227chr752651 2510 2477 2029 1210 1838 ----
NM_004228chr191122 ------
NM_004229chrX41709 1516 593 587 --21550 68 --
NM_004232chr181662 1280 ----
NM_004236chr151376 ------
NM_004238chr21102 ------
NM_004247chr17186 ------
NM_004248chr102267 138 ------
NM_004253chr95871 678 387 277 51 ------
NM_004261chr11834 ------
NM_004272chr521755 767 ------
NM_004274chr1423058 2794 13050 11155 --
NM_004277chr621200 657 123 ----
NM_004286chr22112839 2805 2423 2115 689 474 235 219 211 97 22 --2852 266 --
NM_004293chr952750 2703 2438 2401 623 12900 ----
NM_004295chr1721079 148 ----11043
NM_004302chr1282539 2253 1031 857 794 760 450 102 --32548 2229 604 --
NM_004309chr176988 446 277 179 173 105 --1963 1841
NM_004311chr1082893 2838 2556 2478 2244 2147 1219 605 1344 22087 812 --
NM_004316chr124902 465 440 427 ------
NM_004321chr273289 3153 2860 2701 2485 1397 50 ------
NM_004323chr9102425 2387 2335 2222 2198 2038 867 504 353 131 21987 821 22266 561 --
NM_004330chr151958 ------
NM_004331chr822119 1789 1140 12707 --
NM_004338chr1876305 5806 5132 4689 2820 2293 1117 16276 22221 971 12490
NM_004349chr8265 59 2906 462 --11317
NM_004350chr121966 546 31921 531 51 11894 --
NM_004354chr4--1286 ----
NM_004356chr111552 --1441 1473
NM_004370chr661564 814 806 678 591 521 ------
NM_004376chr1031451 1420 1308 --21487 207 11021
NM_004377chr223298 131 26 ------
NM_004379chr2--2265 204 ----
NM_004380chr1642317 2208 1726 723 --11930 --
NM_004384chr512093 ------
NM_004386chr1972047 2037 1810 1767 818 509 54 --1630 --
NM_004392chr1322410 424 ------
NM_004393chr372084 1826 1800 736 363 164 154 ------
NM_004396chr171278 ------
NM_004397chr1143751 1582 933 411 --12766 --
NM_004399chr12135 1634 --1706
NM_004405chr23317 284 49 ------
NM_004408chr93495 191 103 ------
NM_004409chr195759 743 620 562 548 ------
NM_004418chr22117 91 --1214 --
NM_004420chr1182360 2197 2087 1526 832 540 251 182 ------
NM_004423chr3102718 2586 2065 1099 1082 906 709 627 364 295 ----12292
NM_004429chrX2319 207 --11250 --
NM_004430chr871696 1106 942 783 353 211 205 21048 406 ----
NM_004431chr14727 330 284 197 ------
NM_004432chr921843 254 12167 11769 --
NM_004433chr13668 605 580 21618 274 ----
NM_004436chr11142 ------
NM_004438chr263207 2137 1114 902 854 97 --12120 --
NM_004440chr61271 --159 --
NM_004441chr31390 ------
NM_004443chr35609 586 538 263 241 ------
NM_004446chr1135 ------
NM_004450chr14--1280 --1368
NM_004451chr113673 561 155 ------
NM_004454chr321648 107 1155 ----
NM_004456chr71169 ------
NM_004457chr2199 ------
NM_004459chr17----1434 --
NM_004464chr431188 214 40 --2914 885 --
NM_004474chr13914 397 39 ------
NM_004475chr175943 873 459 354 42 ------
NM_004481chr162422 2158 2149 2119 1945 196 --12481 --
NM_004482chr2--1967 ----
NM_004484chrX1309 ------
NM_004485chr143479 1711 1400 375 140 ----
NM_004487chr33974 858 51 134 ----
NM_004494chr141169 1109 955 115 1453 1191 --
NM_004498chr15--1255 ----
NM_004500chr1441984 1909 740 446 21294 632 ----
NM_004501chr142655 1554 843 45 --22797 441 11362
NM_004502chr173445 429 372 ------
NM_004503chr124309 251 172 41 ------
NM_004514chr17122879 2850 2812 2682 2627 2613 2324 2288 968 513 269 111 --22586 380 --
NM_004520chr52122 37 ------
NM_004525chr231256 615 574 ------
NM_004527chr174517 469 230 73 ------
NM_004529chr91151 ------
NM_004540chr211926 --1783 --
NM_004556chr62901 25 --1798 --
NM_004569chr141737 ------
NM_004575chr431472 1162 1049 --11039 --
NM_004583chr173615 494 276 --1505 --
NM_004586chrX64682 4455 4016 3464 1212 948 1348 ----
NM_004588chr1193971 3203 1626 1548 952 854 833 679 425 --22910 628 --
NM_004594chr163975 391 259 --1164 175
NM_004598chr572708 2679 2579 2395 1325 708 112 ------
NM_004603chr781127 1098 1052 922 831 385 152 81 1739 1311 --
NM_004606chrX3355 266 31 ------
NM_004612chr914511 23872 3559 14751 1622
NM_004626chr112726 52 --1145 --
NM_004630chr114938 864 261 212 ------
NM_004631chr121239 981 ------
NM_004637chr34225 165 108 33 ----161
NM_004640chr6139 ------
NM_004645chr171834 ------
NM_004655chr1721005 147 ------
NM_004656chr34957 885 863 283 --2773 48 --
NM_004660chrY21566 27 ----12149
NM_004663chr152415 244 ------
NM_004667chr151108 ------
NM_004671chr181212 ------
NM_004673chr111495 ------
NM_004686chr82639 354 1331 ----
NM_004687chr172198 181 ------
NM_004697chr94972 197 122 36 158 1727 --
NM_004698chr13186 175 52 ------
NM_004703chr1712079 1203 12498 12549
NM_004711chr22123354 2993 2803 2756 2531 2502 2361 2257 1279 1213 1159 871 1974 21021 741 --
NM_004719chr1212453 ------
NM_004723chr12418 234 --1821 --
NM_004726chrX85515 5119 5093 4697 4495 1280 539 373 --34470 2239 1058 --
NM_004730chr541789 738 592 333 1374 ----
NM_004732chr172313 277 ------
NM_004734chr1332920 877 103 --13234 1329
NM_004736chr141715 865 522 460 ------
NM_004737chr2231168 1162 978 --1144 175
NM_004739chr111150 ------
NM_004740chr172322 287 --165 --
NM_004741chr1041192 1014 562 76 1484 21401 287 --
NM_004742chr331674 434 264 ------
NM_004745chr8136693 6220 6203 6140 6094 5031 4827 4289 2199 1647 490 108 26 16954 ----
NM_004748chr1573936 3771 3745 3426 3164 1324 1147 13273 ----
NM_004755chr142154 46 1406 1861 --
NM_004759chr1102026 1780 1537 1404 734 641 450 408 391 290 --2381 258 --
NM_004762chr1761298 1288 1237 236 228 95 ----1355
NM_004768chr11920 11191 1838 --
NM_004772chr51238 --1252 --
NM_004774chr1732742 1929 983 ------
NM_004776chr2083055 2442 2282 2214 1030 998 884 269 12946 2405 170 --
NM_004779chr52531 225 ------
NM_004781chr131607 388 243 11510 ----
NM_004781chr131607 388 243 11510 ----
NM_004788chr1122041 1877 --2713 473 --
NM_004796chr1432007 1814 548 ------
NM_004798chr2083421 3130 3099 2925 926 688 302 43 32582 2315 1329 22763 1110 --
NM_004799chr1--1314 ----
NM_004801chr2----11074 --
NM_004814chr1199 ------
NM_004815chr164383 4130 3902 3510 1567 1461 24440 4325 24888 1491 --
NM_004818chr123244 145 68 --190 --
NM_004822chr17112701 1575 1537 1505 1495 1448 1385 1367 1046 948 157 --13481 11417
NM_004824chr61385 ------
NM_004830chr61754 ------
NM_004840chrX72162 1935 1707 824 668 577 411 1605 42179 383 349 34 --
NM_004845chrX31585 507 163 1370 --14154
NM_004850chr221193 265 ------
NM_004859chr1721962 590 12826 1670 --
NM_004860chr17----161 --
NM_004863chr1463319 2025 808 437 414 36 24018 3357 ----
NM_004871chr1733751 1720 1556 23885 3023 ----
NM_004872chr1153 ------
NM_004874chr81471 ------
NM_004879chr112343 113 ------
NM_004886chr19132 ------
NM_004887chr53999 969 889 21021 870 ----
NM_004891chr2------1234
NM_004893chr53432 72 44 ------
NM_004896chr1011426 ------
NM_004898chr442413 1956 1141 876 12539 ----
NM_004904chr765046 4758 4495 1966 1261 102 ----14742
NM_004905chr1----1185 --
NM_004907chr194783 377 299 238 --1188 --
NM_004923chr111147 ------
NM_004924chr192153 111 1366 1850 --
NM_004925chr93150 129 87 ------
NM_004926chr143519 166 153 ------
NM_004936chr932061 898 620 12471 11001 1201
NM_004938chr95941 849 449 286 264 ------
NM_004943chr198981 781 770 457 410 349 261 187 1888 21211 385 --
NM_004947chr32794 376 1929 21795 32 --
NM_004952chr12705 321 ------
NM_004953chr31340 ------
NM_004955chr61584 --1575 --
NM_004956chr713466 ------
NM_004959chr931006 598 296 --11183 11471
NM_004962chr10257 46 1187 ----
NM_004964chr13472 60 39 ------
NM_004965chr21--1771 ----
NM_004966chr102911 738 ------
NM_004968chr72641 249 ------
NM_004969chr10--1433 ----
NM_004973chr621330 629 ------
NM_004975chr202368 240 --1120 --
NM_004977chr194562 394 195 153 ------
NM_004978chr171616 1563 1533 621 417 410 44 --1652 --
NM_004979chrX2440 30 --31088 471 323 --
NM_004983chr141433 631 616 245 ----1995
NM_004991chr32401 170 ------
NM_004992chrX178274 7930 7087 6994 6915 6442 6414 5870 3090 3082 2607 1819 1796 1489 1377 1370 760 32979 1065 268 13180 --
NM_004992chrX178274 7930 7087 6994 6915 6442 6414 5870 3090 3082 2607 1819 1796 1489 1377 1370 760 32979 1065 268 13180 --
NM_004993chr1431462 1354 330 1510 --1960
NM_004994chr201133 ------
NM_004995chr1461308 472 331 253 235 151 11282 11029 --
NM_005004chr10127 ------
NM_005010chr73387 231 69 12230 1841 --
NM_005011chr731472 1313 558 ------
NM_005017chr3357 48 26 ------
NM_005020chr71159 ------
NM_005022chr17123 ------
NM_005028chr1031815 1774 859 --1846 --
NM_005045chr72126 50 ------
NM_005056chr1284943 4901 4439 1785 863 665 375 197 --1360 --
NM_005057chr191903 1745 1541 658 595 584 464 380 220 ----1389
NM_005063chr1063525 1442 996 270 260 234 --12982 --
NM_005065chr1454831 3572 1992 1461 1438 23488 643 ----
NM_005067chr33857 630 336 3871 686 22 ----
NM_005076chr1183215 3024 2964 2951 2941 2913 2766 1595 1267 976 750 691 621 500 492 452 342 137 33670 3578 508 13986 --
NM_005078chr1561638 1520 1238 1180 1143 350 --1601 --
NM_005080chr224834 298 110 102 ------
NM_005087chr31548 ------
NM_005095chr192241 2216 2049 1551 662 614 593 402 95 --1822 --
NM_005096chrX41193 414 141 61 ------
NM_005099chr141337 387 225 22 --21021 396 --
NM_005103chr111334 ----1290
NM_005109chr34985 974 629 365 1710 1605 --
NM_005110chr53801 277 143 1629 ----
NM_005112chr41143 --1341 1789
NM_005116chr2094605 3917 1763 1710 1688 1433 421 266 215 13132 11547 1203
NM_005119chr121211 1092 11288 ----
NM_005121chr1753862 3477 2936 2392 529 23610 1510 ----
NM_005128chr21--1515 ----
NM_005133chr11248 31 ------
NM_005135chr1543523 3159 937 52 1211 --13351
NM_005146chr114306 260 204 36 ------
NM_005151chr1822398 1741 --1480 --
NM_005155chr63663 463 223 1262 ----
NM_005156chr984563 4073 3714 3570 3367 3351 231 54 ----11426
NM_005157chr9101954 1856 1491 753 604 565 458 319 224 188 ------
NM_005159chr1531719 892 80 ----1773
NM_005161chr1192201 2184 1964 1655 1585 429 139 54 38 --31552 650 32 12034
NM_005164chr1212017 ------
NM_005165chr173307 149 25 --1102 --
NM_005166chr194341 309 220 22 ------
NM_005168chr21583 11422 --1435
NM_005171chr12------1844
NM_005182chr165507 412 246 181 115 ------
NM_005184chr19111351 1213 1161 1142 1122 452 428 327 307 277 205 --1224 1995
NM_005186chr114559 475 130 102 ------
NM_005187chr1671553 1486 1374 1353 1332 1305 269 11657 ----
NM_005188chr11227927 7871 7733 7532 7315 6716 6035 5786 5727 5658 5583 5548 5254 5080 3158 3054 2724 1234 928 633 228 114 11580 27795 6248 --
NM_005189chr1762392 2205 2196 2168 598 249 190 2691 444 --
NM_005191chr331060 111 82 ------
NM_005197chr1475537 4171 4080 2060 616 510 426 1186 11429 11152
NM_005201chr31298 ------
NM_005203chr101407 ------
NM_005204chr10----1846 --
NM_005206chr1741096 900 893 416 ------
NM_005215chr181477 ------
NM_005219chr551388 1373 1278 722 30 1151 11258 --
NM_005220chr1721449 489 --1569 --
NM_005222chr73627 614 371 ------
NM_005224chr191701 ------
NM_005225chr204868 792 401 81 ------
NM_005227chr15559 431 173 43 22 1532 ----
NM_005229chrX3422 159 52 --1233 --
NM_005230chr121478 ------
NM_005233chr312196 2855 729 ----
NM_005235chr297624 7058 6485 5507 5094 2636 2525 1741 863 56908 6447 2463 2198 2028 --15633
NM_005238chr1183014 2963 2799 1210 1191 1104 249 121 --1743 --
NM_005239chr21--22041 496 ----
NM_005241chr311239 ------
NM_005249chr14----1649 --
NM_005254chr151871 11322 11122 --
NM_005256chr112636 30 ------
NM_005264chr102956 766 ------
NM_005271chr1021187 23 ----1446
NM_005276chr1231747 1181 1161 --1607 --
NM_005276chr1231747 1181 1161 --1607 --
NM_005277chr41666 1434 ----
NM_005279chr2148 ------
NM_005281chr14776 671 654 59 122 ----
NM_005311chr742009 1015 600 540 --1940 --
NM_005324chr1742126 2056 1746 1300 --1696 --
NM_005329chr1642243 2016 1721 1563 22070 887 ----
NM_005336chr282020 1998 1723 1495 1455 903 672 400 --2804 301 --
NM_005337chr122346 30 ------
NM_005339chr434313 3682 608 ------
NM_005342chrX42011 1927 1104 269 1140 192 --
NM_005347chr911653 1258 11668 --
NM_005359chr18106023 5958 5188 4829 4619 1680 1448 1166 831 299 1670 --25467 25
NM_005370chr1951247 832 527 83 67 ------
NM_005373chr111187 11424 1129 11670
NM_005374chr1792376 2156 2078 2041 1838 1791 840 661 435 --32143 2030 1480 --
NM_005375chr6--168 11183 --
NM_005380chr181293 1228 1144 1033 923 856 504 28 11319 ----
NM_005381chr2184 ------
NM_005382chr81163 ------
NM_005385chr362441 2177 2139 2081 1987 324 1901 12062 --
NM_005387chr112608 240 ------
NM_005389chr6--1689 --1108
NM_005392chr921682 150 2351 182 1286 --
NM_005397chr763790 2548 1201 1054 430 295 13395 ----
NM_005399chr174241 1210 1097 594 563 554 404 13457 ----
NM_005400chr272763 2455 517 504 450 292 195 12686 ----
NM_005406chr1821312 331 --1538 --
NM_005407chr1421382 208 11510 ----
NM_005415chr22745 498 ------
NM_005417chr2071826 1615 766 612 329 134 98 1601 --11799
NM_005418chr112639 569 --1140 --
NM_005426chr12382 338 ------
NM_005430chr125855 669 414 45 34 1169 ----
NM_005433chr1852568 2537 1905 1123 862 ------
NM_005435chr74547 148 108 85 ------
NM_005436chr1063832 3583 2811 2509 1518 419 ------
NM_005440chr1763285 2711 2490 2154 472 400 23192 2668 ----
NM_005442chr32431 103 ------
NM_005458chr95907 531 460 449 121 ------
NM_005461chr20128 11526 1535 --
NM_005465chr141638 359 154 138 --1131 --
NM_005474chr1721481 107 --21028 534 --
NM_005475chr12113046 3018 2757 2288 2147 1023 998 982 510 172 35 12033 ----
NM_005477chr1542519 1006 837 56 12290 1755 --
NM_005477chr1542519 1006 837 56 12290 1755 --
NM_005493chr61307 ------
NM_005497chr1734800 853 504 65835 4495 4164 3846 2119 1876 14888 --
NM_005501chr1711167 ------
NM_005502chr952973 2633 2180 2143 417 --13072 1219
NM_005504chr12106592 5694 4982 4348 4117 2279 1666 1642 1248 513 35807 353 270 11673 --
NM_005507chr114324 201 128 51 ------
NM_005509chr531457 393 137 ------
NM_005512chr1151604 1477 1287 756 737 --11435 1339
NM_005517chr11349 1390 ----
NM_005522chr72377 198 21438 477 ----
NM_005523chr72407 66 --1986 11557
NM_005542chr711562 11206 ----
NM_005544chr23970 175 121 2957 350 ----
NM_005550chr161421 2439 120 137 --
NM_005563chr1----1829 --
NM_005565chr5131 ------
NM_005573chr5169 2255 22 ----
NM_005578chr323863 1736 ------
NM_005581chr193397 123 89 ------
NM_005587chr151834 ------
NM_005596chr975567 5336 5025 4912 998 933 927 2276 94 26052 4477 1665
NM_005598chr161461 1405 1175 680 504 321 11512 189 --
NM_005602chr3--1971 ----
NM_005603chr1821250 63 11537 ----
NM_005604chr64747 736 71 60 1133 ----
NM_005607chr8155 --188 --
NM_005614chr73887 765 142 1683 ----
NM_005617chr5----142 --
NM_005618chr62206 156 ------
NM_005625chr8182 ------
NM_005626chr13377 180 154 ------
NM_005627chr62945 179 ------
NM_005634chrX1216 ------
NM_005637chr1821872 696 ------
NM_005639chr1231496 197 181 ------
NM_005647chrX83378 3031 2662 1334 1148 836 776 598 --1462 --
NM_005649chr51473 --1115 --
NM_005650chr221497 --1916 --
NM_005653chr123159 58 40 ------
NM_005663chr41367 ------
NM_005688chr33887 78 68 11065 ----
NM_005700chr112359 56 ------
NM_005704chr111130 ------
NM_005715chr622722 1965 --11792 --
NM_005717chr13479 116 105 ------
NM_005722chr222165 108 1824 11873 --
NM_005730chr1283245 3208 3137 2891 2788 1269 681 425 33465 2514 899 33216 2919 1127 --
NM_005734chr111281 ------
NM_005736chr1041560 1370 389 269 --31321 639 582 11111
NM_005737chr242697 2690 710 331 ------
NM_005738chr721790 97 --11534 --
NM_005746chr72223 125 12318 --11078
NM_005748chr1233441 3358 2227 --23410 3144 --
NM_005749chr171210 ------
NM_005754chr51803 ------
NM_005759chr263298 1886 1039 941 613 562 13054 ----
NM_005780chr13--2716 79 ----
NM_005786chr181157 ------
NM_005789chr1772167 1913 1578 791 597 442 146 --1576 --
NM_005795chr233012 2118 390 32143 2007 535 1125 --
NM_005801chr177793 758 504 326 320 198 151 ------
NM_005813chr241856 1850 1712 269 ------
NM_005822chr631768 450 277 1686 1942 --
NM_005826chr11220 ------
NM_005828chr17124277 4223 4160 3879 3527 1600 1455 635 586 558 205 171 31972 740 262 23511 855 11657
NM_005839chr12741 658 ------
NM_005840chrX117214 6528 6294 6190 5693 4697 2141 1294 847 535 477 55239 4842 4790 2324 1754 11193 --
NM_005843chr211889 195 2624 32 --
NM_005851chr114447 410 279 153 --172 --
NM_005852chr1741059 167 84 21 2860 720 ----
NM_005859chr521443 1352 ------
NM_005862chr311036 ------
NM_005870chr1321058 188 ------
NM_005876chr23698 621 566 1152 ----
NM_005881chr161304 ------
NM_005885chr531266 1247 88 --1429 --
NM_005898chr1163121 3077 2973 2127 956 253 ----1380
NM_005899chr1721546 81 1530 ----
NM_005900chr411151 ------
NM_005901chr1837286 3456 2449 38176 2229 1859 22304 760 17273
NM_005902chr15104611 4579 4436 4350 4265 4251 1423 835 604 454 21474 119 14340 --
NM_005904chr182600 150 ------
NM_005906chr611240 1305 ----
NM_005909chr553971 2704 1154 773 693 ------
NM_005910chr17143781 3719 3631 3516 3214 3044 2952 1504 1384 1357 1351 1204 285 88 13284 ----
NM_005911chr261073 1034 487 481 99 77 11185 --156
NM_005916chr7130 ------
NM_005920chr1143826 3282 3138 2839 2714 2511 2439 1502 1132 880 385 266 64 23 33518 3233 3059 1218 --
NM_005933chr1172708 2226 2006 1857 376 365 135 --11970 --
NM_005934chr19142391 2248 2155 2075 2055 2015 851 715 478 302 246 233 120 69 11053 21743 822 --
NM_005935chr484611 3389 2108 1813 1758 1724 1276 232 24074 150 11222 15002
NM_005937chr17134039 3746 3343 3121 2922 2871 2599 2572 1274 1078 1042 690 673 21321 616 23838 3099 --
NM_005938chrX71300 1286 1076 535 443 255 79 ------
NM_005944chr32800 204 ------
NM_005955chr1145201 4973 4783 4618 3950 3903 3896 3870 1699 1485 908 884 757 118 11382 14290 --
NM_005957chr1113623 3563 1653 1320 1126 1025 867 855 837 695 47 24389 646 13468 1325
NM_005962chr1012121 11499 22143 723 --
NM_005962chr1012121 11499 22143 723 --
NM_005964chr1761033 488 433 380 315 129 2632 498 ----
NM_005967chr126606 594 516 280 111 66 --1215 --
NM_005984chr223508 472 356 1111 1465 --
NM_005990chr5102420 2406 2151 918 468 363 332 126 55 48 42439 2014 1773 261 12479 --
NM_005996chr123377 347 100 21360 143 ----
NM_006007chr944226 3120 2796 208 13492 ----
NM_006011chr15154089 4079 3471 3363 3149 3098 3085 3032 3015 2884 2796 2637 1530 1358 1140 24053 3207 23411 2648 --
NM_006015chr13911 227 72 --1213 --
NM_006016chr61862 ------
NM_006030chr341705 1660 324 103 ------
NM_006032chr144178 56 37 29 1163 ----
NM_006035chr1451194 1184 1084 315 75 ------
NM_006037chr254926 3772 3081 1599 101 --34137 3237 1475 11307
NM_006038chr2061660 1364 648 466 401 350 ------
NM_006039chr1741045 449 394 111 ------
NM_006043chr163764 483 477 ----125
NM_006047chr2022373 400 --1464 --
NM_006048chr141230 883 507 336 ------
NM_006051chr52308 100 169 ----
NM_006054chr1151386 1374 1143 1115 162 11066 --2474 394
NM_006055chr232760 2712 2420 12523 22862 645 --
NM_006058chr52539 31 ------
NM_006070chr31366 ------
NM_006077chr102792 74 ------
NM_006079chr63293 231 73 ------
NM_006080chr722142 1919 --1464 --
NM_006091chr1561673 632 606 497 255 69 158 1416 --
NM_006094chr821910 1559 11940 ----
NM_006095chr454500 3842 3301 2847 1783 23978 3587 ----
NM_006099chr13810 317 119 --1899 --
NM_006106chr1153020 2596 1334 1177 916 12516 ----
NM_006108chr1141826 1579 784 494 --21773 198 --
NM_006113chr151509 1443 739 730 556 --12089 --
NM_006129chr82534 42 ------
NM_006134chr212625 66 1604 11324 11202
NM_006135chr121412 1045 ------
NM_006136chr721175 470 ------
NM_006145chr192978 259 ------
NM_006148chr17132874 2656 2603 2253 2127 959 936 892 645 557 343 321 155 ------
NM_006153chr31212 ------
NM_006154chr1542558 2500 2491 1954 --12278 --
NM_006156chr142175 61 ------
NM_006157chr111276 ------
NM_006158chr811656 1575 11620 --
NM_006160chr1751383 1036 401 207 133 --1515 --
NM_006162chr1831427 370 204 ------
NM_006166chr1222200 388 ------
NM_006167chr82479 42 --1533 --
NM_006176chr115720 635 232 191 149 ------
NM_006180chr951591 1399 143 99 41 11784 ----
NM_006183chr121447 2459 48 ----
NM_006185chr116227 179 168 86 78 60 --2528 416 --
NM_006186chr21456 ------
NM_006187chr1282433 1978 1068 1031 915 701 287 174 --32993 2351 55 --
NM_006191chr121620 ------
NM_006194chr14196 1301 ----
NM_006195chr91994 ------
NM_006201chrX31153 223 53 --1212 --
NM_006203chr534838 4542 4217 ------
NM_006206chr422708 949 ------
NM_006212chr175168 1880 1224 959 461 431 69 --1362 --
NM_006218chr3162 ------
NM_006224chr1792321 2233 2144 1802 1633 1571 938 711 160 ------
NM_006237chr1352153 767 704 136 83 ------
NM_006239chr43553 299 72 ------
NM_006241chr31906 ------
NM_006243chr11785 2741 718 1771 --
NM_006245chr66871 859 353 347 277 62 ------
NM_006251chr523188 2210 13176 1324 --
NM_006252chr146657 6246 6173 980 36181 2646 882 --26922 694
NM_006256chr13180 73 64 ------
NM_006265chr8----1593 --
NM_006267chr221538 609 ------
NM_006268chr1151103 396 322 252 96 11030 2944 191 --
NM_006270chr194176 99 51 35 --180 --
NM_006277chr22107 70 ------
NM_006281chr81393 ------
NM_006281chr81393 ------
NM_006283chr864797 3172 1893 759 512 260 34018 3862 1287 1796 --
NM_006288chr1151029 999 956 832 127 195 ----
NM_006289chr92346 64 ------
NM_006293chr151120 ------
NM_006298chr63689 648 411 ------
NM_006301chr121446 ------
NM_006306chrX104947 4455 4401 1961 1033 1019 972 910 273 99 14419 24709 523 --
NM_006311chr17189 ------
NM_006315chr474308 4231 4220 3566 3371 909 222 --135 13306
NM_006317chr52641 265 ------
NM_006320chr4--1393 132 --
NM_006321chr321632 379 --22058 1839 --
NM_006328chr112135 119 ------
NM_006329chr142151 33 1737 2659 276 --
NM_006330chr82587 154 1651 ----
NM_006333chr2--1662 ----
NM_006337chr122261 28 ------
NM_006347chr1127 ------
NM_006359chrX----11966 --
NM_006361chr1781747 1640 1631 1591 1310 442 418 151 21646 771 ----
NM_006367chr1234 28 --1140 --
NM_006369chr11308 1317 1384 --
NM_006371chr394584 3401 3348 1935 575 560 540 243 97 --12004 --
NM_006373chr1771342 1113 984 518 463 144 108 --1921 --
NM_006375chrX21655 441 ------
NM_006377chr961046 953 910 899 314 113 ------
NM_006378chr94992 344 288 139 11156 ----
NM_006379chr7--1310 1200 --
NM_006380chr1733559 2942 969 12910 ----
NM_006383chr154606 500 243 134 ------
NM_006386chr2232309 616 353 ------
NM_006389chr1141273 1127 1058 899 --198 --
NM_006390chr1241392 670 362 102 --11638 --
NM_006401chr91161 ------
NM_006407chr321397 54 ------
NM_006416chr6------1738
NM_006422chr12160 --149 --
NM_006434chr1032452 809 540 ------
NM_006439chr43532 137 45 ------
NM_006455chr174917 845 826 60 ------
NM_006457chr453942 3869 3761 3245 1100 --12535 --
NM_006465chr15152267 2186 2043 1707 1701 865 850 840 830 820 810 506 479 390 348 1554 3762 578 472 12053
NM_006469chr121444 404 1337 ----
NM_006471chr181217 --175 --
NM_006482chr1231045 856 394 1387 12801 --
NM_006489chr1421375 799 --11628 --
NM_006494chr192673 92 ------
NM_006497chr173645 569 523 ------
NM_006500chr1141074 1007 112 66 ------
NM_006516chr161515 1479 1027 1016 360 53 --11587 --
NM_006517chrX51984 1469 914 45 26 12328 1545 --
NM_006526chr2021942 1480 ------
NM_006527chr42276 239 ------
NM_006529chr4--11524 ----
NM_006532chr1941509 819 298 179 --1738 --
NM_006538chr283923 3633 3610 3548 3018 3005 731 316 23864 323 23080 1109 --
NM_006539chr163399 154 136 1208 ----
NM_006544chr1445243 902 434 214 --170 --
NM_006546chr17186196 5539 5360 5164 4741 4526 4360 4306 4211 4156 2133 1924 1374 335 276 217 173 63 --32352 2094 1020 14201
NM_006547chr742076 1725 1482 183 ------
NM_006548chr331515 1351 44 ------
NM_006557chr911495 --11472 --
NM_006559chr111133 ------
NM_006560chr111143 ------
NM_006561chr1085929 5225 5217 4976 4283 2440 2413 2007 --23837 28 24811 4488
NM_006565chr16----1928 --
NM_006566chr182875 378 11015 ----
NM_006587chr431509 183 53 11144 ----
NM_006589chr11426 ----1544
NM_006593chr23654 290 54 3757 213 122 ----
NM_006595chr1132042 1897 1890 --1159 --
NM_006599chr1668050 7417 6814 6324 5503 2562 ------
NM_006601chr1211125 --1356 --
NM_006602chr202201 63 1758 ----
NM_006603chrX21814 1372 ------
NM_006609chr252357 2160 1003 444 202 ------
NM_006614chr322848 2424 42748 2376 2259 1210 ----
NM_006618chr131246 428 413 11141 11036 --
NM_006621chr151813 673 597 483 211 31446 1421 1302 ----
NM_006625chr1--1153 ----
NM_006625chr1--1153 ----
NM_006625chr1--1153 ----
NM_006626chr932678 928 913 ------
NM_006628chr1554477 3196 1742 1154 748 14240 ----
NM_006629chr18--2586 522 --12015
NM_006633chr51689 1723 ----
NM_006640chr1751588 1300 1197 721 63 11832 ----
NM_006644chr131573 128 ----
NM_006646chr1362591 2539 2050 1139 959 630 --21225 1110 --
NM_006650chr5113864 3252 2880 2585 2495 707 403 258 170 153 147 1640 13132 --
NM_006651chr481445 1370 1285 1136 1066 519 496 150 ------
NM_006653chr62275 67 ------
NM_006654chr1254777 4275 3554 1280 1036 11178 1561 --
NM_006658chr7----187 --
NM_006662chr162302 122 ------
NM_006675chr12133369 3134 3109 2880 2669 2590 2385 1227 998 712 552 317 84 --1736 --
NM_006682chr7157 ------
NM_006688chr176433 364 163 105 80 33 ------
NM_006690chr2092287 2013 1832 928 784 563 485 221 48 --32027 1843 396 --
NM_006698chr201415 ------
NM_006704chr131391 1149 ----
NM_006717chr952358 1164 1067 1055 310 --11359 1689
NM_006720chr1094865 4791 4258 3951 3899 1898 1665 1445 1338 1723 1362 --
NM_006722chr31683 22039 779 ----
NM_006727chr51341 ------
NM_006729chrX85455 5372 4989 4337 4162 4064 3420 804 --13655 --
NM_006735chr7164 ------
NM_006744chr10187 --147 --
NM_006749chr851325 458 401 122 107 ------
NM_006750chr16167851 7155 7043 6643 6229 2818 2744 2334 1751 1743 1721 1479 1151 672 108 90 16675 37492 7209 506 --
NM_006754chr71278 ------
NM_006763chr141740 1561 624 423 21439 177 --11470
NM_006764chr32448 37 ------
NM_006766chr82628 374 --11803 --
NM_006769chr11149 --132 --
NM_006772chr691684 1403 1313 1241 694 345 281 222 185 ------
NM_006775chr641214 1170 431 175 ----1552
NM_006777chrX32419 2334 579 ------
NM_006783chr13----1733 --
NM_006788chr1881807 1456 737 713 463 426 151 82 ------
NM_006805chr551444 1276 116 102 88 ------
NM_006807chr172356 265 ------
NM_006809chr204785 643 355 297 1122 ----
NM_006814chr2041981 294 179 150 ------
NM_006816chr51219 ------
NM_006819chr111272 --133 --
NM_006823chr821144 331 ------
NM_006826chr231252 414 185 133 ----
NM_006827chr1462566 825 793 757 478 432 1461 ----
NM_006833chr71139 ------
NM_006841chr37774 612 511 485 274 181 139 ------
NM_006843chr122437 29 1327 ----
NM_006846chr5163 ----1230
NM_006852chr1762560 2529 2453 1997 931 726 ----11895
NM_006854chr731544 677 33 1423 ----
NM_006856chr1211102 --126 --
NM_006861chr125693 665 344 198 161 --11559 --
NM_006875chrX2873 211 ------
NM_006876chr112534 45 1613 --1549
NM_006885chr1631519 1228 971 43103 2830 1081 1054 11147 --
NM_006887chr2276 63 --1590 --
NM_006888chr1463373 3011 2540 2444 2252 547 22262 1199 ----
NM_006889chr31445 21454 353 ----
NM_006892chr203959 367 95 1889 ----
NM_006892chr203959 367 95 1889 ----
NM_006898chr21682 --1753 --
NM_006901chr151360 ------
NM_006906chr115771 397 373 126 107 --156 --
NM_006908chr741397 435 255 107 ------
NM_006914chr921098 581 ------
NM_006918chr1162190 2154 1740 1725 1626 975 14077 1346 14365
NM_006920chr21536 ------
NM_006922chr2--1484 1872 --
NM_006924chr1733782 2803 869 --13438 11647
NM_006925chr142471 213 ------
NM_006930chr511235 --11973 --
NM_006931chr123802 430 238 22060 53 11389 --
NM_006937chr17--1566 ----
NM_006939chr1441056 221 186 174 ----1898
NM_006943chr2093125 1075 1052 1004 394 380 284 141 74 13044 11337 --
NM_006946chr118485 424 404 397 387 380 176 76 ----1541
NM_006950chrX5904 875 803 611 127 1135 ----
NM_006965chr1831169 452 381 --1911 --
NM_006981chr922827 2808 12052 ----
NM_006987chr1751225 1035 906 493 430 --2221 87 --
NM_006990chr1112532 2493 1871 1789 1765 1717 722 569 358 333 51 1249 32433 1707 375 --
NM_006997chr101297 ------
NM_006999chr531593 246 229 --1438 --
NM_007008chr21366 ------
NM_007011chr15256694 5810 5803 5070 5033 4993 4876 4594 4411 4394 4238 2479 2061 2002 1961 1664 1564 1164 1110 821 649 252 86 56 34 24180 2175 11804 1766
NM_007013chr81419 21013 116 ----
NM_007024chr32126 58 --1235 --
NM_007026chr171518 1108 ----
NM_007030chr563472 3191 1444 1144 888 511 34615 1613 192 33206 905 246 --
NM_007038chr2135882 4741 147 35899 5797 2241 15203 --
NM_007040chr194892 399 383 250 ------
NM_007042chr331762 402 40 --1262 --
NM_007045chr62398 98 ------
NM_007050chr20137667 7284 7143 6640 6615 5153 3129 2821 2792 1739 569 483 378 12378 25232 5113 11917
NM_007052chrX--1110 ----
NM_007054chr513028 13610 ----
NM_007064chr311422 ------
NM_007067chr1751105 316 309 248 128 11573 11323 --
NM_007078chr1062495 1117 1080 711 495 122 ------
NM_007084chr1331177 422 85 31318 1241 605 ----
NM_007108chr16--1546 ----
NM_007111chr13--1571 ----
NM_007112chr12163 93 ------
NM_007115chr21178 ------
NM_007118chr51611 ------
NM_007122chr13585 235 81 ------
NM_007124chr621833 48 ----11739
NM_007126chr91374 ------
NM_007135chr9--1148 ----
NM_007144chr175948 840 826 401 65 11130 ----
NM_007145chr1921398 953 ------
NM_007146chr1711062 --12213 --
NM_007153chr1913036 2456 287 1117 2361 34
NM_007158chr121007 381 ------
NM_007159chr3130 ------
NM_007162chr68589 579 510 470 463 379 201 79 --1230 --
NM_007166chr11--1258 2454 313 --
NM_007170chr12187 40 ------
NM_007174chr1221553 27 ------
NM_007178chr12169 ------
NM_007181chr19----1139 --
NM_007182chr33651 497 109 1292 1208 --
NM_007185chr16780 418 313 288 232 72 ------
NM_007191chr12--1476 ----
NM_007197chr122733 308 --2722 282 --
NM_007202chr171776 ------
NM_007207chr1132 --1659 --
NM_007218chr8280 74 ------
NM_007221chr12430 316 ------
NM_007222chr831732 1410 643 --1339 1628
NM_007236chr1562092 660 596 372 87 58 11924 ----
NM_007241chr171120 --1147 --
NM_007245chr163759 748 139 --1189 --
NM_007249chr1389176 8530 7513 6686 2599 558 266 78 58018 6961 2363 595 412 23263 2401 --
NM_007271chr651634 1269 1154 395 64 ------
NM_007275chr34938 918 445 134 ------
NM_007278chr171103 182 ----
NM_007282chr31276 177 ----
NM_007286chr582022 2008 1487 819 452 347 226 170 --21383 177 12103
NM_007287chr372896 2824 2636 2452 2395 2027 26 2700 474 --13123
NM_007288chr372896 2824 2636 2452 2395 2027 26 2700 474 --13123
NM_007289chr372896 2824 2636 2452 2395 2027 26 2700 474 --13123
NM_007294chr172999 85 2442 172 ----
NM_007295chr172999 85 2442 172 ----
NM_007296chr172999 85 2442 172 ----
NM_007297chr172999 85 2442 172 ----
NM_007298chr172999 85 2442 172 ----
NM_007299chr172999 85 2442 172 ----
NM_007300chr172999 85 2442 172 ----
NM_007302chr172999 85 2442 172 ----
NM_007303chr172999 85 2442 172 ----
NM_007304chr172999 85 2442 172 ----
NM_007305chr172999 85 2442 172 ----
NM_007313chr9101954 1856 1491 753 604 565 458 319 224 188 ------
NM_007320chr191315 ------
NM_007324chr1--1314 ----
NM_007327chr941112 827 297 288 --11043 --
NM_007331chr451115 1038 929 888 771 --22541 303 --
NM_007349chr7183 ------
NM_007350chr1284458 3939 3657 3619 3555 3418 3397 1424 14088 13246 --
NM_007362chr311479 11092 11120 --
NM_007363chrX1729 134 ----
NM_007365chr182008 1467 585 487 175 151 72 56 1537 ----
NM_007372chr172896 147 --1112 --
NM_007373chr101384 ------
NM_007375chr142107 2038 1781 496 1909 22248 524 12543
NM_009588chr61207 ------
NM_012064chr1221152 459 11032 ----
NM_012074chr142815 133 ----1355
NM_012081chr542450 2327 2276 190 23670 291 ----
NM_012084chrX123 ----1435
NM_012095chr10--23438 2676 ----
NM_012096chr332694 674 442 1191 ----
NM_012097chr21250 22149 1503 ----
NM_012098chr95621 307 218 201 85 --11149 --
NM_012102chr162458 2352 2312 2193 1874 345 12299 12002 --
NM_012104chr1153467 2453 1389 1219 810 --11335 --
NM_012104chr1153467 2453 1389 1219 810 --11335 --
NM_012110chr4168 ------
NM_012115chr6163 ------
NM_012118chr41399 ------
NM_012120chr622523 2006 22882 824 ----
NM_012134chr141237 655 376 203 11813 21729 1561 --
NM_012137chr162869 2651 2379 1906 1095 626 1178 ----
NM_012141chr1353876 3802 2752 1366 290 11150 ----
NM_012154chr83588 151 81 ------
NM_012156chr2053406 3101 2494 757 674 2688 681 168 --
NM_012158chr1321528 1462 ------
NM_012164chr967040 6835 6020 1544 863 449 25286 4615 16028 --
NM_012166chr911023 2450 100 11343 --
NM_012175chr11--1923 ----
NM_012193chr1154803 3700 3694 1907 1623 --15203 14780
NM_012197chr971280 1117 635 334 243 55 28 ------
NM_012199chr1114112 4076 4010 3271 2920 1795 1540 940 780 630 223 14454 --13168
NM_012207chr10----1273 --
NM_012210chr95586 371 328 303 53 1968 ----
NM_012214chr256134 5472 2515 2316 2168 --26354 190 --
NM_012215chr1021666 401 ------
NM_012216chrX132 ------
NM_012224chr4--126 ----
NM_012232chr1732184 325 319 --1551 --
NM_012234chr342690 2606 1143 676 ------
NM_012238chr10--11710 ----
NM_012244chr1491568 1474 1287 577 505 363 342 305 192 21668 1276 ----
NM_012247chr103749 647 53 ------
NM_012249chr253326 2230 826 245 41 --2357 130 --
NM_012250chr11162 --143 --
NM_012257chr71774 ----195
NM_012259chr6140 ------
NM_012262chr174581 4306 4254 3855 1940 1535 1287 34884 3370 668 1395 --
NM_012264chr2271602 862 837 797 532 375 348 --1188 --
NM_012264chr2271602 862 837 797 532 375 348 --1188 --
NM_012278chrX147 1154 ----
NM_012281chr71221 11528 ----
NM_012282chrX3298 260 33 ------
NM_012288chr6145046 3949 3939 3875 3756 3725 2307 2261 2114 1971 1243 1117 479 231 14989 41906 963 490 249 --
NM_012290chr221682 155 ------
NM_012296chr11123492 3015 3003 2715 2486 1486 1472 859 843 423 283 51 --23445 385 1125
NM_012297chr422348 900 ------
NM_012300chr552077 1577 1551 250 186 ------
NM_012301chr71674 ------
NM_012306chr12163406 3304 3209 3167 2933 2811 2495 2300 2286 1310 895 829 655 433 149 26 ------
NM_012307chr18------11004
NM_012308chr1172286 2088 834 574 322 135 118 --32458 888 297 --
NM_012311chr101642 ------
NM_012316chr1135235 4182 4170 3768 3640 3556 2050 1990 1370 1355 748 409 62 1907 34547 4151 807 --
NM_012325chr2031262 1106 554 ------
NM_012327chr181625 ------
NM_012334chr523523 3078 13466 1169 --
NM_012337chr1131 --121 --
NM_012347chr672801 2686 2603 878 787 761 320 22817 2789 ----
NM_012382chr554209 3397 3345 2791 644 13774 ----
NM_012384chr2042127 1906 984 49 --42121 2041 1823 1509 --
NM_012399chr2221798 1628 --11410 --
NM_012402chr113857 515 99 ------
NM_012406chr1221200 307 11172 ----
NM_012407chr221137 ------
NM_012410chr16297 47 ------
NM_012412chr71623 ------
NM_012414chr1--1630 ----
NM_012417chr171408 ------
NM_012419chr61105 ------
NM_012421chr11174 ------
NM_012423chr193453 42 26 ------
NM_012425chr102424 27 176 ----
NM_012426chr161145 2328 178 ----
NM_012428chr151284 ------
NM_012432chr1144 ------
NM_012434chr641123 407 389 68 ------
NM_012446chr52141 45 ------
NM_012448chr1792550 2226 2143 2083 1880 943 684 539 246 11729 --12255
NM_012461chr145661 636 268 54 48 1207 178 --
NM_012463chr1221833 152 ------
NM_012465chr1022272 955 ------
NM_012470chr71167 --1122 --
NM_012475chr1132 145 ----
NM_012478chr177688 681 642 346 288 233 30 2838 302 ----
NM_012479chr752707 1848 1769 943 389 --1339 --
NM_012482chr11112 ------
NM_013227chr153670 663 81 ------
NM_013229chr1212380 ------
NM_013230chrY--1486 ----
NM_013233chr231148 967 98 2315 61 ----
NM_013243chr153958 439 233 ------
NM_013246chr112334 117 133 ----
NM_013252chr732502 870 475 --12659 --
NM_013261chr453658 3017 1368 1172 680 12924 13139 --
NM_013269chr1234085 3619 1743 23969 1158 ----
NM_013279chr1182161 1845 1599 731 725 498 227 184 31699 930 506 21732 1476 --
NM_013281chr2011298 1984 ----
NM_013293chr71634 1614 ----
NM_013341chr262658 1180 1173 1102 1075 271 ------
NM_013346chrX124 ------
NM_013353chr1287 64 ------
NM_013363chr3163 1388 ----
NM_013368chr192441 31 ------
NM_013372chr153949 481 341 23181 2282 ----
NM_013377chr121691 ------
NM_013390chr92540 251 --11517 --
NM_013396chr2121292 60 ------
NM_013403chr194805 560 178 146 ------
NM_013411chr1102482 2459 2132 2099 1988 1751 1073 996 697 656 22595 2083 ----
NM_013417chr92107 33 ------
NM_013433chr1971936 1751 1719 1320 532 180 139 --1383 --
NM_013437chr81455 11114 ----
NM_013438chr921438 535 ------
NM_013444chrX2390 174 ------
NM_013446chr731424 420 156 1102 11032 --
NM_013449chr1272365 2263 866 819 749 591 134 2662 197 ----
NM_013943chr142607 2500 641 291 23167 718 1301 12908
NM_013960chr84568 240 167 147 ------
NM_013999chr174554 506 267 110 ------
NM_014000chr1041749 1282 608 332 --11613 --
NM_014007chr9--1176 ----
NM_014011chr22966 479 ------
NM_014021chr132774 2327 1109 13353 ----
NM_014023chr1052127 1179 1134 1050 221 --12234 --
NM_014030chr1751119 477 351 310 292 --1111 --
NM_014034chr6--11133 11231 --
NM_014066chr82307 96 ------
NM_014071chr202182 120 ------
NM_014079chr361048 329 265 257 249 241 ------
NM_014109chr831055 475 449 ------
NM_014112chr864816 3336 1224 1107 771 532 2907 517 11167 --
NM_014117chr1632507 2324 980 153 ----
NM_014141chr774615 4605 4348 4247 3508 1823 584 25057 1868 1364 14628
NM_014153chr16----1182 --
NM_014154chr31507 ------
NM_014155chr1155852 5502 4867 2546 2286 26803 117 14774 --
NM_014166chr131813 ------
NM_014169chr142235 198 ------
NM_014175chr8169 ------
NM_014181chr211107 --12153 1144
NM_014182chr122730 500 ------
NM_014183chr204290 272 211 205 ------
NM_014190chr471481 590 556 480 462 223 88 11294 ----
NM_014191chr121835 ------
NM_014217chr111211 11859 ----
NM_014220chr31652 1805 ----
NM_014231chr12101893 1802 1793 1760 1597 1488 1471 97 58 51 41684 260 168 73 ----
NM_014232chr1791376 416 397 363 314 272 254 70 51 21458 657 --1451
NM_014232chr1791376 416 397 363 314 272 254 70 51 21458 657 --1451
NM_014233chr174523 359 218 208 ----1495
NM_014234chr61167 ------
NM_014243chr42764 270 21753 1543 ----
NM_014251chr72812 209 ------
NM_014253chrX3717 535 444 ------
NM_014263chr1031252 346 88 ------
NM_014267chr113813 326 111 ------
NM_014271chrX2835 178 ------
NM_014275chr51780 1794 1851 --
NM_014279chr91765 --136 --
NM_014286chr9142995 2972 2678 2549 2531 2202 1282 1227 460 316 261 151 129 99 --33459 719 453 --
NM_014289chrX51255 1120 1080 1067 497 21285 1218 11424 --
NM_014292chr2281640 1609 1564 1496 688 321 88 38 1624 1372 --
NM_014293chr22133699 3681 3306 2722 1087 1045 1029 1012 765 425 136 95 73 13641 23594 1069 --
NM_014294chr811381 ----1216
NM_014299chr1982078 1757 1510 471 282 263 189 123 --11580 --
NM_014309chr22115082 5063 4472 4368 4031 3990 3926 3290 1868 1372 1284 14120 2871 701 --
NM_014323chr22--1425 ----
NM_014331chr455859 5312 4846 804 506 37204 5391 332 --27227 879
NM_014333chr11----12079 --
NM_014345chr6--1183 ----
NM_014368chr961902 1342 350 287 209 51 ------
NM_014376chr5102138 2084 1976 1619 778 770 586 376 168 23 1266 ----
NM_014381chr1462584 2269 1206 468 421 138 12476 1930 --
NM_014393chr832060 1716 948 --1335 --
NM_014399chr71675 ------
NM_014408chr1174 ------
NM_014409chr13359 302 147 2856 63 3401 253 126 --
NM_014415chr3--11165 ----
NM_014417chr192595 380 ------
NM_014418chr1431865 1452 458 11310 41970 1738 1335 432 --
NM_014421chr431348 739 347 ------
NM_014423chr543755 1182 1007 174 ------
NM_014445chr31460 ------
NM_014452chr631002 891 309 1754 --21196 975
NM_014458chr111181 11107 ----
NM_014460chr22101659 1251 684 599 582 564 516 479 416 304 11760 ----
NM_014462chr81221 ------
NM_014470chr12----1711 --
NM_014472chr101644 --157 --
NM_014482chr2----1109 --
NM_014488chr11194 ------
NM_014491chr73890 152 49 ------
NM_014494chr1632057 1999 492 --12066 --
NM_014496chrX----1243 --
NM_014507chr223916 450 396 1375 11206 --
NM_014515chr1211074 ------
NM_014517chr351800 1405 1252 194 166 ------
NM_014521chr241743 1496 154 42 ------
NM_014554chr1242018 1777 1605 93 11612 ----
NM_014572chr1321168 216 --165 --
NM_014573chr1741833 1483 487 161 ------
NM_014575chr31429 ------
NM_014584chr1411501 1303 ----
NM_014588chr20293 47 ------
NM_014591chr1061202 1124 1072 1045 391 93 --1225 --
NM_014592chr53626 264 73 --128 --
NM_014603chr1791540 1366 1276 1247 528 310 192 89 51 ------
NM_014604chr172571 145 --1619 --
NM_014606chr461260 961 503 346 215 38 ------
NM_014607chr242040 1654 1394 832 11958 --1857
NM_014612chr9----11110 --
NM_014613chr562642 2631 2313 2165 1904 708 12790 ----
NM_014614chr2276 54 11205 1110 --
NM_014620chr124611 190 130 49 ------
NM_014630chr15163819 3769 3274 2910 2888 2504 2482 1250 1221 1210 1039 801 512 416 385 194 23206 559 1369 --
NM_014632chr11270 59 ------
NM_014634chr22103288 3093 2905 2740 2527 1445 637 625 56 23 --12551 --
NM_014636chr9114232 3133 3114 2738 883 869 778 668 471 258 201 21494 1405 13392 --
NM_014640chr21115 ------
NM_014653chr1231734 1504 92 1765 --1136
NM_014659chr153398 335 89 157 1229 --
NM_014661chr10123895 2619 2384 1250 1206 1097 821 625 500 426 205 74 21554 1257 ----
NM_014662chr223463 365 328 ----150
NM_014663chr11154 1974 ----
NM_014665chr8133555 3526 3517 3314 2755 2525 2494 2374 2308 2284 1096 659 587 12399 23489 87 --
NM_014667chr311674 ----1194
NM_014670chr21295 ------
NM_014676chr141409 1385 451 25 ------
NM_014677chr841113 1019 496 309 --1185 --
NM_014683chr1721483 419 ------
NM_014686chr1932105 810 100 --1240 --
NM_014690chr782118 2062 1168 1067 960 945 131 25 ------
NM_014693chr32515 52 1154 1756 --
NM_014701chr1533247 2198 1209 ----1588
NM_014702chr663109 3024 2476 1289 777 205 ------
NM_014705chr71643 ------
NM_014707chr722271 1780 ------
NM_014709chr22106 35 ------
NM_014715chr111699 1884 1858 --
NM_014717chr193329 55 38 1281 ----
NM_014721chr697493 6315 6236 5362 5342 5203 4510 1181 158 46454 5286 4678 540 26408 793 --
NM_014723chr2073142 2322 2311 2295 2077 880 470 1477 22669 1006 --
NM_014726chr1761387 1094 1038 861 100 37 ------
NM_014730chr1295028 4223 3836 3597 3239 291 234 209 203 1820 2688 169 --
NM_014730chr1295028 4223 3836 3597 3239 291 234 209 203 1820 2688 169 --
NM_014731chr2081609 1532 1235 1116 700 495 392 160 --31546 1326 1319 --
NM_014733chr511460 ------
NM_014735chrX41811 1735 1414 576 --11976 --
NM_014741chr1181991 1983 1819 1688 1366 490 484 86 --2673 259 --
NM_014742chr2061454 1388 533 485 400 35 ------
NM_014746chr264054 2873 2824 1698 79 50 23329 3050 34020 3825 2733 --
NM_014747chr1225287 5140 5022 4917 4888 4864 4540 4114 3990 3857 3735 3706 2103 2048 1521 1469 1254 932 900 777 548 62 25388 4122 15055 --
NM_014751chr811384 21492 1429 ----
NM_014752chr1141800 1521 449 21 ------
NM_014755chr243650 2873 1666 212 --1167 11222
NM_014756chr11----157 --
NM_014757chr531909 1564 172 ----22327 1667
NM_014759chr881543 1493 1036 650 344 166 131 125 --11555 --
NM_014761chr161146 ------
NM_014762chr152300 1670 976 673 56 21575 264 32044 1875 527 --
NM_014764chr12146 ------
NM_014766chr763798 1276 922 790 754 401 --43354 2912 1373 1305 --
NM_014767chr10163574 3447 3094 3068 2709 2651 2621 2368 2332 1334 1084 990 700 582 485 405 22537 1177 23190 3088 --
NM_014770chr1251167 1152 1024 871 155 ------
NM_014774chr182800 2756 863 729 265 92 84 67 22870 595 11226 --
NM_014779chr32343 304 ------
NM_014784chr13711 209 43 --3964 337 289 --
NM_014790chr5--134 ----
NM_014798chr1761797 1276 662 617 192 126 --41706 1627 1307 593 --
NM_014800chr75741 321 306 292 129 11159 ----
NM_014802chr121217 ----11088
NM_014806chr9266 35 1168 ----
NM_014807chr115713 656 611 100 33 ------
NM_014810chr153411 2640 2619 1382 1358 2874 453 ----
NM_014819chr521946 949 ------
NM_014820chr3--11580 ----
NM_014824chr11----1266 --
NM_014826chr164331 3948 1379 159 56 30 23122 2823 24220 3451 1751
NM_014827chr121471 1079 --11673 --
NM_014830chr1272928 2446 1204 1001 789 737 500 --1514 11316
NM_014836chr101213 ------
NM_014838chr22102594 2529 2471 2425 2262 2235 1937 171 127 116 ------
NM_014839chr111819 1492 ----
NM_014841chr611374 1976 ----
NM_014847chr1------1506
NM_014849chr1111264 1258 1092 991 967 521 472 342 300 241 195 1895 198 --
NM_014850chr3134785 4600 4393 4045 1864 1856 1687 1456 1443 1333 811 769 689 1709 ----
NM_014864chr184291 3652 3258 1494 1437 1161 1093 213 34103 4095 1636 ----
NM_014869chr381313 1019 983 914 368 234 217 51 ------
NM_014871chr12128 ------
NM_014872chr922070 1925 ------
NM_014873chr123376 853 13052 ----
NM_014876chr226526 472 120 81 44 38 --11477 --
NM_014877chr1785592 5586 5562 5429 2788 2557 1616 1167 --23090 2856 --
NM_014883chr482279 1927 1586 658 576 547 460 114 --1583 --
NM_014884chr19147 ------
NM_014887chr131852 ------
NM_014888chr711096 21503 1368 ----
NM_014891chr751111 536 470 282 103 ------
NM_014892chr61553 ------
NM_014893chrY22165 1735 ------
NM_014897chr1743154 1103 922 538 1342 ----
NM_014899chr522494 291 1252 --23030 774
NM_014901chr561619 609 578 416 325 276 ------
NM_014903chr121520 21521 709 ----
NM_014904chr1033736 3170 328 --13928 --
NM_014905chr231576 672 491 ------
NM_014906chr1774063 1448 811 491 307 268 30 1454 ----
NM_014912chr103614 562 537 22792 2608 ----
NM_014917chr11831 ------
NM_014918chr151532 ------
NM_014920chr631485 510 55 --13001 1823
NM_014921chr1982837 2491 2282 1246 1227 860 148 124 12911 ----
NM_014923chr132475 266 ------
NM_014926chr361036 767 236 181 173 107 ------
NM_014931chr19139 --197 --
NM_014932chr311469 ------
NM_014933chr42383 371 --187 --
NM_014934chr1383372 3231 2979 2879 2757 2427 1306 1108 13322 ----
NM_014935chr1123746 3397 3291 3009 2439 1514 1430 1424 1352 773 286 71 --11290 --
NM_014936chr61980 ------
NM_014945chr561849 1473 688 600 514 415 11416 ----
NM_014946chr2--11027 ----
NM_014947chr122957 529 --12485 --
NM_014948chr2022055 804 22234 1982 31597 1554 394 --
NM_014949chr12670 29 ------
NM_014952chr1592028 1796 1746 1505 1376 635 452 372 214 ----1396
NM_014956chr1151041 703 315 281 75 --2788 672 --
NM_014961chr41733 ------
NM_014969chr11122 ------
NM_014974chr1061669 1475 1414 1369 603 365 1711 1232 --
NM_014977chr142458 212 1176 ----
NM_014978chr1041394 695 342 120 11325 21315 644 --
NM_014989chr61336 ------
NM_014990chr14----1247 --
NM_014991chr452360 2144 2094 536 291 ------
NM_014992chr142108 44 ------
NM_014994chr15162284 2160 2149 2098 2082 1951 1529 887 790 767 672 556 472 322 133 68 --2731 448 --
NM_014997chr752914 2252 1124 1111 660 ------
NM_014999chr1211578 ----156
NM_015000chr1252320 2264 2124 716 661 ------
NM_015002chr1221704 193 --188 11432
NM_015008chr373448 3138 2765 2517 1012 802 675 22556 592 ----
NM_015009chr31190 ------
NM_015015chr1961838 742 657 261 86 27 --11750 --
NM_015020chr1633726 3312 954 ------
NM_015023chr191777 1274 1244 1232 1176 1153 648 606 362 ------
NM_015024chr81907 11133 --1984
NM_015025chr212545 --11809 --
NM_015026chr121863 --1639 --
NM_015027chr162611 529 21298 780 ----
NM_015033chr95855 798 347 167 33 --3529 318 240 1595
NM_015035chr20126535 5845 5116 4114 1936 1772 1710 1289 970 668 476 169 44850 4676 1382 554 ----
NM_015039chr173413 3343 2682 1633 944 449 436 24116 3703 ----
NM_015042chr15164263 3969 3705 3670 3664 3320 3100 2831 2806 1341 1083 846 453 349 242 199 --12684 --
NM_015044chr16103201 2989 2665 877 808 795 783 770 658 23 12740 ----
NM_015045chr1022003 1423 ------
NM_015050chr651236 1121 942 864 406 ------
NM_015051chr923120 1063 ------
NM_015052chr731217 187 168 21382 80 ----
NM_015057chr13----142 --
NM_015063chr1941141 878 496 184 2998 459 2969 510 --
NM_015064chr12113143 2893 2758 2676 2609 1431 1408 1035 713 701 361 --12528 13103
NM_015068chr753870 1105 705 570 237 2902 192 --135
NM_015070chr1341146 522 444 128 --11487 --
NM_015071chr574489 4324 1888 1078 566 472 327 15499 ----
NM_015074chr1134678 4596 4590 3717 3422 3225 3139 1986 1515 862 148 58 31 --122 --
NM_015075chrX112074 1994 1762 1725 1593 1444 822 540 351 138 91 ------
NM_015076chr663522 3207 2961 1383 771 282 24062 3924 --13069
NM_015077chr17154597 4381 4143 4001 3850 3531 3346 3051 1759 829 648 475 173 146 123 13473 53260 3016 1834 1118 555 --
NM_015079chr15122791 2632 2446 2401 2317 1194 882 783 354 232 191 127 13213 ----
NM_015082chr582608 2392 2143 655 487 462 361 314 --22154 343 --
NM_015090chr1166111 6019 5436 5178 5084 4740 4595 2465 1237 964 767 751 713 309 191 100 11061 55694 5419 2290 1551 1488 --
NM_015092chr1634434 4363 4132 ----13279
NM_015093chr621170 325 --11683 --
NM_015097chr32168 58 32215 701 32 ----
NM_015101chr182886 2615 2512 2279 1883 1859 883 869 ------
NM_015107chrX52022 1806 206 45 23 ------
NM_015113chr1772050 1980 1686 669 603 276 105 1337 1383 1254
NM_015115chr422866 2802 1869 22531 240 --
NM_015125chr195511 466 452 104 41 1159 ----
NM_015130chr41539 ------
NM_015132chr711572 --1768 1541
NM_015133chr1651429 1353 1120 539 222 1111 21192 449 1273
NM_015138chr1532585 501 235 12786 ----
NM_015141chr362227 1052 819 637 578 227 21827 1026 ----
NM_015143chr41248 ----1149
NM_015144chr1643738 2641 2515 311 --33658 1238 929 --
NM_015150chr33762 324 149 --1253 --
NM_015155chr1032965 2479 2390 22177 125 ----
NM_015156chr1453430 3155 1115 855 443 12996 --1726
NM_015157chr1181127 1107 1072 1007 1001 771 451 258 ------
NM_015161chr163500 310 112 --1123 --
NM_015172chr11427 ------
NM_015176chr1--195 ----
NM_015178chr892126 1939 1791 941 827 819 734 716 492 --2524 51 --
NM_015185chrX72659 2472 2312 2179 963 592 566 22634 1188 1640 --
NM_015199chr332767 2231 616 ------
NM_015200chr432295 713 176 11865 ----
NM_015205chr13144214 4125 4081 1971 1331 1305 1273 1260 1252 1165 1144 561 65 39 --33426 1565 1213 1286
NM_015206chr1573255 3091 2655 2608 2461 873 548 --13740 1724
NM_015209chr141957 1428 644 476 --11938 --
NM_015215chr132510 552 22 ----13142
NM_015219chr1782218 2193 2129 1634 1603 632 347 99 ------
NM_015225chr962987 2585 1939 965 726 297 ------
NM_015236chr451276 986 234 134 112 ------
NM_015242chr113495 65 48 ------
NM_015250chr9------11915
NM_015254chr872931 2494 1177 1109 924 725 216 --12502 --
NM_015264chr22114283 4155 4110 4006 3639 1904 1730 1506 1496 939 260 13921 21034 45 --
NM_015265chr2----2586 313 --
NM_015267chr1221655 596 167 ----
NM_015268chr31481 1494 ----
NM_015271chr441372 1012 957 573 ------
NM_015272chr162210 34 --11645 --
NM_015277chr18----21229 130 1286
NM_015278chr622957 370 1185 1992 12218
NM_015282chr252540 883 662 75 52 22561 937 12117 --
NM_015284chr1112093 2024 1882 1533 820 564 517 398 260 185 87 --31923 1613 760 --
NM_015288chr5103859 3395 3304 3279 2840 2474 2351 1165 1150 1099 33695 2723 104 ----
NM_015292chr125291 283 120 112 43 ----1522
NM_015296chr13146 ------
NM_015299chr14143919 3696 3427 3402 3294 3242 2893 2785 2719 1318 917 893 709 60 --13738 1195
NM_015305chr142463 416 --1395 --
NM_015310chr8107960 6586 6259 6222 3187 3109 3003 1946 1521 776 17780 ----
NM_015313chr11104115 3539 3470 3348 3328 1582 1261 579 233 219 33434 1443 748 ----
NM_015315chr573174 2778 2187 1334 1234 1181 570 1406 11318 --
NM_015316chr1431310 481 165 --11176 --
NM_015317chr232385 2374 1146 ------
NM_015319chr123312 152 113 --164 --
NM_015321chr19184759 4085 4078 3901 3861 3731 3690 3650 3599 3508 3391 3040 1779 1748 1409 435 281 79 21254 694 43760 3065 1854 427 --
NM_015326chr182690 2537 2479 2066 1130 334 193 164 ------
NM_015328chr782693 2614 2485 2460 2026 504 417 298 ------
NM_015335chr1231004 385 198 22451 2162 ----
NM_015336chr1222649 1749 ------
NM_015338chr2061844 1429 1374 238 150 122 ------
NM_015343chr17156 ------
NM_015344chr821764 588 ------
NM_015346chr1441628 1325 148 67 ----11698
NM_015347chr1211958 1555 11983 12110
NM_015349chr632875 551 348 --12160 --
NM_015355chr1711531 ------
NM_015361chr2143 ------
NM_015365chrX74113 3478 3261 3165 1485 465 318 23268 3156 ----
NM_015374chr2261445 1032 572 531 512 432 --11339 --
NM_015375chr194435 3834 3398 3368 3264 1590 1515 577 48 11692 --13775
NM_015385chr1032452 809 540 ------
NM_015387chr21301 1724 ----
NM_015388chr6128 ------
NM_015393chr453536 3500 2969 2396 635 ------
NM_015396chr321389 191 ------
NM_015399chr114180 139 98 30 ------
NM_015401chr127779 754 716 434 293 240 35 1342 ----
NM_015416chr124791 721 245 178 1669 1684 --
NM_015417chr201139 --2453 112 --
NM_015435chr81444 ------
NM_015436chr462833 2496 2167 768 473 424 32610 2539 2456 1866 --
NM_015443chr1751021 539 463 379 326 ------
NM_015444chr32255 200 ------
NM_015447chr92181 53 ------
NM_015455chr533891 3337 643 11534 23292 1514 --
NM_015457chr1121089 1001 176 ----
NM_015458chr874314 3725 1771 1516 885 635 68 13343 ----
NM_015460chr332086 570 459 ------
NM_015464chr71258 2961 382 ----
NM_015470chr271201 1001 420 255 162 75 55 21124 1097 ----
NM_015475chr23987 930 407 1750 ----
NM_015481chr1261119 1072 970 809 763 311 ------
NM_015488chr291547 1504 1471 1350 1268 685 520 440 403 11559 31339 1294 1235 --
NM_015503chr16128 ------
NM_015508chr321241 1121 ------
NM_015516chr1131049 445 295 ------
NM_015517chr111482 ------
NM_015526chr1961474 1438 553 400 254 228 4583 537 486 394 1521 1133
NM_015530chr2--1824 1604 --
NM_015531chr111126 ------
NM_015534chr12802 30 --1382 --
NM_015535chr263901 3147 1201 995 664 210 --13566 --
NM_015541chr311044 11150 ----
NM_015542chr102867 61 ------
NM_015548chr6125 1762 ----
NM_015553chr674631 3582 3392 1931 1492 313 175 1108 15000 --
NM_015554chr1542764 2648 1989 149 ------
NM_015557chr1102777 2756 2627 2457 1341 1170 1088 897 697 270 13297 33042 2853 510 --
NM_015564chr553602 2575 1365 984 392 1992 ----
NM_015568chr20113990 3874 3679 3663 3317 3187 3144 1510 1466 1293 601 --23000 142 --
NM_015569chr133874 2950 622 ------
NM_015570chr711829 1600 ----
NM_015571chr621787 357 ------
NM_015575chr263131 1106 853 626 521 147 12287 1983 --
NM_015576chr322726 213 12226 --11961
NM_015577chr531324 503 227 ------
NM_015578chr1921845 1775 ------
NM_015605chr103616 86 53 ------
NM_015608chr10------142
NM_015609chr142091 1886 1050 882 --12429 --
NM_015626chr1711156 ------
NM_015630chr211028 ------
NM_015638chr205666 469 240 155 98 ------
NM_015645chr113354 305 293 --130 --
NM_015649chr19129 1385 ----
NM_015652chr102631 456 ------
NM_015660chr71222 ------
NM_015686chrX82417 2387 2248 2094 2006 1989 822 489 --11842 --
NM_015691chrX12845 11111 12331 --
NM_015695chr641674 664 222 105 --1843 --
NM_015716chr173605 196 43 1720 1637 --
NM_015723chr71238 ------
NM_015726chr121300 635 ----11545
NM_015831chr74930 890 768 590 1110 ----
NM_015840chr172712 1797 1715 1686 1032 508 72 --22176 2082 --
NM_015841chr172712 1797 1715 1686 1032 508 72 --22176 2082 --
NM_015844chr183901 208 156 ------
NM_015845chr182679 212 ------
NM_015846chr183901 208 156 ------
NM_015847chr183901 208 156 ------
NM_015850chr851961 1822 392 133 49 1878 41909 420 377 151 --
NM_015855chr11--1310 1586 --
NM_015878chr822210 1674 1238 ----
NM_015879chr18108372 6251 5748 3431 2643 2494 1957 1184 941 301 28550 6058 67161 6459 3298 707 354 67 --
NM_015885chr11----1124 --
NM_015886chr875162 4943 4342 1360 1187 1057 671 15552 --1789
NM_015898chr19102511 2479 1683 1002 880 806 760 550 446 236 12271 12018 --
NM_015904chr22710 281 ------
NM_015906chr184513 4162 3647 3501 3272 886 747 436 14568 ----
NM_015911chr13575 550 101 1658 ----
NM_015912chr821737 532 1471 ----
NM_015913chr11226 1690 1138 --
NM_015957chr112354 292 ------
NM_015974chr133414 76 31 ----167
NM_015975chrX21707 276 21395 441 ----
NM_015980chr521328 1223 --11451 --
NM_015981chr582773 2375 2202 1193 607 587 247 210 12973 12142 --
NM_015990chr411071 ------
NM_016006chr31175 ------
NM_016016chr17182 --1315 --
NM_016019chr71771 1404 ----
NM_016021chr682994 2397 2257 1908 1892 665 311 108 1453 23010 1128 --
NM_016022chr13745 441 430 --1292 --
NM_016025chr1631393 1227 51 ------
NM_016026chr141254 177 ----
NM_016032chrX51103 998 929 891 317 11030 ----
NM_016041chr171389 ------
NM_016057chr1241281 993 892 316 1151 2396 89 --
NM_016061chr231152 1110 40 ------
NM_016072chr1242329 2195 1709 718 12430 ----
NM_016073chr15------1242
NM_016076chr152539 2322 877 204 108 11137 ----
NM_016083chr623341 2575 1240 ----
NM_016096chr82705 452 --11482 --
NM_016097chr182719 332 ------
NM_016120chrX--11224 ----
NM_016132chr1543245 2719 753 576 11275 ----
NM_016141chr3--169 ----
NM_016151chr165258 165 138 108 87 ------
NM_016152chr33994 162 40 ------
NM_016156chr1152248 1869 1771 1587 716 ------
NM_016162chr123669 223 212 ------
NM_016172chr92141 93 ------
NM_016201chr33510 502 62 21442 776 ----
NM_016206chr377711 7284 3373 3276 2454 1822 212 --21394 507 16852
NM_016211chr42383 371 --187 --
NM_016223chr11297 76 ------
NM_016250chr141776 --2511 37 --
NM_016252chr21638 ----1124
NM_016255chr633215 2911 562 --22700 2129 --
NM_016257chr1113079 3061 2682 2542 1201 996 574 464 197 138 125 12559 ----
NM_016258chr1--169 ----
NM_016260chr286536 5853 5614 5217 1972 1496 1479 1172 184 --15294
NM_016272chr2272823 1951 1863 774 525 367 195 ------
NM_016277chr621565 112 ------
NM_016281chr12--1946 1104 --
NM_016284chr162715 106 ------
NM_016287chr11191 1668 ----
NM_016289chr221634 421 12237 ----
NM_016308chr11288 ------
NM_016315chr231451 153 147 ----11312
NM_016316chr22572 26 ------
NM_016319chr124568 247 120 77 --167 --
NM_016322chr953135 2995 2571 251 24 --12592 --
NM_016329chr32122 55 ------
NM_016338chr52864 226 1192 ----
NM_016340chr521171 932 --11087 --
NM_016357chr122920 58 ------
NM_016374chr11248 2643 191 ----
NM_016374chr11248 2643 191 ----
NM_016376chr1774333 4206 3995 2903 1542 857 402 --34270 2951 742 --
NM_016396chr1512618 --32858 1146 1037 --
NM_016399chr121147 --2645 577 1729
NM_016418chr2273595 3234 1322 1169 1116 260 45 --13247 --
NM_016422chr1122772 2424 ----1918
NM_016441chr2--1189 11670 --
NM_016451chr11------1211
NM_016463chr52120 26 ------
NM_016467chr21993 1137 --11003
NM_016470chr201554 ------
NM_016476chr173420 263 48 --1298 --
NM_016480chr5184 ------
NM_016494chr2257 27 ------
NM_016506chr112443 127 ------
NM_016507chr1742342 846 776 680 --12067 --
NM_016513chr631485 510 55 --13001 1823
NM_016516chr22646 636 ------
NM_016522chr1111573 ------
NM_016530chr15142 1131 11435 --
NM_016531chr464186 2656 1592 1079 584 48 1340 13716 13951
NM_016542chrX1687 ------
NM_016559chr31537 ------
NM_016569chr123377 347 100 21360 143 ----
NM_016577chr3114384 4373 4303 3990 3583 3541 3322 3015 1492 969 434 --1766 --
NM_016578chr11----146 --
NM_016592chr2031326 1246 991 ------
NM_016596chr127779 754 716 434 293 240 35 1342 ----
NM_016598chr321250 225 ------
NM_016603chr531776 1642 219 1177 ----
NM_016604chr5195 ------
NM_016605chr5112577 2534 1946 1933 1805 948 936 898 843 396 44 --11734 --
NM_016607chrX1396 11603 ----
NM_016621chr11154649 4480 4342 4288 4253 4195 4102 4082 3495 3038 3027 1836 1558 1541 802 --24369 2826 --
NM_016626chr181429 ------
NM_016628chr101216 ------
NM_016641chr1621332 1325 ------
NM_016645chr151325 ------
NM_016652chr201427 11789 ----
NM_016654chr151871 11322 11122 --
NM_016655chr15------1117
NM_016823chr172966 286 ------
NM_016824chr104655 566 295 172 --1237 --
NM_016827chr32734 23 ------
NM_016830chr123164 155 122 146 ----
NM_016834chr17143781 3719 3631 3516 3214 3044 2952 1504 1384 1357 1351 1204 285 88 13284 ----
NM_016835chr17143781 3719 3631 3516 3214 3044 2952 1504 1384 1357 1351 1204 285 88 13284 ----
NM_016836chr2--1191 ----
NM_016839chr2--1191 ----
NM_016841chr17143781 3719 3631 3516 3214 3044 2952 1504 1384 1357 1351 1204 285 88 13284 ----
NM_016848chr91107 ------
NM_016929chr654547 3970 1114 977 188 11505 33365 3264 1498 --
NM_016936chr1681862 1792 1524 1488 1467 795 180 85 --11390 --
NM_016950chr4------1536
NM_016952chr11114090 4038 4004 3609 3318 2844 1171 822 315 216 164 ------
NM_016953chr285583 3795 3754 2324 1846 1399 694 222 ------
NM_017409chr12----2276 232 --
NM_017410chr121955 21069 898 --11029
NM_017412chr831405 1050 977 ----11347
NM_017413chrX81808 963 852 441 358 350 339 203 --22127 100 --
NM_017414chr222177 21 ------
NM_017415chr5104226 4080 3956 3615 3568 3153 3130 1164 634 125 24526 3106 ----
NM_017420chr1433205 2473 1512 13017 ----
NM_017423chr43793 769 491 11624 ----
NM_017447chr2133946 2700 33 23985 1623 13639 --
NM_017450chr175996 286 82 76 48 ------
NM_017455chr151284 ------
NM_017456chr1761298 1288 1237 236 228 95 ----1355
NM_017457chr191122 ------
NM_017459chr12278 31 --150 --
NM_017488chr231431 1307 141 1264 11460 --
NM_017491chr41143 --1341 1789
NM_017514chrX4752 377 162 48 1598 1722 --
NM_017519chr61450 ------
NM_017522chr121239 981 ------
NM_017530chr16123 ------
NM_017544chrX1230 1872 ----
NM_017546chr21876 ------
NM_017548chr311757 1549 1320 --
NM_017551chr1032202 834 473 --12671 --
NM_017553chr154945 914 395 275 127 ----
NM_017559chr172273 26 --156 --
NM_017575chr1771587 1391 1179 1043 1035 339 167 --31143 652 292 --
NM_017582chr11101 1644 11352 --
NM_017586chr992034 1720 1653 1513 742 641 507 412 130 --11487 --
NM_017590chr2282683 2384 832 635 601 406 247 227 --3675 666 107 --
NM_017593chr41368 ------
NM_017596chr1214546 4248 4216 4201 4152 3760 3684 3469 3296 3212 3145 2854 1853 1488 1349 1301 763 745 724 704 508 33578 1094 608 43950 3510 1042 254 --
NM_017602chrX5381 170 133 112 51 ------
NM_017610chr1541978 1665 33 26 ------
NM_017617chr941410 1178 454 43 ------
NM_017623chr262310 292 228 193 178 123 --1149 --
NM_017626chr1071356 1266 397 371 234 168 161 ------
NM_017628chr453615 3334 2115 1956 1233 21272 1010 14061 13809
NM_017629chr111761 ------
NM_017633chr61833 --194 --
NM_017637chr9129025 8869 8717 8314 8189 7402 6371 6033 3156 2596 2272 1324 58273 7513 6611 3474 1551 22869 33 --
NM_017640chr61268 ------
NM_017643chr1743122 2308 1235 493 ------
NM_017644chr3--1139 --1750
NM_017657chr21360 ------
NM_017658chr1443130 2992 2880 355 ------
NM_017666chrX31560 560 231 --3576 278 126 --
NM_017668chr164807 703 697 45 ----1734
NM_017670chr11----2768 646 2845 623
NM_017672chr153444 307 69 ------
NM_017697chr82471 26 ------
NM_017709chr183461 3297 3291 3016 2970 2881 1482 869 1189 2406 54 --
NM_017714chr201282 ------
NM_017719chr312503 12222 ----
NM_017728chr17112959 2454 2117 1987 1979 1947 1177 1141 944 206 57 --52584 782 762 639 188 --
NM_017737chr112178 1198 11633 --
NM_017739chr15583 522 516 492 59 ------
NM_017742chr1821372 240 ------
NM_017744chr162207 1966 1674 990 777 557 ------
NM_017754chr6144475 3972 3916 3819 3435 3276 3173 1179 1093 1021 956 950 354 274 44428 4087 3536 1472 13383 --
NM_017772chr661639 1378 1366 1324 1184 1134 21670 1514 134 --
NM_017778chr831290 1217 516 --11277 --
NM_017784chr3--1906 ----
NM_017787chr1052306 2037 968 953 244 22444 1803 22054 1117 21033 834
NM_017797chr195987 961 352 248 25 --1716 --
NM_017798chr2011066 ------
NM_017799chr1411699 172 11684 --
NM_017810chr16133 --1633 --
NM_017811chr992872 2781 2300 2037 1948 1134 966 142 84 1633 ----
NM_017813chr865728 5350 4221 1524 1340 1126 34731 4657 1276 ----
NM_017824chr1031839 579 32 12198 ----
NM_017826chr131559 129 ----
NM_017848chrX24121 2998 1713 11335 --
NM_017851chr1551084 1027 383 369 205 ----1974
NM_017860chr15365 264 232 171 53 1600 ----
NM_017866chr8----1780 --
NM_017870chr111202 ------
NM_017893chr1081307 1244 954 530 241 223 174 90 --1945 --
NM_017902chr10175114 4806 4718 4686 4553 4476 4369 4260 4181 4062 3554 2228 2137 1982 1545 1426 632 35645 4216 1351 21670 405 --
NM_017911chr223938 310 40 ----1150
NM_017919chr9105169 5149 4840 4419 3929 3921 2264 2213 1679 811 45445 4934 4498 3935 ----
NM_017921chr17122122 2102 1841 1824 1709 1624 1589 582 573 360 247 45 ------
NM_017925chr911510 11809 ----
NM_017935chr42241 85 ------
NM_017938chrX32217 1491 352 --1345 --
NM_017944chr1152077 918 886 873 630 --12678 --
NM_017954chr7--21608 1117 ----
NM_017955chr1451167 1106 856 845 257 11175 ----
NM_017969chr21145 ------
NM_017975chr152883 182 2396 102 11128 --
NM_017982chr11502 1990 1244 --
NM_017983chr171158 ------
NM_017987chr1042125 848 477 83 ----11684
NM_017988chr123815 594 244 ------
NM_018027chr1061109 853 846 834 165 100 1345 21319 213 --
NM_018032chr162106 43 ------
NM_018045chr1122929 2687 2643 2489 2372 2055 1970 1897 696 644 451 76 --22743 355 --
NM_018054chr164529 472 142 22 ------
NM_018061chr121715 103 197 ----
NM_018063chr101399 ------
NM_018064chr61308 ------
NM_018070chr11526 2229 124 ----
NM_018071chr144567 318 192 41 1606 2852 230 1617
NM_018084chr23296 185 53 33282 3007 2460 ----
NM_018085chr1107764 7042 6734 5937 2195 951 823 440 283 120 58000 6719 5571 2600 631 22460 62 1858
NM_018086chr211636 1514 ----
NM_018092chr161156 --1633 --
NM_018095chr112443 127 ------
NM_018107chr144886 865 413 291 2315 146 ----
NM_018110chr1641206 398 285 279 ----11242
NM_018111chr19----131 --
NM_018114chr31157 1206 ----
NM_018115chr43768 762 302 --1748 --
NM_018116chr12538 532 ------
NM_018128chr1721044 990 ------
NM_018131chr101738 ------
NM_018133chr32682 580 --1430 --
NM_018137chr151411 1276 964 523 125 1210 ----
NM_018155chr31722 43046 2936 2129 243 11256 --
NM_018157chr1232979 352 92 124 ----
NM_018159chrX11383 --1258 --
NM_018164chr121201 ------
NM_018168chr141451 156 ----
NM_018171chr121681 ------
NM_018172chr1181425 1283 1263 551 499 447 395 343 1604 11054 --
NM_018178chr151998 1801 663 635 429 1705 12058 --
NM_018181chr1841928 1484 691 139 11390 11881 --
NM_018182chr1782216 1969 1720 1683 594 322 173 165 3803 545 526 22017 1957 --
NM_018193chr152200 137 ------
NM_018196chrX41376 282 217 210 ------
NM_018198chr121121 965 --2932 372 --
NM_018200chr1521948 723 --1673 --
NM_018205chr1072276 2151 1981 1956 841 515 266 --12211 --
NM_018206chr163716 635 162 ------
NM_018208chr141128 1111 897 307 --1890 --
NM_018222chr1121178 108 1611 ----
NM_018223chr1241162 908 892 208 ------
NM_018227chr432514 768 696 --12353 --
NM_018234chr221927 845 ----12238
NM_018237chr10------1188
NM_018239chr1072276 2151 1981 1956 841 515 266 --12211 --
NM_018240chr12206 109 --1770 --
NM_018241chr4--2837 751 ----
NM_018243chr472927 1454 1223 1185 964 726 614 1117 --21581 648
NM_018244chr2081151 1054 964 492 427 231 224 211 ------
NM_018246chr872339 2157 1854 1776 560 280 112 ------
NM_018247chr621910 811 ------
NM_018254chr111900 ------
NM_018263chr222546 1618 22283 2117 ----
NM_018269chr21198 ------
NM_018286chr17--1852 ----
NM_018287chr10----1168 --
NM_018293chr312341 12429 ----
NM_018299chr823154 2819 1725 1300 --
NM_018307chr173926 759 693 ------
NM_018312chr1121612 488 --12094 --
NM_018313chr311973 11891 11069 --
NM_018314chr11--1120 ----
NM_018315chr4154 ------
NM_018319chr1431392 634 108 189 ----
NM_018322chr671226 1198 1185 1154 1116 929 48 ------
NM_018325chr911315 --1107 --
NM_018327chr20194 ------
NM_018351chr1254437 4131 4076 3798 122 13759 24198 4007 13644
NM_018357chr152366 349 ------
NM_018362chr1133780 3496 1409 ------
NM_018364chr143654 3066 794 549 23075 333 ----
NM_018365chr15--1253 ----
NM_018375chr1461713 1663 1370 580 239 81 21891 1312 --11355
NM_018381chr194814 616 323 257 --1802 --
NM_018383chr22819 208 1140 ----
NM_018388chrX11509 ------
NM_018398chr31246 ------
NM_018403chr343735 3509 2717 2593 22775 532 23894 976 --
NM_018409chr422923 1247 1727 1211 --
NM_018416chr1272516 2502 2300 1634 1036 989 555 22002 586 ----
NM_018419chr202377 85 ------
NM_018424chr951866 1791 1214 433 33 ------
NM_018425chr1041810 702 194 113 12057 12456 --
NM_018440chr8107917 7151 7110 5618 5274 2594 2203 2141 576 255 37289 5996 862 --23435 513
NM_018441chr2122 --140 --
NM_018442chr1--1271 ----
NM_018444chr8--12240 ----
NM_018448chr1221220 124 ------
NM_018457chr12292 46 126 ----
NM_018462chr32594 310 2617 342 174 --
NM_018469chr1751249 1061 935 427 129 ------
NM_018482chr841734 984 562 36 --2174 55 --
NM_018486chrX------1194
NM_018489chr13702 340 68 ------
NM_018534chr22444 104 ------
NM_018557chr211089 --1507 --
NM_018566chr164427 4184 3541 3441 2051 1909 --1920 --
NM_018569chr431281 635 199 ------
NM_018640chr1222237 827 ------
NM_018644chr1172093 1712 864 578 413 47 28 --12005 --
NM_018650chr112270 --1848 1121
NM_018652chr151804 --1341 --
NM_018660chr883011 2374 2018 1913 1159 866 621 527 --21946 77 --
NM_018664chr1172 ------
NM_018667chr1672357 2273 1869 676 529 396 34 11114 ----
NM_018686chr122326 39 ------
NM_018688chr86949 772 295 125 82 59 ------
NM_018691chr521171 1042 --1150 --
NM_018695chr51381 --1398 --
NM_018698chrX21774 169 11366 ----
NM_018699chr41278 ------
NM_018710chr831109 885 283 ------
NM_018713chr11974 1448 ----
NM_018715chr141497 891 597 430 21975 212 ----
NM_018717chr442600 1845 645 370 ------
NM_018718chr74722 654 545 162 --1783 --
NM_018841chr163467 1025 1016 1004 976 76 11522 11327 --
NM_018847chr931908 1316 56 ------
NM_018890chr741397 435 255 107 ------
NM_018898chr51103 ------
NM_018899chr51103 ------
NM_018900chr51103 ------
NM_018901chr51103 ------
NM_018902chr51103 ------
NM_018903chr51103 ------
NM_018904chr51103 ------
NM_018905chr51103 ------
NM_018906chr51103 ------
NM_018907chr51103 ------
NM_018908chr51103 ------
NM_018909chr51103 ------
NM_018910chr51103 ------
NM_018911chr51103 ------
NM_018945chr672664 2636 1177 1037 1013 258 28 11196 175 --
NM_018948chr121114 89 ------
NM_018952chr174225 143 113 85 ------
NM_018953chr124776 737 651 214 ------
NM_018964chr2151039 735 724 355 44 ------
NM_018970chr732539 844 640 ------
NM_018977chrX3885 363 250 ------
NM_018993chr2041412 410 110 57 --1466 --
NM_018994chr12455 394 ------
NM_018999chr1043023 1583 881 535 ------
NM_019000chr521322 1259 --11548 --
NM_019004chr71303 ----1456
NM_019005chr7158 129 ----
NM_019008chr22123581 3436 3351 3277 2975 2792 2666 2599 1092 648 403 214 --12574 --
NM_019027chr442032 1800 769 695 22305 378 21742 237 --
NM_019035chr432005 1400 733 ------
NM_019041chr662005 1712 982 363 199 76 22228 161 ----
NM_019050chr422232 54 ------
NM_019062chr1242 33 ------
NM_019063chr24906 550 478 32 3742 657 157 21983 888 --
NM_019071chr7--1278 ----
NM_019072chr5--2378 88 12684 --
NM_019074chr151788 2859 799 2283 112 --
NM_019087chr51131 11488 --11090
NM_019091chr2190 ------
NM_019096chr62876 846 ----1392
NM_019102chr7--1330 ----
NM_019102chr7--1330 ----
NM_019106chr22102685 2506 2321 2278 2250 811 766 683 622 230 22124 84 12328 --
NM_019114chr942052 1644 1012 40 ------
NM_019116chr16143484 3321 2870 2774 2724 2601 2548 2339 2304 1449 1369 1232 845 788 1565 1720 --
NM_019117chrX32739 2539 1399 22301 826 --13104
NM_019556chrX21286 441 ------
NM_019557chr12764 60 149 1829 --
NM_019558chr21114 ------
NM_019593chr2083046 2925 2834 2195 2124 2109 2019 918 13136 ----
NM_019594chr941562 1262 377 332 --149 --
NM_019595chr22107 70 ------
NM_019600chr151529 ------
NM_019605chr12296 52 ------
NM_019610chr111745 ------
NM_019613chr172970 297 --143 --
NM_019842chr6175 1344 ----
NM_019845chr23309 158 68 --1175 --
NM_019850chr22489 261 1672 1133 --
NM_019854chr125661 594 540 210 44 ------
NM_019857chrX1621 --11415 --
NM_019859chr1021351 1100 ------
NM_019884chr193496 470 154 ------
NM_019885chr292356 2176 1814 931 828 603 553 524 119 ------
NM_019895chr31397 2806 74 ----
NM_019903chr104655 566 295 172 --1237 --
NM_020039chr12121841 1718 1521 1297 1247 1241 703 552 487 365 160 75 1591 11476 --
NM_020062chr203991 409 255 ------
NM_020063chr13189 182 70 ------
NM_020066chr12870 386 ------
NM_020116chr4--1601 1526 --
NM_020122chr295517 5303 5182 3971 2290 1397 1000 255 29 55394 4973 4605 4510 4387 24540 2044 14533
NM_020123chr1021387 297 ------
NM_020131chr181298 1288 1136 629 345 157 107 88 138 ----
NM_020140chr12170 ------
NM_020141chr13334 296 271 1729 ----
NM_020144chr71138 ----1476
NM_020150chr1051447 681 144 96 64 ------
NM_020151chr231486 379 275 1428 1163 --
NM_020159chr4--2590 22 ----
NM_020163chr3102345 1996 1948 1899 1863 1692 1575 796 374 191 ------
NM_020168chr1551142 478 178 144 92 ------
NM_020177chr532698 1324 1278 --23236 118 --
NM_020178chr173903 181 132 ------
NM_020182chr2083434 3357 2840 2750 2606 1253 1059 115 12687 53177 2638 2575 2469 2305 --
NM_020188chr16--1274 ----
NM_020193chr1111024 ------
NM_020205chr133374 3228 733 13432 22501 562 --
NM_020210chr158887 855 807 755 724 274 151 118 ------
NM_020211chr1581480 1261 974 598 350 284 245 37 11023 ----
NM_020214chr15----153 --
NM_020228chr1131805 195 133 12203 1653 --
NM_020231chr3125 --1678 --
NM_020238chr113919 139 87 1350 ----
NM_020239chr182222 2019 1723 1445 827 694 447 272 1563 --1718
NM_020248chr141912 1718 1574 342 --21641 609 --
NM_020309chr195935 895 425 368 170 ------
NM_020310chr17112542 2332 2263 2249 2179 1949 1796 598 354 294 63 --22226 704 --
NM_020319chr73671 639 34 1306 177 --
NM_020337chr482837 2734 2437 1184 1094 975 526 171 ------
NM_020341chr201251 1619 ----
NM_020342chr2--22061 1779 21758 567 --
NM_020346chr1111361 1475 --1565
NM_020360chr173579 228 193 --1536 --
NM_020364chrY31378 1155 97 ------
NM_020374chr123787 630 612 --11374 --
NM_020382chr1251397 1299 1267 1062 994 ----162
NM_020384chrX111696 1686 1671 1648 1637 1611 1476 1225 717 316 229 31743 287 266 ----
NM_020403chr1311121 --11194 --
NM_020404chr11------1206
NM_020416chr44980 813 794 63 12160 1704 --
NM_020418chr32236 166 ------
NM_020420chrY31378 1155 97 ------
NM_020428chr193988 801 297 125 ----
NM_020432chr71525 12040 ----
NM_020438chr951103 887 476 426 234 2973 184 1276 --
NM_020440chr1122955 2876 2870 2126 2081 2072 1190 1072 710 265 135 106 ------
NM_020441chr112254 24 ------
NM_020443chr1216954 6916 6848 6615 6301 5569 5248 5031 4980 4472 4230 2730 2657 2615 2519 2120 1447 919 666 434 97 --1746 11636
NM_020447chr1532231 884 697 1520 1129 --
NM_020452chr151469 795 771 457 178 11918 191 --
NM_020455chr62718 113 ------
NM_020456chr1321999 1876 ------
NM_020474chr182799 180 ------
NM_020475chr842456 2167 1663 864 1528 21549 473 --
NM_020476chr842456 2167 1663 864 1528 21549 473 --
NM_020477chr842456 2167 1663 864 1528 21549 473 --
NM_020478chr842519 2230 1726 927 1591 21612 536 --
NM_020480chr842456 2167 1663 864 1528 21549 473 --
NM_020526chr1111770 1748 1698 1546 1272 1214 1196 686 637 115 109 --1729 --
NM_020532chr21366 ------
NM_020630chr104600 590 509 244 ------
NM_020638chr1261764 1642 557 265 198 37 ------
NM_020640chr31104 ------
NM_020647chr851860 1851 867 221 78 ------
NM_020651chr22300 270 ------
NM_020655chr1651250 1171 919 324 119 ------
NM_020665chrX--124 ----
NM_020673chr20177278 6826 6547 6534 6482 6459 6327 5557 2904 2781 2495 2404 2271 2097 1373 1274 1099 16488 1692 --
NM_020676chr32133 75 ------
NM_020686chr1692823 2347 981 941 678 621 589 460 435 ------
NM_020689chr2031166 510 153 --21657 119 --
NM_020690chr5171 ----1221
NM_020693chr111378 ------
NM_020699chr1125138 4966 4914 4628 3451 2148 1894 1870 1644 949 380 313 24128 1516 --14772
NM_020702chr931144 305 221 ------
NM_020703chr12596 203 ------
NM_020708chr20111895 1855 1002 768 755 741 605 384 238 204 120 2946 723 158 --
NM_020711chr241961 602 566 479 12640 11978 --
NM_020713chr20163084 2740 2577 2417 2386 2186 2172 985 833 815 565 345 259 165 84 47 1769 22502 1024 --
NM_020714chr1974187 3113 2966 2944 1803 1462 780 24308 4221 41738 1731 264 110 --
NM_020718chr16136635 6162 5682 5252 5166 4131 2132 2041 1979 1944 1053 1020 62 14881 ----
NM_020728chr742996 66 39 24 1821 ----
NM_020732chr61450 ------
NM_020734chr12--12560 1240 --
NM_020739chr1573936 3771 3745 3426 3164 1324 1147 13273 ----
NM_020742chrX32234 444 177 --11029 --
NM_020749chr821869 325 ------
NM_020750chr64458 308 293 76 1553 1967 1407
NM_020752chr1011978 --2982 498 --
NM_020760chr251926 1779 1337 172 53 11816 ----
NM_020765chr13125 115 47 ------
NM_020766chrX54230 3747 3533 3465 1268 ------
NM_020769chrX5765 725 333 147 111 --3886 782 104 --
NM_020771chr611403 ------
NM_020772chr1766729 6576 5584 5396 2532 927 13020 12866 13438
NM_020774chr1832334 1529 364 25121 3990 15701 --
NM_020778chr15214925 4591 4001 3751 3538 1666 1502 1440 1358 839 821 755 733 687 648 586 494 350 323 277 144 44393 4183 3290 995 43612 1302 1163 452 --
NM_020783chr182459 235 ------
NM_020791chr1721289 82 ------
NM_020792chr322326 2133 12245 1319 --
NM_020794chr11346 ------
NM_020795chr1781972 1828 1321 1315 1263 546 34 21 1369 31875 1613 644 --
NM_020796chr542306 228 215 135 --12269 --
NM_020800chr321129 975 ------
NM_020801chr5--12053 --1632
NM_020805chr1811278 11360 1586 1692
NM_020807chr1691574 1562 1376 1307 1155 686 544 293 79 ------
NM_020810chr141264 13239 ----
NM_020813chr1951886 908 814 768 112 11057 22173 1828 --
NM_020820chr20101403 1372 1228 983 437 354 288 170 135 77 1396 11261 --
NM_020824chr10----1103 --
NM_020826chr1173603 2956 1303 575 131 77 47 --13335 --
NM_020830chr252235 2174 875 388 62 ------
NM_020839chr321543 1427 --11223 --
NM_020844chr896973 6486 6129 5938 5477 5303 2933 2508 257 --17563 --
NM_020845chr1272284 2038 1945 1879 1801 369 171 --22374 1958 --
NM_020850chr16152925 2845 2751 2604 2465 2250 2221 2139 1042 977 256 244 203 65 32 ----13199
NM_020851chr1581766 1704 1691 1434 1420 1329 119 102 ------
NM_020854chr182622 91 11060 ----
NM_020856chr1941381 1238 387 62 ------
NM_020859chr451406 851 356 333 168 143 ----
NM_020861chr6129 ------
NM_020865chr3----1122 --
NM_020868chr2----1320 --
NM_020872chr31299 1609 ----
NM_020886chr1131111 1064 322 ----11125
NM_020888chr181861 1851 1458 1406 693 658 522 138 --1174 --
NM_020896chr113211 183 40 --1851 --
NM_020897chr121222 1190 --1165 --
NM_020899chr1792360 1693 1616 586 424 383 272 208 98 ------
NM_020918chr1062944 2398 1178 861 843 142 ------
NM_020920chr14160 ------
NM_020921chr1443332 2890 2697 154 1856 ----
NM_020924chr91183 ------
NM_020925chr121444 357 ------
NM_020935chr223782 3478 1989 --11140
NM_020948chr123584 510 13369 ----
NM_020956chr19154643 4626 4050 4030 3733 3399 3274 2988 2904 1585 1476 1009 982 903 37 --33217 1111 141 13174
NM_020958chr141380 --1319 --
NM_020962chr15101730 1622 1548 878 771 709 692 629 322 110 11643 ----
NM_020964chr18104572 4428 3328 3066 2921 1182 1058 787 642 409 11347 --14132
NM_020967chr2051106 1053 503 140 33 ------
NM_020975chr102770 72 ------
NM_020977chr441955 1940 1497 371 ------
NM_020980chr1541573 1280 687 239 11258 ----
NM_020987chr101924 ------
NM_020993chr12112489 2415 2319 1837 1029 984 800 730 535 491 432 ------
NM_021003chr142592 32 187 ----
NM_021013chr17--166 ----
NM_021020chr8103555 3024 2849 2526 2268 1124 1083 1074 861 54 --22736 2259 --
NM_021032chr331766 1723 30 --11670 --
NM_021033chr1323205 758 --2205 122 --
NM_021038chr322698 120 22612 863 13166 --
NM_021061chr833873 3004 380 21034 201 21046 63 --
NM_021072chr5137 ------
NM_021076chr224461 448 420 207 ------
NM_021079chr17103047 2801 2559 2498 2221 1067 1041 896 426 237 --22850 2484 --
NM_021083chrX43223 2902 948 887 32491 2327 1181 ----
NM_021090chr2283062 1372 1244 919 803 621 560 437 --24824 1607 1218
NM_021097chr232058 1973 466 --12180 --
NM_021101chr322273 570 21925 201 22136 633 --
NM_021109chrX150 ------
NM_021109chrX150 ------
NM_021117chr11102174 1954 1908 1779 1688 1629 1545 1537 601 396 --11433 --
NM_021120chrX93143 2810 2757 2575 2272 2195 1987 1259 561 13041 ----
NM_021131chr971444 1397 1245 1204 1018 303 51 ------
NM_021132chr1031259 324 24 ------
NM_021136chr14159 ------
NM_021140chrX2351 185 11114 ----
NM_021144chr91431 ------
NM_021145chr71866 1373 ----
NM_021148chr722520 1814 1781 ----
NM_021149chr162901 168 ------
NM_021151chr71159 11086 1794 --
NM_021156chr2031029 901 122 11144 ----
NM_021158chr204549 101 93 64 ------
NM_021165chr12698 620 --173 --
NM_021173chr112353 33 --127 --
NM_021174chr83661 285 64 ----1260
NM_021183chrX--32264 2117 1760 --1176
NM_021189chr181041 1025 906 802 784 747 435 222 --2426 216 --
NM_021198chr281462 1446 1312 1249 1085 947 938 592 ----1216
NM_021202chr2092296 2147 1992 543 445 314 306 197 191 32610 383 141 11245 --
NM_021215chr2042308 1501 356 161 ------
NM_021216chr1961149 1092 1083 474 287 198 --122 --
NM_021229chr122431 325 ------
NM_021237chr31300 --1133 --
NM_021238chr1231781 1469 660 ------
NM_021239chr142451 139 11451 ----
NM_021249chr1441583 1486 1364 37 143 ----
NM_021255chr1422853 1613 12842 13796 --
NM_021260chr1491336 963 396 285 182 138 107 76 26 21122 865 ----
NM_021569chr941112 827 297 288 --11043 --
NM_021619chr981056 1041 1000 815 371 328 204 76 11020 ----
NM_021622chr10----2837 40 --
NM_021627chr32951 143 ------
NM_021637chrX21374 220 ------
NM_021639chr11348 ------
NM_021643chr211691 1145 11627 --
NM_021644chr10----1273 --
NM_021647chr464136 3165 1285 293 109 102 11587 21714 508 --
NM_021648chr652481 2123 756 553 241 22247 2178 21702 197 --
NM_021705chr621508 101 ------
NM_021724chr171246 ------
NM_021728chr141349 ------
NM_021729chr111112 --2315 131 --
NM_021738chr101285 1783 ----
NM_021813chr655478 4892 1828 1684 189 35089 4053 3803 11463 14233
NM_021814chr62588 207 ------
NM_021905chr652042 1743 1724 1687 1475 11876 1282 --
NM_021907chr22273 261 ------
NM_021911chr593725 3521 2105 1941 1898 1857 1165 807 363 143 ----
NM_021913chr1951788 1372 494 240 29 11694 ----
NM_021914chr1442002 813 223 116 11679 ----
NM_021935chr3--1111 ----
NM_021940chr6--1287 ----
NM_021943chr641871 1861 1799 1776 ------
NM_021960chr132636 2616 1845 1657 ----
NM_021961chr11117425 6975 6443 4569 2926 2748 2688 1968 1365 1121 740 46153 2793 1552 669 --15646
NM_021962chr1772412 1887 1834 1706 623 467 220 --11605 --
NM_021964chr335569 4960 1776 11767 16454 --
NM_021965chr921099 67 ------
NM_021970chr4--1624 ----
NM_021973chr41586 ------
NM_021977chr652992 2520 1536 755 254 12394 ----
NM_021988chr2071244 640 590 423 385 377 25 ------
NM_021991chr175596 564 132 41 27 ------
NM_021998chrX2171 65 ------
NM_022003chr1151204 1134 1032 398 105 11278 ----
NM_022037chr2--1951 1211 --
NM_022042chr451166 823 759 267 168 --1729 --
NM_022044chr22------191
NM_022048chr15126249 6021 5243 5041 4393 4221 2352 1784 1690 1302 1077 338 22382 368 24676 23 --
NM_022054chr141841 ------
NM_022060chr1461320 1297 981 507 375 86 --1555 --
NM_022062chr1161892 1502 1447 1340 1260 665 --161 --
NM_022066chr175953 902 871 345 120 ------
NM_022073chr1431593 1094 126 ------
NM_022075chr13969 289 278 ------
NM_022095chr20144 ------
NM_022107chr62519 23 ----2174 69
NM_022117chrX4377 213 68 61 ------
NM_022123chr14----1197 --
NM_022124chr101202 1669 ----
NM_022129chr101111 ------
NM_022130chr53306 246 181 135 --1409
NM_022138chr641166 286 216 50 ------
NM_022140chr531996 1544 938 ------
NM_022157chr1--1159 ----
NM_022166chr16256126 5816 5611 5378 5037 4869 4751 4481 4361 4295 4119 2101 1912 1775 1769 1468 1410 1160 1026 696 687 645 573 450 101 45073 4255 819 253 ----
NM_022169chr1151456 1186 346 192 58 ------
NM_022170chr741263 1106 419 114 --11340 --
NM_022173chr2--1951 1211 --
NM_022307chr72641 249 ------
NM_022336chr252093 1969 843 690 24 11905 12341 --
NM_022343chr93945 837 442 --1933 11277
NM_022367chr15660 630 504 286 217 ------
NM_022368chrX170 ------
NM_022369chr154418 410 118 79 --1380 --
NM_022442chr2071244 640 590 423 385 377 25 ------
NM_022455chr5--184 ----
NM_022459chr1355622 4205 758 475 87 31917 1839 1683 ----
NM_022461chr33302 274 56 ------
NM_022462chr19133502 3471 3363 3305 2583 2518 1448 1260 1137 689 248 186 26 12694 1154 23699 2631
NM_022465chr12152886 2487 2480 2454 2140 1873 1155 1122 1108 1044 622 570 231 145 21 32046 998 813 31032 444 102 --
NM_022476chr161897 ------
NM_022477chr20--142 ----
NM_022479chr731408 978 174 ------
NM_022484chr711247 --1122 --
NM_022485chr32262 37 --149 --
NM_022494chr101365 1112 ----
NM_022553chr63384 185 117 --1138 --
NM_022572chr291547 1504 1471 1350 1268 685 520 440 403 11559 31339 1294 1235 --
NM_022574chr742057 1925 862 698 --12041 --
NM_022644chr173197 106 31 ------
NM_022652chr123913 774 41 ------
NM_022659chr81162 ------
NM_022719chr2273876 3618 1479 1349 530 514 80 --32867 2470 842 --
NM_022730chr25945 817 202 170 115 ------
NM_022733chr141091 342 231 221 1317 141 --
NM_022735chr141553 387 217 201 ------
NM_022737chr1991265 1203 952 919 842 480 137 88 63 --1280 --
NM_022745chr152474 1856 1088 68 22 --12070 143
NM_022754chr551859 1131 618 574 191 --1276 --
NM_022758chr663129 2854 2566 2490 1069 123 ------
NM_022760chr20140 ------
NM_022763chr392779 2701 2670 2532 2503 2162 2145 290 83 ----12788
NM_022768chr1--1347 ----
NM_022771chr121217 ------
NM_022778chr151422 1322 1038 524 465 --1259 --
NM_022781chr962660 2654 1245 708 94 39 12782 1384 --
NM_022782chr12------1100
NM_022802chr101556 1413 ----
NM_022817chr222129 424 --12170 --
NM_022821chr14343 178 133 74 ------
NM_022824chr53521 448 362 ------
NM_022825chrX3276 77 43 ------
NM_022831chr131817 1442 1317 21702 86 ----
NM_022836chr151433 1400 712 639 171 ------
NM_022840chr183580 521 43 158 1155 --
NM_022844chr162877 301 ------
NM_022845chr1622052 577 ------
NM_022893chr232686 73 24 ------
NM_022894chr241646 1572 534 186 --1118 --
NM_022897chr52817 745 --1382 --
NM_022898chr1453552 3445 3097 1851 1166 --13215 --
NM_022901chr921588 1317 --11499 --
NM_022913chr5146 ------
NM_022970chr1041051 966 305 245 ------
NM_023000chr14------11168
NM_023001chr14------11168
NM_023009chr12217 91 ------
NM_023018chr161300 1152 645 567 51 40 1361 11179 --
NM_023019chr2241 35 ------
NM_023033chr122492 139 ------
NM_023039chr5128 ------
NM_023067chr361109 872 410 384 202 190 ----1919
NM_023068chr2081563 1496 1376 599 362 299 242 21 1283 21129 1073 --
NM_023074chr1971223 1161 1042 948 511 405 245 ------
NM_023076chr1632524 2310 119 2859 235 ----
NM_023079chr1741406 672 509 494 ------
NM_023105chr851961 1822 392 133 49 1878 41909 420 377 151 --
NM_023106chr851961 1822 392 133 49 1878 41909 420 377 151 --
NM_023110chr851961 1822 392 133 49 1878 41909 420 377 151 --
NM_023111chr851961 1822 392 133 49 1878 41909 420 377 151 --
NM_023923chr173493 2888 1125 627 569 502 253 13442 ----
NM_023925chr12----176 --
NM_023929chr8--12121 ----
NM_023930chr113831 750 559 ------
NM_024007chr542801 1078 913 608 12608 11218 --
NM_024015chr1741070 987 801 120 ------
NM_024017chr172329 25 11480 2512 170 --
NM_024019chr42184 67 ------
NM_024038chr193279 228 83 ------
NM_024040chr10129 ------
NM_024046chr381232 1203 1197 1152 973 912 425 320 --1100 --
NM_024054chr71140 ------
NM_024061chr72392 116 171 ----
NM_024072chr1271636 1503 1387 1162 1144 1072 1035 11340 ----
NM_024076chr1951819 1725 946 892 416 ----12435
NM_024085chr22950 697 21046 402 1748 --
NM_024094chr81124 ------
NM_024103chr1971688 1279 724 536 274 227 31 --11704 1339
NM_024107chr176740 620 565 546 248 234 --2710 526 --
NM_024117chr931072 139 91 1283 ----
NM_024122chrX2237 203 ------
NM_024294chr663129 2854 2566 2490 1069 123 ------
NM_024295chr82452 362 131 ----
NM_024297chr17----168 --
NM_024306chr166965 882 806 449 219 170 --2332 29 --
NM_024312chr1221235 1073 ------
NM_024320chr173927 271 197 1684 ----
NM_024323chr191104 ------
NM_024345chr9126099 5848 5640 4910 4753 4469 4245 3827 1301 1058 491 305 24680 2155 ----
NM_024408chr123529 2261 1777 ----
NM_024411chr2051277 1249 1088 610 430 1325 ----
NM_024424chr11183 ----11261
NM_024425chr11183 ----11261
NM_024426chr11183 ----11261
NM_024430chr1831797 1293 1188 ------
NM_024491chr35582 476 462 420 223 --1106 --
NM_024496chr14192 --1326 --
NM_024507chr162252 44 --1335 --
NM_024512chr3----21053 974 --
NM_024524chr322469 681 22499 697 ----
NM_024525chr1192 ------
NM_024529chr12329 193 ------
NM_024539chrX1221 ------
NM_024541chr1051685 1335 1222 408 275 --21557 36 --
NM_024546chr13175 ------
NM_024548chr321312 377 21351 1212 ----
NM_024551chr1252324 2294 2133 1726 670 --11649 --
NM_024551chr1252324 2294 2133 1726 670 --11649 --
NM_024554chr141592 1073 271 204 21362 210 21435 177 --
NM_024557chr112427 57 ------
NM_024567chr83695 659 180 --1159 --
NM_024595chr1----1281 --
NM_024599chr17379 65 26 --1497 --
NM_024602chr13876 728 689 ------
NM_024607chr873115 3066 1334 819 435 404 338 23935 3493 23348 3008 --
NM_024612chr1731034 407 264 ------
NM_024615chr5137 ------
NM_024617chr91837 ------
NM_024624chr211487 --1640 --
NM_024626chr141580 1314 1231 1137 ------
NM_024627chr22124483 4446 4317 3736 3669 3231 854 680 309 225 207 33 ------
NM_024630chr62811 301 ------
NM_024631chr112508 76 ------
NM_024639chr62330 183 --1379 12929
NM_024641chr632641 2280 165 32105 554 418 ----
NM_024643chr14----2463 131 --
NM_024646chr153279 2639 1503 683 308 23681 947 13966 --
NM_024657chrX3114 108 65 ------
NM_024659chr21250 ------
NM_024665chr321133 400 13376 ----
NM_024674chr163062 2813 1031 953 466 427 --1766 --
NM_024680chr11--2518 385 ----
NM_024689chrX31296 132 62 --11137 --
NM_024692chr241356 694 587 523 ------
NM_024698chr1181225 1145 988 872 542 451 443 104 1242 ----
NM_024700chr11101 ------
NM_024704chr20139 1385 ----
NM_024713chr1511470 11329 ----
NM_024721chr81555 22387 287 ----
NM_024742chr167772 727 694 566 392 206 133 ------
NM_024761chr974430 4366 4016 1496 1288 1030 483 23971 3373 ----
NM_024770chr2116398 5673 5641 5628 4799 4663 4333 4162 2160 1365 1197 45738 5447 5195 1908 11209 --
NM_024779chr1241489 1148 348 170 ------
NM_024785chr21619 ----1352
NM_024787chr86870 656 612 331 201 150 ------
NM_024798chr1562695 2494 2225 2201 2012 79 11071 ----
NM_024811chr1161508 673 603 536 179 53 11890 21539 450 --
NM_024824chr142602 559 --1692 --
NM_024825chr191294 ------
NM_024828chr921612 110 ------
NM_024830chr531585 1533 90 11362 ----
NM_024834chr1041999 1884 1756 1249 ------
NM_024835chr172153 56 ------
NM_024837chr1531822 1199 350 --1686 --
NM_024874chr171262 932 474 438 234 158 54 1172 ----
NM_024887chr13534 393 35 1327 ----
NM_024900chr431451 274 74 ------
NM_024900chr431451 274 74 ------
NM_024909chr631583 1021 286 ------
NM_024911chr12713 159 ------
NM_024915chr852835 2602 1825 396 216 22484 345 22882 36 --
NM_024930chr522234 624 1970 ----
NM_024939chr161506 31411 384 81 1116 1284
NM_024953chr1242175 376 203 107 --11926 --
NM_024969chr22889 757 ------
NM_024989chr277283 6180 2992 1552 1473 1418 1348 36954 6843 1316 28126 1596 17686
NM_024991chr1032452 809 540 ------
NM_024993chr211350 ----11616
NM_025027chr191244 --2315 197 --
NM_025054chr8--14248 14032 --
NM_025073chr134511 3621 3152 ----13723
NM_025074chr462840 2760 2439 735 642 575 13036 --12736
NM_025134chr1622390 1607 ------
NM_025140chr122558 143 ------
NM_025146chr322640 2583 --1478 --
NM_025151chr841589 1362 690 117 ----11561
NM_025154chr7168 3480 293 114 1244 11231
NM_025160chr133965 3592 1330 2760 595 --11182
NM_025164chr1131782 130 90 --1455 --
NM_025179chr1124651 4441 4435 4385 4138 3735 3504 3219 1753 1379 1321 215 --24558 4537 13280
NM_025181chr2--1788 ----
NM_025182chr94834 712 430 92 1887 1112 --
NM_025184chrX2617 42 ------
NM_025187chr162892 522 1418 11366 1278
NM_025191chr133113 797 375 23045 229 22791 472 --
NM_025195chr851819 1752 644 230 71 1220 ----
NM_025204chr224787 373 316 135 ------
NM_025208chr1122435 468 --11676 --
NM_025221chr42909 538 157 ----
NM_025222chr351155 1092 926 798 127 --1437 1299
NM_025224chr2051855 1755 1656 682 449 11680 22035 1864 --
NM_025230chr1481208 745 679 624 608 589 479 46 1701 ----
NM_025235chr1032247 1700 1540 21852 1433 --1321
NM_025237chr1731121 179 69 ------
NM_025238chr151255 ------
NM_025248chr17103203 2887 2769 2127 771 382 376 141 70 40 ------
NM_025251chr86811 482 411 289 254 68 --11136 --
NM_025261chr6_qbl_hap22170 143 ------
NM_025264chr2134 ------
NM_030576chr1762568 1910 1753 979 362 344 1416 12312 --
NM_030582chr2111107 1144 ----
NM_030594chr1531019 988 276 ------
NM_030621chr1472786 1108 1099 984 931 680 237 --13267 --
NM_030625chr1042668 2196 1628 799 12281 ----
NM_030627chr51983 31613 662 73 ----
NM_030629chr1651862 1402 1213 635 444 --31568 1345 491 --
NM_030634chr152334 2312 1805 857 161 ----173
NM_030647chr795540 5159 4914 4701 4554 4542 4086 1016 811 12373 ----
NM_030648chr4104778 4541 4257 3907 1684 1660 1484 1343 563 114 --25457 4576 --
NM_030653chr12135 1634 --1706
NM_030660chr1431462 1354 330 1510 --1960
NM_030661chr741549 469 158 99 ------
NM_030664chr101145 --11829 --
NM_030665chr17----11132 --
NM_030674chr1295244 4490 4289 3888 3613 2165 1745 1193 69 25132 4588 23798 1739 24352 891
NM_030751chr1021734 520 ------
NM_030751chr1021734 520 ------
NM_030753chr17----194 --
NM_030763chrX2897 43 ------
NM_030766chr1221020 216 1967 ----
NM_030767chr9142729 2654 2636 2542 2438 2384 2102 1877 1011 639 592 383 225 107 --22718 2053 1966
NM_030780chr821763 177 ------
NM_030799chr5196 21978 1832 ----
NM_030802chr175252 196 150 108 94 --1330 --
NM_030805chr241274 1165 1095 358 ------
NM_030806chr1229216 8570 8425 8247 7988 7432 7419 7165 7156 7057 7034 6481 6403 5703 3271 2856 2506 1882 838 728 423 327 59244 8511 6631 5812 1035 23107 2943 --
NM_030808chr1771040 897 741 731 417 69 33 11093 ----
NM_030809chr1282367 2213 2119 1794 773 549 365 48 21846 555 ----
NM_030816chr142730 2447 1410 418 ------
NM_030881chr2232309 616 353 ------
NM_030884chr392108 1701 1603 1579 679 531 482 344 290 12143 1849 --
NM_030885chr322167 79 ------
NM_030912chr106772 612 323 284 110 82 ------
NM_030913chr17525 298 218 182 110 91 45 --3667 507 494 --
NM_030914chr94613 311 103 29 ------
NM_030915chr2132127 1933 1873 1865 1548 1519 1474 954 943 892 834 228 208 1881 ----
NM_030918chr1205077 4788 4547 4396 4296 4272 4263 4057 3977 3898 3778 3746 3440 1658 1403 1338 1331 845 739 141 11728 24514 225 --
NM_030920chr11694 22062 822 ----
NM_030937chr1101452 1314 1003 921 480 349 304 84 63 35 --1105 --
NM_030938chr171267 1196 ----
NM_030958chr8172 1117 ----
NM_030964chr573567 3356 3090 2996 2578 2479 343 11417 1413 11393
NM_030981chr1141076 1039 977 790 --21228 878 --
NM_031216chr1831784 1750 1744 1792 ----
NM_031243chr7----12005 --
NM_031268chr16174899 4257 3951 3671 3664 3358 2019 2007 1950 1917 1858 1411 1154 1115 729 230 25 --31449 562 261 --
NM_031309chr8111560 855 746 691 633 624 590 519 407 336 105 1174 22375 35 --
NM_031314chr1441984 1909 740 446 21294 632 ----
NM_031371chr11248 2643 191 ----
NM_031371chr11248 2643 191 ----
NM_031372chr411365 ------
NM_031411chr51103 ------
NM_031417chr1981862 1823 885 720 512 240 230 21 11955 52257 2217 966 321 296 12428
NM_031419chr3------1264
NM_031433chr113425 38 23 --1144 --
NM_031439chr821411 38 2384 232 31439 1426 31 --
NM_031442chrX42927 547 491 473 --1411 --
NM_031443chr75355 310 146 90 54 ------
NM_031444chr2261873 830 692 667 658 295 --22118 30 --
NM_031445chr252687 2403 674 663 609 22130 223 23339 2605 --
NM_031453chr1032245 813 58 12253 ----
NM_031461chr822297 1822 --21776 361 --
NM_031475chr15525 308 163 103 46 1617 1778 --
NM_031477chr164354 326 277 94 ------
NM_031478chr163615 569 92 1676 1640 --
NM_031844chr142655 1554 843 45 --22797 441 11362
NM_031845chr21819 23317 2601 12594 --
NM_031847chr21819 23317 2601 12594 --
NM_031849chr51103 ------
NM_031857chr51103 ------
NM_031858chr1721546 81 1530 ----
NM_031860chr51103 ------
NM_031862chr1721546 81 1530 ----
NM_031866chr1051047 1000 747 320 98 1393 ----
NM_031890chr2272674 2247 2140 2080 2009 1221 520 1689 12017 --
NM_031891chr181135 ------
NM_031892chrX2776 646 ------
NM_031911chr442515 2327 1727 501 1836 ----
NM_031935chr12211 138 --1687 --
NM_031953chr41344 ------
NM_031954chr1262772 2249 1025 994 31 25 1383 ----
NM_031990chr1971150 544 525 498 350 253 231 11025 1970 11000
NM_031991chr1971150 544 525 498 350 253 231 11025 1970 11000
NM_031992chr741263 1106 419 114 --11340 --
NM_032012chr975012 4976 4373 4328 3538 79 72 13601 ----
NM_032013chr20--142 ----
NM_032017chr1111923 1815 1763 1753 1680 1378 674 525 502 447 340 --11992 --
NM_032040chr19131 ------
NM_032041chr821879 132 --22134 148 --
NM_032042chr541147 992 89 57 12529 --1419
NM_032050chr22--1425 ----
NM_032051chr225668 647 475 468 223 ------
NM_032052chr226935 910 270 250 217 28 ------
NM_032102chr1111222 --1414 --
NM_032108chr193952 945 174 ------
NM_032109chr5101198 1189 1158 1100 409 355 343 133 112 62 --1266 --
NM_032124chr18163 --