TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1228-3p
miRNA Sequence: UCACACCUGCCUCGCCCCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_005955chr165077 4913 4794 997 410 329 ----23703 2121
NM_025090chr1713355 295 288 268 239 210 184 167 158 99 89 62 43 ------
NM_182493chr1624094 1120 11780 --45223 5048 1975 423