TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1228-5p
miRNA Sequence: GUGGGCGGGGGCAGGUGUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr141864 11072 ----
NM_000029chr1142 ------
NM_000034chr16372 44 23 ------
NM_000037chr862173 1837 1711 1699 1665 1609 --1544 --
NM_000053chr1331477 140 114 ------
NM_000068chr192568 303 --1278 --
NM_000080chr172600 245 ------
NM_000084chrX36710 4261 352 --16168 --
NM_000088chr174512 506 354 325 --2517 453 --
NM_000089chr71199 1653 ----
NM_000093chr932443 737 247 1313 ----
NM_000135chr163380 354 235 ------
NM_000141chr1011218 ------
NM_000168chr743251 2680 674 280 12920 ----
NM_000176chr5--22553 321 ----
NM_000178chr201254 ------
NM_000210chr22591 562 --1483 --
NM_000214chr20----1279 --
NM_000216chrX2341 281 ------
NM_000217chr1211330 13673 ----
NM_000228chr12282 41 ------
NM_000238chr72258 60 ------
NM_000244chr116611 582 497 190 78 45 --1319 --
NM_000248chr312342 ------
NM_000259chr1534869 4233 2398 ------
NM_000262chr2251424 699 393 292 68 ----11199
NM_000278chr10152073 1993 1835 1785 1734 1617 1601 1429 582 442 259 249 242 230 120 ------
NM_000332chr626485 935 ------
NM_000335chr321913 1520 --1502 --
NM_000367chr621621 527 22198 410 12136 --
NM_000368chr994697 4193 4109 4076 3737 3288 1489 1240 208 11921 13689 --
NM_000378chr111186 ------
NM_000399chr101142 ------
NM_000425chrX2583 191 --2722 597 --
NM_000430chr1753036 2932 2894 1360 945 12780 ----
NM_000434chr61206 ------
NM_000435chr192722 48 ------
NM_000442chr1721221 104 ------
NM_000445chr851001 758 321 207 23 ------
NM_000461chr364028 3133 1715 1343 580 298 ----11302
NM_000476chr941411 94 48 38 ------
NM_000495chrX1294 ------
NM_000503chr81108 ------
NM_000523chr21315 ----1173
NM_000530chr13716 416 285 ------
NM_000533chrX--1536 ----
NM_000536chr111524 ------
NM_000555chrX56796 6054 5493 5213 329 --15164 --
NM_000578chr231478 1246 580 --21625 665 --
NM_000594chr62757 41 ------
NM_000599chr223306 414 --24062 3157 --
NM_000612chr11113737 3295 3282 3172 3129 2923 2871 2544 2527 2434 146 --23443 3058 --
NM_000618chr1225537 5164 15908 15588 --
NM_000618chr1225537 5164 15908 15588 --
NM_000663chr1642869 944 659 438 --12761 1297
NM_000665chr72190 29 --135 --
NM_000678chr204684 354 294 215 ------
NM_000681chr102989 459 11087 ----
NM_000684chr1011198 ------
NM_000687chr20143 ------
NM_000722chr7162 ------
NM_000723chr1761278 1165 1157 1094 632 486 11573 ----
NM_000724chr101703 ------
NM_000725chr121283 --1124 --
NM_000757chr16869 841 729 669 107 64 --1848 --
NM_000767chr193512 259 54 ------
NM_000787chr94577 323 244 105 ------
NM_000795chr1131013 307 161 --147 --
NM_000806chr5----11579 --
NM_000813chr545064 4816 4335 2174 ------
NM_000814chr151222 --13785 --
NM_000826chr41944 ------
NM_000831chr145728 569 284 139 1820 ----
NM_000836chr195694 332 123 63 25 --1860 --
NM_000837chr83435 213 56 --128 --
NM_000841chr64834 801 764 99 --2811 778 --
NM_000860chr411473 ------
NM_000868chrX--11766 ----
NM_000875chr1586597 1592 1493 850 719 451 134 125 --2978 708 2873 217
NM_000883chr77600 572 557 525 477 212 160 ------
NM_000883chr77600 572 557 525 477 212 160 ------
NM_000891chr1723540 3013 --13485 --
NM_000901chr42596 555 ------
NM_000939chr2282 71 ------
NM_000945chr2171 ------
NM_000961chr2083252 3074 3024 2556 1032 333 57 47 23892 3371 22823 39 --
NM_000964chr1771302 1191 1043 101 91 39 32 --1311 --
NM_000966chr125818 678 280 213 99 ------
NM_000984chr171324 1452 ----
NM_001001132chr21----172 --
NM_001001331chr341839 660 553 22 --2307 27 --
NM_001001343chr53413 225 21 ------
NM_001001395chr1212476 --1954 --
NM_001001396chr144503 1239 1137 818 --11729 11769
NM_001001502chr55568 456 235 116 51 1183 1176 1384
NM_001001557chr831556 698 53 ------
NM_001001790chr9----1363 --
NM_001001890chr2174194 4164 3238 463 184 117 42 1136 11197 --
NM_001001924chr811286 ----1194
NM_001001925chr811286 ----1194
NM_001001931chr811286 ----1194
NM_001001933chr1----1133 --
NM_001001974chr102834 37 ------
NM_001001995chrX1374 ------
NM_001002243chr2--1902 ----
NM_001002265chr101336 --1270 --
NM_001002266chr101336 --1270 --
NM_001002838chrX1354 ------
NM_001002860chr1423195 695 --1557 --
NM_001002909chr1711905 --11551 --
NM_001003652chr1847357 3357 2812 2447 1882 --17486
NM_001003656chr104424 170 142 84 1550 ----
NM_001003694chr31152 ------
NM_001003800chr951460 1422 1377 1314 817 ------
NM_001003809chr185332 244 223 93 58 ------
NM_001003810chr41628 ------
NM_001003954chr8139 ------
NM_001004106chr55842 828 643 319 145 1742 ----
NM_001004304chr1222951 86 --12909 --
NM_001004354chr97868 420 251 244 236 83 36 --2725 434 --
NM_001004360chr21130 ------
NM_001004419chr1241814 1781 1014 505 ------
NM_001004722chr22219 116 --2455 224 --
NM_001005266chr15----1688 1700
NM_001005267chr15----1688 1700
NM_001005268chr15----1688 1700
NM_001005269chr15----1688 1700
NM_001005271chr1731073 1054 37 ------
NM_001005273chr1731073 1054 37 ------
NM_001005336chr9145 ------
NM_001005375chrY11454 ------
NM_001005377chr19123 ------
NM_001005386chr21106 ------
NM_001005463chr1022479 280 ------
NM_001005473chr535971 5045 2041 1430 --15767
NM_001005476chr22667 642 ------
NM_001005505chr381703 1656 1418 512 382 322 82 68 ------
NM_001005732chr21178 ------
NM_001005733chr21178 ------
NM_001005743chr14----1510 --
NM_001005744chr14----1510 --
NM_001005745chr14----1510 --
NM_001005920chr161755 --1264 --
NM_001006115chr382774 2750 2438 2132 1111 1034 441 399 --1902 12666
NM_001006617chr93990 323 300 --1272 --
NM_001006619chr93990 323 300 --1272 --
NM_001006620chr93990 323 300 --1272 --
NM_001006621chr93990 323 300 --1272 --
NM_001006623chr212033 ------
NM_001006634chr162598 541 ------
NM_001006636chr2167 ------
NM_001006946chr22741 27 11911 1139 --
NM_001007098chr11110 1787 ----
NM_001007156chr1531672 1594 469 --11316 --
NM_001007214chr111341 1283 ----
NM_001007226chr1721386 986 ------
NM_001007227chr1721386 986 ------
NM_001007228chr1721386 986 ------
NM_001007229chr1721386 986 ------
NM_001007230chr1721386 986 ------
NM_001007271chr104835 742 268 177 --1387 --
NM_001007277chr112221 198 ------
NM_001007279chr223670 316 111 2637 308 ----
NM_001007533chr17463 39 30 21 ------
NM_001007553chr11909 ------
NM_001007559chr1841864 1703 1656 1392 ------
NM_001008220chr593765 3525 3203 2583 2506 998 894 861 116 --1374 --
NM_001008222chrX31180 1101 526 ------
NM_001008407chr721667 1652 ----1361
NM_001008701chr1952645 2411 1207 653 636 --12485 --
NM_001008738chr522094 1888 ------
NM_001008925chr412379 1916 ----
NM_001008938chr111397 ------
NM_001009184chr83435 213 56 --128 --
NM_001009555chr4----1574 --
NM_001009566chr141377 1371 1334 1005 --1171 --
NM_001009880chr22114571 4551 4153 1902 1509 1367 1031 591 327 236 215 --33552 1016 230 --
NM_001009955chr1--1520 ----
NM_001009955chr1--1520 ----
NM_001009993chr274131 2958 1726 1712 1699 1492 1475 ------
NM_001010854chr14175 --131 --
NM_001010862chrX2171 138 ------
NM_001010867chr1135918 5355 5177 4707 2629 2432 2222 1870 1488 975 612 98 79 14934 11364 --
NM_001010891chr585446 5324 5238 5166 4562 2655 2537 845 ------
NM_001010917chr1032071 2041 118 --11445 --
NM_001010922chr163955 3876 2648 775 725 641 ------
NM_001010924chr101208 ------
NM_001010926chr12489 93 ------
NM_001010938chr33674 270 163 --2169 58 --
NM_001010942chr12--151 ----
NM_001010984chr111656 ------
NM_001011513chr41224 ------
NM_001011546chr201550 ------
NM_001011657chrX--1318 ----
NM_001011708chr211178 12463 ----
NM_001011713chr141405 ------
NM_001012329chr142276 2209 1698 124 --22100 968 --
NM_001012393chr1154915 4731 1946 1463 612 14294 ----
NM_001012426chr6183340 3138 3131 3110 2580 2489 2459 2188 1250 1235 1071 972 957 742 716 641 515 463 --11257 --
NM_001012427chr6183340 3138 3131 3110 2580 2489 2459 2188 1250 1235 1071 972 957 742 716 641 515 463 --11257 --
NM_001012614chr45693 678 617 190 174 --1633 --
NM_001012751chr1021970 98 ------
NM_001012755chrX44594 1477 1328 1221 ------
NM_001012761chr542270 1869 505 405 --1249 --
NM_001012977chrX1519 --1215 --
NM_001012989chrX1559 ------
NM_001013415chr4152 ------
NM_001013622chr412867 819 479 417 408 356 284 232 170 161 109 47 ------
NM_001013635chr1231112 884 251 ----1195
NM_001013690chr1262223 1778 898 468 51 42 --2438 253 --
NM_001013693chr172283 1856 956 929 884 596 280 --32557 1836 601 1753
NM_001013693chr172283 1856 956 929 884 596 280 --32557 1836 601 1753
NM_001013839chr1782206 1826 1669 1012 992 939 615 302 11997 31597 489 485 --
NM_001014283chr1341757 1475 1355 303 --11521 --
NM_001014435chr162410 188 ------
NM_001014443chr1----1216 --
NM_001014794chr112234 97 ------
NM_001014795chr112234 97 ------
NM_001014797chr1027712 2855 --17662 17748
NM_001014809chr41798 --1973 --
NM_001014812chr15--1437 ----
NM_001015045chr4----1608 --
NM_001015055chr21255 --131 --
NM_001015056chr21255 --131 --
NM_001015056chr21255 --131 --
NM_001015877chrX------1110
NM_001015881chrX11149 ------
NM_001015887chr311219 --1302 --
NM_001017402chr12282 41 ------
NM_001017405chr41680 ------
NM_001017423chr10177 ------
NM_001017424chr12535 256 ------
NM_001017425chr12535 256 ------
NM_001017440chr777350 5941 3136 2075 1956 1929 749 12951 16308 13061
NM_001017923chr14----139 --
NM_001017926chr8--172 ----
NM_001017963chr141879 ------
NM_001017999chr142059 1497 546 26 2595 481 --11673
NM_001017999chr142059 1497 546 26 2595 481 --11673
NM_001018000chr142059 1497 546 26 2595 481 --11673
NM_001018000chr142059 1497 546 26 2595 481 --11673
NM_001018001chr142059 1497 546 26 2595 481 --11673
NM_001018064chr932088 1652 406 ------
NM_001018067chr113919 15372 14839 --
NM_001018068chr113919 15372 14839 --
NM_001018069chr113919 15372 14839 --
NM_001018070chr112201 39 --2248 91 --
NM_001018074chr5--22553 321 ----
NM_001018075chr5--22553 321 ----
NM_001018076chr5--22553 321 ----
NM_001018077chr5--22553 321 ----
NM_001018108chr152837 331 ------
NM_001018111chr733877 3229 1243 1344 1436 --
NM_001020658chr111407 ------
NM_001020658chr111407 ------
NM_001020825chr5--128 ----
NM_001024094chr5--22553 321 ----
NM_001024226chr11814 --1470 --
NM_001024227chr11814 --1470 --
NM_001024228chr11814 --1470 --
NM_001024401chr16102807 2729 2530 1843 859 782 582 468 149 45 ------
NM_001024455chrX52246 433 227 78 54 2810 186 ----
NM_001024666chrX161 ------
NM_001024808chr1272418 2393 2182 2176 1027 545 533 ------
NM_001024809chr1771302 1191 1043 101 91 39 32 --1311 --
NM_001024845chr15924 821 375 324 89 --21000 990 1680
NM_001024858chr1461822 908 408 213 198 160 --183 --
NM_001024959chr31180 ------
NM_001024960chr31180 ------
NM_001025076chr1055671 5137 4807 2184 1323 --35699 4145 2262 --
NM_001025077chr1057029 6495 6165 2681 455 --27057 5503 --
NM_001025079chr321646 376 1223 ----
NM_001025105chr521400 1171 ------
NM_001025108chr222929 185 ------
NM_001025205chr32444 62 ------
NM_001025242chrX21318 387 ------
NM_001025243chrX21318 387 ------
NM_001025266chr354004 1868 422 259 106 --11619 --
NM_001025366chr621483 1188 --1613 --
NM_001025366chr621483 1188 --1613 --
NM_001025367chr621483 1188 --1613 --
NM_001025367chr621483 1188 --1613 --
NM_001025368chr621483 1188 --1613 --
NM_001025368chr621483 1188 --1613 --
NM_001025369chr621499 1204 --1629 --
NM_001025369chr621499 1204 --1629 --
NM_001025370chr621483 1188 --1613 --
NM_001025370chr621483 1188 --1613 --
NM_001025579chr175877 823 403 117 50 --1247 --
NM_001025580chrX13321 13454 ----
NM_001025596chr11--1104 ----
NM_001025780chr911153 ------
NM_001029858chr651349 1277 1230 945 53 ------
NM_001029863chr6----11002 --
NM_001029882chr13130 110 82 ------
NM_001029882chr13130 110 82 ------
NM_001029884chr652737 2112 1967 528 307 11870 ----
NM_001029998chr421442 1325 ------
NM_001030001chr14138 1182 ----
NM_001031690chr763034 2125 1972 1120 677 549 ------
NM_001031695chr2245132 5090 4480 1380 --12015 --
NM_001031738chr22444 147 ------
NM_001031740chr11244 ------
NM_001031812chr51236 1451 1586 --
NM_001032280chr671346 235 217 173 143 53 21 ------
NM_001032288chr202588 396 ------
NM_001032289chrX3352 316 98 ------
NM_001032296chr1342094 1168 909 137 --22534 141 --
NM_001032999chr2054122 4092 1519 1507 1401 --65124 4923 4646 3960 3290 962 --
NM_001033081chr1----11406 --
NM_001033082chr1----11406 --
NM_001033117chr374824 4465 3476 1227 809 704 172 --34593 4350 792 --
NM_001033506chr111166 ------
NM_001033507chr111449 ------
NM_001033551chr1763354 1603 413 366 357 42 --2338 246 --
NM_001033561chr172813 345 ------
NM_001033677chr124367 333 272 141 ------
NM_001033723chr832087 46 40 ------
NM_001033756chr621417 1122 --1547 --
NM_001033756chr621417 1122 --1547 --
NM_001034837chr53688 275 71 --1586 --
NM_001034838chr53688 275 71 --1586 --
NM_001034850chr511560 ------
NM_001034852chr1441812 678 118 80 --21464 1430 --
NM_001034954chr1051198 997 668 632 342 --11295 1526
NM_001034955chr1051198 997 668 632 342 --11295 1526
NM_001034956chr1051198 997 668 632 342 --11295 1526
NM_001034957chr1051198 997 668 632 342 --11295 1526
NM_001035chr111320 ------
NM_001035003chr411335 ------
NM_001035004chr411335 ------
NM_001035254chr942153 1818 1731 966 --2983 900 --
NM_001035256chr2282 71 ------
NM_001035267chr121204 ------
NM_001037164chr7195 1143 ----
NM_001037331chr183954 939 264 ------
NM_001037334chr181202 ------
NM_001037535chrX21081 80 ------
NM_001037536chrX21081 80 ------
NM_001037540chrX21081 80 ------
NM_001037582chr43653 593 451 --11108 --
NM_001037639chr3143 ------
NM_001038493chr24614 458 250 229 --2191 53 --
NM_001038707chr151627 825 714 445 70 ------
NM_001038707chr151627 825 714 445 70 ------
NM_001039140chr206408 170 129 90 48 21 ------
NM_001039459chr74723 374 186 92 ----1363
NM_001039467chr20131 --1169 --
NM_001039468chr11167 1275 ----
NM_001039469chr11167 1315 1208 --
NM_001039479chr1411754 11691 1182 --
NM_001039550chr2----1716 --
NM_001039573chr17287 44 ------
NM_001039574chr13974 886 334 --1751 --
NM_001039590chrX23561 174 ------
NM_001039591chrX23561 174 ------
NM_001039618chr1145384 5313 317 278 ------
NM_001039709chr2054122 4092 1519 1507 1401 --65124 4923 4646 3960 3290 962 --
NM_001039762chr102126 101 ------
NM_001040002chr171474 --21155 142 --
NM_001040056chr164561 494 260 221 ------
NM_001040108chr1421319 432 ------
NM_001040151chr1131612 1290 366 --1954 --
NM_001040159chr411303 ------
NM_001040167chr741021 755 153 72 ------
NM_001040214chr61244 2585 319 ----
NM_001040424chr2122770 918 1303 1867 --
NM_001040429chr131143 ------
NM_001040439chr1661348 1256 1070 490 396 94 --31128 514 61 --
NM_001040450chr1522634 2254 ------
NM_001040453chr1522634 2254 ------
NM_001040455chr113991 368 190 --31040 514 105 1862
NM_001040624chr842655 2131 184 109 ------
NM_001040625chr842655 2131 184 109 ------
NM_001040626chr842655 2131 184 109 ------
NM_001040627chr842655 2131 184 109 ------
NM_001040628chr842655 2131 184 109 ------
NM_001040629chr842655 2131 184 109 ------
NM_001040630chr842655 2131 184 109 ------
NM_001040712chr923032 424 --12547 --
NM_001040876chr41409 ------
NM_001042355chr1635025 3441 85 ------
NM_001042406chr6--1839 ----
NM_001042412chr1635025 3441 85 ------
NM_001042425chr671346 235 217 173 143 53 21 ------
NM_001042472chr204497 467 240 37 ------
NM_001042486chr2061555 1428 1229 1141 969 430 --11167 --
NM_001042494chr1522545 909 12808 12758 --
NM_001042495chr1522545 909 12808 12758 --
NM_001042496chr1522545 909 12808 12758 --
NM_001042497chr1522545 909 12808 12758 --
NM_001042555chr12--13226 11265 13493
NM_001042599chr225484 1739 ------
NM_001042603chr1223542 3242 ------
NM_001042663chr141445 1327 332 138 --41338 995 286 210 11258
NM_001042664chr141445 1327 332 138 --41338 995 286 210 11258
NM_001042665chr141445 1327 332 138 --41338 995 286 210 11258
NM_001042681chr112218 ------
NM_001042682chr112218 ------
NM_001042682chr112218 ------
NM_001042728chr125818 678 280 213 99 ------
NM_001043318chr1492859 2690 2643 1357 922 780 748 521 102 --1412 --
NM_001044385chr243598 3337 2883 1046 ------
NM_001044722chr51236 1451 1586 --
NM_001044723chr51236 1451 1586 --
NM_001045556chr8--130 11424 --
NM_001045557chr8--130 11424 --
NM_001065chr12135 --1114 --
NM_001066chr152014 1353 632 389 294 --21974 300 --
NM_001076778chr31852 --3630 338 30 --
NM_001077628chr1153 ------
NM_001080418chr15443 217 187 101 91 --2480 245 --
NM_001083620chr41943 ------
NM_001087chr2156 ------
NM_001092chr1782311 2292 2237 731 633 485 368 218 11779 1183 --
NM_001094chr171650 1167 1538 --
NM_001095chr1251659 1507 742 253 84 --11303 --
NM_001113490chrX31343 1325 593 ------
NM_001116chr16112349 2105 1241 1118 1021 764 739 731 683 602 21 ------
NM_001122631chr112648 535 ------
NM_001127chr223869 718 34 ------
NM_001131chr61335 ------
NM_001140chr172515 77 ------
NM_001148chr4----1180 --
NM_001150chr152344 43 ------
NM_001153chr21115 ------
NM_001157chr101113 --128 --
NM_001174chrX41810 759 653 587 ------
NM_001191chr2031393 1343 109 --2117 64 --
NM_001194chr1910503 462 436 424 223 217 205 197 184 81 --199 --
NM_001197chr223277 254 50 --1284 --
NM_001204chr236501 1961 600 13068 ----
NM_001220chr7154 ------
NM_001221chr4199 ------
NM_001222chr1021662 528 --1171 --
NM_001241chr2--185 ----
NM_001241chr2--185 ----
NM_001256chr17------12086
NM_001259chr746305 6257 6093 6084 --1158 15980
NM_001271chr1522545 2259 12046 ----
NM_001273chr12----1108 --
NM_001292chr1521074 39 --2967 820 --
NM_001294chr194392 331 125 83 ------
NM_001313chr41798 --1973 --
NM_001328chr45693 678 617 190 174 --1633 --
NM_001331chr1151106 978 747 709 122 12839 ----
NM_001343chr5198 ------
NM_001352chr19141 ------
NM_001356chrX11549 --1247 --
NM_001364chr1143513 3285 1653 1589 ----1273
NM_001365chr175758 318 281 271 30 173 ----
NM_001386chr82631 386 12446 122 1937
NM_001387chr542970 2539 2150 2034 ------
NM_001389chr211202 ------
NM_001406chr1741481 359 190 178 ------
NM_001407chr31587 ------
NM_001408chr15586 458 128 107 88 126 ----
NM_001417chr1211833 ------
NM_001419chr1921733 1683 --23112 570 --
NM_001420chr19112589 2516 2388 1236 1176 1142 1095 944 401 226 213 ------
NM_001447chr531317 1130 533 --21053 389 --
NM_001453chr621684 1577 ------
NM_001454chr172942 57 137 ----
NM_001456chrX4121 92 62 40 --1102 --
NM_001458chr71629 ------
NM_001478chr123921 193 150 --1251 --
NM_001493chrX6676 516 493 298 289 28 ------
NM_001495chr821176 57 --1412 --
NM_001520chr16138 --1200 --
NM_001523chr19123 ------
NM_001543chr564404 3210 3145 1441 1423 1382 --14351 --
NM_001569chrX21318 387 ------
NM_001616chr212632 ------
NM_001626chr1973483 3349 2247 1285 1064 653 206 --21291 239 --
NM_001635chr71350 --1406 --
NM_001658chr11814 --1470 --
NM_001659chr1262575 2355 647 586 127 62 --22494 566 --
NM_001663chr141408 ------
NM_001665chr115386 192 70 33 27 ------
NM_001670chr222164 129 ------
NM_001677chr11243 --1764 --
NM_001678chr1761761 1528 1345 1272 474 341 ------
NM_001679chr31197 ------
NM_001683chr341839 660 553 22 --2307 27 --
NM_001684chr144220 956 854 535 --11446 11486
NM_001694chr163415 139 98 --1170 --
NM_001701chr91577 ------
NM_001703chr11243 ------
NM_001707chr75717 632 619 215 21 ------
NM_001709chr11----21869 786 --
NM_001714chr12------166
NM_001722chr82393 35 ------
NM_001742chr7------11752
NM_001754chr2174194 4164 3238 463 184 117 42 1136 11197 --
NM_001759chr1231067 113 36 ------
NM_001777chr321646 376 1223 ----
NM_001789chr311387 --1218 --
NM_001800chr19----193 --
NM_001823chr14162 ------
NM_001854chr1--11087 ----
NM_001859chr923522 3332 1462 ----
NM_001892chr521400 1171 ------
NM_001894chr223312 294 224 ------
NM_001895chr2021012 390 ------
NM_001896chr161328 ------
NM_001903chr53731 302 21 ------
NM_001914chr181114 1310 ----
NM_001918chr138635 7143 5627 ------
NM_001923chr112117 55 ------
NM_001938chr11365 --1715 --
NM_001958chr205251 235 219 82 71 ------
NM_001964chr521172 390 --1179 --
NM_001970chr174559 529 231 174 ------
NM_001978chr86952 882 876 726 413 282 --1975 --
NM_001981chr112118 ------
NM_002037chr6142 --1103 --
NM_002048chr91231 --1272 --
NM_002055chr1781517 1452 1189 634 333 158 73 28 ------
NM_002061chr111703 ------
NM_002063chrX1801 1880 ----
NM_002074chr121476 1340 ----11625
NM_002081chr251636 1618 1396 1211 387 1230 11726 --
NM_002082chr54805 791 282 108 1705 ----
NM_002084chr5----1838 --
NM_002088chr194178 76 54 27 ------
NM_002089chr4153 1113 ----
NM_002094chr16169 --187 --
NM_002103chr194789 400 85 25 --1854 --
NM_002138chr41628 ------
NM_002148chr21110 ------
NM_002157chr2----141 --
NM_002196chr205848 390 226 114 108 ------
NM_002196chr205848 390 226 114 108 ------
NM_002205chr121917 ----1934
NM_002206chr12133 ------
NM_002211chr1011061 ------
NM_002226chr142877 703 --2857 694 --
NM_002227chr1--163 ----
NM_002229chr194360 353 310 151 ------
NM_002234chr121193 ------
NM_002240chr211164 ------
NM_002249chr1----1500 --
NM_002264chr324399 122 ------
NM_002267chr13----1335 --
NM_002268chr3--1192 1413 --
NM_002285chr222929 185 ------
NM_002298chr1341584 557 415 48 ------
NM_002315chr112103 41 --150 --
NM_002319chr74833 680 262 256 --1890 --
NM_002350chr8--11266 ----
NM_002355chr1221128 1062 ------
NM_002356chr61369 --1873 --
NM_002359chr17154190 4121 3988 3915 3818 3677 3399 3351 3096 1645 1362 1125 1076 240 64 --11674 --
NM_002373chr1531142 988 463 ------
NM_002382chr142408 382 --2388 330 --
NM_002387chr531012 877 205 --21567 29 --
NM_002390chr1771921 1487 1386 765 256 164 63 1701 11609 --
NM_002395chr611100 ------
NM_002397chr521444 1381 ------
NM_002398chr21225 ------
NM_002399chr15--1321 ----
NM_002402chr7--179 ----
NM_002419chr113460 413 385 ------
NM_002430chr2251825 947 853 744 630 ------
NM_002436chrX2322 61 ------
NM_002442chr1211710 674 605 336 282 236 214 171 163 136 98 ------
NM_002446chr193185 58 23 ------
NM_002478chr114594 226 155 149 159 --127
NM_002479chr1194 ------
NM_002499chr1511624 12015 12303 --
NM_002501chr19254061 3933 3644 3420 3378 3339 3327 3224 3178 3114 3022 3011 2514 1487 1228 1220 1012 996 990 975 942 936 566 491 369 13747 13782 --
NM_002505chr6199 --1576 --
NM_002506chr1128 ------
NM_002509chr202771 314 --1208 --
NM_002515chr1431597 1505 1331 ------
NM_002521chr1171 ------
NM_002522chr17102588 2450 2398 869 824 808 790 649 114 37 --32518 1479 28 --
NM_002524chr11252 ------
NM_002537chr151996 ------
NM_002545chr1154915 4731 1946 1463 612 14294 ----
NM_002552chr21126 ------
NM_002553chr71382 ------
NM_002581chr922030 325 ------
NM_002586chr61527 ----1449
NM_002587chr52143 25 ------
NM_002588chr551595 1460 1410 1254 155 --11317 --
NM_002589chr4178 ------
NM_002599chr111341 --127 --
NM_002605chr151438 ----1841
NM_002608chr2231521 1269 213 1542 1165 --
NM_002609chr551496 1232 672 100 22 --11543 --
NM_002616chr172489 105 ------
NM_002623chr201136 ------
NM_002628chr31453 1132 ----
NM_002634chr172854 605 ------
NM_002636chr6153 --1345 --
NM_002645chr111961 ------
NM_002650chr22280 27 ------
NM_002651chr12269 217 ------
NM_002657chr2083251 3236 3172 3054 2969 1386 1016 518 1386 12797 13071
NM_002660chr2011167 --11126 --
NM_002673chr31529 ------
NM_002698chr1972796 2710 2458 518 115 97 73 ------
NM_002699chr171060 968 305 299 275 264 257 1198 2609 57 --
NM_002707chr21348 --2135 22 --
NM_002710chr12----1895 --
NM_002721chr9136 ------
NM_002731chr122157 77 --12914 --
NM_002738chr16122 ------
NM_002746chr164392 202 91 52 ------
NM_002753chr41141 ------
NM_002761chr161129 ------
NM_002763chr1--1224 ----
NM_002779chr101470 ------
NM_002821chr62628 108 ------
NM_002824chr123453 349 156 ------
NM_002829chr921010 473 ------
NM_002833chr1511194 ------
NM_002839chr923032 424 --12547 --
NM_002845chr18------1168
NM_002850chr1961037 977 400 214 184 51 --11119 --
NM_002851chr71499 ------
NM_002854chr22138 ------
NM_002855chr11113603 3594 2848 2569 992 849 356 279 204 108 33 23089 543 33405 3345 66 2867 117
NM_002859chr1251858 1683 594 575 23 --1230 --
NM_002860chr10177 ------
NM_002867chr13527 150 78 --1109 --
NM_002885chr13693 128 98 --1192 --
NM_002892chr141525 ------
NM_002898chr121182 ------
NM_002911chr1971579 1536 1311 1243 1031 471 257 ------
NM_002918chr1961045 717 316 278 238 28 --11032 1838
NM_002940chr41409 ------
NM_002942chr31249 ------
NM_002945chr172679 181 ------
NM_002959chr133661 3416 367 13111 1876 --
NM_002966chr1167 ------
NM_002996chr1651626 1224 579 338 315 --21632 396 --
NM_002997chr22741 27 11911 1139 --
NM_003009chr191301 ------
NM_003010chr17195 ------
NM_003011chr91115 ------
NM_003012chr821054 152 --1618 --
NM_003025chr1951098 364 287 272 24 1995 133 --
NM_003026chr921108 1003 ------
NM_003028chr953090 3077 3033 2535 483 11143 33326 2959 1228 --
NM_003029chr121136 411 ------
NM_003030chr32221 118 11318 ----
NM_003045chr1354935 4907 641 598 107 13775 23372 428 --
NM_003047chr141229 252 170 104 ------
NM_003071chr311762 ------
NM_003072chr19----1350 --
NM_003075chr122250 131 ------
NM_003076chr1231486 1078 361 ------
NM_003077chr171229 ------
NM_003085chr55568 456 235 116 51 1183 1176 1384
NM_003088chr771125 1050 992 883 255 157 23 --3893 187 30 --
NM_003108chr262922 2799 2081 2044 1811 434 14877 ----
NM_003110chr173867 362 99 1250 1225 --
NM_003128chr231017 307 24 ------
NM_003131chr65597 580 469 213 186 --11867 1809
NM_003150chr1772194 2176 1871 1649 1550 315 45 ------
NM_003151chr2--167 ----
NM_003156chr1141223 215 204 146 ------
NM_003165chr941511 1486 1400 114 --21385 167 --
NM_003170chr173544 202 75 --2526 57 --
NM_003173chrX41256 399 115 69 ------
NM_003174chr10--138 ----
NM_003179chrX51242 240 208 176 60 ------
NM_003185chr205975 506 499 487 298 ------
NM_003199chr1825112 528 ------
NM_003202chr531180 242 53 ------
NM_003204chr1731615 1593 1581 11259 ----
NM_003213chr12--1160 ----
NM_003220chr671346 235 217 173 143 53 21 ------
NM_003221chr663260 3129 2883 2539 469 239 --23115 612 --
NM_003239chr142707 54 ------
NM_003244chr181367 ------
NM_003253chr2131696 1541 46 --158 --
NM_003255chr1751693 823 524 515 493 --1750 12265
NM_003269chr631094 221 172 ------
NM_003300chr14186 ------
NM_003317chr142581 56 --1562 --
NM_003319chr21627 1907 ----
NM_003325chr22173 --1255 --
NM_003340chr4--1239 ----
NM_003342chr1733043 3021 2486 ------
NM_003347chr2262340 2242 2213 504 458 105 ------
NM_003349chr202588 396 ------
NM_003369chr1142683 2649 573 534 ------
NM_003371chr96742 718 581 411 322 181 --1122 --
NM_003376chr621483 1188 --1613 --
NM_003376chr621483 1188 --1613 --
NM_003378chr74122 109 75 21 ------
NM_003392chr3129 ------
NM_003400chr21256 ------
NM_003409chr181232 ------
NM_003412chr311970 ------
NM_003418chr31303 ------
NM_003458chr3103429 3002 2560 2463 1584 1130 1027 571 442 379 ------
NM_003472chr61966 ------
NM_003482chr1282416 2095 1076 769 743 619 482 232 ------
NM_003483chr1212255 ------
NM_003485chr142959 71 --1420 --
NM_003498chr1611066 12511 21071 201 --
NM_003508chr7258 33 --196 --
NM_003538chr6159 ------
NM_003542chr6177 ------
NM_003545chr6164 ------
NM_003563chr1721386 986 ------
NM_003564chr12486 26 ------
NM_003575chr771439 1433 1345 1121 1087 257 180 11189 1628 1612
NM_003576chr1342094 1168 909 137 --22534 141 --
NM_003579chr1--1131 ----
NM_003583chr12--13504 1594 --
NM_003586chr162456 95 ------
NM_003607chr143920 3715 3625 35 ------
NM_003613chr15129 ------
NM_003624chr1961398 1094 954 431 86 65 --41253 473 438 58 --
NM_003628chr22667 642 ------
NM_003632chr172730 250 --1766 1719
NM_003633chr521644 1018 --11795 --
NM_003644chr1796481 4522 4418 4181 1196 941 767 259 209 1849 1967 --
NM_003654chr117640 532 522 493 226 147 121 ------
NM_003660chr197759 733 574 483 241 159 70 ------
NM_003663chr32587 302 ------
NM_003671chr913106 --1774 --
NM_003673chr172105 35 ------
NM_003713chr121365 421 --1585 --
NM_003714chr552302 2054 384 299 240 --2938 42 --
NM_003716chr31104 ------
NM_003728chr41168 --2156 59 --
NM_003735chr551595 1460 1410 1254 155 --11317 --
NM_003736chr551595 1460 1410 1254 155 --11317 --
NM_003737chr113392 386 73 --1399 --
NM_003741chr31345 ------
NM_003744chr14----1510 --
NM_003748chr13526 410 272 --240 24 --
NM_003749chr1331915 622 65 ------
NM_003758chr15138 ------
NM_003758chr15138 ------
NM_003768chr121467 1162 --11780 --
NM_003800chr6161 ------
NM_003822chr133196 2502 519 ------
NM_003870chr1512067 ------
NM_003873chr102418 292 ------
NM_003888chr1531621 1225 402 ------
NM_003893chr10141 ------
NM_003924chr43627 278 170 ------
NM_003927chr182874 830 ------
NM_003930chr721971 145 ------
NM_003936chr26996 769 755 129 32 22 --197 --
NM_003939chr102470 30 --1110 --
NM_003947chr33350 336 170 ------
NM_003949chr1791976 1911 1885 1629 1377 1351 276 259 40 --21772 460 --
NM_003954chr1751051 979 283 194 67 --1483 --
NM_003966chr525052 2560 1491 167 --
NM_003987chr10152073 1993 1835 1785 1734 1617 1601 1429 582 442 259 249 242 230 120 ------
NM_003988chr10182150 2070 1912 1862 1811 1694 1678 1506 1470 659 519 336 326 319 307 197 42 27 ------
NM_003989chr10152009 1929 1771 1721 1670 1553 1537 1365 518 378 195 185 178 166 56 ------
NM_003990chr10152009 1929 1771 1721 1670 1553 1537 1365 518 378 195 185 178 166 56 ------
NM_003993chr11232 ------
NM_004024chr12531 46 ------
NM_004036chr21263 ------
NM_004068chr32444 62 ------
NM_004077chr122413 217 ------
NM_004078chr121072 279 --129 --
NM_004081chrY11454 ------
NM_004082chr22116 52 ------
NM_004089chrX11149 ------
NM_004090chr1712638 --11074 --
NM_004104chr174606 284 177 126 ------
NM_004116chr2------1146
NM_004134chr51615 ------
NM_004152chr192126 78 ------
NM_004161chr2----11321 --
NM_004164chr3----144 --
NM_004186chr33918 630 114 --1904 --
NM_004200chr11132952 2932 2742 2170 2115 2087 2060 1242 1168 1049 1019 519 76 --22238 2135 --
NM_004202chrY1126 ------
NM_004205chr115426 403 394 234 46 ------
NM_004227chr762674 2312 2022 723 191 98 ------
NM_004228chr19140 ------
NM_004229chrX--12160 ----
NM_004230chr194821 701 430 106 --52176 1819 914 587 384 --
NM_004254chr11127 --1158 --
NM_004274chr1423056 85 ------
NM_004276chr124367 333 272 141 ------
NM_004302chr1262545 2503 2407 2226 376 157 --2835 96 --
NM_004306chr8139 ------
NM_004308chr11101763 1738 1515 1231 753 650 532 469 434 145 ------
NM_004309chr1781063 924 915 888 813 444 275 131 ------
NM_004311chr1082851 2721 2271 1262 1217 908 694 413 --12262 --
NM_004316chr122438 240 ------
NM_004320chr161138 ------
NM_004321chr243478 3384 2629 133 --179 --
NM_004349chr821180 891 ------
NM_004364chr193485 311 23 --11224 --
NM_004370chr611339 ------
NM_004377chr223438 99 24 ------
NM_004383chr154615 514 463 418 1557 1608 --
NM_004384chr51236 1451 1586 --
NM_004386chr1942329 2063 2035 921 ------
NM_004392chr1312320 ------
NM_004393chr362102 1857 1525 1486 152 94 --11491 --
NM_004394chr521602 23 186 ----
NM_004395chr52522 99 --141 --
NM_004397chr1111587 --13856 --
NM_004405chr23410 324 271 ------
NM_004409chr194148 100 82 76 --2585 120 1770
NM_004414chr21----1426 --
NM_004416chr123970 949 257 ------
NM_004418chr2126 --1396 --
NM_004420chr1182253 1814 1524 1511 1503 848 591 299 --130 --
NM_004427chr13906 822 282 --1911 --
NM_004428chr11637 ------
NM_004429chrX5322 311 152 95 64 --11289 --
NM_004430chr841776 940 704 461 1358 ----
NM_004431chr11328 --1703 --
NM_004436chr1276 48 ------
NM_004437chr143605 2778 1385 31 11340 22925 314 --
NM_004438chr22560 95 ------
NM_004444chr73720 590 34 2645 269 ----
NM_004451chr111222 ------
NM_004459chr171431 11717 ----
NM_004463chrX2526 48 ------
NM_004468chr12568 433 --1517 --
NM_004475chr1721178 1109 ------
NM_004484chrX129 ------
NM_004503chr122532 519 --1262 --
NM_004514chr1722611 377 12667 ----
NM_004517chr112234 97 ------
NM_004527chr171474 --21155 142 --
NM_004530chr161298 1178 ----
NM_004540chr211780 --1153 --
NM_004576chr51279 ------
NM_004577chr73511 461 259 ------
NM_004579chr112332 32 1253 ----
NM_004583chr175598 530 39 30 24 ------
NM_004588chr1163381 3222 3186 2805 1624 52 --22510 349 --
NM_004593chr3127 ------
NM_004598chr522934 492 ------
NM_004602chr20----1267 --
NM_004608chr162108 43 --1120 --
NM_004626chr112664 257 ------
NM_004630chr112821 357 ------
NM_004634chr31152 ------
NM_004637chr321251 1186 --1258 --
NM_004640chr6181 ------
NM_004642chr12----1213 --
NM_004643chr142607 294 --1281 --
NM_004655chr1731183 1171 946 ------
NM_004658chr122372 67 ------
NM_004667chr152178 106 ------
NM_004690chr61624 ------
NM_004723chr1121 ------
NM_004725chr10----1488 --
NM_004730chr51605 ------
NM_004734chr131101 1211 ----
NM_004736chr121713 1390 --1378 --
NM_004737chr222188 141 ------
NM_004739chr11149 ------
NM_004746chr185332 244 223 93 58 ------
NM_004747chr103384 202 38 ------
NM_004762chr1751377 1230 715 496 110 ----12039
NM_004772chr52305 202 ------
NM_004774chr1722866 765 ------
NM_004798chr2023419 3097 11435 --13014
NM_004801chr21496 ------
NM_004826chr2294 33 ------
NM_004836chr2--1105 ----
NM_004839chr153585 578 571 --2140 27 --
NM_004845chrX64125 3351 3270 3255 3209 389 14054 ----
NM_004860chr17------147
NM_004879chr11299 76 ------
NM_004883chr5125 --265 31 --
NM_004906chr61456 ------
NM_004925chr92196 33 1174 ----
NM_004926chr1431630 610 587 --1455 --
NM_004936chr911074 1625 122 --
NM_004943chr1951114 753 408 388 312 --3945 836 810 --
NM_004953chr33338 288 61 ------
NM_004954chr11167 1275 ----
NM_004958chr1121 ------
NM_004959chr991408 1372 1290 1004 927 271 143 128 106 --11331 --
NM_004961chrX31388 163 119 ------
NM_004968chr72247 36 ------
NM_004975chr201931 ------
NM_004978chr141637 1549 1162 638 1629 11414 --
NM_004979chrX2766 107 ------
NM_004981chr22----129 --
NM_004991chr31125 ------
NM_004992chrX108059 6920 6845 6694 6623 3188 3153 2994 2643 1368 26661 1328 37438 7318 5263 1333
NM_004992chrX108059 6920 6845 6694 6623 3188 3153 2994 2643 1368 26661 1328 37438 7318 5263 1333
NM_005022chr17129 ------
NM_005032chrX1272 ------
NM_005056chr1223786 3486 ------
NM_005057chr111539 ------
NM_005063chr1033138 2979 258 ------
NM_005073chr133323 251 56 ------
NM_005077chr91369 1321 ----
NM_005093chr2054122 4092 1519 1507 1401 --65124 4923 4646 3960 3290 962 --
NM_005094chr92127 58 ----1449
NM_005096chrX31207 429 421 --1125 --
NM_005099chr181209 929 248 239 175 162 139 126 11075 ----
NM_005103chr11----1264 --
NM_005110chr51739 ------
NM_005116chr2044095 3962 571 182 --14031 --
NM_005135chr1522545 909 12808 12758 --
NM_005151chr181202 ------
NM_005153chr163811 70 27 ------
NM_005156chr91173 ------
NM_005164chr12--22588 803 ----
NM_005168chr21431 ------
NM_005169chr114409 90 49 31 ------
NM_005178chr19295 50 ------
NM_005180chr101350 1103 ----
NM_005182chr162410 188 ------
NM_005184chr1931176 1164 305 --31392 1358 1039 --
NM_005187chr1651414 1386 1303 159 117 --31636 1542 329 --
NM_005197chr1434179 3825 1148 --24428 4212 1915
NM_005202chr12733 24 21791 1739 11606 11678
NM_005219chr52695 54 ------
NM_005220chr1731091 552 63 ------
NM_005225chr2041121 966 824 79 ------
NM_005229chrX3937 420 230 ------
NM_005235chr225484 1739 ------
NM_005249chr14----1607 --
NM_005273chr73229 126 50 --144 --
NM_005281chr13860 774 669 ------
NM_005296chrX1892 ------
NM_005328chr81264 ----1645
NM_005334chrX51666 1421 1187 319 85 --1260 --
NM_005347chr911512 1668 --11399
NM_005348chr141879 ------
NM_005354chr197647 528 425 267 235 177 124 ------
NM_005359chr1824902 2118 ------
NM_005369chrX2524 432 ------
NM_005370chr192509 30 --1104 --
NM_005392chr931680 606 549 --134 --
NM_005397chr733877 3229 1243 1344 1436 --
NM_005400chr21448 1807 12217 --
NM_005415chr21496 ------
NM_005417chr2071574 1543 1448 1290 610 467 451 1704 21757 354 --
NM_005430chr124927 270 221 88 ------
NM_005434chr251323 709 562 502 118 --1660 --
NM_005436chr1022621 238 23149 525 ----
NM_005439chr121380 --1474 --
NM_005458chr911617 --12310 --
NM_005461chr203395 223 26 1576 ----
NM_005477chr1561948 914 701 674 431 414 --12200 --
NM_005477chr1561948 914 701 674 431 414 --12200 --
NM_005491chrX1437 ----152
NM_005499chr191541 ------
NM_005502chr942649 1138 900 440 ------
NM_005515chr75630 424 135 119 76 ------
NM_005523chr731204 650 467 ------
NM_005529chr13921 283 128 --2755 741 --
NM_005539chr1011363 ----1105
NM_005542chr72571 205 1376 1243 --
NM_005544chr21316 ------
NM_005557chr17----133 --
NM_005563chr11582 ------
NM_005565chr5129 ------
NM_005576chr151268 ------
NM_005578chr313765 ------
NM_005581chr197440 429 423 405 334 87 81 --1117 --
NM_005585chr152405 77 ------
NM_005587chr15149 ------
NM_005596chr915897 --13960 --
NM_005599chr12115 27 ------
NM_005613chr121645 1581 ------
NM_005614chr72763 59 ------
NM_005618chr61192 ------
NM_005619chr19132 ------
NM_005627chr61257 ------
NM_005628chr19125 ------
NM_005629chrX61217 1140 1045 834 308 296 --2319 256 --
NM_005630chr34371 301 262 21 --2633 409 --
NM_005634chrX5551 543 480 55 21 ------
NM_005637chr1841864 1703 1656 1392 ------
NM_005639chr122195 31 ----11568
NM_005653chr12121 ------
NM_005665chr134208 742 580 ------
NM_005668chr553034 2860 902 742 696 --1326 --
NM_005692chr7157 ------
NM_005698chr1157 ------
NM_005716chr191152 ------
NM_005717chr1181 ------
NM_005718chr31180 ------
NM_005722chr21106 ------
NM_005724chr151147 ------
NM_005736chr1021432 1001 ------
NM_005737chr252695 415 329 228 105 ------
NM_005738chr7195 1143 ----
NM_005740chr225770 619 367 148 22 ------
NM_005746chr72603 123 ------
NM_005781chr33674 270 163 --2169 58 --
NM_005786chr181108 ------
NM_005796chr16----1337 --
NM_005801chr17------1711
NM_005803chr6124 ------
NM_005826chr11549 ------
NM_005828chr1764802 4129 3508 389 169 55 --25064 344 1366
NM_005852chr1731073 1054 37 ------
NM_005871chr101295 ------
NM_005873chr20131 --1169 --
NM_005876chr21678 --1767 --
NM_005882chr41680 ------
NM_005892chr172388 279 --1417 --
NM_005895chr1273826 3146 2897 840 633 587 33 12839 33656 791 618 --
NM_005901chr1847357 3357 2812 2447 1882 --17486
NM_005904chr183587 492 478 ------
NM_005906chr61194 1367 ----
NM_005909chr513969 ------
NM_005910chr1763629 2647 1044 685 93 86 ------
NM_005920chr152626 2505 1484 88 72 --22748 59 --
NM_005933chr1132674 2431 2199 --11959 --
NM_005934chr19152453 2359 2268 2049 1620 908 831 767 356 305 222 175 124 89 67 --2434 163 --
NM_005938chrX21074 165 ------
NM_005941chr81273 1267 11522 --
NM_005943chr651288 1173 661 271 72 ----11328
NM_005955chr134781 2088 1048 --1355 23855 3791
NM_005967chr122562 109 --1225 --
NM_005984chr223481 366 28 ------
NM_005990chr562555 2470 1123 1008 163 129 11825 22461 739 12035
NM_005997chr1136 ------
NM_006007chr923712 3665 --13888 --
NM_006026chr3----1301 --
NM_006030chr381703 1656 1418 512 382 322 82 68 ------
NM_006034chr1162424 2337 1545 231 115 99 1446 21859 28 --
NM_006036chr21196 ------
NM_006037chr284638 3330 3274 3266 3229 3016 1458 521 --24131 159 --
NM_006062chr221134 29 --11248 --
NM_006064chrX--1298 ----
NM_006079chr61614 ------
NM_006080chr7----12381 --
NM_006089chrX31523 1398 1296 --11474 --
NM_006095chr443381 2845 1076 576 ------
NM_006096chr83348 73 22 196 21543 396 --
NM_006106chr1132530 317 120 ------
NM_006108chr112451 124 ------
NM_006136chr7----184 --
NM_006141chr16----1703 --
NM_006154chr1511948 ------
NM_006156chr143105 88 36 ------
NM_006160chr1751308 1044 1034 131 45 --11473 --
NM_006161chr52217 72 ------
NM_006176chr113718 698 290 --1102 --
NM_006180chr932088 1652 406 ------
NM_006185chr111140 --166 --
NM_006186chr21111 ----1902
NM_006194chr142261 94 ------
NM_006201chrX21007 447 --2741 124 1147
NM_006206chr422231 947 ------
NM_006210chr1911156 1300 ----
NM_006212chr133646 114 67 ------
NM_006224chr174754 724 504 110 ------
NM_006228chr83302 99 54 ------
NM_006247chr193394 303 87 ------
NM_006251chr52699 604 ------
NM_006256chr11349 ------
NM_006279chr15900 717 708 661 238 ------
NM_006282chr2043279 3192 3119 3073 --1794 14313
NM_006285chr92298 288 ------
NM_006292chr11172 ------
NM_006293chr152714 367 ------
NM_006301chr121241 ----1514
NM_006306chrX44930 4461 310 22 ----14690
NM_006311chr17187 ------
NM_006317chr5--1174 ----
NM_006322chr131105 --1114 --
NM_006330chr8172 ------
NM_006336chr961435 1073 1036 1013 456 30 --1942 --
NM_006369chr11292 --169 --
NM_006378chr9----21094 1063 --
NM_006380chr1754307 3525 3478 2834 534 11100 13012 --
NM_006386chr22----1194 --
NM_006389chr1131125 1113 95 ------
NM_006401chr91159 ------
NM_006408chr7----1988 --
NM_006411chr62789 175 ------
NM_006420chr2031340 1117 1019 13348 ----
NM_006424chr441701 1326 1320 292 --21879 1707 --
NM_006430chr2----1427 --
NM_006434chr1051198 997 668 632 342 --11295 1526
NM_006454chr4122807 2366 2330 2145 2116 1971 1156 828 443 183 149 33 --2988 262 --
NM_006455chr171824 ----125
NM_006457chr41224 ------
NM_006477chr221112 179 ----
NM_006482chr12--13504 1594 --
NM_006489chr1431597 1505 1331 ------
NM_006494chr191188 --1600 --
NM_006496chr111840 ------
NM_006516chr121393 288 ------
NM_006517chrX12065 1785 12114 --
NM_006532chr1961694 1682 1617 1449 720 456 ------
NM_006540chr82225 157 ------
NM_006544chr1424519 4384 12311 ----
NM_006546chr1785887 5126 4122 2489 2349 1919 213 130 12113 ----
NM_006548chr32232 225 ------
NM_006549chr1252583 2447 2329 2182 983 ------
NM_006557chr91451 11699 --1628
NM_006559chr111131 ------
NM_006560chr11--1104 ----
NM_006561chr1055671 5137 4807 2184 1323 --35699 4145 2262 --
NM_006562chr103222 109 26 ------
NM_006575chr141925 ------
NM_006614chr332496 777 587 ------
NM_006650chr593765 3525 3203 2583 2506 998 894 861 116 --1374 --
NM_006651chr4121276 1267 1073 1051 501 494 208 193 144 138 126 37 1281 1266 --
NM_006653chr6130 ------
NM_006654chr12--13226 11265 13493
NM_006675chr12163278 3267 3255 3212 2898 1284 996 478 385 369 315 309 122 38 30 22 --13022 --
NM_006690chr2052056 1620 1577 926 832 ------
NM_006695chr17124 ------
NM_006709chr6152 ------
NM_006711chr16123 ------
NM_006713chr5----1210 --
NM_006722chr312342 ------
NM_006736chr2----11726 --
NM_006741chr1231016 425 190 ------
NM_006746chrX21081 80 ------
NM_006748chr8--130 11424 --
NM_006761chr171133 1754 ----
NM_006766chr821904 1800 ------
NM_006772chr661566 462 442 220 192 140 --1262 --
NM_006775chr611247 --11976 --
NM_006800chrX2141 112 ------
NM_006802chr111027 ------
NM_006813chr6----1256 --
NM_006823chr81526 ------
NM_006841chr31715 --147 1266
NM_006854chr71675 --11721 --
NM_006870chr201550 ------
NM_006884chr32221 118 11318 ----
NM_006885chr1632864 1116 516 11031 23820 3130 --
NM_006888chr1432449 976 831 ------
NM_006896chr7--1298 ----
NM_006897chr121594 ------
NM_006901chr15181 ------
NM_006906chr112615 371 --137 --
NM_006913chr61420 --121 --
NM_006924chr1731553 668 270 ------
NM_006936chr21----128 --
NM_006941chr2271034 974 423 172 155 69 41 --131 --
NM_006943chr20123284 3028 2483 594 507 392 383 349 282 232 131 114 ------
NM_006946chr112579 74 ------
NM_006950chrX2819 286 1328 ----
NM_006990chr121572 512 ----1620
NM_006999chr581591 1556 785 736 435 161 117 46 ------
NM_007011chr1546614 4417 4400 557 ------
NM_007014chr1621751 1581 ------
NM_007026chr171584 ------
NM_007030chr5104336 4213 3407 3171 1917 1470 1142 898 881 155 32012 1981 1779 11400 --
NM_007050chr2052230 2040 595 467 376 --36945 6087 640 27693 5263
NM_007067chr1721103 322 ------
NM_007084chr131418 ------
NM_007108chr162540 76 ------
NM_007126chr93366 95 71 ------
NM_007144chr171523 --11115 --
NM_007158chr11909 ------
NM_007159chr3128 ------
NM_007162chr62577 111 ------
NM_007170chr12653 148 ------
NM_007174chr1261854 1757 1573 210 200 91 ------
NM_007177chr31852 --3630 338 30 --
NM_007212chr111664 ------
NM_007214chr6--2437 417 ----
NM_007222chr8--172 ----
NM_007232chr207999 809 773 365 297 224 72 --2765 280 --
NM_007236chr1522090 781 ------
NM_007245chr166726 720 360 144 137 37 ------
NM_007249chr1358822 3260 854 805 738 --26595 934 --
NM_007275chr3135 ------
NM_007284chr3155 --145 --
NM_007320chr19286 65 --158 --
NM_007322chr193431 86 65 --3473 438 58 --
NM_007327chr9151153 1145 1040 997 885 875 841 825 793 438 408 333 181 144 26 --71031 775 451 447 421 341 149 21179 281
NM_007350chr1223029 106 12847 ----
NM_007357chr11142 1181 ----
NM_007359chr1721714 1600 ------
NM_007363chrX4956 672 383 356 ------
NM_007365chr141989 1462 829 64 1292 ----
NM_007368chr132463 114 --140 --
NM_007371chr91618 ------
NM_009588chr63508 229 187 ------
NM_012074chr141755 ------
NM_012081chr52836 605 13421 ----
NM_012083chr10155 ------
NM_012102chr112218 ------
NM_012129chr72985 776 ----12225
NM_012134chr131303 1268 374 1151 178 --
NM_012137chr1163 11851 ----
NM_012154chr82586 156 ------
NM_012164chr947286 4679 2291 1651 25704 4842 ----
NM_012166chr92592 83 ------
NM_012191chr3146 ------
NM_012193chr1144165 4083 2012 1849 ------
NM_012199chr183618 3164 1825 1793 1410 1097 656 284 --21103 758 13202
NM_012200chr111124 --171 --
NM_012202chr111275 ------
NM_012218chr1962870 1235 787 541 163 106 --42099 2010 1206 118 --
NM_012234chr313447 --164 --
NM_012244chr1451519 1260 692 515 503 --21510 233 --
NM_012249chr2----1350 --
NM_012259chr611141 ------
NM_012262chr124304 546 12067 ----
NM_012264chr2281888 1694 1646 447 270 222 177 111 --11794 --
NM_012264chr2281888 1694 1646 447 270 222 177 111 --11794 --
NM_012281chr7----1256 --
NM_012282chrX146 1323 ----
NM_012287chr31358 ------
NM_012288chr635232 1115 290 --24913 4477 --
NM_012293chr22901 125 1323 ----
NM_012296chr1131484 1402 599 11216 22416 198 --
NM_012297chr42764 284 ------
NM_012300chr5------1492
NM_012306chr1273207 783 728 710 223 214 24 --1540 --
NM_012308chr1122455 832 --21828 609 --
NM_012309chr1184448 3877 3497 1388 1090 681 487 391 --1274 1835
NM_012311chr101592 ------
NM_012316chr175036 1857 1288 719 414 147 117 ------
NM_012325chr2011275 ------
NM_012326chr26787 771 684 660 293 181 1263 ----
NM_012334chr52166 80 --1105 --
NM_012382chr5----13583 --
NM_012399chr2211509 ------
NM_012402chr113430 194 147 --1962 --
NM_012423chr192443 40 ------
NM_012446chr51433 ------
NM_012447chr7--1348 ----
NM_012465chr1022332 85 ------
NM_012475chr1----1216 --
NM_013233chr2----180 --
NM_013261chr4--12291 --12529
NM_013269chr1241741 1708 941 432 ------
NM_013275chr16----148 --
NM_013279chr1152020 1980 1764 180 45 --32146 1758 414 --
NM_013281chr2011486 --11132 --
NM_013341chr211178 12463 ----
NM_013346chrX122 ------
NM_013374chr3--1980 ----
NM_013381chr121399 ------
NM_013386chr11261 ------
NM_013396chr211191 ------
NM_013423chrX243 29 ------
NM_013427chrX243 29 ------
NM_013433chr1951552 754 672 465 146 --2171 163 --
NM_013446chr721422 425 ------
NM_013960chr82573 97 ------
NM_013981chr5125 --265 31 --
NM_013982chr5125 --265 31 --
NM_013983chr5125 --265 31 --
NM_014001chr1741627 1362 1306 47 ------
NM_014011chr21813 21920 860 ----
NM_014023chr102819 143 ------
NM_014038chr71333 ------
NM_014109chr8------169
NM_014112chr824296 3920 13506 ----
NM_014117chr1622574 626 ------
NM_014155chr1131455 1286 1080 --22885 2193 --
NM_014190chr44696 547 316 218 --1468 1288
NM_014217chr12535 256 ------
NM_014231chr1281791 1595 1540 1463 593 376 95 56 --1346 11626
NM_014232chr1741624 1262 584 442 --11246 --
NM_014232chr1741624 1262 584 442 --11246 --
NM_014235chrX--128 ----
NM_014240chr353513 3466 3297 931 783 --13504 11059
NM_014246chr2252057 2044 1732 803 69 --1359 --
NM_014251chr72801 97 --1215 --
NM_014272chr15270 43 ------
NM_014278chr4187 ------
NM_014286chr9113271 2894 2750 2676 2547 1220 1170 314 182 127 89 11074 1775 --
NM_014289chrX31378 1209 586 ------
NM_014292chr2251689 748 595 279 44 11738 1220 11715
NM_014299chr19102051 1922 1695 1586 1548 1508 1351 857 187 178 --32022 257 219 --
NM_014309chr2245122 5080 4470 1370 --12005 --
NM_014322chr11138 1986 ----
NM_014325chr1222100 689 22124 345 ----
NM_014331chr415283 ----134
NM_014335chr1511252 --1960 --
NM_014343chr73121 107 39 ------
NM_014344chr113319 146 102 ------
NM_014345chr6159 ------
NM_014368chr951720 1340 116 47 26 --2621 129 --
NM_014381chr1421319 432 ------
NM_014390chr72440 387 --134 --
NM_014405chr1782286 2278 2251 2030 1970 1754 1579 24 --12186 --
NM_014408chr12210 72 ------
NM_014417chr194748 661 654 644 --2305 292 --
NM_014452chr61910 ------
NM_014470chr122708 259 ------
NM_014488chr11292 40 ------
NM_014489chr11----140 --
NM_014491chr71291 ------
NM_014494chr1641925 334 90 73 ------
NM_014507chr2251203 842 483 144 57 ------
NM_014515chr121871 ----1188
NM_014516chr192189 71 --155 --
NM_014517chr311248 ------
NM_014520chr172138 52 ------
NM_014562chr25685 652 566 201 153 --182 --
NM_014564chr93857 776 44 ------
NM_014571chr152674 2459 532 298 23 12823 1282 --
NM_014587chr1651287 1069 1006 558 141 ------
NM_014592chr53688 275 71 --1586 --
NM_014612chr911391 ------
NM_014613chr522926 182 --1503 --
NM_014615chr1662325 2304 1154 1061 258 227 --12233 --
NM_014620chr122188 22 ------
NM_014630chr1551498 825 133 89 58 ------
NM_014636chr953792 3389 881 430 226 ------
NM_014646chr1842572 1078 775 560 ------
NM_014655chr131923 1728 110 --21578 470 --
NM_014665chr8133336 3312 2961 2941 2694 2245 1366 1343 1052 991 974 652 32 --12539 11191
NM_014667chr31293 ------
NM_014676chr111407 ------
NM_014686chr1932365 808 38 --143 --
NM_014690chr763034 2125 1972 1120 677 549 ------
NM_014699chr161394 ------
NM_014707chr71469 ------
NM_014726chr1731209 98 35 ------
NM_014727chr191196 ------
NM_014730chr1224676 3595 --14888 --
NM_014730chr1224676 3595 --14888 --
NM_014731chr2031621 178 158 11720 31593 1175 566 --
NM_014732chr16165738 5556 5243 4628 4448 4411 3779 3661 2058 1985 1892 1345 1249 765 127 65 ------
NM_014747chr175070 5036 4112 1447 1252 626 576 --23666 1878 --
NM_014755chr233839 3510 27 ----1540
NM_014756chr111397 ------
NM_014757chr542323 1873 1826 869 --11969 --
NM_014761chr162961 294 ------
NM_014762chr132041 811 656 ------
NM_014764chr121251 1134 ----
NM_014770chr1251095 920 365 264 108 --1517 --
NM_014784chr13709 334 286 ------
NM_014798chr1761812 1786 1534 1332 613 22 ----1317
NM_014800chr74723 374 186 92 ----1363
NM_014824chr1121251 559 ------
NM_014826chr143920 3715 3625 35 ------
NM_014827chr1----11356 --
NM_014828chr14--12435 ----
NM_014830chr1233690 1413 223 11289 1932 --
NM_014832chr1321706 128 ------
NM_014847chr11106 ------
NM_014850chr374824 4465 3476 1227 809 704 172 --34593 4350 792 --
NM_014869chr3123 --31114 357 38 --
NM_014873chr153708 1493 1126 869 411 --11444 --
NM_014876chr2251804 811 610 423 79 22158 2102 ----
NM_014883chr4----1608 --
NM_014897chr1742619 2547 1154 104 12753 12703 --
NM_014900chr21991 ------
NM_014901chr551436 910 320 219 99 1741 32326 422 224 --
NM_014902chr2061555 1428 1229 1141 969 430 --11167 --
NM_014903chr122485 393 --1700 --
NM_014921chr1952645 2411 1207 653 636 --12485 --
NM_014926chr31881 ------
NM_014931chr192537 37 ------
NM_014941chr22137 --130 --
NM_014944chr141377 1371 1334 1005 --1171 --
NM_014947chr142801 997 951 217 ------
NM_014952chr1511824 ------
NM_014961chr412058 ------
NM_014974chr1071645 1524 1496 1418 1389 363 207 ------
NM_014989chr6----11861 --
NM_015000chr1212318 ------
NM_015001chr12805 384 --1144 --
NM_015002chr12----1199 --
NM_015020chr162399 145 ------
NM_015023chr141813 1700 360 50 --11731 --
NM_015024chr811294 ------
NM_015025chr212133 ------
NM_015033chr982777 2711 2552 2428 1113 215 165 83 12460 21199 174 --
NM_015035chr2096304 6020 5008 4748 2488 2416 1770 1622 47 11190 55748 4638 4127 1461 178 12452
NM_015039chr12353 314 --14018 --
NM_015042chr1543287 1664 674 637 --33782 2676 385 --
NM_015044chr1632858 2330 680 --12680 --
NM_015051chr912353 ------
NM_015052chr71407 ------
NM_015063chr191133 --3524 36 32 11193
NM_015071chr555054 4929 4439 4104 704 24754 321 15175 --
NM_015074chr133732 3246 1633 --21702 880 --
NM_015075chrX101723 1646 608 592 459 419 412 320 294 37 ------
NM_015076chr612978 ------
NM_015078chr3111192 1054 1042 982 937 507 435 396 179 42 23 --183 --
NM_015080chr113901 167 33 --2653 185 --
NM_015082chr542390 2141 1672 460 ------
NM_015090chr1115842 5715 5661 4805 4303 3787 2502 1235 765 327 307 14052 25467 4343 --
NM_015091chr14----1743 --
NM_015092chr1623275 245 1191 ----
NM_015101chr132613 874 829 ------
NM_015102chr13111 84 63 ------
NM_015103chr34305 283 169 48 --1262 --
NM_015104chr111134 --2421 35 --
NM_015107chrX3583 525 87 2691 273 31675 938 433 --
NM_015113chr1742070 2032 1978 99 --21972 441 --
NM_015125chr192509 464 ------
NM_015132chr71243 --11888 --
NM_015133chr1661348 1256 1070 490 396 94 --31128 514 61 --
NM_015138chr151499 ------
NM_015144chr161213 13076 ----
NM_015155chr1032477 2284 755 ------
NM_015171chr162420 143 --1165 --
NM_015180chr14154 1628 ----
NM_015185chrX32117 1922 1030 --12343 --
NM_015192chr203655 452 168 --180 --
NM_015193chr871445 1173 962 943 616 444 55 --31099 1026 29 --
NM_015194chr1751460 1332 682 251 127 1429 1231 --
NM_015199chr312558 ------
NM_015209chr142059 1497 546 26 2595 481 --11673
NM_015219chr1782206 1826 1669 1012 992 939 615 302 11997 31597 489 485 --
NM_015238chr51655 ----1571
NM_015247chr1635025 3441 85 ------
NM_015250chr92444 292 ------
NM_015264chr22114571 4551 4153 1902 1509 1367 1031 591 327 236 215 --33552 1016 230 --
NM_015265chr212501 ------
NM_015267chr122758 594 ------
NM_015271chr443629 1288 1243 776 ------
NM_015282chr242337 2294 2156 609 --186 --
NM_015284chr152055 1971 353 183 160 --1788 --
NM_015288chr591143 1122 896 790 669 656 403 256 31 --32822 622 262 13159
NM_015292chr12163 1705 ----
NM_015296chr1311205 ------
NM_015299chr14246 28 12922 ----
NM_015317chr222591 654 ------
NM_015327chr131188 960 50 ------
NM_015332chr773493 3480 2928 2754 1385 1212 60 --13186 --
NM_015338chr201488 --31919 1221 730 1217
NM_015343chr172130 111 ------
NM_015344chr81581 ------
NM_015361chr2141 ------
NM_015365chrX13321 13454 ----
NM_015385chr1051198 997 668 632 342 --11295 1526
NM_015401chr12----2765 25 --
NM_015404chr91235 --134 --
NM_015444chr3128 ------
NM_015447chr91188 122 ----
NM_015455chr511447 --13570 --
NM_015457chr112279 38 ------
NM_015458chr823514 883 24492 1493 ----
NM_015470chr221189 53 ------
NM_015472chr31104 ------
NM_015472chr31104 ------
NM_015475chr21265 ------
NM_015477chr151244 ------
NM_015481chr1261117 807 801 756 213 75 1707 ----
NM_015488chr271748 1476 1367 1336 1291 540 518 11779 ----
NM_015493chr1952195 2137 1580 534 44 ------
NM_015515chr17121 ------
NM_015526chr1921433 389 ------
NM_015527chr162789 241 ------
NM_015531chr112162 26 ------
NM_015541chr31134 ------
NM_015542chr10------11217
NM_015545chr72625 305 ------
NM_015553chr674527 4223 4175 4073 3415 3292 362 --24533 3398 --
NM_015557chr1123579 3101 3039 2738 1300 1041 988 572 492 455 70 34 --11015 --
NM_015565chr2112166 ------
NM_015569chr124415 143 ------
NM_015570chr7------1642
NM_015609chr172705 2680 2665 2414 1984 1843 43 --52916 2686 2671 673 146 11909
NM_015638chr206639 615 483 229 107 72 ------
NM_015640chr113919 15372 14839 --
NM_015646chr12--151 ----
NM_015649chr193369 34 27 ------
NM_015686chrX72415 2246 2240 2194 2143 2105 304 --1451 --
NM_015704chr22121 ------
NM_015713chr831365 994 278 ------
NM_015719chr193673 585 126 ------
NM_015831chr74934 773 601 588 --2849 779 --
NM_015845chr181210 --195 --
NM_015850chr831607 478 85 ------
NM_015872chr161477 703 660 593 426 378 --21493 687 --
NM_015878chr811603 ------
NM_015898chr1992123 1839 1782 1630 1579 758 638 606 526 12098 1829 --
NM_015912chr832169 1902 513 12558 ----
NM_015964chr16136 ------
NM_015981chr572930 2362 2016 1256 400 347 303 --32760 1988 672 --
NM_015994chr14----1212 --
NM_015995chr1595189 4876 4557 4407 2200 765 685 300 27 --21812 501 1532
NM_016022chr13445 369 85 --149 1302
NM_016026chr141464 ------
NM_016032chrX31180 1101 526 ------
NM_016037chr141075 1029 924 810 ------
NM_016045chr201385 1623 ----
NM_016061chr21462 ------
NM_016063chr61562 ------
NM_016076chr12631 202 --1665 --
NM_016083chr61576 ------
NM_016084chr172452 124 ------
NM_016097chr181717 ------
NM_016107chr5142 ------
NM_016140chr16136 ------
NM_016147chr111988 --197 --
NM_016148chr191123 --130 --
NM_016205chr4128 ------
NM_016216chr31115 ------
NM_016235chr162192 105 ------
NM_016248chr1321096 829 ------
NM_016257chr112885 ----1132
NM_016260chr252927 2800 2399 2159 2022 16541 ----
NM_016269chr41769 11114 1115 --
NM_016284chr162649 126 ------
NM_016320chr11134 ------
NM_016338chr511166 ------
NM_016357chr12156 ------
NM_016358chr52192 39 ------
NM_016396chr1512609 1134 ----
NM_016418chr2242914 2867 1223 861 1350 53293 3071 591 473 400 --
NM_016424chr171266 ------
NM_016433chr12191 ------
NM_016463chr5124 ------
NM_016470chr201552 ------
NM_016507chr17--1900 ----
NM_016510chr22643 315 --9691 650 302 288 274 260 246 232 218 --
NM_016574chr1131013 307 161 --147 --
NM_016575chr1265010 4894 3416 1492 1290 32 ------
NM_016588chr6129 ----1707
NM_016591chr5--177 ----
NM_016596chr12----2765 25 --
NM_016598chr32319 57 --1425 --
NM_016603chr511640 ------
NM_016605chr542575 2546 1844 946 --12557 --
NM_016609chr14--1256 191 --
NM_016621chr1164193 4033 3563 3100 2823 523 1808 23239 707 --
NM_016623chr81405 ------
NM_016626chr181621 --1680 --
NM_016628chr10--156 ----
NM_016631chr211720 --1750 --
NM_016656chrX--1298 ----
NM_016823chr171964 ------
NM_016830chr121153 ------
NM_016834chr1763629 2647 1044 685 93 86 ------
NM_016835chr1763629 2647 1044 685 93 86 ------
NM_016841chr1763629 2647 1044 685 93 86 ------
NM_016950chr411303 ------
NM_016952chr1183932 3833 3038 679 673 594 548 522 ------
NM_017409chr12247 31 ------
NM_017413chrX82193 2124 1762 686 367 301 89 30 11592 1217 --
NM_017420chr1413256 ------
NM_017423chr4166 ------
NM_017447chr2122871 31 ------
NM_017452chr20----1267 --
NM_017453chr20----1267 --
NM_017454chr20----1267 --
NM_017456chr1751377 1230 715 496 110 ----12039
NM_017457chr19140 ------
NM_017488chr2--2529 506 ----
NM_017490chr11167 1275 ----
NM_017514chrX6791 772 759 257 249 46 --1781 --
NM_017519chr61120 ------
NM_017530chr16121 ------
NM_017550chr195971 401 371 224 62 ------
NM_017551chr1042111 1082 661 432 --124 --
NM_017559chr17----1221 --
NM_017563chr344247 4083 3936 1681 14878 ----
NM_017580chr1021914 1819 1555 ----
NM_017590chr2271844 1649 955 404 225 161 104 ------
NM_017596chr1184475 4319 4246 4060 3467 3221 3143 1740 1641 1611 1584 1480 1472 1360 1341 887 702 185 --44513 4481 2922 349 --
NM_017602chrX1377 ------
NM_017607chr191468 --1480 --
NM_017622chr174511 448 148 89 ------
NM_017626chr1031661 1403 159 ------
NM_017628chr41206 --14208 --
NM_017629chr121674 72 ------
NM_017633chr612431 ------
NM_017637chr948700 8487 3418 3138 --17789 --
NM_017643chr1712414 ------
NM_017651chr621317 421 ----11494
NM_017657chr2--1902 ----
NM_017668chr163586 176 43 ------
NM_017670chr117870 787 688 211 187 33 25 ------
NM_017715chr7------1571
NM_017739chr11390 1433 ----
NM_017747chr51127 ------
NM_017758chr1731511 1017 424 ------
NM_017772chr651132 1099 640 469 261 --1129 --
NM_017797chr192936 23 --1316 --
NM_017798chr2031086 1028 141 ------
NM_017805chr19166 ------
NM_017811chr931132 283 29 --13111 --
NM_017848chrX33992 1603 772 --11747 --
NM_017849chr263076 2432 1215 612 486 233 ----12724
NM_017859chr20123 ------
NM_017893chr1011305 ----1338
NM_017921chr1772100 1570 910 899 571 398 89 1254 22172 650 --
NM_017933chr21315 ------
NM_017938chrX1534 ------
NM_017944chr111130 1157 ----
NM_017955chr1451117 908 169 102 29 ------
NM_018013chr652187 2157 557 343 29 ------
NM_018027chr103895 320 131 ------
NM_018032chr161250 ------
NM_018048chr1222032 1463 ------
NM_018054chr162598 541 ------
NM_018070chr1--1520 ----
NM_018086chr2----11760 --
NM_018094chrX----181 --
NM_018107chr141997 --1170 --
NM_018111chr19128 ------
NM_018133chr321409 854 ------
NM_018150chr1146 ------
NM_018155chr323480 1296 --23148 2982 --
NM_018171chr121271 ------
NM_018189chr331569 390 344 ------
NM_018199chr141794 11208 ----
NM_018202chr1--124 1172 --
NM_018207chr151727 1618 1427 1200 1100 --31447 662 60 1274
NM_018222chr11----11216 129
NM_018223chr125953 900 887 282 206 ------
NM_018240chr13853 204 160 ------
NM_018243chr421438 362 ------
NM_018244chr202878 164 ------
NM_018246chr821744 278 ------
NM_018263chr232107 1798 734 --11743 --
NM_018273chr193729 194 51 --122 --
NM_018315chr4152 ------
NM_018327chr2011227 ------
NM_018348chr16148 ------
NM_018362chr1143460 3410 3202 2967 ------
NM_018380chr16199 ------
NM_018388chrX------11487
NM_018400chr1131612 1290 366 --1954 --
NM_018403chr342903 973 739 625 ------
NM_018425chr1052222 2153 1849 1688 192 ------
NM_018440chr827631 3431 --37390 980 562 15734
NM_018452chr6_random42938 2828 1500 1452 33554 2730 894 ----
NM_018461chr104424 170 142 84 1550 ----
NM_018469chr172145 127 ------
NM_018482chr81666 ------
NM_018489chr11598 1544 ----
NM_018534chr2185 ------
NM_018557chr21466 ------
NM_018622chr3143 ------
NM_018638chr1211416 ------
NM_018640chr1212476 --1954 --
NM_018644chr112550 342 --1843 --
NM_018667chr16102472 2017 1874 1812 1795 1071 535 410 343 199 ------
NM_018689chr1531938 1012 176 ------
NM_018710chr8----11119 --
NM_018717chr42631 383 1787 1294 --
NM_018718chr74821 814 504 383 11603 1551 --
NM_018719chr721318 891 ------
NM_018847chr91346 --11641 --
NM_018898chr51318 ------
NM_018899chr51318 ------
NM_018900chr51318 ------
NM_018901chr51318 ------
NM_018902chr51318 ------
NM_018903chr51318 ------
NM_018904chr51318 ------
NM_018905chr51318 ------
NM_018906chr51318 ------
NM_018907chr51318 ------
NM_018908chr51318 ------
NM_018909chr51318 ------
NM_018910chr51318 ------
NM_018911chr51318 ------
NM_018912chr551595 1460 1410 1254 155 --11317 --
NM_018913chr551595 1460 1410 1254 155 --11317 --
NM_018914chr551595 1460 1410 1254 155 --11317 --
NM_018915chr551595 1460 1410 1254 155 --11317 --
NM_018916chr551595 1460 1410 1254 155 --11317 --
NM_018917chr551595 1460 1410 1254 155 --11317 --
NM_018918chr551595 1460 1410 1254 155 --11317 --
NM_018919chr551595 1460 1410 1254 155 --11317 --
NM_018920chr551595 1460 1410 1254 155 --11317 --
NM_018921chr551595 1460 1410 1254 155 --11317 --
NM_018922chr551595 1460 1410 1254 155 --11317 --
NM_018923chr551595 1460 1410 1254 155 --11317 --
NM_018924chr551595 1460 1410 1254 155 --11317 --
NM_018925chr551595 1460 1410 1254 155 --11317 --
NM_018926chr551595 1460 1410 1254 155 --11317 --
NM_018927chr551595 1460 1410 1254 155 --11317 --
NM_018928chr551595 1460 1410 1254 155 --11317 --
NM_018929chr551595 1460 1410 1254 155 --11317 --
NM_018931chr54566 281 221 174 ------
NM_018944chr21234 28 ------
NM_018945chr61313 ----11001
NM_018951chr7----2356 73 --
NM_018957chr223128 110 75 ------
NM_018964chr2131037 733 279 ------
NM_018970chr732988 540 233 ------
NM_018977chrX2911 883 ------
NM_018999chr1031942 528 382 ------
NM_019000chr511560 ------
NM_019008chr2253598 3349 2738 788 222 --11451 --
NM_019009chr11102181 2175 1737 992 915 740 723 135 110 33 --2508 141 --
NM_019027chr4--11035 ----
NM_019036chr6--1839 ----
NM_019046chr102900 360 --1836 --
NM_019057chr5------1100
NM_019074chr154845 780 686 265 ------
NM_019096chr64862 741 440 69 ------
NM_019105chr6157 ------
NM_019106chr2283293 3191 3155 2504 2298 2198 867 228 ------
NM_019116chr1613217 11482 --1902
NM_019593chr20--12175 12851 --
NM_019600chr151658 ------
NM_019606chr7136 ------
NM_019613chr17140 --1107 1509
NM_019845chr24596 202 161 29 --142 --
NM_019849chr191179 ------
NM_019854chr123646 194 65 1771 ----
NM_019884chr193475 439 86 ----1426
NM_019885chr21756 1508 22570 447 1733
NM_020039chr1251659 1507 742 253 84 --11303 --
NM_020062chr203989 771 291 ------
NM_020063chr1164 ----149
NM_020119chr793928 3193 2965 1057 496 459 409 291 187 ------
NM_020121chr13152 ------
NM_020130chr81264 ------
NM_020142chr12----1463 1514
NM_020144chr721621 472 ------
NM_020155chr11134 ------
NM_020168chr1551155 1107 173 142 33 --1529 --
NM_020177chr512880 13018 ----
NM_020180chr1821309 1238 ------
NM_020182chr2033355 3076 2572 ------
NM_020184chr221520 881 --126 --
NM_020193chr11----11280 --
NM_020205chr113379 12333 ----
NM_020211chr1571489 1132 1070 589 248 128 35 --2620 70 --
NM_020214chr15287 50 ------
NM_020239chr151627 825 714 445 70 ------
NM_020248chr142276 2209 1698 124 --22100 968 --
NM_020309chr1911083 ------
NM_020310chr1772242 2037 2027 1940 793 342 272 12155 11958 --
NM_020337chr411092 ------
NM_020338chr1083734 3202 2606 1301 1289 1204 251 96 --12977 --
NM_020348chr1022546 915 ------
NM_020372chr14--1256 191 --
NM_020374chr12192 ----11560
NM_020381chr63772 616 570 11469 ----
NM_020410chr19182 --127 --
NM_020416chr441074 804 524 164 ------
NM_020418chr31112 ----172
NM_020420chrY11454 ------
NM_020441chr112201 39 --2248 91 --
NM_020443chr166547 5891 5819 2116 664 654 --12507 --
NM_020457chr161195 ------
NM_020465chr1621864 27 --11441 1604
NM_020475chr862110 1774 1648 1636 1602 1546 --1481 --
NM_020476chr862110 1774 1648 1636 1602 1546 --1481 --
NM_020477chr862110 1774 1648 1636 1602 1546 --1481 --
NM_020478chr862173 1837 1711 1699 1665 1609 --1544 --
NM_020480chr862110 1774 1648 1636 1602 1546 --1481 --
NM_020631chr141445 1327 332 138 --41338 995 286 210 11258
NM_020640chr31211 ------
NM_020647chr821866 466 ------
NM_020676chr32129 87 ------
NM_020686chr1642869 944 659 438 --12761 1297
NM_020689chr202196 130 21618 1291 ----
NM_020695chr199742 625 568 298 271 212 152 36 24 --2172 98 --
NM_020699chr163420 1460 1324 222 172 23 --23892 1332 --
NM_020703chr1130 --1393 191
NM_020708chr206992 753 734 473 236 36 1665 ----
NM_020713chr20133094 2798 2666 2617 2557 2384 2162 1061 678 563 222 110 45 --43057 2463 618 123 --
NM_020718chr1642039 1203 521 60 16005 ----
NM_020732chr61120 ------
NM_020737chr61260 1215 ----
NM_020742chrX2479 33 --143 --
NM_020748chr1711384 --11422 --
NM_020749chr811286 ----1194
NM_020760chr21202 11652 ----
NM_020764chr16101256 1040 1015 402 355 344 258 205 165 152 --2332 33 --
NM_020766chrX----1834 --
NM_020772chr1748398 6126 1717 851 27716 6565 --18370
NM_020783chr18--12449 ----
NM_020787chr171992 ------
NM_020795chr1731937 1272 549 ------
NM_020796chr512532 --156 --
NM_020801chr51114 ------
NM_020804chr6112520 2498 2415 2362 2178 510 418 374 344 330 46 --22507 2145 --
NM_020807chr1651620 1501 1374 343 175 --11185 --
NM_020809chr11----1749 --
NM_020825chr1633612 3567 3274 1171 11256 --
NM_020830chr22778 22 ------
NM_020845chr1272462 1988 1889 739 730 665 157 --62357 1898 949 767 763 650 --
NM_020850chr16158 --2181 169 --
NM_020858chr151638 ------
NM_020868chr21130 ------
NM_020870chr411384 ------
NM_020888chr152012 1401 1279 805 191 --21573 529 --
NM_020899chr173695 398 82 --1502 --
NM_020909chr2141 ----2198 163
NM_020922chrX1354 ------
NM_020935chr213780 --153 --
NM_020947chr1611593 --11918 --
NM_020951chr1931790 1571 763 ------
NM_020956chr19244207 4132 4036 3950 3848 3525 3214 3207 3170 2932 1388 1284 1178 1048 977 839 758 752 702 562 502 369 90 76 23384 1518 44520 1460 1127 1118 11698
NM_020962chr1541936 977 956 386 1536 ----
NM_020964chr1843662 3524 3455 3099 14074 13613 --
NM_020971chr195807 615 547 332 185 ------
NM_020977chr4----1180 --
NM_020993chr1272418 2393 2182 2176 1027 545 533 ------
NM_021012chr1763090 2917 2812 2395 996 61 ----1899
NM_021025chr52208 37 --1112 --
NM_021064chr661445 1311 1239 1192 499 358 ------
NM_021077chr15146 ------
NM_021095chr2121 ------
NM_021104chr121204 ------
NM_021109chrX1126 ------
NM_021109chrX1126 ------
NM_021120chrX32232 848 235 ------
NM_021140chrX1888 ------
NM_021143chr191405 1490 ----
NM_021148chr71872 ------
NM_021155chr1952960 2598 1846 812 608 ------
NM_021173chr11124 ------
NM_021189chr13826 800 97 ------
NM_021248chr20197 --141 1541
NM_021267chr19151301 1274 1254 1239 1178 948 913 384 344 335 205 182 134 74 64 11216 ----
NM_021569chr9151153 1145 1040 997 885 875 841 825 793 438 408 333 181 144 26 --71031 775 451 447 421 341 149 21179 281
NM_021622chr102834 37 ------
NM_021625chr121365 --132 --
NM_021629chr313457 ------
NM_021633chr111027 ------
NM_021637chrX145 ------
NM_021638chr4124925 4811 4413 3795 3427 1901 1391 1032 980 537 463 413 --185 --
NM_021643chr22731 570 --1284 --
NM_021705chr6199 --1576 --
NM_021724chr17129 ------
NM_021738chr10--138 ----
NM_021783chrX139 ------
NM_021784chr201186 ------
NM_021813chr61211 14499 11397 --
NM_021911chr545064 4816 4335 2174 ------
NM_021912chr151222 --13785 --
NM_021943chr631888 751 702 --21744 1475 --
NM_021946chrX41312 1014 126 45 ------
NM_021948chr13305 252 39 ------
NM_021949chrX61160 876 842 271 166 160 2581 69 1107 --
NM_021960chr112109 --12119 --
NM_021961chr1145162 1966 1928 1504 ------
NM_021962chr1782311 2292 2237 731 633 485 368 218 11779 1183 --
NM_021963chrX134 ------
NM_021973chr43584 97 86 ------
NM_021984chrX31388 163 119 ------
NM_021987chrX31388 163 119 ------
NM_021988chr202588 396 ------
NM_021990chrX31388 163 119 ------
NM_022042chr4111135 1111 953 874 864 393 385 376 299 263 128 --1882 --
NM_022048chr1545705 1374 246 194 11741 ----
NM_022059chr172180 44 ------
NM_022066chr174963 298 118 52 ------
NM_022085chr6----2397 31 --
NM_022114chr1134337 3690 3614 3600 3140 3065 1831 1604 1298 1107 1022 820 792 11776 24178 3376 23624 256
NM_022137chr1441812 678 118 80 --21464 1430 --
NM_022166chr16106124 5810 5455 4608 4357 2336 1466 1408 571 469 --21119 538 --
NM_022307chr72247 36 ------
NM_022369chr15----2521 28 --
NM_022373chr71792 ------
NM_022442chr202588 396 ------
NM_022455chr52102 35 ------
NM_022459chr1346154 5279 4132 2148 ------
NM_022465chr1242326 2159 490 40 ------
NM_022469chr19712 689 508 485 393 376 76 64 38 ------
NM_022557chr171209 ------
NM_022572chr271748 1476 1367 1336 1291 540 518 11779 ----
NM_022574chr732126 2055 1453 --11987 --
NM_022640chr171207 ------
NM_022644chr173479 378 29 1169 ----
NM_022716chr11902 ------
NM_022719chr2293421 3174 2901 2795 2704 2547 2512 1101 179 --23071 721 --
NM_022730chr21106 --2789 253 --
NM_022737chr19101257 1244 1136 1118 1045 406 117 98 61 47 --2340 204 --
NM_022753chr121990 154 --1919 --
NM_022756chr111022 ------
NM_022758chr643127 2081 1225 539 ----12188
NM_022763chr322777 512 13200 1900 --
NM_022781chr912594 13301 ----
NM_022825chrX1274 ------
NM_022831chr111525 ------
NM_022893chr222107 71 11001 ----
NM_022898chr1423212 1274 ------
NM_022910chr1621864 27 --11441 1604
NM_022914chr16126 ------
NM_022970chr1011218 ------
NM_023000chr141525 ------
NM_023001chr141525 ------
NM_023009chr12479 100 ------
NM_023018chr171443 1249 1225 1123 1057 88 38 11337 21488 1010 --
NM_023019chr22116 52 ------
NM_023039chr5126 ------
NM_023067chr33486 132 116 ----2426 316
NM_023076chr1652624 2303 768 267 156 ------
NM_023105chr831607 478 85 ------
NM_023106chr831607 478 85 ------
NM_023110chr831607 478 85 ------
NM_023111chr831607 478 85 ------
NM_023926chr192281 139 ------
NM_024003chrX2583 191 --2722 597 --
NM_024007chr51911 ------
NM_024015chr172481 118 ------
NM_024019chr4183 ------
NM_024034chr203418 345 111 --11029 --
NM_024038chr19----121 --
NM_024040chr10121 ------
NM_024052chr1731054 319 304 --12303 --
NM_024085chr23995 695 50 1892 1332 --
NM_024092chr1141030 949 868 85 11148 ----
NM_024117chr93990 323 300 --1272 --
NM_024165chr6----1121 --
NM_024294chr643127 2081 1225 539 ----12188
NM_024295chr83450 434 24 ------
NM_024306chr163856 168 21 --1767 --
NM_024312chr1221204 1158 --11053 --
NM_024321chr19296 23 ------
NM_024326chr101107 ------
NM_024328chr146614 603 509 253 212 184 ------
NM_024424chr111186 ------
NM_024425chr111186 ------
NM_024426chr111186 ------
NM_024490chr151553 ------
NM_024496chr141524 ------
NM_024507chr163332 42 33 ------
NM_024511chr452941 2746 2381 2335 605 11125 ----
NM_024522chr161730 1532 1381 351 103 33 1120 ----
NM_024523chr7----11024 --
NM_024541chr1051683 711 592 86 33 --11390 --
NM_024554chr131518 578 71 ------
NM_024595chr11767 ------
NM_024599chr174472 287 63 22 ------
NM_024612chr171984 ------
NM_024627chr2294770 3706 3400 1326 678 410 241 198 29 --24591 1306 --
NM_024639chr642359 210 162 151 ------
NM_024645chr811191 --11391 --
NM_024646chr1--12572 1146 --
NM_024659chr2167 ------
NM_024676chr191287 1017 946 836 541 407 252 203 149 ------
NM_024698chr1191306 1152 1063 944 540 471 457 267 256 ------
NM_024721chr81647 ------
NM_024742chr1661504 1329 1191 770 692 72 --21528 429 --
NM_024770chr266405 5618 4661 2158 1714 1572 24377 1929 11665 --
NM_024784chr116992 968 833 719 443 287 --3919 394 109 --
NM_024798chr1572905 2385 2189 2153 705 499 117 ------
NM_024811chr1161909 1506 447 436 149 85 --1667 --
NM_024825chr191292 ------
NM_024874chr151015 370 337 110 43 ------
NM_024884chr1434186 1067 961 ------
NM_024887chr171967 1913 1758 1435 867 508 33 ------
NM_024896chr92310 30 ------
NM_024900chr442299 1985 1939 40 ------
NM_024900chr442299 1985 1939 40 ------
NM_024909chr641450 567 528 464 ------
NM_024915chr842465 2202 484 257 --22726 330 --
NM_024922chr1671605 1530 1512 334 171 128 76 --22100 728 --
NM_024949chr484529 3511 3249 3170 3118 3082 527 252 --11725 1510
NM_024954chr102496 34 ------
NM_024989chr257466 2890 2854 2468 2421 11306 16229 --
NM_024991chr1051198 997 668 632 342 --11295 1526
NM_025045chr222303 126 1341 139 --
NM_025054chr8----1183 --
NM_025073chr164509 4006 1189 1124 1086 631 --24102 3588 --
NM_025083chr1531860 775 754 11812 21946 1332 --
NM_025104chr1721176 292 ------
NM_025109chr172155 39 ------
NM_025129chr19164 ------
NM_025133chr2185 ------
NM_025134chr1611746 ------
NM_025160chr123751 484 ------
NM_025176chr201156 ------
NM_025179chr183909 3217 1751 1520 1345 1278 411 209 ----1427
NM_025182chr91177 1128 141 --
NM_025187chr161520 --11333 --
NM_025221chr411335 ------
NM_025222chr322407 2036 --1934 --
NM_025224chr2072298 2065 833 799 784 447 92 --42049 1772 814 42 --
NM_025235chr101100 ------
NM_025237chr1741119 434 321 255 --31127 411 268 --
NM_025248chr17103194 3037 2937 2757 2260 2251 1245 1219 374 21 --22901 745 --
NM_025251chr891187 809 803 467 382 375 247 92 38 --11171 --
NM_025256chr6152 ------
NM_025257chr6----145 --
NM_025261chr6_qbl_hap2121 ------
NM_030629chr1691211 641 633 611 585 481 442 435 177 ----1622
NM_030634chr121534 716 ------
NM_030647chr725842 117 ------
NM_030648chr424573 1844 11993 ----
NM_030661chr731131 129 97 11324 ----
NM_030755chr1422478 437 ------
NM_030761chr172647 2447 2275 1705 680 670 251 --22371 2076 12552
NM_030762chr121498 ------
NM_030766chr121214 ------
NM_030780chr81531 --11726 134
NM_030792chr112659 575 ------
NM_030795chr8173 ------
NM_030798chr72613 31 ------
NM_030808chr174791 737 317 31 --1161 --
NM_030809chr1211939 ------
NM_030810chr6----2397 31 --
NM_030813chr114886 596 183 93 --1841 --
NM_030816chr112374 ------
NM_030881chr22----1194 --
NM_030913chr14294 265 94 86 139 ----
NM_030918chr165169 4441 3686 2033 1934 1862 --24154 3296 --
NM_030920chr11816 ------
NM_030923chr22205 178 --1140 --
NM_030935chr73146 56 37 --1349 --
NM_030937chr151450 476 347 82 61 --1927 --
NM_030957chr194584 522 400 210 ------
NM_030958chr81366 ------
NM_030963chr6----160 --
NM_030964chr562931 2845 2414 1451 746 376 --2781 119 --
NM_030981chr1171125 1105 1074 975 424 405 160 ----1374
NM_031205chr124367 333 272 141 ------
NM_031216chr1811669 ------
NM_031297chr9126 ------
NM_031309chr8102262 2036 2020 1998 853 762 622 436 348 143 --22099 149 --
NM_031369chr41628 ------
NM_031370chr41628 ------
NM_031407chrX2191 140 ------
NM_031411chr51318 ------
NM_031417chr1972214 963 744 715 520 222 173 2904 727 2438 67 --
NM_031432chr931092 767 71 --21097 35 1940
NM_031433chr114556 482 32 21 ------
NM_031439chr821520 174 --2102 74 --
NM_031442chrX2489 417 ------
NM_031444chr2272375 828 756 607 497 267 22 11701 62401 2253 1734 996 918 62 --
NM_031445chr242525 2087 837 774 ------
NM_031450chr112528 158 --126 --
NM_031468chr777350 5941 3136 2075 1956 1929 749 12951 16308 13061
NM_031475chr14672 632 200 51 1214 ----
NM_031477chr161250 ------
NM_031483chr2012213 ------
NM_031849chr51318 ------
NM_031857chr51318 ------
NM_031860chr51318 ------
NM_031890chr2272823 2639 2349 2151 1896 554 281 --1645 --
NM_031892chrX161 ------
NM_031934chr171235 --130 --
NM_031954chr1252770 2015 907 37 23 --1812 --
NM_032012chr9177 ------
NM_032017chr141847 1376 620 477 --11501 --
NM_032041chr842655 2131 184 109 ------
NM_032042chr54415 358 247 30 ------
NM_032051chr223473 466 111 --1102 --
NM_032052chr223506 248 168 ------
NM_032088chr551595 1460 1410 1254 155 --11317 --
NM_032092chr551595 1460 1410 1254 155 --11317 --
NM_032108chr194950 881 761 172 ------
NM_032109chr514590 584 470 419 412 397 236 211 197 116 94 52 40 23 ------
NM_032148chr121465 1435 ----
NM_032153chr342188 2140 1879 756 --2399 195 --
NM_032182chr1011093 ------
NM_032192chr173693 210 162 --1625 --
NM_032195chr211387 ------
NM_032217chr4----1176 --
NM_032231chr15--1313 ----
NM_032246chr15----1173 --
NM_032256chr121727 ------
NM_032268chr1652453 2309 2093 1075 477 --1386 --
NM_032271chr1641517 1295 148 97 --1194 --
NM_032281chr19112589 2516 2388 1236 1176 1142 1095 944 401 226 213 ------
NM_032283chr11743 --21294 711 --
NM_032294chr1751273 279 163 122 81 --1458 --
NM_032307chr91115 ------
NM_032316chr362457 2246 2163 619 289 40 --12259 --
NM_032320chr112562 499 ------
NM_032375chr199756 720 713 683 564 156 137 59 36 --2313 234 --
NM_032379chr111279 ------
NM_032403chr551595 1460 1410 1254 155 --11317 --
NM_032408chr721048 994 ----11004
NM_032420chr53743 597 591 1249 ----
NM_032429chr10----1415 1198
NM_032434chr2--1240 ----
NM_032440chr10----11070 --
NM_032441chrX--1318 ----
NM_032445chr1532106 623 146 ------
NM_032457chr41976 13840 ----
NM_032458chrX------1440
NM_032470chr6157 ------
NM_032484chr175572 476 215 122 48 --123 --
NM_032488chr19124 ------
NM_032499chr152120 93 ------
NM_032509chr811710 ----1956
NM_032510chr181998 --178 --
NM_032514chr204372 329 299 155 --4340 323 292 57 --
NM_032538chr6112160 2035 1968 1856 1758 1102 647 365 301 239 131 199 22773 266 --
NM_032552chr961669 682 520 440 273 136 --21605 1340 --
NM_032569chr163744 602 313 --1331 --
NM_032575chr16121633 1540 1464 1399 638 624 485 455 394 286 101 52 ------
NM_032580chr171203 ------
NM_032588chr11184 --1421 --
NM_032595chr1741225 1076 994 515 --21484 405 --
NM_032603chr21520 --1279 --
NM_032622chr421512 602 ------
NM_032638chr321067 137 --1208 --
NM_032682chr321280 410 1369 ----
NM_032687chr8132 ------
NM_032711chr17154190 4121 3988 3915 3818 3677 3399 3351 3096 1645 1362 1125 1076 240 64 --11674 --
NM_032741chr62789 175 ------
NM_032781chr112615 371 --137 --
NM_032784chr6156 ------
NM_032810chr1011107 ------
NM_032827chr251086 951 837 176 119 ------
NM_032836chr194695 656 400 25 ------
NM_032842chr72672 537 ------
NM_032875chr172560 269 ------
NM_032876chr141342 ------
NM_032883chr203882 336 271 --2227 190 --
NM_032900chr1033360 1555 1198 --21333 70 --
NM_032927chr4133 ------
NM_032943chr111279 ------
NM_032947chr52403 129 --2962 913 --
NM_032951chr74191 114 96 34 ------
NM_032953chr74191 114 96 34 ------
NM_032968chrX22656 731 ------
NM_032969chrX22656 731 ------
NM_032973chrY22651 731 ------
NM_032982chr771936 1675 831 678 435 141 98 ------
NM_032983chr782750 2489 2296 1249 955 912 541 177 --1533 1374
NM_033008chr31112 ----172
NM_033009chr31112 ----172
NM_033010chr31112 ----172
NM_033016chr2231521 1269 213 1542 1165 --
NM_033018chrX21007 447 --2741 124 1147
NM_033023chr73950 935 327 ------
NM_033027chr361120 1112 758 742 732 223 --1943 --
NM_033036chr114616 159 79 34 ------
NM_033046chr21255 --131 --
NM_033058chr81133 ------
NM_033081chr202428 393 ------
NM_033102chr1158 ----11044
NM_033102chr1158 ----11044
NM_033103chr1931130 919 873 ------
NM_033118chr203659 285 188 ------
NM_033129chr2091979 1651 826 748 498 449 81 67 25 --21537 106 --
NM_033136chr521466 328 ------
NM_033137chr521466 328 ------
NM_033181chr61576 ------
NM_033224chr766886 6836 6750 6628 1714 1675 ------
NM_033226chr161246 ------
NM_033256chr19122 ------
NM_033259chr36586 335 312 227 105 90 --2696 208 --
NM_033274chr563026 2632 2369 1310 1191 94 --33432 2323 524 --
NM_033285chr8----1895 --
NM_033290chrX22580 924 ------
NM_033315chr17122158 2114 2037 1880 1856 1769 1695 726 485 328 221 189 --4671 465 402 180 --
NM_033331chr913106 --1774 --
NM_033375chr1721075 584 21054 33 31449 522 141 --
NM_033380chrX1294 ------
NM_033381chrX1294 ------
NM_033387chr982597 2553 2449 2386 1792 617 464 279 --21700 1654 --
NM_033396chr112385 46 ------
NM_033419chr1761529 1441 1068 45 39 22 ------
NM_033420chr1971165 981 825 371 234 177 110 ------
NM_033421chr202778 337 --1621 --
NM_033448chr12124 ------
NM_033467chr1297 34 --1282 --
NM_033506chr7----1151 --
NM_033516chr911153 ----1225
NM_033518chrX2294 58 ----179
NM_033549chr51949 ------
NM_033624chr12----1199 --
NM_033631chr153725 2854 894 58 26 1442 ----
NM_033632chr4152 ------
NM_033637chr102470 30 --1110 --
NM_033644chr5------1492
NM_033645chr5------1492
NM_033656chr2115372 14082 ----
NM_052837chr1157 ------
NM_052840chr151591 ------
NM_052851chr1321908 842 ------
NM_052854chr113469 219 79 ----1575
NM_052865chr202864 337 ------
NM_052885chr12175 24511 886 ----
NM_052896chr172043 1773 930 159 104 97 43 --1487 --
NM_052897chr123698 674 208 ------
NM_052906chr2284701 4269 4248 3847 1403 1103 656 644 --64276 3584 1644 1143 1000 274 --
NM_052910chr1361734 1718 1384 1353 557 305 --11523 --
NM_052925chr194677 412 273 137 --1398 --
NM_052932chr11143 ------
NM_052934chr131686 751 304 ----1619
NM_052978chr1421187 330 --139 --
NM_052996chr1611438 11317 ----
NM_052998chr11147 ------
NM_053023chr1132359 722 418 12811 ----
NM_053024chr31170 1454 ----
NM_053025chr31339 ------
NM_053026chr31339 ------
NM_053027chr31339 ------
NM_053028chr31339 ------
NM_053031chr31339 ------
NM_053032chr31339 ------
NM_053280chr11--1199 ----
NM_054025chr112550 342 --1843 --
NM_054035chr171341 --1695 --
NM_058004chr22280 27 ------
NM_058240chr14193 --11515 1385
NM_058243chr191577 --1235 --
NM_078470chr102896 642 --1847 --
NM_078629chrX2141 112 ------
NM_078630chrX2141 112 ------
NM_079421chr19----193 --
NM_080491chr1131484 1402 599 11216 22416 198 --
NM_080594chr16123 ------
NM_080599chr10------11217
NM_080618chr203908 131 29 ------
NM_080629chr1--11087 ----
NM_080630chr1--11087 ----
NM_080645chr611339 ------
NM_080647chr225429 379 332 71 25 ------
NM_080654chr112239 86 ------
NM_080669chr1743935 3565 1555 1433 13165 ----
NM_080679chr62938 646 ------
NM_080680chr62938 646 ------
NM_080681chr62938 646 ------
NM_080738chr132056 1948 624 ------
NM_080744chr71495 --1177 --
NM_080759chr1312320 ------
NM_080760chr1312320 ------
NM_080829chr20--1247 2118 53 --
NM_080872chr813652 --180 --
NM_080881chr52522 99 --141 --
NM_100264chr10--156 ----
NM_100486chr10--156 ----
NM_130385chr1132662 275 203 --1100 12864
NM_130391chr923032 424 --12547 --
NM_130392chr923032 424 --12547 --
NM_130393chr923032 424 --12547 --
NM_130438chr211336 ------
NM_130442chr74723 374 186 92 ----1363
NM_130446chr351349 1147 960 627 50 ------
NM_130469chr141958 1308 ----
NM_130799chr116611 582 497 190 78 45 --1319 --
NM_130800chr116611 582 497 190 78 45 --1319 --
NM_130801chr116611 582 497 190 78 45 --1319 --
NM_130802chr116611 582 497 190 78 45 --1319 --
NM_130803chr116611 582 497 190 78 45 --1319 --
NM_130804chr116611 582 497 190 78 45 --1319 --
NM_133170chr2052230 2040 595 467 376 --36945 6087 640 27693 5263
NM_133171chr20----1213 --
NM_133264chr1763650 3091 2992 2944 2539 584 --1810 --
NM_133265chrX31343 1325 593 ------
NM_133266chr112280 108 ------
NM_133328chr192819 550 --1580 --
NM_133369chr58834 757 730 724 683 649 313 160 ------
NM_133372chr522094 1888 ------
NM_133378chr21627 1907 ----
NM_133432chr21627 1907 ----
NM_133437chr21627 1907 ----
NM_133445chr933663 2474 1048 1148 11473 --
NM_133446chr10--1233 ----
NM_133452chr191908 --21056 970 --
NM_133499chrX2889 356 1398 ----
NM_133642chr222188 141 ------
NM_133647chr1522545 909 12808 12758 --
NM_134325chr121221 286 ----1154
NM_138356chr154643 626 569 48 --1454 --
NM_138381chr321755 1550 --11833 --
NM_138385chr471273 1085 529 478 361 181 88 ----1888
NM_138395chr2--1306 ----
NM_138415chr2211319 --21829 403 --
NM_138426chr71487 ------
NM_138444chr134730 100 48 33 14812 1147 1837
NM_138457chr6183340 3138 3131 3110 2580 2489 2459 2188 1250 1235 1071 972 957 742 716 641 515 463 --11257 --
NM_138459chr6----1579 --
NM_138473chr1224743 4375 ------
NM_138479chr121740 1490 ------
NM_138576chr1423212 1274 ------
NM_138578chr2031393 1343 109 --2117 64 --
NM_138619chr1741627 1362 1306 47 ------
NM_138689chr11149 ------
NM_138693chr7----172 --
NM_138732chr113901 167 33 --2653 185 --
NM_138734chr113901 167 33 --2653 185 --
NM_138735chr21496 ------
NM_138736chr16154221 3975 3963 3956 3862 3744 3208 2827 1564 1489 1417 1291 971 240 47 --44115 3540 2648 772 --
NM_138783chr194165 54 40 22 --191 --
NM_138795chr151591 1238 561 309 287 --31348 1191 68 1589
NM_138799chr211400 ------
NM_138961chr111119 ------
NM_138969chr83901 510 299 ------
NM_138981chr41141 ------
NM_138992chr214961 299 139 66 --122 --
NM_139014chr62937 567 ------
NM_139057chr1592429 2383 2295 2283 2223 2177 2011 872 464 124 ----
NM_139067chr122250 131 ------
NM_139068chr51487 ------
NM_139069chr51487 ------
NM_139071chr1231486 1078 361 ------
NM_139132chr11134 ------
NM_139161chr191477 --2345 35 --
NM_139276chr1772194 2176 1871 1649 1550 315 45 ------
NM_139280chr17----124 --
NM_139316chr71350 --1406 --
NM_144571chr424299 811 ----12656
NM_144582chr252226 1938 1872 1727 104 --12021 --
NM_144583chr231728 1689 1644 11756 ----
NM_144593chr12136 ------
NM_144617chr194869 636 132 21 --175 --
NM_144628chr2073009 2732 2657 2326 1986 328 128 --23020 2340 --
NM_144631chr21213 --1250 --
NM_144635chr341057 514 487 201 167 ----
NM_144667chr1241028 982 457 280 --1116 --
NM_144685chr191271 --121 --
NM_144723chr51598 --1242 --
NM_144726chr51288 ------
NM_144949chr21813 21920 860 ----
NM_144967chrX--1229 ----
NM_144973chr1221863 1652 ------
NM_145008chr11188 ------
NM_145021chr101336 --1270 --
NM_145047chr1126 ------
NM_145065chr1151154 1107 450 415 30 --138 --
NM_145071chr32710 307 --2938 21 --
NM_145112chr142408 382 --2388 330 --
NM_145113chr14--1119 1602 --
NM_145159chr142877 703 --2857 694 --
NM_145176chr61334 --22156 487 --
NM_145185chr1981971 1536 801 404 387 182 160 144 --11774 --
NM_145201chr82243 85 --1237 --
NM_145204chr15145 ------
NM_145234chrX2701 666 ------
NM_145245chr1951234 1197 1106 1021 53 --11124 --
NM_145251chr1411273 ------
NM_145253chr163640 537 530 --2295 178 --
NM_145259chr236024 1965 128 ------
NM_145307chr1021467 1269 ------
NM_145313chr101492 --11309 --
NM_145349chr176740 599 440 347 168 104 --159 --
NM_145351chr1791091 932 839 660 596 460 421 211 202 --1551 --
NM_145716chr1--1520 ----
NM_145725chr14186 ------
NM_145726chr14186 ------
NM_145730chr223869 718 34 ------
NM_145733chr2251082 980 944 293 87 ------
NM_145861chr132056 1948 624 ------
NM_145868chr101113 --128 --
NM_145869chr101113 --128 --
NM_145891chr1611191 ------
NM_145892chr1611191 ------
NM_145893chr1611313 ------
NM_145912chr22154073 3703 3587 1649 1555 1442 1436 1401 1383 1179 956 424 311 214 161 --33650 3340 1855 --
NM_145913chr121721 ------
NM_146388chr1941141 1006 874 858 187 1932 --
NM_147127chr4158 ------
NM_147161chr141168 279 124 27 --1460 --
NM_147181chr411335 ------
NM_147182chr411335 ------
NM_147183chr411335 ------
NM_147192chr15622 559 422 408 332 ------
NM_147193chr1152 --125 --
NM_147202chr941722 761 281 92 ----1563
NM_147204chr121365 --132 --
NM_147223chr22556 47 --2620 582 --
NM_148174chr811603 ------
NM_148898chr71291 ------
NM_148899chr71291 ------
NM_148961chr2--1119 126 --
NM_152221chr223312 294 224 ------
NM_152237chr2261415 1274 492 478 456 233 --2537 366 --
NM_152245chr223438 99 24 ------
NM_152253chr2294307 4053 3978 3878 3572 3299 2698 1412 811 --193 --
NM_152263chr165795 5644 5598 2427 979 34 ------
NM_152264chr1161003 960 897 417 271 27 --2823 404 --
NM_152271chr811054 1434 1833 --
NM_152274chrX------123
NM_152287chr162428 105 --1500 --
NM_152296chr194255 56 37 22 ------
NM_152342chr163214 73 40 ------
NM_152344chr172947 305 ------
NM_152380chr121298 1221 ------
NM_152384chr2211694 1665 1657 1628 1530 1518 1489 1481 1452 1404 1360 1343 1314 1277 1265 785 718 688 318 303 219 --71617 1580 1568 1536 1441 1393 1307 --
NM_152388chr243598 3337 2883 1046 ------
NM_152390chr21703 ------
NM_152410chr61356 ------
NM_152420chr91537 ------
NM_152424chrX84212 3908 3714 3336 3181 1649 1235 482 --1204 --
NM_152441chr123644 582 58 --1132 --
NM_152470chr1863614 3400 2888 2770 250 216 13526 ----
NM_152499chr1162 --1325 --
NM_152538chr311219 --1302 --
NM_152570chr91104 ------
NM_152572chr9126 ------
NM_152594chr1512325 ------
NM_152600chr195293 164 146 101 27 ------
NM_152622chr523145 322 ------
NM_152667chr2031129 1084 963 ------
NM_152686chr512333 --1484 12111
NM_152694chrX----1189 --
NM_152695chrX--12020 ----
NM_152699chr353380 2929 2721 2663 2339 --13059 --
NM_152704chr132122 115 ------
NM_152722chr1131458 1175 30 --11187 --
NM_152731chr6--1780 ----
NM_152733chr6155640 5571 5349 5059 4759 4093 2473 2417 2039 1736 1184 1155 921 101 89 16359 55891 2074 1960 1740 967 --
NM_152734chr654763 4595 298 174 117 ------
NM_152739chr7274 63 ------
NM_152745chr7----1171 --
NM_152753chr611897 11871 1297 11288
NM_152758chr81170 ------
NM_152769chr192665 122 --1128 1642
NM_152787chrX21582 421 ------
NM_152835chr142404 1955 1025 571 ------
NM_152860chr1231029 611 34 ------
NM_152868chr22----129 --
NM_152924chr1546614 4417 4400 557 ------
NM_152996chr112041 ------
NM_153000chr18----1199 --
NM_153029chr16174127 4099 4061 3637 3570 3547 3380 3260 2950 2772 2755 2626 802 733 722 481 30 11156 13648 --
NM_153035chr112937 --1402 --
NM_153047chr6142 --1103 --
NM_153048chr6142 --1103 --
NM_153208chr162359 26 --1814 --
NM_153235chr61420 11995 ----
NM_153262chr1----13041 --
NM_153273chr382774 2750 2438 2132 1111 1034 441 399 --1902 12666
NM_153334chr224633 558 538 157 --151 --
NM_153341chr11133 ------
NM_153342chr22444 147 ------
NM_153347chr11----11074 --
NM_153350chr16111274 1087 694 414 396 327 283 220 190 176 84 11544 --11138
NM_153367chr10103970 3801 3782 3768 3501 1582 548 410 190 89 ------
NM_153371chr133707 623 551 ------
NM_153487chr6134856 4598 4476 4375 4097 3788 3722 3673 3576 3240 3068 566 94 11860 24309 1773 --
NM_153499chr1262681 2545 2427 2280 1081 39 ------
NM_153500chr1262681 2545 2427 2280 1081 39 ------
NM_153616chr151638 ------
NM_153617chr151638 ------
NM_153618chr151638 ------
NM_153619chr1521157 1023 --1130 --
NM_153631chr731131 129 97 11324 ----
NM_153632chr731131 129 97 11324 ----
NM_153633chr122188 22 ------
NM_153675chr201186 ------
NM_153685chr1241060 319 174 118 --2325 311 --
NM_153693chr122532 519 --1262 --
NM_153695chr9----140 --
NM_153715chr7----2356 73 --
NM_153756chr121741 1493 11801 ----
NM_153809chr9----1565 --
NM_153832chr12488 67 ------
NM_170606chr71381 ------
NM_170662chr31495 ------
NM_170674chr15--1321 ----
NM_170677chr15--1321 ----
NM_170695chr181367 ------
NM_170696chr1531621 1225 402 ------
NM_170697chr1531621 1225 402 ------
NM_170706chr12353 314 --14018 --
NM_170726chr1----240 24 --
NM_170731chr11----21869 786 --
NM_170732chr11----21869 786 --
NM_170733chr11----21869 786 --
NM_170734chr11----21869 786 --
NM_170735chr11----21869 786 --
NM_170739chr11--1184 --1106
NM_170768chr11131 ------
NM_170782chr1----1500 --
NM_171825chr572930 2362 2016 1256 400 347 303 --32760 1988 672 --
NM_172020chr751249 781 755 383 293 11297 ----
NM_172057chr72258 60 ------
NM_172058chr81108 ------
NM_172059chr81108 ------
NM_172060chr81108 ------
NM_172070chr21837 ------
NM_172071chr167286 6370 4969 2351 2233 1624 ------
NM_172078chr7154 ------
NM_172079chr7154 ------
NM_172080chr7154 ------
NM_172081chr7154 ------
NM_172082chr7154 ------
NM_172083chr7154 ------
NM_172084chr7154 ------
NM_172127chr41110 ------
NM_172128chr4166 ------
NM_172169chr1021662 528 --1171 --
NM_172170chr1021662 528 --1171 --
NM_172171chr1021662 528 --1171 --
NM_172173chr1021662 528 --1171 --
NM_172206chr1751273 279 163 122 81 --1458 --
NM_172208chr63917 469 366 ------
NM_172211chr16869 841 729 669 107 64 --1848 --
NM_172216chr1252583 2447 2329 2182 983 ------
NM_172225chr15622 559 422 408 332 ------
NM_172226chr1262681 2545 2427 2280 1081 39 ------
NM_172315chr15--1321 ----
NM_172316chr15--1321 ----
NM_172349chr52102 35 ------
NM_172375chr142758 186 ------
NM_173156chr151689 1651 1491 278 206 ------
NM_173171chr21111 ----1902
NM_173172chr23419 157 36 ----11210
NM_173173chr21111 ----1902
NM_173207chr181367 ------
NM_173208chr181367 ------
NM_173209chr181367 ------
NM_173210chr181367 ------
NM_173211chr181367 ------
NM_173454chr151438 ----1841
NM_173470chrX21890 81 ------
NM_173475chr16143 ------
NM_173496chr1022292 258 ------
NM_173505chr182117 108 ------
NM_173515chr62143 38 ------
NM_173552chr312340 ------
NM_173561chr63967 484 95 162 1136 --
NM_173595chr12145065 4987 4327 4273 4199 4044 1996 1535 1515 1075 819 711 698 372 --33733 3338 912 --
NM_173602chr1223301 1281 ------
NM_173609chr15----1688 1700
NM_173681chr791918 1800 1747 1441 814 800 725 651 67 ------
NM_173683chr811406 --11555 --
NM_173808chr111063 ----13092
NM_173833chr82275 211 --1110 --
NM_174886chr181367 ------
NM_174890chr10129 ------
NM_174934chr1163524 1445 1177 1015 840 581 --2161 152 --
NM_174955chr1751012 121 60 51 26 ------
NM_174963chr15900 717 708 661 238 ------
NM_174964chr15900 717 708 661 238 ------
NM_174965chr15919 736 727 680 257 ------
NM_174966chr15900 717 708 661 238 ------
NM_174967chr15919 736 727 680 257 ------
NM_174968chr15900 717 708 661 238 ------
NM_174969chr15900 717 708 661 238 ------
NM_174970chr15919 736 727 680 257 ------
NM_174971chr15900 717 708 661 238 ------
NM_175061chr711641 --11425 --
NM_175575chr1741240 1224 1205 22 ------
NM_175607chr3------1692
NM_175612chr3------1692
NM_175634chr821180 891 ------
NM_175635chr821180 891 ------
NM_175636chr821180 891 ------
NM_175709chr2292696 2582 2332 1985 1099 639 605 263 155 ------
NM_175736chr12177128 6350 6031 5721 5320 5251 2637 2532 2454 2403 1805 1667 1289 1121 773 540 118 11312 1555 --
NM_175747chr61922 ------
NM_175863chr61120 ------
NM_175866chr1--1143 ----
NM_175898chr1581464 1256 1077 582 511 404 92 36 --41412 591 413 350 1118
NM_175900chr1641514 1353 1172 90 --1666 --
NM_175902chr172263 256 ------
NM_175907chr1822264 918 --22381 1768 --
NM_175931chr1651414 1386 1303 159 117 --31636 1542 329 --
NM_176783chr14----1320 --
NM_176801chr44696 547 316 218 --1468 1288
NM_176871chr852972 2724 2609 1184 330 --132 --
NM_177398chr111449 ------
NM_177399chr111449 ------
NM_177414chr121365 421 --1585 --
NM_177524chr7--179 ----
NM_177525chr7--179 ----
NM_177539chr13789 182 34 --1680 --
NM_177559chr2021012 390 ------
NM_177560chr2021012 390 ------
NM_177977chr1791976 1911 1885 1629 1377 1351 276 259 40 --21772 460 --
NM_177983chr21348 --2135 22 --
NM_177999chr9123593 3247 3099 3034 2831 1493 1002 766 503 419 326 68 --1157 --
NM_178006chr1321908 842 ------
NM_178007chr1321908 842 ------
NM_178011chr101495 ------
NM_178014chr63993 259 59 1162 ----
NM_178126chr1752224 846 800 471 188 ------
NM_178127chr11------1522
NM_178135chr431187 1041 934 ------
NM_178138chr93857 776 44 ------
NM_178151chrX56796 6054 5493 5213 329 --15164 --
NM_178152chrX56796 6054 5493 5213 329 --15164 --
NM_178153chrX56796 6054 5493 5213 329 --15164 --
NM_178229chr13352 318 205 ------
NM_178313chr232032 376 170 ------
NM_178426chr11857 ------
NM_178450chr51526 ------
NM_178493chr175166 151 143 117 53 --1137 --
NM_178500chr172642 170 ------
NM_178502chr123551 84 77 ------
NM_178539chr12--1116 ----
NM_178554chr353477 2284 1043 896 356 1405 11248 --
NM_178562chr71615 ------
NM_178565chr81254 --1106 --
NM_178580chr20241 24 ------
NM_178835chr45707 266 188 71 45 ------
NM_178841chr166716 407 387 198 50 22 --1393 --
NM_178860chr175920 370 201 170 160 ------
NM_178863chr161390 --1452 --
NM_178864chr112475 61 --1646 --
NM_180989chr13------1925
NM_181332chrX2479 33 --143 --
NM_181358chr123583 270 ------
NM_181491chr962250 2006 1953 1183 965 782 --33134 2575 901 --
NM_181504chr532699 1540 543 --13732 12669
NM_181505chr173693 210 162 --1625 --
NM_181509chr204372 329 299 155 --4340 323 292 57 --
NM_181521chr1642447 825 256 31 12014 1231 --
NM_181523chr532699 1540 543 --13732 12669
NM_181524chr532699 1540 543 --13732 12669
NM_181670chr122294 81 ------
NM_181671chr172213 117 ------
NM_181672chrX11886 ------
NM_181673chrX11886 ------
NM_181674chr51279 ------
NM_181675chr51279 ------
NM_181676chr51279 ------
NM_181677chr51279 ------
NM_181678chr51279 ------
NM_181701chr95939 464 407 365 53 --11575 --
NM_181741chr21126 ------
NM_181742chr21126 ------
NM_181784chr241696 659 341 80 --1194 --
NM_181828chr2242914 2867 1223 861 1350 53293 3071 591 473 400 --
NM_181829chr2242914 2867 1223 861 1350 53293 3071 591 473 400 --
NM_181830chr2242914 2867 1223 861 1350 53293 3071 591 473 400 --
NM_181832chr2242929 2882 1238 876 1365 53308 3086 606 488 415 --
NM_181839chr81526 ------
NM_181843chr112295 253 ------
NM_181876chr441074 804 524 164 ------
NM_181886chr4--1239 ----
NM_181887chr4--1239 ----
NM_181888chr4--1239 ----
NM_181889chr4--1239 ----
NM_181890chr4--1239 ----
NM_181891chr4--1239 ----
NM_181892chr4--1286 ----
NM_181893chr4--1239 ----
NM_182485chr41382 ----12725
NM_182488chr131720 ------
NM_182507chr1232292 706 205 1366 ----
NM_182509chr1441647 572 394 64 21173 307 3579 244 57 --
NM_182511chr18155 --11171 --
NM_182527chr2242076 1485 65 49 --1432 --
NM_182540chrX2634 275 ------
NM_182553chr114500 454 168 65 ------
NM_182557chr1182031 1983 1898 1723 1658 1461 1395 239 --1464 --
NM_182580chr122309 650 ------
NM_182616chr151308 ------
NM_182641chr171431 11717 ----
NM_182646chr41382 ----12725
NM_182685chr11637 ------
NM_182728chr1451519 1260 692 515 503 --21510 233 --
NM_182763chr112098 --12108 --
NM_182764chr20----1213 --
NM_182811chr2011167 --11126 --
NM_182895chr224633 558 538 157 --151 --
NM_182910chr14154 1628 ----
NM_182913chr14154 1628 ----
NM_182914chr14154 1628 ----
NM_182917chr33338 288 61 ------
NM_182920chr311236 --11306 --
NM_182936chr14193 --11515 1385
NM_182948chr122157 77 --12914 --
NM_182970chr2083975 1515 1052 609 591 549 451 138 --34215 2888 356 --
NM_182972chr121901 1106 ------
NM_183002chr14193 --11515 1385
NM_183006chr2061555 1428 1229 1141 969 430 --11167 --
NM_183049chr41126 ------
NM_183243chr77600 572 557 525 477 212 160 ------
NM_183243chr77600 572 557 525 477 212 160 ------
NM_183373chr63274 91 26 --1847 --
NM_183377chr171650 1167 1538 --
NM_183393chr31104 ------
NM_183394chr31104 ------
NM_183397chr2064990 4754 4726 4057 1614 214 12049 24268 3239 --
NM_183425chr20101399 1208 686 447 434 314 162 121 83 60 --11079 --
NM_184041chr16372 44 23 ------
NM_184043chr16372 44 23 ------
NM_184085chr8121 ------
NM_184086chr8121 ------
NM_184087chr8121 ------
NM_194247chr233637 3355 901 --13086 --
NM_194248chr29953 896 804 391 382 364 351 303 224 --1687 --
NM_194272chr154834 250 108 80 --1692 1303
NM_194278chr1492859 2690 2643 1357 922 780 748 521 102 --1412 --
NM_194282chr411183 ------
NM_194285chr1131032 399 212 ------
NM_194314chr112169 ------
NM_194322chr29953 896 804 391 382 364 351 303 224 --1687 --
NM_194323chr29755 698 606 193 184 166 153 105 26 ------
NM_194328chr912594 13301 ----
NM_194329chr912594 13301 ----
NM_194330chr912594 13301 ----
NM_194332chr912594 13301 ----
NM_197941chr51956 ------
NM_198040chr13906 822 282 --1911 --
NM_198056chr321913 1520 --1502 --
NM_198057chrX11149 ------
NM_198074chr12485 448 ------
NM_198086chr141342 ------
NM_198158chr312342 ------
NM_198159chr312342 ------
NM_198177chr312342 ------
NM_198178chr312342 ------
NM_198236chr13709 334 286 ------
NM_198241chr33338 288 61 ------
NM_198242chr33338 288 61 ------
NM_198244chr33338 288 61 ------
NM_198268chr123583 270 ------
NM_198269chr123583 270 ------
NM_198291chr2071574 1543 1448 1290 610 467 451 1704 21757 354 --
NM_198324chr122413 217 ------
NM_198336chr72483 117 1288 1155 --
NM_198390chr1691211 641 633 611 585 481 442 435 177 ----1622
NM_198391chr2011486 --11132 --
NM_198400chr1511948 ------
NM_198504chr3133 ------
NM_198521chr12----135 --
NM_198527chr151495 ------
NM_198560chr371489 1434 1159 968 814 373 58 ------
NM_198563chr33144 130 93 1190 ----
NM_198573chr91110 ------
NM_198595chr4124925 4811 4413 3795 3427 1901 1391 1032 980 537 463 413 --185 --
NM_198681chr141445 1327 332 138 --41338 995 286 210 11258
NM_198686chr1452417 1675 917 869 591 --21669 340 --
NM_198700chr11--1104 ----
NM_198793chr321642 372 1219 ----
NM_198794chr141925 ------
NM_198834chr1751678 869 381 324 26 ------
NM_198836chr1751678 869 381 324 26 ------
NM_198837chr1751678 869 381 324 26 ------
NM_198838chr1751678 869 381 324 26 ------
NM_198839chr1751678 869 381 324 26 ------
NM_198843chr24978 498 462 34 --21089 1060 --
NM_198850chr191220 --179 --
NM_198867chr194318 174 146 28 --2123 90 1159
NM_198889chr4----1176 --
NM_198900chr12177128 6350 6031 5721 5320 5251 2637 2532 2454 2403 1805 1667 1289 1121 773 540 118 11312 1555 --
NM_198902chr151147 ------
NM_198904chr521346 162 1836 ----
NM_198993chr1761676 1617 1576 1186 273 36 --1364 --
NM_198995chr181421 ------
NM_199000chr7--12236 ----
NM_199054chr19101713 1558 1468 797 755 433 340 294 95 37 --41700 1597 1542 352 --
NM_199138chr132122 115 ------
NM_199144chr202588 396 ------
NM_199160chr931661 1281 57 --2562 70 --
NM_199169chr2033355 3076 2572 ------
NM_199170chr2033355 3076 2572 ------
NM_199171chr2033355 3076 2572 ------
NM_199181chr201232 ------
NM_199191chr22309 84 ------
NM_199194chr22309 84 ------
NM_199203chr202588 396 ------
NM_199245chr1292197 2001 1946 1869 1629 999 782 501 462 --1752 12032
NM_199330chr153585 578 571 --2140 27 --
NM_199331chr153585 578 571 --2140 27 --
NM_199332chr153585 578 571 --2140 27 --
NM_199334chr17----1155 --
NM_199368chr206639 615 483 229 107 72 ------
NM_199424chr1621751 1581 ------
NM_199427chr202117 54 ------
NM_199454chr1134337 3690 3614 3600 3140 3065 1831 1604 1298 1107 1022 820 792 11776 24178 3376 23624 256
NM_199478chrX--1536 ----
NM_199487chr202878 164 ------
NM_201267chr2185 ------
NM_201378chr851001 758 321 207 23 ------
NM_201379chr851001 758 321 207 23 ------
NM_201380chr851001 758 321 207 23 ------
NM_201381chr851001 758 321 207 23 ------
NM_201382chr851001 758 321 207 23 ------
NM_201383chr851001 758 321 207 23 ------
NM_201384chr851001 758 321 207 23 ------
NM_201432chr1796481 4522 4418 4181 1196 941 767 259 209 1849 1967 --
NM_201433chr1796481 4522 4418 4181 1196 941 767 259 209 1849 1967 --
NM_201434chr175598 530 39 30 24 ------
NM_201441chr12--1160 ----
NM_201443chr12--1160 ----
NM_201520chr17101680 1415 1374 1312 1200 1117 728 561 510 169 --31232 493 464 --
NM_201521chr62346 138 ------
NM_201522chr62346 138 ------
NM_201523chr62346 138 ------
NM_201567chr311387 --1218 --
NM_201568chr151689 1651 1491 278 206 ------
NM_201569chr151689 1651 1491 278 206 ------
NM_201570chr101703 ------
NM_201571chr101703 ------
NM_201572chr101703 ------
NM_201590chr101703 ------
NM_201593chr101703 ------
NM_201596chr101703 ------
NM_201597chr101703 ------
NM_201599chrX31207 429 421 --1125 --
NM_201627chr51345 ------
NM_201632chr531180 242 53 ------
NM_201634chr551279 341 152 106 67 ------
NM_201995chr11------1116
NM_202467chr191152 ------
NM_202468chr191152 ------
NM_202469chr191152 ------
NM_202470chr191152 ------
NM_202494chr191152 ------
NM_203301chr1411361 ------
NM_203304chr191170 ------
NM_203305chr942153 1818 1731 966 --2983 900 --
NM_203307chr1931455 1249 647 11204 ----
NM_203327chr2044095 3962 571 182 --14031 --
NM_203342chr143605 2778 1385 31 11340 22925 314 --
NM_203343chr143605 2778 1385 31 11340 22925 314 --
NM_203374chr192675 195 ------
NM_203394chr122827 82 ------
NM_203399chr11582 ------
NM_203401chr11582 ------
NM_203406chr532471 2351 302 ------
NM_203413chr1731033 999 118 ------
NM_203417chr21----1426 --
NM_203418chr21----1426 --
NM_203434chr941037 461 321 217 ------
NM_203437chr2--1902 ----
NM_203473chrX1274 ------
NM_203474chrX1274 ------
NM_203475chrX1274 ------
NM_203476chrX1274 ------
NM_203504chr42764 284 ------
NM_203505chr42764 284 ------
NM_205848chr12233 96 ------
NM_205860chr133196 2502 519 ------
NM_205861chr171967 1913 1758 1435 867 508 33 ------
NM_206900chr19132 ------
NM_206901chr19132 ------
NM_206907chr52699 604 ------
NM_206914chr122280 39 ------
NM_206927chr111279 ------
NM_206928chr111279 ------
NM_206929chr111279 ------
NM_206930chr111279 ------
NM_207042chr1276 48 ------
NM_207045chr1276 48 ------
NM_207046chr1276 48 ------
NM_207111chr772521 2466 2032 1822 1719 908 235 ----1638
NM_207113chr741133 1099 275 67 ------
NM_207116chr772521 2466 2032 1822 1719 908 235 ----1638
NM_207306chr134542 4368 241 --23665 228 --
NM_207336chr7396 65 32 ------
NM_207351chr3242 34 ------
NM_207366chr71427 ------
NM_207371chr1011110 ------
NM_207380chr1573611 3232 2676 1286 933 811 187 1467 1297 11381
NM_207381chr1511274 ------
NM_207396chr151556 1442 479 432 129 --1638 --
NM_207406chr414004 --35536 5303 362 --
NM_207442chr1421015 649 --1364 1302
NM_207577chr1162557 2219 2206 1034 948 582 12159 ----
NM_212460chr7195 1143 ----
NM_212464chr1531838 762 310 ------
NM_213606chr1011786 ----1627
NM_213613chr4111135 1111 953 874 864 393 385 376 299 263 128 --1882 --
NM_213648chr531180 242 53 ------
NM_213651chr11261 ------
NM_213662chr1772288 2270 1965 1743 1644 409 139 ------