TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-124-3p
miRNA Sequence: UAAGGCACGCGGUGAAUGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51862 1110 ----
NM_000016chr11727 1616 ----
NM_000038chr551967 1308 804 516 166 2522 300 11815 --
NM_000044chrX3327 282 54 --194 --
NM_000051chr1172423 1352 1268 1085 1029 751 197 ------
NM_000052chrX73079 2942 2617 2164 1148 608 390 23272 2485 1586 23108 528
NM_000055chr31321 ------
NM_000074chrX----1355 --
NM_000081chr141544 616 530 499 21408 1163 ----
NM_000084chrX156717 6522 5406 5277 4770 4584 2688 2332 2320 1897 1316 1294 620 449 272 26952 2203 --1943
NM_000090chr22861 199 ------
NM_000093chr92620 559 --1538 --
NM_000109chrX12123 22657 2633 --1418
NM_000112chr5125187 5066 4904 4212 3554 3467 2134 1472 1336 1087 758 683 34268 1587 1569 35365 4080 3430 --
NM_000125chr684187 4044 3934 3827 3777 3205 2708 179 ----1917
NM_000129chr62164 87 ------
NM_000133chrX1120 --11105 --
NM_000138chr1532095 1842 678 --1327 --
NM_000141chr1051341 1238 1031 585 304 1981 ----
NM_000163chr532327 1616 133 1260 ----
NM_000165chr621495 1260 ------
NM_000168chr7103303 2988 2703 2384 2369 2288 2282 1225 403 199 --1715 12873
NM_000170chr91199 ------
NM_000176chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_000183chr21402 ------
NM_000192chr1221593 393 --11354 11552
NM_000210chr242240 1607 433 228 1663 ----
NM_000214chr2011579 11315 1432 --
NM_000217chr1275196 4094 3249 1758 1692 1270 341 --11657 --
NM_000222chr451976 1850 1578 1555 128 ------
NM_000227chr181289 ------
NM_000228chr1279 48 ------
NM_000240chrX32172 1861 1584 --12235 --
NM_000245chr722117 1427 ------
NM_000248chr31840 2491 123 ----
NM_000252chrX21066 401 --1144 --
NM_000253chr4----1768 --
NM_000254chr14638 316 180 21 12351 --167
NM_000259chr15106338 5619 5449 5208 4157 4002 2107 2018 1315 650 24904 2175 45852 4671 4277 300 --
NM_000264chr953005 2448 879 828 669 ------
NM_000267chr1753133 2746 1111 372 186 12965 ----
NM_000271chr182655 34 ------
NM_000275chr152431 104 ------
NM_000280chr112894 685 --1639 --
NM_000304chr1741072 973 815 232 ------
NM_000314chr1033007 2903 2079 ------
NM_000319chr1221097 280 ------
NM_000321chr1341718 618 598 348 11711 --1282
NM_000325chr41190 ------
NM_000332chr6127063 7001 6331 4617 4472 2766 1236 990 737 281 190 176 ----12021
NM_000333chr32234 89 ------
NM_000334chr17102213 1964 1728 1663 1576 1485 1371 641 108 63 1462 ----
NM_000335chr352028 1864 839 429 191 ------
NM_000337chr556506 4813 2256 1402 137 24524 1410 11210 --
NM_000340chr321490 1231 21412 1159 ----
NM_000345chr41179 1892 1378 --
NM_000346chr1741867 1681 1360 607 21505 736 ----
NM_000353chr161141 ------
NM_000362chr22113589 3379 3145 2996 1373 1289 814 776 571 561 95 ------
NM_000368chr944644 526 488 373 13825 11903 --
NM_000369chr1441854 1765 1271 580 ------
NM_000376chr1253054 2650 2607 1186 24 13199 11147 1805
NM_000378chr114414 166 144 57 ------
NM_000379chr241606 1515 345 37 11276 1413 --
NM_000386chr173514 314 285 ----1160
NM_000389chr621300 1258 171 11467 191
NM_000390chrX33347 2945 518 ------
NM_000391chr1161685 1662 1604 1540 1493 522 2444 207 ----
NM_000393chr241398 1348 535 145 1607 ----
NM_000397chrX42414 2215 692 549 ------
NM_000399chr1011013 2913 293 1864 --
NM_000408chr273089 2717 2632 2439 2142 1274 108 --13180 --
NM_000411chr2111213 --22369 2027 --
NM_000417chr1031311 906 116 ------
NM_000424chr122357 24 ------
NM_000428chr1432474 2347 131 ------
NM_000430chr1742643 711 457 370 11248 12555 --
NM_000437chr142096 1646 1506 696 ------
NM_000439chr562326 2222 1720 659 422 68 ------
NM_000447chr12429 398 ------
NM_000448chr1112660 1933 32888 1162 432 --
NM_000450chr131878 623 118 ------
NM_000459chr92926 586 ------
NM_000461chr334335 1615 1570 11478 ----
NM_000462chr1551818 1684 1557 521 163 --21429 738 --
NM_000474chr71623 ------
NM_000480chr1121200 287 1420 ----
NM_000484chr21--1381 11067 --
NM_000486chr1263096 2846 2227 1988 1005 365 --12484 --
NM_000489chrX53409 2887 2425 2405 315 1528 ----
NM_000495chrX4936 776 450 72 ------
NM_000503chr841234 445 256 146 ------
NM_000522chr731226 1008 58 ------
NM_000523chr221145 741 ------
NM_000525chr1151582 1488 1029 399 374 ------
NM_000527chr1941757 1612 1547 694 12472 1527 --
NM_000533chrX31243 402 88 ------
NM_000539chr351473 594 363 333 299 ------
NM_000555chrX137635 5898 5711 5687 4821 2936 2558 2048 1506 1423 1335 859 298 17019 197 --
NM_000565chr112142 11554 11790 1488
NM_000590chr51130 ------
NM_000594chr62747 558 --1634 --
NM_000599chr254601 3242 3210 2810 1851 ------
NM_000601chr72333 43 ------
NM_000609chr1032254 869 760 1258 2795 270 13047
NM_000610chr1152835 2542 1918 441 195 11122 11111 --
NM_000611chr11116584 5849 5560 4684 2433 1965 1918 1282 797 703 618 26802 2779 36689 6128 1492 --
NM_000615chr1162630 2499 2121 969 785 150 1846 1143 --
NM_000618chr1286122 5855 5154 5092 1269 1063 464 168 16399 ----
NM_000618chr1286122 5855 5154 5092 1269 1063 464 168 16399 ----
NM_000619chr121482 ----1400
NM_000620chr1262132 1874 1670 541 442 209 --11599 --
NM_000633chr1854935 4485 954 355 291 11806 13856 --
NM_000635chr1931670 1562 92 ------
NM_000676chr171216 ------
NM_000679chr51152 ------
NM_000686chrX21242 43 1613 ----
NM_000693chr1551592 1426 1292 662 343 ------
NM_000698chr101336 ------
NM_000702chr121907 1507 11874 ----
NM_000719chr1266412 5897 4194 2578 787 71 --21763 350 --
NM_000721chr162304 2285 2229 2139 2106 797 1184 ----
NM_000723chr1741494 1065 562 122 11717 ----
NM_000724chr1031706 1503 111 2677 496 ----
NM_000726chr221489 1075 11329 ----
NM_000735chr6122 ------
NM_000747chr172880 668 --2613 166 --
NM_000780chr831125 1050 136 1514 ----
NM_000792chr1----1970 --
NM_000793chr14115112 5055 5029 4056 3855 3555 3508 3424 3386 399 318 --13290 --
NM_000806chr531859 503 485 3694 97 83 ----
NM_000809chr499036 8146 7838 6207 5741 2523 1792 1536 51 16469 23303 1178 --
NM_000810chr152495 148 ------
NM_000811chr51281 ------
NM_000813chr575457 2170 1661 1628 1562 846 625 23782 979 11379 --
NM_000814chr1543024 1194 639 361 12666 23825 405 --
NM_000816chr51632 ------
NM_000817chr221029 37 ------
NM_000824chr4------1803
NM_000826chr412552 --11687 1194
NM_000827chr552145 1977 1847 626 286 --12274 1361
NM_000828chrX31540 716 228 --1814 1173
NM_000829chr1172330 2312 2270 2171 588 423 369 ----127
NM_000838chr642753 1754 1690 763 21979 157 11795 --
NM_000839chr31336 ------
NM_000841chr64876 826 368 91 --1793 --
NM_000844chr31897 2336 163 ----
NM_000860chr451577 1299 1063 304 277 ------
NM_000868chrX31797 900 508 22571 2501 ----
NM_000875chr15137036 6618 6284 5883 4914 4829 2823 2380 2199 1959 1733 1455 1371 --14540 --
NM_000876chr62951 98 1327 ----
NM_000891chr1753612 3436 1416 1393 786 23683 374 1902 --
NM_000899chr1253795 3770 1401 702 313 --21745 1271 --
NM_000901chr442534 2305 1958 639 21977 30 1961 --
NM_000909chr451335 1173 950 147 132 --1239 --
NM_000912chr822791 385 12547 13539 --
NM_000917chr102397 46 1386 --1841
NM_000919chr51207 1571 ----
NM_000922chr113441 393 294 --1432 --
NM_000924chr1221084 921 --1854 --
NM_000933chr2011521 2671 328 ----
NM_000935chr341054 1010 810 251 ------
NM_000937chr172380 120 ------
NM_000938chr41133 --145 --
NM_000944chr441725 1686 662 231 --11601 --
NM_000945chr231852 1551 36 --1537 --
NM_000950chrX93313 3126 3120 2957 2756 2366 2237 1004 887 2979 328 ----
NM_000958chr51412 1394 ----
NM_000960chr194767 604 496 36 ------
NM_000963chr132443 1568 639 11782 ----
NM_000965chr331246 475 392 --1381 --
NM_000966chr122352 155 --1753 --
NM_000983chr141580 1064 1043 338 --11001 --
NM_001001132chr2121155 133 --1319 --
NM_001001323chr1262885 2074 1936 1197 961 385 13184 22514 476 --
NM_001001331chr332171 1725 740 ------
NM_001001342chr1041475 1349 923 239 155 ----
NM_001001389chr1152835 2542 1918 441 195 11122 11111 --
NM_001001390chr1152835 2542 1918 441 195 11122 11111 --
NM_001001391chr1152835 2542 1918 441 195 11122 11111 --
NM_001001392chr1152881 2588 1964 487 241 11168 11157 --
NM_001001395chr1262521 2339 2299 2187 810 422 --1843 --
NM_001001396chr183878 3315 2816 1490 1344 1076 858 851 13688 22925 1746 --
NM_001001419chr565079 2059 1449 998 796 276 13849 45176 4681 1901 1070 --
NM_001001420chr565079 2059 1449 998 796 276 13849 45176 4681 1901 1070 --
NM_001001433chr2022919 1216 --13001 --
NM_001001436chr161745 ------
NM_001001481chr823238 199 ------
NM_001001483chr112427 372 ------
NM_001001484chr1031819 173 144 1832 ----
NM_001001523chr12995 532 ------
NM_001001549chr752566 2546 2452 1070 1058 1967 22757 750 --
NM_001001550chr752566 2546 2452 1070 1058 1967 22757 750 --
NM_001001552chr12327 224 ------
NM_001001555chr752566 2546 2452 1070 1058 1967 22757 750 --
NM_001001557chr841821 776 764 543 ----1352
NM_001001560chr223715 528 122 ----1759
NM_001001567chr211190 ------
NM_001001568chr211190 ------
NM_001001571chr211190 ------
NM_001001572chr211190 ------
NM_001001573chr211190 ------
NM_001001574chr211190 ------
NM_001001575chr211190 ------
NM_001001576chr211190 ------
NM_001001577chr211190 ------
NM_001001579chr211190 ------
NM_001001580chr211190 ------
NM_001001581chr211190 ------
NM_001001582chr211190 ------
NM_001001584chr211190 ------
NM_001001585chr211190 ------
NM_001001664chr293734 2950 2879 1484 1309 1140 893 620 233 13085 43784 3174 2772 270 1929
NM_001001668chr1943519 3388 1677 38 23808 2813 ----
NM_001001669chr552249 2010 851 326 172 --12454 12494
NM_001001710chr9122 ------
NM_001001787chr13108 79 64 1164 ----
NM_001001852chr222629 40 --1147 --
NM_001001890chr2173362 3207 3110 2666 1475 1387 600 --14046 --
NM_001001924chr831321 450 294 11476 --11672
NM_001001925chr831321 450 294 11476 --11672
NM_001001928chr2286903 6470 6039 3288 2403 1248 550 360 38341 866 300 11327 27937 2315
NM_001001931chr831321 450 294 11476 --11672
NM_001001936chr1041121 992 471 60 2375 298 1390 --
NM_001001938chr963715 3609 3262 3116 2832 2611 11631 13978 --
NM_001001974chr1042324 2296 940 895 21524 703 --1653
NM_001001995chrX11637 1763 11258 --
NM_001002032chr172664 28 ------
NM_001002033chr173764 534 128 ------
NM_001002233chr841572 1551 602 74 --1226 --
NM_001002243chr23641 273 31 1691 ----
NM_001002257chr22932 874 23324 1426 13136 13146
NM_001002258chr22617 596 11911 ----
NM_001002259chr122329 320 ------
NM_001002264chr13299 61 ------
NM_001002295chr1041113 966 792 169 ------
NM_001002814chr893851 3754 3500 2857 1572 1551 1165 602 74 23694 1328 2918 226 --
NM_001002838chrX--2511 280 ----
NM_001002843chr1521148 822 --11206 --
NM_001002860chr1483950 3617 1369 1238 1228 988 212 26 --24390 4112 --
NM_001002876chr22165 --1367 --
NM_001002909chr17122116 2022 1838 1695 1648 1385 835 726 430 327 168 109 --11430 --
NM_001002914chr1721291 841 ------
NM_001003406chr2263059 2931 2695 1300 1020 605 ------
NM_001003407chr1055028 4339 3744 1610 1598 --11217 15142
NM_001003408chr1055028 4339 3744 1610 1598 --11217 15142
NM_001003652chr18158489 8203 7367 6916 6638 3425 2976 2884 2748 2580 2362 1829 1580 553 192 66465 6441 3142 2100 875 249 28623 473 --
NM_001003665chr143509 3245 845 164 ------
NM_001003674chr18146860 6622 6369 5932 4963 4928 4853 4683 4664 2690 1841 1269 646 279 15446 35627 5126 4946 --
NM_001003675chr18146860 6622 6369 5932 4963 4928 4853 4683 4664 2690 1841 1269 646 279 15446 35627 5126 4946 --
NM_001003676chr1121002 334 ------
NM_001003681chr2241895 601 595 180 3419 410 281 21481 779 --
NM_001003682chr121397 586 --1330 --
NM_001003698chr641632 1605 1384 556 ----1224
NM_001003699chr641632 1605 1384 556 ----1224
NM_001003712chr1252782 1525 1400 606 248 21316 794 23020 2790 13550
NM_001003790chr8--1303 1208 --
NM_001003791chr8--1303 1208 --
NM_001003792chr32415 36 1782 1943 --
NM_001003793chr32415 36 1782 1943 --
NM_001003800chr953610 1241 1137 783 407 --22966 2722 --
NM_001003805chr14163 ----1106
NM_001003810chr42871 196 --1655 1324
NM_001003891chr222131 118 ------
NM_001003940chr151244 22346 469 2848 83 --
NM_001003942chr151244 22346 469 2848 83 --
NM_001003943chr151248 22350 473 2852 87 --
NM_001004051chrX----161 --
NM_001004065chr973931 2929 2636 944 728 243 34 ------
NM_001004196chr351108 1098 1080 936 502 1817 ----
NM_001004304chr1232888 2261 770 ------
NM_001004317chr654427 4223 4164 1513 316 34474 3869 3811 --13922
NM_001004329chr12190 1132 11496 --
NM_001004342chr1105795 5521 5018 4573 3982 2137 1636 1611 340 26 --24759 4060 --
NM_001004346chr431195 1003 987 ------
NM_001004360chr232007 1686 772 --11699 --
NM_001004441chr551602 1514 1410 1372 1071 ------
NM_001004720chr2----1662 --
NM_001004722chr2----1831 --
NM_001005158chr32469 394 165 ----
NM_001005159chr32469 394 165 ----
NM_001005209chr22643 266 ------
NM_001005353chr131161 219 182 ------
NM_001005353chr131161 219 182 ------
NM_001005360chr192805 164 --1577 --
NM_001005361chr192805 164 --1577 --
NM_001005362chr192805 164 --1577 --
NM_001005366chr122759 46 ------
NM_001005375chrY21851 1739 --11608 --
NM_001005386chr24991 349 243 37 --1142 --
NM_001005404chr1794422 3835 3762 3592 2797 1758 1747 1258 191 ------
NM_001005417chr1------1702
NM_001005463chr1032027 946 658 11695 12105 11008
NM_001005473chr575928 5559 5414 4941 4733 4480 2332 1457 26493 4650 --
NM_001005474chr321543 261 21058 83 ----
NM_001005609chrX63731 3609 1469 1353 869 829 --2663 500 --
NM_001005611chrX1119 ------
NM_001005732chr21164 ------
NM_001005733chr21164 ------
NM_001005739chr22351 224 ------
NM_001005746chr221489 1075 11329 ----
NM_001005747chr221489 1075 11329 ----
NM_001005849chr171509 ------
NM_001005861chr37948 892 658 359 110 73 38 1139 --1128
NM_001005910chr32482 270 2565 225 1441 --
NM_001005911chr32482 270 2565 225 1441 --
NM_001005920chr163919 799 118 ------
NM_001006115chr382789 2706 2478 2301 2247 2122 1881 91 1246 ----
NM_001006600chr521588 661 ------
NM_001006610chr162766 347 ------
NM_001006612chrX2184 48 ------
NM_001006613chrX2184 48 ------
NM_001006614chrX2184 48 ------
NM_001006623chr262464 697 538 483 247 159 12332 12497 --
NM_001006635chr22142 101 --1350 --
NM_001006657chr263121 2736 2721 1061 866 496 12346 ----
NM_001006658chr12568 25 ------
NM_001006684chrX1452 ------
NM_001006933chrX155 188 ----
NM_001006935chrX------136
NM_001006936chrX------136
NM_001006937chrX------136
NM_001006944chr11--1180 1695 --
NM_001006946chr241437 1292 1191 338 --11382 --
NM_001007023chr14115112 5055 5029 4056 3855 3555 3508 3424 3386 399 318 --13290 --
NM_001007024chr1794306 3170 1512 1445 731 570 385 247 88 23896 2672 23579 1617 --
NM_001007025chr1794306 3170 1512 1445 731 570 385 247 88 23896 2672 23579 1617 --
NM_001007075chr43942 840 121 1906 ----
NM_001007097chr933630 907 41 31775 1152 681 24017 340 --
NM_001007098chr15825 706 378 210 132 1153 ----
NM_001007099chr13864 690 194 ------
NM_001007100chr13864 690 194 ------
NM_001007102chr621440 174 138 ----
NM_001007224chr781842 1667 881 481 472 277 244 91 12044 ----
NM_001007226chr1721135 348 ------
NM_001007227chr1721135 348 ------
NM_001007228chr1721135 348 ------
NM_001007229chr1721135 348 ------
NM_001007230chr1721135 348 ------
NM_001007237chr162376 1932 1799 839 774 584 --2983 973 --
NM_001007246chr2121191 321 11881 ----
NM_001007267chr21173 ------
NM_001007466chr695129 5025 4323 3949 3677 3273 2041 1222 1132 1426 ----
NM_001007467chr221107 ------
NM_001007471chr92704 126 196 ----
NM_001007527chr51623 2715 230 1547 1501
NM_001007553chr121187 873 2460 412 ----
NM_001008220chr533838 2429 1317 --11244 --
NM_001008222chrX11426 ------
NM_001008225chr7286 40 ------
NM_001008239chr1893182 3132 3018 2910 2739 2369 1478 563 297 ------
NM_001008392chr373440 3228 3221 2877 1060 782 231 22401 482 1404 --
NM_001008407chr741825 1553 1389 1196 ------
NM_001008408chr7156040 5967 5948 5514 5426 5276 5081 4817 4713 4697 3988 1558 1066 465 275 ----11162
NM_001008410chr262235 2171 2153 2077 1755 600 --1844 --
NM_001008495chr821848 426 --1321 --
NM_001008539chr885379 5011 3966 3506 1350 1113 654 515 25360 1119 14231 --
NM_001008540chr22195 120 ------
NM_001008541chr1021864 818 ------
NM_001008541chr1021864 818 ------
NM_001008564chr1342280 2227 1378 904 11579 ----
NM_001008660chr1121600 238 --11170 --
NM_001008707chr1421773 329 ------
NM_001008726chr1421481 374 --11643 --
NM_001008738chr562836 2158 1103 935 628 352 22819 2684 ----
NM_001008783chr61649 1688 ----
NM_001008895chr1311395 ------
NM_001009552chr83569 121 23 ------
NM_001009554chr463341 1408 450 364 292 234 14754 ----
NM_001009554chr463341 1408 450 364 292 234 14754 ----
NM_001009566chr141137 282 142 32 ------
NM_001009899chr3146233 5247 4992 4608 4505 4267 4256 2376 1831 1618 1147 759 621 105 15384 16190 --
NM_001009955chr11442 ------
NM_001009955chr11442 ------
NM_001009959chr232627 664 656 182 22656 495 --
NM_001009960chr71860 --12827 --
NM_001009993chr254360 4107 3438 1284 845 33821 3444 945 33672 3277 3182 --
NM_001009996chr31110 ------
NM_001010000chr1873451 3033 2869 2814 989 741 480 22436 924 --13215
NM_001010853chr642657 2394 2073 1170 --2815 506 --
NM_001010861chr151932 836 637 630 190 12021 ----
NM_001010862chrX33299 2855 69 --1395 --
NM_001010867chr1106102 5654 2451 1693 1650 1621 541 461 394 314 22465 1551 22238 1898 --
NM_001010888chrX64531 4235 4100 3450 3263 1175 24345 3679 13399 --
NM_001010891chr556283 1168 764 741 293 1272 26109 545 11233
NM_001010897chr131390 ------
NM_001010898chr173746 3334 3213 3005 2816 2560 2503 13555 22807 2296 --
NM_001010927chr6--1391 ----
NM_001010932chr72333 43 ------
NM_001010934chr71277 ------
NM_001010971chr11872 --1994 --
NM_001010984chr131936 995 747 11963 11713 --
NM_001010986chrX42494 2449 2171 530 --1930 --
NM_001010989chr163491 208 130 ----1509
NM_001010990chr163491 208 130 ----1509
NM_001011513chr454052 2756 2533 1291 983 33997 839 394 12764 --
NM_001011515chr441038 953 946 785 195 ----
NM_001011516chr441038 953 946 785 195 ----
NM_001011537chr362118 2055 1841 1692 537 455 ----12294
NM_001011546chr202742 108 --2694 673 --
NM_001011553chr72395 170 ------
NM_001011645chrX3327 282 54 --194 --
NM_001011658chrX12096 ------
NM_001011663chr102953 669 --1408 --
NM_001011666chr7136064 6051 5207 4880 4751 4652 4614 2551 2463 1715 847 811 154 11536 34502 2112 229 --
NM_001011713chr1481547 1302 1157 1029 601 578 125 78 21111 536 ----
NM_001012267chr911413 ----1699
NM_001012329chr132311 2174 607 1753 --1359
NM_001012393chr1184828 4507 4190 3684 3320 1810 885 156 24960 3377 ----
NM_001012398chr16--1781 --1203
NM_001012415chr95820 198 118 100 70 ------
NM_001012418chr6104226 4169 3722 3658 3255 3205 1379 447 164 90 --23940 632 --
NM_001012420chr1532133 2032 409 ------
NM_001012426chr633094 1152 540 ------
NM_001012427chr633094 1152 540 ------
NM_001012446chr9--175 ----
NM_001012514chr241120 1082 827 259 ------
NM_001012516chr241120 1082 827 259 ------
NM_001012614chr4--1490 ----
NM_001012732chr431027 257 64 1198 ----
NM_001012751chr1041526 1302 1255 1215 2727 77 --1551
NM_001012754chr1332002 492 59 11664 1459 --
NM_001012755chrX74728 4651 4362 3627 3340 1794 1647 --11775 --
NM_001012761chr532535 874 305 --1550 --
NM_001012968chrX62775 2195 2017 887 457 197 --1712 --
NM_001012977chrX21426 468 --11064 --
NM_001012979chrX2165 55 ----188
NM_001012989chrX2256 163 ------
NM_001013031chr10103280 3077 3026 2781 2400 1100 1081 1062 757 534 12984 12221 --
NM_001013399chr6168 --1839 --
NM_001013406chr711182 ------
NM_001013415chr411553 ------
NM_001013437chr184115 66 50 39 2382 332 ----
NM_001013438chr32208 47 --1368 --
NM_001013439chr3154 --1214 --
NM_001013620chr12138425 8333 7040 6917 5311 3351 2835 1665 1656 1448 1094 1028 791 --38011 5703 1055 --
NM_001013635chr1261179 934 915 904 341 37 ------
NM_001013642chr131009 997 218 1913 ----
NM_001013690chr1271968 1923 1826 577 567 506 418 ------
NM_001013693chr172921 2237 2142 1102 903 616 232 ------
NM_001013693chr172921 2237 2142 1102 903 616 232 ------
NM_001013703chr151501 1384 ----
NM_001013839chr1752048 1816 878 669 169 ------
NM_001013843chr153920 343 140 ------
NM_001014283chr1331657 203 164 --11468 --
NM_001014443chr1----191 --
NM_001014794chr111206 ------
NM_001014795chr111206 ------
NM_001014797chr10118183 7600 7510 7308 5600 2838 2689 2349 1830 827 286 ------
NM_001014831chr191819 ------
NM_001014832chr191819 ------
NM_001014834chr191819 ------
NM_001014835chr191819 ------
NM_001015045chr411628 1163 --12413
NM_001015048chr1473182 2769 1274 1151 723 146 49 12745 ----
NM_001015049chr1473182 2769 1274 1151 723 146 49 12745 ----
NM_001015053chr1741535 1386 636 462 1402 2371 210 --
NM_001015508chr81518 --1646 --
NM_001015877chrX42892 2409 984 147 12551 1627 12194
NM_001015880chr1091548 1515 1499 1160 1147 360 319 132 71 ----11604
NM_001015881chrX2883 812 ------
NM_001015887chr321366 1179 11372 21461 400 --
NM_001017368chr1762303 2180 1833 304 160 52 12824 --2460 29
NM_001017395chr383279 2699 1358 1248 1068 969 808 396 22504 2220 ----
NM_001017396chr211374 21438 66 1827 --
NM_001017402chr1279 48 ------
NM_001017405chr41891 ------
NM_001017415chr12537 306 --1518 --
NM_001017416chr12537 306 --1518 --
NM_001017423chr101314 157 ----
NM_001017424chr11246 ----1480
NM_001017425chr11246 ----1480
NM_001017440chr7137264 7068 6884 5180 3310 2798 2780 1913 1638 1611 1081 617 207 ----1217
NM_001017523chr1221430 401 1721 11892 --
NM_001017535chr1253054 2650 2607 1186 24 13199 11147 1805
NM_001017916chr1751875 1608 1367 222 142 --137 --
NM_001017917chr1751875 1608 1367 222 142 --137 --
NM_001017922chr131719 620 423 ------
NM_001017926chr821332 708 1509 ----
NM_001017962chr102397 46 1386 --1841
NM_001017963chr141199 ----1684
NM_001017977chr11371 ------
NM_001017999chr14894 682 462 38 --11767 --
NM_001017999chr14894 682 462 38 --11767 --
NM_001018000chr14894 682 462 38 --11767 --
NM_001018000chr14894 682 462 38 --11767 --
NM_001018001chr14894 682 462 38 --11767 --
NM_001018003chr82475 256 ------
NM_001018004chr152447 253 ------
NM_001018005chr15----1142 --
NM_001018006chr152447 253 ------
NM_001018007chr152447 253 ------
NM_001018008chr151105 1535 ----
NM_001018009chr321032 981 11199 ----
NM_001018020chr152447 253 ------
NM_001018050chr22103415 3182 2776 2661 2571 2254 1117 943 786 100 ------
NM_001018052chr22103415 3182 2776 2661 2571 2254 1117 943 786 100 ------
NM_001018053chr181968 1798 1563 1451 1431 715 555 212 ------
NM_001018054chr131447 428 25 ------
NM_001018057chr1141289 396 265 198 --1475 168
NM_001018064chr931675 441 425 ------
NM_001018065chr9135477 5033 4473 3817 2042 1476 1456 1404 741 618 415 335 167 44696 1774 1365 1108 ----
NM_001018066chr9135477 5033 4473 3817 2042 1476 1456 1404 741 618 415 335 167 44696 1774 1365 1108 ----
NM_001018067chr131359 942 443 15056 13323 --
NM_001018068chr131359 942 443 15056 13323 --
NM_001018069chr131359 942 443 15056 13323 --
NM_001018072chr1221430 401 1721 11892 --
NM_001018074chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_001018075chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_001018076chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_001018077chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_001018078chr91157 --3671 176 77 --
NM_001018090chr1562179 556 358 315 172 148 --12484 12494
NM_001018091chr1562289 666 468 425 282 258 --12594 12604
NM_001018100chr152725 637 ----1631
NM_001018102chr1562179 556 358 315 172 148 --12484 12494
NM_001018108chr1552146 1539 724 151 46 ------
NM_001018111chr733177 2450 212 33903 3090 3010 21082 429 --
NM_001018676chr82124 31 ------
NM_001018677chr82124 31 ------
NM_001019chr16151 ------
NM_001020818chr1911464 ----1689
NM_001020819chr1911464 ----1689
NM_001020820chr1911464 ----1689
NM_001020821chr1911464 ----1689
NM_001020825chr521426 492 --11241 --
NM_001023567chr1521559 183 12367 1355 --
NM_001024071chr14--3806 397 215 ----
NM_001024094chr563951 3311 3017 2392 994 685 126 23766 497 --
NM_001024218chr142302 245 ------
NM_001024226chr111091 142 ----
NM_001024227chr111091 142 ----
NM_001024228chr111091 142 ----
NM_001024401chr1632800 2547 2498 11904 ----
NM_001024460chr621270 331 11122 1854 --
NM_001024463chr1521064 241 ------
NM_001024465chr6158 ------
NM_001024660chr321259 1064 ------
NM_001024668chr123790 698 652 ------
NM_001024680chr231710 1464 1364 ------
NM_001024736chr1551550 1434 1303 359 198 2406 268 ----
NM_001024808chr1252357 2215 1146 859 257 11799 21098 424 --
NM_001024845chr12895 79 ------
NM_001024847chr332456 578 190 ----11609
NM_001024855chr32160 123 ------
NM_001024934chr6295 56 1530 ----
NM_001024935chr6295 56 1530 ----
NM_001024936chr6295 56 1530 ----
NM_001024937chr173213 158 100 ------
NM_001024948chr183166 3144 2922 2500 2434 2182 1347 223 52841 2260 2169 276 231 ----
NM_001024956chr11105760 4315 4307 3791 3605 1906 1718 1366 378 344 14783 33847 2044 1451 13562
NM_001024959chr35725 303 277 197 145 ------
NM_001024960chr35725 303 277 197 145 ------
NM_001025068chr361691 1591 1462 1132 652 486 1158 11261 --
NM_001025069chr361691 1591 1462 1132 652 486 1158 11261 --
NM_001025076chr1095470 5206 4208 3794 2161 1984 1790 790 139 14910 --16053
NM_001025077chr1096828 6564 5566 5152 4950 2148 1497 480 306 36268 5025 1045 --17411
NM_001025079chr363443 2523 1592 730 492 302 13150 11362 --
NM_001025105chr51361 ------
NM_001025205chr34401 110 102 87 ------
NM_001025233chr121407 11818 ----
NM_001025252chr831146 910 355 22875 312 23200 102 --
NM_001025253chr831146 910 355 22875 312 23200 102 --
NM_001025356chr1272887 2400 987 734 715 592 278 --22742 1083 --
NM_001025366chr6----1466 --
NM_001025366chr6----1466 --
NM_001025367chr6----1466 --
NM_001025367chr6----1466 --
NM_001025368chr6----1466 --
NM_001025368chr6----1466 --
NM_001025369chr6----1482 --
NM_001025369chr6----1482 --
NM_001025370chr6----1466 --
NM_001025370chr6----1466 --
NM_001025389chr1121200 287 1420 ----
NM_001025390chr1121200 287 1420 ----
NM_001025580chrX93665 3477 3361 3052 2781 2681 1509 326 284 --21518 872 --
NM_001025595chr431647 1508 1468 ------
NM_001025596chr113479 387 68 ------
NM_001025616chr451544 1526 645 609 336 ------
NM_001025780chr941588 1371 310 107 ------
NM_001029858chr622982 696 13411 ----
NM_001029875chr552393 1082 841 715 524 11012 11006 --
NM_001029884chr622511 873 --22300 229 --
NM_001030006chr1732542 2515 586 --22687 2431 --
NM_001030007chr1643996 3211 3132 529 23556 1504 22846 1380 12441
NM_001030009chr16151 ------
NM_001030055chr1443098 1218 384 372 --23557 3067 --
NM_001030287chr13833 348 86 1816 1467 --
NM_001031623chr61127 1587 11347 --
NM_001031679chr1223384 2943 33455 3390 2984 ----
NM_001031681chr171708 ----1459
NM_001031690chr772565 2389 2336 1898 990 431 24 ------
NM_001031692chr71307 ------
NM_001031695chr22114658 4345 3569 2187 2181 1919 960 617 565 306 204 23947 3336 --14577
NM_001031702chr34753 640 118 34 ------
NM_001031716chr21379 ------
NM_001031723chr41370 ------
NM_001031732chr463254 2320 1104 885 852 370 13675 --13649
NM_001031804chr1663715 2853 2734 1684 1180 263 22883 912 13084 --
NM_001031812chr562128 1912 1828 1451 1438 53 21785 153 1231 --
NM_001031855chrX--1194 ----
NM_001032221chr941714 644 590 513 ------
NM_001032279chr111381 ------
NM_001032280chr651680 1593 1403 1149 582 ------
NM_001032282chr8------1947
NM_001032296chr1332721 567 508 1375 1291 --
NM_001032363chr11541 31987 465 119 ----
NM_001032363chr11541 31987 465 119 ----
NM_001032367chr152444 115 ------
NM_001032393chrX2524 493 ------
NM_001032999chr2094973 4704 4563 3827 1659 1605 1448 1339 49 14207 15245 --
NM_001033044chr121267 147 ------
NM_001033045chr264216 3474 2959 1551 966 503 ------
NM_001033047chr44454 255 242 158 ------
NM_001033056chr121267 147 ------
NM_001033057chr321581 183 ------
NM_001033059chr62664 60 --189 --
NM_001033081chr161910 1758 1421 751 492 415 130 ----
NM_001033082chr161910 1758 1421 751 492 415 130 ----
NM_001033087chr2093262 3169 2921 2306 2296 1015 936 341 264 23009 2341 ----
NM_001033112chr52730 299 --1720 --
NM_001033117chr384874 4839 3544 3455 3297 399 130 79 13809 13910 --
NM_001033506chr11------1325
NM_001033518chr742151 1998 1957 1902 --22882 1004 --
NM_001033519chr742151 1998 1957 1902 --22882 1004 --
NM_001033520chr742151 1998 1957 1902 --22882 1004 --
NM_001033551chr1753140 1208 323 297 134 --23174 1338 --
NM_001033557chr2128 151 ----
NM_001033566chr171810 162 ----
NM_001033568chr171810 162 ----
NM_001033578chr822043 99 ------
NM_001033602chr1342351 829 635 463 11882 ----
NM_001033723chr812536 21122 1020 ----
NM_001033756chr6----2732 400 --
NM_001033756chr6----2732 400 --
NM_001033925chr1031448 175 143 --2762 162 --
NM_001034194chr4------1143
NM_001034841chr1665276 5200 4776 1823 1263 458 25538 3530 25219 3936 --
NM_001034850chr521497 1470 --11546 --
NM_001034853chrX2959 51 ------
NM_001034915chr83470 453 375 21456 987 --1168
NM_001035chr1------1469
NM_001035003chr411278 ------
NM_001035004chr411278 ------
NM_001035254chr962401 1828 1660 670 541 36 ------
NM_001035260chr1031522 424 322 --1289 --
NM_001037132chr721952 463 --1839 --
NM_001037133chr721952 463 --1839 --
NM_001037163chr71303 2959 47 --1206
NM_001037164chr75340 322 181 155 71 ------
NM_001037165chr7198588 7943 7707 6821 6337 6011 5436 3332 3217 2790 2140 2071 1632 1596 1485 1126 974 240 167 --11358 18505
NM_001037174chr231930 1437 181 ------
NM_001037317chr151932 836 637 630 190 12021 ----
NM_001037324chr32177 170 ----1629
NM_001037331chr181178 --1370 --
NM_001037332chr532299 1902 730 --1247 --
NM_001037333chr532299 1902 730 --1247 --
NM_001037334chr184790 623 323 284 1432 --12270
NM_001037339chr131687 428 195 --1404 --
NM_001037340chr131687 428 195 --1404 --
NM_001037341chr131687 428 195 --1404 --
NM_001037341chr131687 428 195 --1404 --
NM_001037631chr23939 812 454 --1854 --
NM_001037637chr5171 ------
NM_001037872chr22636 49 ------
NM_001037954chr1133369 2182 164 1655 12151 --
NM_001038493chr221522 1397 ------
NM_001038707chr142229 588 508 137 11649 ----
NM_001038707chr142229 588 508 137 11649 ----
NM_001039091chrX21345 1063 1227 ----
NM_001039348chr23420 321 186 11055 ----
NM_001039349chr23420 321 186 11055 ----
NM_001039465chr141200 1372 198 --
NM_001039479chr1452127 1885 805 160 129 ------
NM_001039490chr112539 473 --1146 --
NM_001039538chr282592 2467 1351 1068 979 862 685 307 ------
NM_001039547chr3167789 7529 7001 6188 6138 5633 3100 2921 2555 1051 944 884 865 814 585 139 24886 614 ----
NM_001039570chr2243775 3367 549 447 --24101 3436 --
NM_001039571chr2243775 3367 549 447 --24101 3436 --
NM_001039574chr14962 661 299 281 ------
NM_001039577chr184498 4432 3919 3817 3239 712 219 161 11050 31709 1590 185 --
NM_001039582chrX3315 292 62 ------
NM_001039590chrX63544 2859 2591 979 597 71 23511 139 13234 --
NM_001039591chrX63544 2859 2591 979 597 71 23511 139 13234 --
NM_001039618chr1175844 5714 5040 4330 1809 793 331 35126 4861 1413 ----
NM_001039690chr1611513 11637 22329 1831 --
NM_001039709chr2094973 4704 4563 3827 1659 1605 1448 1339 49 14207 15245 --
NM_001039711chr14836 230 184 107 ------
NM_001039712chr14836 230 184 107 ------
NM_001039715chr1----1970 --
NM_001039716chr1----11034 --
NM_001039762chr1031520 725 571 11710 ----
NM_001039772chr113546 411 61 ------
NM_001039802chr111362 1909 ----
NM_001039840chrX105330 4459 2430 1982 1830 1472 1432 462 447 176 2511 321 34680 4172 55 --
NM_001039877chr192286 177 --1319 --
NM_001039916chr1211065 --151 --
NM_001039917chr1211065 --151 --
NM_001039918chr1211065 --151 --
NM_001039919chr1211065 --151 --
NM_001039920chr1211065 --151 --
NM_001039937chr132693 610 13905 33580 2540 1233 --
NM_001039960chr1241302 595 471 41 11067 ----
NM_001040001chr621437 537 --21872 331 --
NM_001040057chr731283 1191 213 1999 1536 11145
NM_001040100chr331051 909 138 --180 1201
NM_001040101chr431355 1318 139 ------
NM_001040113chr161960 --1876 --
NM_001040142chr272239 1802 1727 708 683 654 138 11818 ----
NM_001040143chr272239 1802 1727 708 683 654 138 11818 ----
NM_001040144chr1611513 11637 22329 1831 --
NM_001040146chr1611513 11637 22329 1831 --
NM_001040152chr764998 4581 3499 3373 1887 141 14211 ----
NM_001040153chr133928 691 306 ------
NM_001040158chr51235 1483 --1374
NM_001040159chr42326 184 1434 1979 --
NM_001040167chr73770 221 109 --1374 --
NM_001040181chr321144 1007 --2958 765 --
NM_001040182chr321144 1007 --2958 765 --
NM_001040183chr321144 1007 --2958 765 --
NM_001040199chr321144 1007 --2958 765 --
NM_001040200chr321144 1007 --2958 765 --
NM_001040202chr462513 1708 1575 934 401 366 2175 124 ----
NM_001040214chr62716 416 22047 562 1956 1753
NM_001040260chr421144 191 ------
NM_001040261chr421144 191 ------
NM_001040284chr1695915 5868 5606 5079 3943 1506 1207 1086 25 25416 1270 ----
NM_001040402chr483008 2979 2381 2366 2326 1241 831 193 --22824 2529 --
NM_001040429chr1383584 3122 2915 2894 2660 2219 1232 1159 2943 114 ----
NM_001040439chr162986 521 11485 ----
NM_001040441chr194608 4283 4074 3808 3751 3346 3329 931 140 ------
NM_001040450chr1542556 870 93 37 ----11000
NM_001040453chr1542556 870 93 37 ----11000
NM_001040455chr1141216 939 353 250 ------
NM_001040619chr131283 1024 536 11266 ----
NM_001040633chr71172 ----1359
NM_001040661chr73733 708 89 ------
NM_001040665chr774808 4593 4319 4261 4208 4026 1855 14956 ----
NM_001040666chr73510 295 21 1658 ----
NM_001040709chr182540 2340 2307 2262 1948 546 239 225 --1536 --
NM_001040712chr942461 924 538 414 13201 33511 3357 2708 --
NM_001040875chr842329 670 518 292 3502 178 83 22096 1884 12291
NM_001040876chr421437 1295 11616 1603 --
NM_001042355chr1674830 3402 1476 1189 419 158 105 --1365 --
NM_001042361chr102615 141 ------
NM_001042364chr102615 141 ------
NM_001042365chr102615 141 ------
NM_001042387chr102615 141 ------
NM_001042388chr185988 658 652 349 271 --122 --
NM_001042393chr102615 141 ------
NM_001042396chr102615 141 ------
NM_001042397chr102615 141 ------
NM_001042404chr131675 598 122 ------
NM_001042406chr6--1999 1918 --
NM_001042412chr1674830 3402 1476 1189 419 158 105 --1365 --
NM_001042413chr983990 3716 3609 3264 3199 2790 2532 237 12880 1682 --
NM_001042425chr651680 1593 1403 1149 582 ------
NM_001042453chrX31446 1126 257 --198 --
NM_001042473chr1062106 1763 1602 804 343 108 --21901 821 --
NM_001042478chr1151 ------
NM_001042481chr1472694 2313 1854 953 808 768 316 42165 1777 820 792 ----
NM_001042492chr1753133 2746 1111 372 186 12965 ----
NM_001042494chr1533348 3262 22 ------
NM_001042495chr1533348 3262 22 ------
NM_001042496chr1533348 3262 22 ------
NM_001042497chr1533348 3262 22 ------
NM_001042506chrX31387 578 468 --21074 1060 --
NM_001042510chr831404 1368 79 32178 545 372 22002 1651 --
NM_001042511chr831404 1368 79 32178 545 372 22002 1651 --
NM_001042517chr132158 80 1282 1677 --
NM_001042533chr353066 2478 1163 754 202 ----33015 2203 1269
NM_001042537chrX52000 1964 1711 672 467 ------
NM_001042539chr163972 900 141 ------
NM_001042543chr421387 58 ------
NM_001042548chr22723 682 ------
NM_001042555chr1254365 1872 559 237 64 44730 4626 889 876 44389 1781 1752 600 --
NM_001042599chr2137822 7768 7314 7271 7158 6730 6290 5137 4785 3104 1972 512 151 25918 2888 ----
NM_001042601chr352880 530 382 313 136 13287 ----
NM_001042603chr12174766 4656 4159 4026 3872 3706 3553 3349 3268 2051 1822 1404 1301 968 880 758 579 11316 21685 203 14237
NM_001042646chr351408 1267 1235 628 146 ------
NM_001042669chr451544 1526 645 609 336 ------
NM_001042681chr142244 2207 1034 820 11890 12361 --
NM_001042682chr142244 2207 1034 820 11890 12361 --
NM_001042682chr142244 2207 1034 820 11890 12361 --
NM_001042728chr122352 155 --1753 --
NM_001042749chrX21864 281 11410 ----
NM_001042750chrX21864 281 11410 ----
NM_001042751chrX21864 281 11410 ----
NM_001043351chr152083 2067 774 256 116 1454 2906 149 --
NM_001044305chr621516 522 ------
NM_001044385chr243872 3704 3007 447 23690 2999 ----
NM_001044722chr562128 1912 1828 1451 1438 53 21785 153 1231 --
NM_001044723chr562128 1912 1828 1451 1438 53 21785 153 1231 --
NM_001046chr563002 2964 1884 461 403 46 --21178 336 --
NM_001049chr1432293 1946 707 22031 1520 12224 --
NM_001068chr32287 56 ------
NM_001071775chr1341919 1483 1205 235 ------
NM_001079874chr122071 303 2508 372 1715 --
NM_001083620chr412550 --11686 1194
NM_001087chr2126 ------
NM_001092chr1741880 831 652 239 ------
NM_001094chr175841 802 768 592 325 ------
NM_001095chr121768 --11736 --
NM_001096chr172710 332 191 --1718
NM_001100108chr1148326 8317 6971 6071 5988 5746 5229 2945 2561 2325 1248 1200 832 813 15237 16532 23054 2536
NM_001105518chr11801 ------
NM_001106chr3137606 7558 7268 6739 6388 6269 3717 3146 2443 2336 2174 2076 1515 1392 57208 7185 7033 2798 563 18145
NM_001109977chr4--1578 153 --
NM_001113490chrX83650 3372 2965 1003 725 613 304 42 32755 1464 1066 1630 --
NM_001116chr1662862 2577 2501 2270 1958 372 --2255 75 --
NM_001117chr182736 639 --12066 --
NM_001121chr1021823 1710 1454 ----
NM_001122679chr51862 1110 ----
NM_001123chr102688 339 ------
NM_001128chr1643996 3211 3132 529 23556 1504 22846 1380 12441
NM_001143chrY148 ------
NM_001145chr142164 44 ------
NM_001146chr842286 1842 1540 281 21865 1746 ----
NM_001148chr41405 1312 ----
NM_001149chr1011041 11010 ----
NM_001153chr2--2720 183 1887 --
NM_001157chr103468 200 132 ----1656
NM_001160chr1282795 2423 860 605 498 403 381 282 32516 2386 484 ----
NM_001167chrX46703 5330 1963 1054 11108 ----
NM_001173chr1443098 1218 384 372 --23557 3067 --
NM_001177chr122675 227 --12309 --
NM_001186chr2132520 2351 2074 12054 ----
NM_001191chr2021248 403 ------
NM_001198chr63463 252 59 12446 12187 --
NM_001199chr81219 ------
NM_001200chr2011078 ------
NM_001201chr4103747 3722 3379 2567 1304 1195 1189 946 876 586 1424 11527 --
NM_001204chr267662 7491 7344 7288 7116 405 32362 135 87 ----
NM_001206chr982369 2136 1049 838 760 596 515 269 ------
NM_001207chr5171 ------
NM_001219chr72862 181 --1710 --
NM_001222chr1031593 660 183 ------
NM_001238chr192465 86 ------
NM_001241chr221831 834 21487 233 ----
NM_001241chr221831 834 21487 233 ----
NM_001254chr172929 266 ----174
NM_001256chr172700 371 32899 639 312 12887 --
NM_001257chr1621439 1166 --11398 11306
NM_001259chr7136356 6326 5974 5738 5472 2484 2461 2200 1525 1457 1213 1096 123 21654 793 31735 1539 1439 --
NM_001260chr131341 ------
NM_001262chr11335 ------
NM_001264chr63773 134 30 ------
NM_001270chr51744 173 ----
NM_001271chr1532859 2040 693 23052 2270 ----
NM_001277chr11174 ------
NM_001278chr1031183 791 290 11165 ----
NM_001282chr1732542 2515 586 --22687 2431 --
NM_001283chr72664 274 ------
NM_001286chr132900 1160 1032 1385 ----
NM_001290chr41433 11062 ----
NM_001300chr101464 ------
NM_001304chr1743679 2714 2545 1342 22780 1319 23711 2434 --
NM_001310chr1242994 2449 2043 1948 3983 327 175 ----
NM_001315chr63368 168 86 --11422 1611
NM_001316chr20--1143 ----
NM_001319chr192705 223 11036 ----
NM_001326chr111124 1411 ----
NM_001328chr4--1490 ----
NM_001331chr1152827 2193 2092 2081 145 --21119 1079 --
NM_001332chr531565 994 476 ----1274
NM_001343chr52318 166 1132 ----
NM_001349chr2--1388 ----
NM_001351chr321830 1712 ------
NM_001356chrX21608 554 12096 1315 --
NM_001358chr41385 ------
NM_001364chr11114672 4464 3878 3808 3588 3007 2984 1583 1439 1329 1085 23022 353 24193 345 --
NM_001383chr171281 ------
NM_001385chr81171 ------
NM_001386chr8112361 2188 2141 2133 1909 1800 1729 815 606 396 336 ------
NM_001387chr553038 1272 929 726 181 ------
NM_001389chr211171 ------
NM_001391chr182124 45 ------
NM_001392chr181259 ------
NM_001394chr82920 802 --1692 --
NM_001396chr2172665 1729 1127 1108 1072 901 286 11752 --12451
NM_001397chr142305 1817 1760 324 ------
NM_001399chrX63731 3609 1469 1353 869 829 --2663 500 --
NM_001400chr121280 919 ------
NM_001401chr921366 473 1578 ----
NM_001402chr621660 484 ----11982
NM_001406chr1741595 1328 1232 495 ------
NM_001407chr32490 417 1641 11609 --
NM_001408chr151326 1163 576 425 72 ----180
NM_001412chrX63374 3323 2946 2900 335 284 ----1876
NM_001417chr1231916 1386 291 ------
NM_001418chr11--1174 ----
NM_001418chr11--1174 ----
NM_001419chr1994409 4093 3004 1824 1143 1101 989 466 110 23186 308 23743 3507 --
NM_001422chr1121056 41 --21042 247 --
NM_001426chr23577 503 470 ------
NM_001427chr752050 1908 1602 1463 1380 11760 ----
NM_001429chr222899 310 ------
NM_001431chr631142 916 317 --1850 --
NM_001432chr433338 292 41 1980 1848 --
NM_001438chr133644 797 334 ----12367
NM_001447chr531258 574 423 --1562 --
NM_001448chrX41427 1141 700 84 21552 522 ----
NM_001449chrX1527 ------
NM_001451chr1631275 485 74 ------
NM_001453chr651300 379 349 334 229 --1604 --
NM_001457chr331169 138 43 1511 ----
NM_001465chr531883 1575 491 1513 11518 --
NM_001482chr15--176 --1102
NM_001483chr7123 --1201 --
NM_001491chr652291 1751 1046 711 79 1610 --12612
NM_001493chrX4684 586 223 40 ------
NM_001494chr10188 ------
NM_001497chr972767 2730 1859 1827 540 222 57 --11850 12096
NM_001511chr43607 586 111 ------
NM_001530chr141435 ------
NM_001542chr162376 1932 1799 839 774 584 --2983 973 --
NM_001543chr573748 3635 3488 3051 1641 1565 659 11128 11936 --
NM_001546chr621486 1240 1580 ----
NM_001552chr1721091 839 ------
NM_001554chr11462 ------
NM_001560chrX62668 2401 1630 877 668 327 ------
NM_001564chr4136 ------
NM_001567chr112729 126 ------
NM_001584chr1121010 147 1322 ----
NM_001604chr112894 685 --1639 --
NM_001614chr172528 496 ------
NM_001614chr172528 496 ------
NM_001616chr232830 2578 1384 22656 1271 ----
NM_001619chr1111104 --1231 --
NM_001621chr772954 2816 1079 835 549 460 157 --2521 495 1805
NM_001621chr772954 2816 1079 835 549 460 157 --2521 495 1805
NM_001634chr62664 60 --189 --
NM_001635chr71885 --1236 --
NM_001649chrX62495 2094 2072 1774 793 295 21624 677 ----
NM_001650chr1863467 3333 2974 1578 1519 1333 ------
NM_001654chrX2392 322 --2332 148 --
NM_001656chr531727 428 373 22010 160 ----
NM_001658chr111091 142 ----
NM_001659chr1252536 2345 2061 1067 397 1824 ----
NM_001660chr33681 643 181 --1660 --
NM_001663chr1442028 1704 522 392 ----12266
NM_001665chr112492 129 --3145 62 54 183
NM_001668chr152264 1785 856 642 346 --12056 --
NM_001674chr13833 348 86 1816 1467 --
NM_001675chr22130 ------
NM_001677chr13746 717 317 2802 123 1864 --
NM_001678chr1721484 1455 ------
NM_001679chr34765 304 142 46 ------
NM_001682chr1262599 1788 1010 911 675 99 12898 22228 190 --
NM_001683chr332171 1725 740 ------
NM_001684chr173595 3032 1207 1061 793 575 568 13405 22642 1463 --
NM_001688chr13241 200 90 ------
NM_001689chr22617 596 11911 ----
NM_001690chr342415 1615 481 121 11032 ----
NM_001699chr1941821 1239 524 116 ------
NM_001704chr6--1459 ----
NM_001706chr331011 98 21 --1836 --
NM_001707chr72221 188 ------
NM_001709chr1152651 1761 1128 818 458 2515 309 11795 --
NM_001711chrX41074 790 774 670 --1664 --
NM_001716chr1131597 1178 29 --11361 --
NM_001718chr631308 1010 36 161 --1129
NM_001722chr8--1258 ----
NM_001730chr1321646 1121 ------
NM_001730chr1321646 1121 ------
NM_001731chr12156 ------
NM_001735chr92400 145 ------
NM_001742chr731393 604 173 ------
NM_001743chr22506 53 ------
NM_001744chr5--1170 1188 --
NM_001748chr12923 812 1932 ----
NM_001753chr731431 623 561 1584 1661 --
NM_001754chr2173362 3207 3110 2666 1475 1387 600 --14046 --
NM_001755chr1612255 32238 2071 774 ----
NM_001759chr1295203 5079 4965 4780 4767 4595 1597 1530 197 25008 3816 --14735
NM_001760chr61650 --1371 --
NM_001769chr122344 166 ------
NM_001773chr121286 132 ------
NM_001777chr363443 2523 1592 730 492 302 13150 11362 --
NM_001781chr121668 --1126 1692
NM_001788chr72395 170 ------
NM_001791chr111362 1909 ----
NM_001792chr182401 109 --1245 --
NM_001794chr201241 ------
NM_001796chr161228 ------
NM_001797chr162606 37 1768 ----
NM_001802chr161118 ------
NM_001806chr19--12796 12785 --
NM_001810chr201544 ------
NM_001826chr12152 86 ------
NM_001833chr91244 ------
NM_001834chr5165 ------
NM_001838chr171865 ------
NM_001839chr12181 86 1133 ----
NM_001845chr132875 544 --1331 1125
NM_001846chr13135 ------
NM_001851chr61488 ------
NM_001854chr13942 573 145 ------
NM_001855chr91617 1574 1896 --
NM_001858chr695107 4920 3499 1551 1538 1462 868 843 93 1220 ----
NM_001859chr931407 1084 260 23887 2606 1850 11324
NM_001876chr112514 374 --2501 346 --
NM_001880chr21208 ------
NM_001892chr51361 ------
NM_001894chr22----138 --
NM_001895chr203901 856 110 ------
NM_001903chr53631 614 180 ------
NM_001904chr331007 402 160 ------
NM_001907chr16175 ------
NM_001913chr71628 ------
NM_001915chr1751875 1608 1367 222 142 --137 --
NM_001918chr199240 9024 8482 8194 7192 6579 6529 964 850 36753 6411 2342 --1830
NM_001921chr431027 257 64 1198 ----
NM_001932chr174749 696 649 302 --1620 --
NM_001933chr1471337 1315 925 513 418 313 277 ------
NM_001935chr21177 --21025 737 1898
NM_001938chr11484 ------
NM_001939chrX73850 3263 3247 1473 1137 888 322 13403 13825 --
NM_001945chr52987 153 ------
NM_001946chr123387 78 34 1810 ----
NM_001949chr672757 2028 1003 444 339 287 225 --1424 --
NM_001951chr8--1189 1499 --
NM_001955chr631072 366 210 ------
NM_001964chr51410 --1775 --
NM_001967chr32384 71 1587 ----
NM_001968chr43964 874 160 ------
NM_001969chr1483495 2618 2448 1036 1018 990 799 696 11115 ----
NM_001970chr171472 ------
NM_001977chr43583 138 112 1495 ----
NM_001978chr82864 342 ------
NM_001981chr152156 2093 1484 863 315 12041 ----
NM_001982chr12----3359 243 50 --
NM_001987chr1274269 3532 3113 1351 905 681 571 11567 1755 --
NM_001991chr17293 45 ------
NM_001995chr41969 21439 175 ----
NM_001999chr5--31188 965 127 1507 --
NM_002006chr485790 4033 3633 3578 1500 1395 975 828 64788 4638 4417 1720 1705 269 ----
NM_002009chr1562611 2502 1968 1011 887 497 ------
NM_002015chr1353204 2731 2541 447 81 --23299 322 --
NM_002023chr141642 1462 1222 604 11269 --1532
NM_002024chrX31829 681 218 --1550 --
NM_002025chrX128673 8168 7905 6970 6727 6698 6248 3216 2736 2117 1330 1314 26222 826 29146 7874 29071 264
NM_002026chr22394 381 1907 ----
NM_002027chr82124 31 ------
NM_002028chr1451285 1106 909 828 500 ------
NM_002033chr1194071 3820 3811 3542 3136 2998 1188 985 819 --13373 --
NM_002037chr61360 --1316 --
NM_002039chr4----1167 --
NM_002040chr2172938 2849 2417 2214 1968 1253 466 2421 409 ----
NM_002051chr1041113 966 792 169 ------
NM_002052chr81187 11469 ----
NM_002054chr21111 1426 ----
NM_002056chr21710 ------
NM_002062chr651059 533 505 185 145 ------
NM_002063chrX51124 848 349 70 46 ------
NM_002065chr121267 147 ------
NM_002069chr71634 --11684 --
NM_002072chr91782 ------
NM_002073chr2221073 319 --11155 --
NM_002074chr11263 ------
NM_002076chr1243002 2143 951 71 12508 13022 --
NM_002077chr951515 781 709 688 119 ------
NM_002078chr32198 21 ------
NM_002079chr101441 ------
NM_002080chr16140 ------
NM_002083chr142267 71 ------
NM_002087chr17----1240 --
NM_002092chr483402 1264 1155 1146 889 674 636 619 34032 3485 1031 1937 --
NM_002095chr8182 --1255 --
NM_002103chr1951062 1015 813 719 711 --2330 200 --
NM_002107chr11478 ------
NM_002114chr6124 --1196 --
NM_002126chr1783724 3266 1598 1259 812 545 280 167 23149 1664 --12738
NM_002128chr1332343 1006 526 --2168 133 --
NM_002129chr41392 1399 ----
NM_002133chr22--1423 1409 --
NM_002135chr121177 1205 158 --
NM_002136chr121477 ------
NM_002137chr721762 245 --32003 1910 1604 11681
NM_002138chr42871 196 --1655 1324
NM_002139chrX2565 204 --1445 --
NM_002140chr91349 ----1999
NM_002141chr7142 ------
NM_002146chr171170 --1917 --
NM_002156chr22341 281 ------
NM_002157chr21134 ------
NM_002158chr253574 3471 3065 1492 781 43143 2611 485 282 21210 749 --
NM_002163chr161411 1113 ----
NM_002165chr202320 295 ------
NM_002166chr2--1659 1679 --
NM_002189chr10--154 1223 --
NM_002190chr641075 893 836 344 ------
NM_002193chr221451 586 --11718 --
NM_002198chr54843 561 280 182 --1686 --
NM_002199chr4--1653 ----
NM_002202chr531024 755 418 ------
NM_002204chr171490 --11353 --
NM_002211chr101940 --31101 838 242 --
NM_002214chr754559 2060 1892 655 565 25498 1671 --1203
NM_002224chr61500 2762 249 ----
NM_002226chr142683 279 --2804 729 --
NM_002227chr12381 168 ------
NM_002228chr131131 851 502 ------
NM_002230chr173839 372 164 --1177 --
NM_002232chr121357 173 ------
NM_002233chr111454 ----1435
NM_002234chr124757 630 599 584 --1624 --
NM_002235chr1251644 1606 1426 1332 352 ------
NM_002240chr212465 89 1538 ----
NM_002241chr132082 2021 1159 12216 1462 --
NM_002246chr251143 497 441 150 81 ------
NM_002247chr1021500 905 11521 1397 --
NM_002252chr21161 ------
NM_002253chr431416 524 195 --1202 --
NM_002254chr252392 1808 660 356 147 ------
NM_002264chr3105071 4521 4163 3579 3520 1968 1861 1375 1294 134 14876 44996 4363 1015 643 1782
NM_002265chr171336 --1404 --
NM_002266chr17--154 ----
NM_002267chr1331659 955 691 --11850 --
NM_002268chr321901 318 --11619 --
NM_002270chr553812 3741 2237 1397 570 13490 11226 --
NM_002274chr173351 117 29 ------
NM_002293chr132406 1731 212 12687 42667 1687 576 66 --
NM_002296chr121560 700 11138 ----
NM_002309chr2242807 2240 537 137 12903 21104 415 --
NM_002310chr5136354 5951 5440 5038 4832 4668 2354 1934 1878 1813 1447 1251 597 --1157 --
NM_002313chr1055028 4339 3744 1610 1598 --11217 15142
NM_002334chr1151360 637 587 333 97 ------
NM_002336chr1264793 4421 3741 1789 1668 970 24848 286 14896 14985
NM_002346chr83597 590 99 ------
NM_002355chr124424 163 130 118 --11054 --
NM_002356chr652408 999 498 262 121 ------
NM_002359chr17103589 3511 3281 3042 1713 1444 1245 1206 1170 816 --11283 --
NM_002360chr782633 2557 2508 2363 2251 1689 633 249 1576 12161 --
NM_002370chr1195 ------
NM_002374chr282592 2467 1351 1068 979 862 685 307 ------
NM_002379chr12116 106 ------
NM_002381chr23968 780 227 ------
NM_002382chr1421291 1170 ------
NM_002383chr163795 723 325 ------
NM_002387chr585058 4740 1952 1143 655 457 277 251 --11630 --
NM_002389chr141627 1424 310 29 11546 ----
NM_002390chr1721938 101 11719 ----
NM_002395chr62982 195 21437 1236 ----
NM_002397chr532235 1604 880 ------
NM_002399chr151930 ------
NM_002401chr1742386 2287 966 805 1595 ----
NM_002402chr71457 11111 ----
NM_002403chr11151 --173 --
NM_002408chr14--198 ----
NM_002430chr2232103 473 417 --1954 12092
NM_002436chrX2365 333 168 ----
NM_002442chr1251719 1650 1390 579 254 ------
NM_002449chr521219 1014 --1356 --
NM_002457chr111127 ------
NM_002467chr81401 ------
NM_002473chr2221040 881 ----11303
NM_002478chr111484 ------
NM_002480chr12--11096 11033 --
NM_002481chr1117811 7572 7418 7267 6704 6252 5447 2428 1669 774 75 15460 57658 7213 6974 2744 831 16730
NM_002486chr942537 2306 2186 84 2609 57 ----
NM_002487chr151740 --2229 133 --
NM_002489chr7--2302 29 ----
NM_002499chr1562339 1809 1763 1521 766 172 --1324 1394
NM_002500chr22153 46 ------
NM_002505chr621507 1433 1196 ----
NM_002515chr1412057 ------
NM_002518chr21996 ------
NM_002519chr1121386 1198 --11100 --
NM_002522chr17113901 3127 2934 2819 2484 1502 1328 550 494 326 312 --33355 3218 459 --
NM_002537chr151940 ------
NM_002538chr5--2214 131 ----
NM_002539chr2195 ------
NM_002541chr73756 171 80 ------
NM_002545chr1184828 4507 4190 3684 3320 1810 885 156 24960 3377 ----
NM_002546chr8------1302
NM_002547chrX53649 3330 3227 922 207 --14265 --
NM_002552chr231134 328 137 --2263 148 --
NM_002556chr1141633 1560 852 818 32124 1975 182 21620 94 --
NM_002568chr8135 1424 ----
NM_002569chr152596 530 --11293 --
NM_002576chr112408 96 ------
NM_002577chr3113963 3948 3936 3502 3189 3083 2973 2806 1560 790 456 ------
NM_002581chr965194 4859 4470 4154 821 132 1931 33905 2015 1470 --
NM_002586chr641273 1181 600 312 ------
NM_002587chr53311 75 21 --1398 --
NM_002588chr531725 1371 709 --11532 --
NM_002590chr131455 ----1103
NM_002591chr203549 531 414 ------
NM_002594chr2031617 1584 926 22104 1654 ----
NM_002595chr1211523 11240 ----
NM_002600chr131687 428 195 --1404 --
NM_002606chr211190 ------
NM_002607chr72504 441 1903 1415 21177 103
NM_002613chr1654477 1986 1302 1025 517 --1876 25350 3481
NM_002622chr52628 64 1104 ----
NM_002628chr32931 33 1266 1345 --
NM_002633chr11508 --1451 --
NM_002641chrX31732 472 73 ------
NM_002645chr1172738 2155 2117 1958 1064 566 553 22838 1077 22330 2181 1622
NM_002646chr142083 1736 1636 795 ------
NM_002648chr631335 830 112 --21196 447 --
NM_002651chr12847 832 ------
NM_002653chr51175 ------
NM_002655chr894070 4054 3911 3895 3753 3681 478 105 75 13489 24297 3847 13380
NM_002656chr61192 11061 ----
NM_002657chr2073522 3323 2595 2506 2472 2459 127 13361 ----
NM_002668chrX1146 --1126 --
NM_002674chr121158 ------
NM_002687chr1431204 511 358 31122 839 93 1833 --
NM_002693chr15----185 --
NM_002697chr11233 ------
NM_002698chr1932374 1993 338 11058 12683 --
NM_002699chr121219 89 ------
NM_002703chr451958 1695 1362 505 413 31847 1534 300 ----
NM_002707chr2170 ------
NM_002709chr211105 22598 688 ----
NM_002710chr122955 735 ------
NM_002711chr72729 716 ------
NM_002713chr12844 186 11024 ----
NM_002715chr51275 ------
NM_002716chr1193280 3262 2520 2380 2368 988 754 702 402 1262 --12488
NM_002717chr81661 ------
NM_002718chr321885 84 ------
NM_002719chr1431755 610 511 --32323 1782 1564 --
NM_002721chr92171 121 ------
NM_002731chr172784 2684 2652 1159 726 389 250 1520 ----
NM_002734chr1741919 698 284 141 32273 2101 67 ----
NM_002737chr17116598 6382 5993 5256 4486 2043 1879 1688 960 686 100 --36142 1971 1427 --
NM_002738chr164923 793 431 304 1879 ----
NM_002742chr142554 73 1624 1288 --
NM_002745chr22144505 4452 4020 3582 3571 3518 3199 1708 1689 1352 1308 562 292 166 1277 13598 13342
NM_002747chr182505 100 1165 ----
NM_002748chr153900 316 52 ------
NM_002750chr10----151 --
NM_002752chr52454 126 ------
NM_002753chr41588 1776 ----
NM_002755chr153822 220 172 ------
NM_002756chr173877 334 225 1673 ----
NM_002757chr151358 ------
NM_002758chr172514 408 ------
NM_002760chrY125903 5761 5459 5390 4780 4429 1993 1730 1477 750 449 274 --25813 5407 15360
NM_002763chr14416 217 206 71 ------
NM_002765chrX21345 1063 1227 ----
NM_002767chr171429 ------
NM_002787chr73682 597 213 ------
NM_002788chr14--1106 ----
NM_002809chr171316 ------
NM_002819chr1931104 349 265 21344 957 --1336
NM_002822chr1211806 --1433 1524
NM_002823chr21230 ------
NM_002827chr2021478 170 11770 ----
NM_002829chr931233 437 267 ------
NM_002833chr152408 118 ----1245
NM_002835chr7--2214 151 1652 --
NM_002837chr1264300 4189 3546 3187 1365 586 24361 3156 --11216
NM_002839chr942461 924 538 414 13201 33511 3357 2708 --
NM_002841chr31467 1154 ----
NM_002843chr1163397 2960 2685 2610 1033 1027 --2523 421 --
NM_002844chr621393 1110 ------
NM_002845chr181107 ------
NM_002847chr71350 11469 182 --
NM_002849chr122894 412 1392 ----
NM_002851chr71507 --1168 --
NM_002852chr31248 --1230 --
NM_002859chr1261270 1251 687 582 429 170 ------
NM_002860chr101314 157 ----
NM_002865chr81257 ------
NM_002866chr192249 36 ------
NM_002868chr1252401 2261 2231 1843 380 --1671 --
NM_002869chr1172128 2065 1405 791 633 388 43 --21913 188 1757
NM_002871chr141977 411 253 92 ------
NM_002873chr5183 ----1389
NM_002874chr94939 880 809 743 1342 12239 --
NM_002886chr375198 4665 4637 1611 1037 743 82 11803 21049 119 13861
NM_002890chr52820 693 ------
NM_002892chr1421660 1268 ------
NM_002893chrX2295 251 ------
NM_002894chr181151 ------
NM_002895chr202909 687 --3844 216 140 --
NM_002897chr25703 675 556 535 492 1612 --2583 86
NM_002904chr62176 26 ------
NM_002906chr1132425 1721 605 --11741 --
NM_002912chr62628 45 1634 173 --
NM_002918chr19------1218
NM_002923chr12610 249 ------
NM_002924chr13481 229 197 ------
NM_002926chr441062 391 260 176 ------
NM_002930chr182175 96 ------
NM_002931chr61209 --1303 --
NM_002938chr431985 1910 375 ------
NM_002940chr421437 1295 11616 1603 --
NM_002941chr311269 11029 1266 --
NM_002942chr311249 ------
NM_002945chr172863 259 ------
NM_002951chr201252 ------
NM_002955chr641632 1605 1384 556 ----1224
NM_002956chr1221257 1177 --1533 --
NM_002957chr963343 2600 1564 1520 1148 747 13387 13689 --
NM_002958chr37948 892 658 359 110 73 38 1139 --1128
NM_002959chr154170 4099 3363 1207 675 --1816 --
NM_002968chr162757 205 1968 ----
NM_002970chrX165 ------
NM_002971chr3171 --11017 2838 809
NM_002977chr262190 929 588 546 421 305 ------
NM_002979chr13864 690 194 ------
NM_002994chr431935 1658 1636 11434 1332 --
NM_002997chr241437 1292 1191 338 --11382 --
NM_002998chr841400 478 450 296 21626 593 ----
NM_003002chr114822 574 290 54 --1813 --
NM_003009chr191262 ------
NM_003010chr1741884 1681 1492 465 22290 544 ----
NM_003011chr941366 1287 1218 419 ------
NM_003013chr41135 1791 ----
NM_003016chr1741713 1667 1410 398 --1578 --
NM_003017chr61256 1574 1903 --
NM_003020chr153316 171 151 ------
NM_003022chrX21256 51 11291 ----
NM_003026chr931038 410 61 --1212 --
NM_003030chr31782 ------
NM_003031chr162766 347 ------
NM_003034chr1288036 6467 6077 5142 2959 2848 1621 855 45121 1640 1379 420 17568 17003
NM_003035chr1142 1951 ----
NM_003036chr141215 1088 1068 120 --21192 1156 --
NM_003038chr232442 2422 117 12673 ----
NM_003040chr7----1148 --
NM_003042chr322008 1697 ------
NM_003043chr334280 4236 2831 --11173 --
NM_003045chr1384872 4225 3823 1999 1512 930 707 249 11885 14582 --
NM_003046chr885379 5011 3966 3506 1350 1113 654 515 25360 1119 14231 --
NM_003048chr2130 --1270 --
NM_003054chr10--182 ----
NM_003055chr101372 ------
NM_003059chr51248 ------
NM_003060chr541198 809 125 44 --21296 941 --
NM_003068chr81380 1701 1849 1446
NM_003069chrX3728 576 297 ------
NM_003070chr93786 770 322 --1855 --
NM_003071chr31693 11970 ----
NM_003074chr362114 1653 534 356 323 134 1362 11840 --
NM_003076chr124606 301 229 79 ------
NM_003077chr172570 101 --1272 --
NM_003079chr173649 343 321 ------
NM_003081chr203887 455 59 --1168 --
NM_003088chr71112 --11078 --
NM_003099chr15145686 5646 5595 5072 4920 4073 2615 2429 2215 2179 1575 1528 914 41 34754 1872 214 15393 --
NM_003100chr51381 ------
NM_003104chr1511282 11050 1293 1163
NM_003107chr612414 12502 ----
NM_003108chr297183 7177 5107 4739 2573 2461 2256 673 291 16343 25141 4553 --
NM_003110chr174920 709 189 89 ------
NM_003112chr733082 2640 958 --11994 --
NM_003113chr2----1164 --
NM_003114chr82780 173 ------
NM_003128chr242695 1098 340 90 ------
NM_003130chr741208 1037 924 71 21282 248 ----
NM_003131chr682169 2009 1718 1586 663 590 433 60 1688 ----
NM_003132chr13235 173 60 ------
NM_003137chr62745 546 ------
NM_003139chr112826 94 ----172
NM_003144chr652103 1899 879 526 400 11859 ----
NM_003145chr12454 432 --167 --
NM_003149chr321621 1209 11504 ----
NM_003150chr1752345 378 368 293 203 ----1926
NM_003155chr831925 1722 82 32030 701 414 --1522
NM_003156chr1141321 1003 448 365 1265 ----
NM_003161chr1733551 1259 950 23515 1411 12643 --
NM_003162chr221089 753 ------
NM_003173chrX41312 1191 554 454 ------
NM_003174chr102308 284 --1698 --
NM_003178chr351441 650 463 267 188 --31904 1583 487 --
NM_003179chrX21315 116 ------
NM_003182chr71490 --1358 --
NM_003182chr71490 --1358 --
NM_003184chr8------11002
NM_003185chr2021229 1211 ------
NM_003189chr182574 2222 1022 691 670 386 331 304 12634 22346 552 --
NM_003199chr1854396 3897 3672 1324 333 --11095 --
NM_003203chr231949 879 76 ----1155
NM_003204chr1741676 1553 1359 100 --11719 --
NM_003211chr1221507 1307 1538 21435 1425 --
NM_003215chr431254 1091 625 1199 ----
NM_003216chr2272400 2303 2122 2038 542 449 411 ------
NM_003217chr122590 540 --11758 --
NM_003220chr651680 1593 1403 1149 582 ------
NM_003221chr683635 3509 3185 2999 2892 1449 394 209 22722 1465 ----
NM_003223chr161694 --1831 --
NM_003234chr322429 139 --2955 254 --
NM_003236chr263309 2952 2856 960 325 300 21148 610 ----
NM_003242chr332456 578 190 ----11609
NM_003243chr13973 473 321 21202 1188 ----
NM_003244chr182435 141 ------
NM_003246chr1551937 1581 304 241 121 11740 11988 --
NM_003248chr5127 ------
NM_003250chr174406 319 182 81 ------
NM_003253chr2141832 1787 1509 1498 ------
NM_003255chr1742632 2079 296 232 1914 ----
NM_003257chr151247 ------
NM_003262chr384046 3767 3675 3597 3280 1567 1300 1141 23635 1338 ----
NM_003263chr4147 ------
NM_003269chr611005 --1350 --
NM_003274chr2142592 1013 355 200 --3567 500 404 --
NM_003275chr931229 387 25 1425 11181 --
NM_003288chr201995 ----11249
NM_003292chr111607 11407 ----
NM_003298chr3116098 3957 3811 2186 2162 1941 1578 1566 992 496 205 13863 25484 5160 --
NM_003300chr14166 ------
NM_003304chr331555 1366 567 ----1274
NM_003305chr42375 354 1339 ----
NM_003309chr661747 1586 1301 290 86 62 11631 198 --
NM_003311chr111254 ------
NM_003319chr23775 658 353 ------
NM_003320chr11104373 4066 3670 3438 3112 2820 1460 734 696 621 21741 1163 24454 4120 13149
NM_003336chrX1331 1918 ----
NM_003337chr521612 1131 21725 325 11740 --
NM_003338chr101539 21750 550 11950 --
NM_003339chr541623 449 339 86 11152 ----
NM_003340chr42295 200 1479 ----
NM_003342chr1773062 2837 2669 2475 1324 567 338 12700 22565 681 --
NM_003344chr721743 536 --1420 --
NM_003345chr161450 ------
NM_003348chr1231310 256 163 ------
NM_003350chr8158 2363 26 ----
NM_003368chr12537 306 --1518 --
NM_003369chr1162135 977 859 292 206 193 ------
NM_003370chr19160 ------
NM_003371chr92783 454 ------
NM_003373chr1031662 694 448 --11804 --
NM_003376chr6----1466 --
NM_003376chr6----1466 --
NM_003380chr101261 --187 --
NM_003390chr1121097 201 --1307 --
NM_003391chr72718 363 ------
NM_003392chr353146 2967 2859 1399 539 --13085 --
NM_003404chr2061999 1859 1481 1473 1359 746 --1589 --
NM_003405chr222801 192 ------
NM_003406chr861928 1722 1577 1501 1430 1377 ------
NM_003409chr1841247 215 204 134 ------
NM_003410chrX73073 2053 2017 1998 1185 696 503 ----12198
NM_003411chrY31603 1236 686 ----11751
NM_003412chr322297 1112 12933 1648 --
NM_003413chrX41648 1393 576 443 1729 ----
NM_003418chr31222 ------
NM_003439chr731362 800 157 --12202 --
NM_003454chr1641431 1315 1099 341 11212 21159 1074 --
NM_003458chr363809 3798 3365 2626 2517 261 --33126 2778 357 --
NM_003463chr6133301 3165 3097 2957 2758 2287 1057 873 808 802 685 676 233 ------
NM_003466chr221678 885 --12525 --
NM_003467chr22195 120 ------
NM_003468chr2123945 3697 3404 1635 1565 1179 1115 847 687 621 307 221 11468 3727 481 417 13004
NM_003470chr1661789 1667 1557 1176 714 352 --21811 1648 --
NM_003471chr31144 2905 647 ----
NM_003472chr641228 1086 960 235 11245 ----
NM_003474chr1071942 1610 1571 1464 751 406 354 --1291 --
NM_003478chr1132238 332 47 23069 126 ----
NM_003483chr1222061 1906 --32795 1177 1035 --
NM_003487chr17172 ------
NM_003489chr2141236 592 365 341 13027 13118 --
NM_003498chr1651950 1003 867 578 361 ------
NM_003503chr11817 11255 ----
NM_003505chr731964 1913 1209 ------
NM_003507chr261770 1263 610 475 441 284 ------
NM_003557chr151389 1315 1146 1104 205 ------
NM_003558chr93614 505 261 ------
NM_003559chr1763888 3283 3198 3189 1375 1135 23905 817 23128 1073 --
NM_003563chr1721135 348 ------
NM_003565chr1241438 1203 1163 207 ------
NM_003566chr1243454 950 742 496 ----23304 2997
NM_003567chr11282 ------
NM_003571chr31222 1165 ----
NM_003574chr18135130 5094 5051 4043 3882 3813 2290 1985 1675 1488 629 452 138 44424 2074 1668 1647 12049 --
NM_003576chr1332721 567 508 1375 1291 --
NM_003581chr2----1662 --
NM_003583chr1253220 2662 847 789 734 32926 2470 190 12819 --
NM_003589chr1311395 ------
NM_003590chr253821 3185 2626 1548 1220 --23699 1187 --
NM_003591chr102273 84 --1306 --
NM_003600chr202679 540 --1297 1148
NM_003603chr421355 328 195 1492 --
NM_003607chr154030 1124 1077 348 255 14177 13148 14228
NM_003615chr3113954 3717 3343 3098 2498 1287 1135 822 754 278 130 33669 848 838 --1413
NM_003618chr231133 199 101 ----1328
NM_003620chr171394 11048 ----
NM_003621chr11------2486 398
NM_003622chr12253 32 1483 ----
NM_003624chr192405 37 11356 ----
NM_003626chr1131370 1240 1221 ------
NM_003629chr1133320 3248 2578 2485 2270 2177 1335 1240 1173 1042 895 422 358 13153 42939 2911 2124 988 --
NM_003631chr1021013 824 ------
NM_003632chr172831 713 1604 ----
NM_003633chr562404 1638 1591 1012 717 263 --1783 --
NM_003637chr12488 328 ------
NM_003644chr17136321 5726 4948 4868 4813 4307 4230 1894 1634 1242 1053 596 252 --25364 4122 --
NM_003651chr122530 405 ------
NM_003654chr11--2776 77 ----
NM_003658chr112341 188 1218 1579 --
NM_003659chr221073 786 ------
NM_003663chr393362 3037 2545 2496 2343 2221 988 783 308 23185 2884 ----
NM_003664chr53194 68 47 1142 ----
NM_003670chr341204 484 191 25 ------
NM_003671chr973390 2671 1446 1361 1028 553 107 --11067 1571
NM_003672chr121808 108 ----11266
NM_003673chr172284 93 ------
NM_003676chr1--1651 ----
NM_003681chr21135888 5764 5363 5279 4903 4802 1591 1301 1239 1223 932 406 42 181 32348 1465 168 --
NM_003684chr161134 1007 950 884 402 206 --11120 --
NM_003685chr193642 203 193 --2996 947 --
NM_003692chr92204 53 ------
NM_003701chr1321048 772 --1807 --
NM_003704chr42669 96 ------
NM_003709chr2142 ------
NM_003710chr152444 115 ------
NM_003716chr33980 738 700 1987 ----
NM_003718chr71487 ------
NM_003722chr332662 2221 265 12601 ----
NM_003726chr172265 36 ------
NM_003728chr42532 466 ------
NM_003735chr531725 1371 709 --11532 --
NM_003736chr531725 1371 709 --11532 --
NM_003743chr23793 457 162 --11950 --
NM_003749chr1342311 1837 932 534 11561 1325 --
NM_003750chr103748 723 74 ----133
NM_003758chr1531273 1122 451 1457 ----
NM_003758chr1531273 1122 451 1457 ----
NM_003762chr1----11233 --
NM_003763chr2022919 1216 --13001 --
NM_003766chr171383 129 ----
NM_003768chr111177 21533 1497 ----
NM_003769chr122261 51 ----193
NM_003774chr1253386 2373 2058 1026 735 1205 11047 12649
NM_003780chr1------1702
NM_003787chr1841480 615 225 165 11322 ----
NM_003795chr61105 1174 ----
NM_003796chr192424 242 ------
NM_003797chr112191 169 ------
NM_003798chr91181 ------
NM_003800chr642362 2309 2277 1842 1821 11543 --
NM_003816chr831311 545 30 ------
NM_003818chr203955 381 109 ------
NM_003822chr133035 609 26 22895 128 --1617
NM_003825chr1541282 374 293 189 ------
NM_003829chr91159 ------
NM_003831chr182292 113 1386 21828 122 --
NM_003861chr1482637 2459 2323 1950 1887 855 464 130 12422 12849 --
NM_003862chr51244 ------
NM_003870chr1512096 11435 ----
NM_003872chr282793 2786 2718 1993 864 818 631 536 --31984 773 466 --
NM_003873chr1031940 944 628 11691 1754 --
NM_003876chr17----1285 --
NM_003884chr341668 1512 590 46 11793 21580 548 --
NM_003885chr1762172 1894 1721 856 552 85 ----12216
NM_003888chr1551604 1261 371 322 54 ------
NM_003895chr2122229 34 1444 11637 --
NM_003896chr21769 ------
NM_003901chr1042682 2573 967 785 1825 21884 1707 --
NM_003902chr11278 ----1340
NM_003908chr2051412 1160 1055 895 339 --1229 --
NM_003909chr842789 2060 688 383 --42895 2284 1230 488 12686
NM_003913chr674048 3261 3229 2649 1321 1075 1029 33752 3089 972 --1184
NM_003916chrX31508 1124 98 11214 ----
NM_003924chr441125 377 357 339 --21429 1317 --
NM_003930chr7145 12238 11870 --
NM_003931chr6295 56 1530 ----
NM_003932chr2241722 1359 1309 468 1481 1120 --
NM_003934chr92898 278 ------
NM_003938chr192410 67 ------
NM_003939chr1094049 2945 2821 1489 1223 631 476 377 237 13338 13712 --
NM_003941chr731909 132 123 12215 ----
NM_003942chr11--1180 1695 --
NM_003947chr321336 1265 11027 ----
NM_003949chr1761866 1783 1739 1681 1289 65 ------
NM_003951chrX1283 ------
NM_003953chr172692 2620 2197 2102 1936 1855 246 1335 ----
NM_003956chr10--1111 145 1508
NM_003958chr643150 2711 400 157 23830 1399 22491 831 --
NM_003968chr33673 179 106 ------
NM_003970chr82355 63 1452 1133 --
NM_003981chr154785 707 97 40 ------
NM_003993chr11337 --168 --
NM_003994chr1253795 3770 1401 702 313 --21745 1271 --
NM_003998chr41476 ------
NM_004006chrX12123 22657 2633 --1418
NM_004007chrX12123 22657 2633 --1418
NM_004009chrX12123 22657 2633 --1418
NM_004010chrX12123 22657 2633 --1418
NM_004011chrX12123 22657 2633 --1418
NM_004012chrX12123 22657 2633 --1418
NM_004013chrX12123 22657 2633 --1418
NM_004014chrX12123 22657 2633 --1418
NM_004015chrX12123 22657 2633 --1418
NM_004016chrX12037 22571 2547 --1332
NM_004017chrX12123 22657 2633 --1418
NM_004018chrX12037 22571 2547 --1332
NM_004020chrX12123 22657 2633 --1418
NM_004021chrX12037 22571 2547 --1332
NM_004022chrX12037 22571 2547 --1332
NM_004023chrX12037 22571 2547 --1332
NM_004024chr121192 445 11175 ----
NM_004028chr1863467 3333 2974 1578 1519 1333 ------
NM_004035chr17104948 4910 4782 4331 4299 4057 3410 3309 2052 1623 14756 ----
NM_004036chr22657 185 1699 ----
NM_004037chr13686 663 113 ------
NM_004040chr251256 1019 297 258 188 ------
NM_004050chr1441997 1045 1024 893 11889 ----
NM_004055chr1131623 1456 635 ------
NM_004059chr93405 185 63 ------
NM_004061chr51243 ------
NM_004067chr751295 1250 628 229 150 --1591 --
NM_004068chr34401 110 102 87 ------
NM_004071chr21220 ------
NM_004073chr1382 54 32 ------
NM_004080chr721457 1025 ------
NM_004081chrY21851 1739 --11608 --
NM_004085chrX2702 276 ------
NM_004086chr142553 164 182 ----
NM_004087chr31152 11943 11713 1685
NM_004089chrX2883 812 ------
NM_004093chr1342688 2610 2074 1102 13183 127 --
NM_004094chr1441072 1058 964 747 --1665 12788
NM_004096chr1052070 1607 673 666 545 ------
NM_004098chr1011189 ------
NM_004099chr931977 1317 366 --11921 1421
NM_004100chr622117 1654 199 --22662 657
NM_004102chr13435 250 242 ------
NM_004103chr82738 63 ------
NM_004105chr23420 321 186 11055 ----
NM_004112chr171283 11424 ----
NM_004114chrX1877 1905 ----
NM_004116chr22483 83 1308 ----
NM_004124chr1453569 3301 3041 2900 2169 --1797 --
NM_004126chr72293 76 ------
NM_004130chr33606 553 207 ------
NM_004133chr831962 664 260 2544 334 ----
NM_004134chr51622 ------
NM_004156chr83569 121 23 ------
NM_004161chr231042 395 258 ------
NM_004163chr181108 ------
NM_004170chr91324 --11501 --
NM_004171chr11129475 8573 8055 7390 6361 6138 2506 1835 1660 1036 891 841 3651 532 199 37812 1372 182 --
NM_004175chr223377 216 69 ------
NM_004177chr1151454 1235 706 318 71 ------
NM_004183chr114753 640 556 180 ------
NM_004187chrX1586 11251 ----
NM_004193chr10132 1551 ----
NM_004200chr1143269 1195 1034 230 ------
NM_004202chrY149 ------
NM_004203chr162112 45 ------
NM_004225chr81127 --1139 --
NM_004227chr753010 2884 2824 2663 546 --12737 --
NM_004229chrX72113 1980 1691 1548 1524 1368 745 11538 ----
NM_004232chr1863319 3219 2688 755 661 406 13273 22674 170 --
NM_004235chr92578 70 2755 715 ----
NM_004236chr15----1132 --
NM_004237chr51826 --126 --
NM_004238chr22275 23 ------
NM_004239chr142153 120 ------
NM_004241chr101734 ------
NM_004242chr61161 --1345 --
NM_004253chr92955 324 ------
NM_004263chr251571 1553 1113 340 219 ------
NM_004268chr1131048 971 936 11178 2286 177 --
NM_004272chr531672 447 378 ------
NM_004274chr1443137 2723 904 783 12952 1746 --
NM_004279chr752372 2175 1839 865 354 --12348 --
NM_004281chr101170 ----144
NM_004293chr953847 3457 682 662 126 1852 1617 --
NM_004295chr1781275 985 973 382 304 269 168 155 ------
NM_004297chr9172 ------
NM_004301chr34347 314 265 251 ------
NM_004302chr1271822 1103 817 719 709 633 585 ------
NM_004309chr1741088 1054 789 157 ------
NM_004311chr1042931 2767 2511 72 ------
NM_004316chr1221096 1073 --179 1952
NM_004319chr172872 2478 2305 2140 891 544 260 ------
NM_004321chr2103366 3032 2779 2700 2582 2427 2371 1224 664 478 23508 2882 1656 --
NM_004326chr12129 63 --1289 --
NM_004329chr105932 527 402 294 240 --1342 11010
NM_004330chr1521202 947 1400 ----
NM_004331chr831788 793 725 11757 ----
NM_004338chr18146860 6622 6369 5932 4963 4928 4853 4683 4664 2690 1841 1269 646 279 15446 35627 5126 4946 --
NM_004342chr752302 1932 737 513 201 --11487 --
NM_004343chr192575 405 ------
NM_004349chr811236 1346 ----
NM_004354chr41191 1601 ----
NM_004357chr112539 473 --1146 --
NM_004359chr192498 165 ------
NM_004360chr1651846 1536 1314 463 428 ------
NM_004362chr41569 1686 ----
NM_004364chr192854 123 1938 3988 347 290 --
NM_004369chr22181 114 1593 ----
NM_004370chr662127 1557 760 565 546 79 32164 1949 377 11625 --
NM_004379chr22593 245 21274 368 2577 155 --
NM_004380chr1642551 639 616 317 ------
NM_004384chr562128 1912 1828 1451 1438 53 21785 153 1231 --
NM_004385chr51460 --162 --
NM_004386chr1972157 2123 1893 1820 628 373 208 ------
NM_004389chr22717 129 ------
NM_004392chr1322340 925 12111 ----
NM_004393chr362221 1625 1466 558 415 376 --12408 --
NM_004397chr1153460 3405 3244 2662 568 11731 13238 1462
NM_004405chr22802 283 ------
NM_004411chr73319 263 172 ------
NM_004412chr1085887 5408 4186 3730 2252 742 716 315 24360 212 ----
NM_004415chr6188 --1653 --
NM_004416chr125924 657 388 313 32 ------
NM_004422chr174461 151 84 69 ------
NM_004424chr16--1148 ----
NM_004426chr1212002 1777 ----
NM_004428chr14798 716 268 70 ------
NM_004429chrX31458 378 176 --1206 --
NM_004430chr831099 872 41 --11041 --
NM_004432chr972249 1898 1808 1767 327 253 86 --1384 --
NM_004433chr151800 1708 1663 440 268 1693 21552 667 --
NM_004434chr1421773 329 ------
NM_004438chr232480 2239 413 ------
NM_004440chr621600 1380 1290 11337 --
NM_004442chr11592 --11062 --
NM_004447chr123729 399 54 --11101 --
NM_004454chr342311 1606 378 221 11990 11596 --
NM_004456chr71168 142 ----
NM_004457chr231628 521 179 --1604 --
NM_004458chrX51700 770 683 608 377 22257 1064 ----
NM_004459chr172692 545 ------
NM_004461chr191200 ------
NM_004464chr42982 878 21622 244 24343 60 --
NM_004469chrX2182 51 ------
NM_004475chr173267 233 152 --2369 251 1102
NM_004481chr132452 2176 1903 --31727 1701 526 --
NM_004483chr16--157 ----
NM_004484chrX1300 ------
NM_004491chr1983442 3356 3134 3055 1704 1311 595 317 ------
NM_004492chr152226 49 ------
NM_004496chr1431160 1075 862 11217 1403 --
NM_004498chr152386 279 ------
NM_004499chr52198 40 ------
NM_004500chr1421896 234 11558 ----
NM_004501chr174042 3318 1642 1417 875 314 108 12822 43948 3817 1146 328 --
NM_004502chr171386 ------
NM_004504chr23996 661 76 ----12873
NM_004505chr172562 284 --1667 --
NM_004506chr63469 140 95 ------
NM_004512chr93301 254 45 ------
NM_004514chr1742633 2284 597 216 ------
NM_004516chr1961211 785 450 320 189 92 1385 ----
NM_004517chr111206 ------
NM_004519chr81188 ------
NM_004520chr51100 ------
NM_004521chr10------1291
NM_004525chr221242 384 --1147 --
NM_004537chr1221238 484 1186 11258 --
NM_004540chr21----1832 --
NM_004554chr1491572 1483 1297 1215 1158 354 279 191 142 ------
NM_004566chr1052533 2056 1783 1738 215 --1881 --
NM_004569chr143568 483 31 ------
NM_004571chr2163414 3180 2703 2393 2109 1302 --22973 2750 --
NM_004575chr431626 1578 1214 ------
NM_004576chr52319 270 ------
NM_004578chr1----1869 --
NM_004580chr151512 1344 11225 1237
NM_004586chrX65071 3856 2142 517 497 149 13701 11381 14222
NM_004588chr1184002 3656 3644 3341 1269 832 355 89 24038 3624 13351 --
NM_004591chr23172 118 103 ------
NM_004593chr33806 583 94 1673 1189 --
NM_004595chrX1430 ------
NM_004598chr583240 2969 2557 2025 1168 622 418 410 --1686 --
NM_004602chr2031174 557 65 ------
NM_004603chr741097 779 449 309 ------
NM_004612chr9104620 4537 4529 4101 2967 1484 1276 844 824 619 33853 1788 374 23132 664 --
NM_004616chr12153 ------
NM_004626chr111471 --1138 --
NM_004630chr111248 --1239 --
NM_004631chr131447 428 25 ------
NM_004637chr32897 391 ------
NM_004639chr6196 ------
NM_004642chr121510 ------
NM_004643chr142733 184 --1566 --
NM_004645chr17136 ------
NM_004654chrY3938 376 70 ------
NM_004655chr1741251 1126 526 57 1422 1855 --
NM_004660chrY11552 22021 245 ----
NM_004661chr521214 270 ------
NM_004663chr1511241 1523 ----
NM_004664chr12160 ------
NM_004667chr15188 ------
NM_004670chr1091548 1515 1499 1160 1147 360 319 132 71 ----11604
NM_004671chr18145 ------
NM_004673chr1--11197 21101 515 --
NM_004687chr1751824 1693 1480 536 482 ------
NM_004689chr141449 ------
NM_004694chr171784 --1817 --
NM_004703chr1762144 2127 1708 1032 553 291 1394 ----
NM_004709chrX51820 1427 499 484 44 --1168 --
NM_004713chr142758 119 --1722 --
NM_004719chr12--22443 2420 22677 654 --
NM_004723chr12819 233 ------
NM_004724chr112501 28 ------
NM_004726chrX155521 5514 5328 5056 4792 4483 4000 3796 3614 1940 1781 1691 776 767 407 14311 ----
NM_004729chrX92104 1848 1732 1643 1535 1485 319 112 54 ------
NM_004730chr531738 1454 31 21588 94 ----
NM_004733chr32610 184 ------
NM_004734chr1372685 2302 2154 1149 1054 905 899 --12703 --
NM_004736chr132028 1965 1955 1844 ----
NM_004737chr223434 342 97 ------
NM_004738chr2062161 2140 2124 1831 464 121 --32032 627 473 --
NM_004739chr112560 410 ------
NM_004742chr311254 11834 1380 2477 61
NM_004744chr452785 2659 1331 989 149 1859 ----
NM_004745chr875932 5766 5127 4902 4558 1663 198 16655 ----
NM_004747chr101479 --21072 607 1221
NM_004748chr1583724 3379 3328 3086 2717 1668 733 651 1987 1681 176
NM_004757chr41538 ------
NM_004759chr152169 2089 1371 778 441 --1503 --
NM_004760chr732025 881 520 1545 22049 941 --
NM_004762chr1751990 1703 787 771 623 ------
NM_004766chr3----180 --
NM_004772chr531263 328 278 1130 ----
NM_004774chr1732496 2158 540 ----22576 2460
NM_004775chr1862304 2284 2230 850 814 313 12172 ----
NM_004776chr2082955 2728 2463 2402 1161 1050 640 112 32271 299 25 ----
NM_004779chr52526 45 --1972 --
NM_004781chr131546 1202 387 --2208 146 1444
NM_004781chr131546 1202 387 --2208 146 1444
NM_004785chr161365 ------
NM_004788chr111390 --32538 2049 867 --
NM_004789chr9------1312
NM_004796chr1452379 2202 1692 776 741 11640 ----
NM_004798chr20123105 2478 1469 1403 1374 1108 925 687 597 493 301 42 --12571 --
NM_004800chr13177 --1174 --
NM_004801chr21257 ------
NM_004805chr24924 907 459 238 ------
NM_004817chr91602 ------
NM_004824chr621330 1072 ------
NM_004840chrX2362 347 --2910 32 12473
NM_004841chr13836 188 150 --1875 --
NM_004844chr321032 981 11199 ----
NM_004845chrX63826 3107 1628 796 468 314 1590 ----
NM_004857chr1413263 --1280 --
NM_004859chr1742473 1952 1911 526 --1693 --
NM_004862chr1641608 1081 444 127 2496 394 ----
NM_004863chr14105066 4614 4123 3984 3318 1971 1792 1436 942 234 --1436 --
NM_004866chr544729 1092 902 468 23950 159 24887 3341 11795
NM_004867chrX--1123 ----
NM_004869chr1821586 1189 11312 11434 --
NM_004871chr1794306 3170 1512 1445 731 570 385 247 88 23896 2672 23579 1617 --
NM_004873chr1473182 2769 1274 1151 723 146 49 12745 ----
NM_004874chr81427 ------
NM_004879chr112342 276 ------
NM_004883chr5--1169 ----
NM_004893chr51235 1483 --1374
NM_004896chr1031437 339 237 --1204 --
NM_004897chr101118 ------
NM_004898chr492835 2735 2672 2332 2291 1993 1962 362 242 1924 ----
NM_004902chr201223 --1287 1593
NM_004904chr7136064 6051 5207 4880 4751 4652 4614 2551 2463 1715 847 811 154 11536 34502 2112 229 --
NM_004905chr11183 --1763 --
NM_004912chr711182 ------
NM_004924chr19----2402 258 --
NM_004925chr92879 721 ------
NM_004926chr1431202 657 296 --21310 375 --
NM_004929chr821490 264 --1468 --
NM_004930chr1----1603 --
NM_004936chr952030 1184 1143 1083 283 2960 189 ----
NM_004937chr1721073 170 ----1824
NM_004945chr192805 164 --1577 --
NM_004947chr322353 273 ------
NM_004949chr1852090 2084 1662 814 624 2586 462 ----
NM_004952chr11775 --1936 --
NM_004953chr33418 121 105 ------
NM_004955chr62538 117 --1573 --
NM_004956chr753438 2811 1511 1119 429 1588 ----
NM_004957chr91157 --3671 176 77 --
NM_004961chrX41479 1111 398 155 --1409 --
NM_004969chr101442 ------
NM_004973chr63705 478 91 ------
NM_004976chr1185098 4950 4930 3825 3655 2021 1583 1527 15167 ----
NM_004978chr151625 1324 1103 577 416 ------
NM_004982chr12----1628 --
NM_004985chr1264167 4019 3200 3029 1185 259 11405 24320 1541 --
NM_004992chrX138347 8055 7004 6612 6201 5782 5417 5404 5372 3195 2205 1850 1238 18547 17495 --
NM_004992chrX138347 8055 7004 6612 6201 5782 5417 5404 5372 3195 2205 1850 1238 18547 17495 --
NM_004993chr1421046 373 ------
NM_004995chr1421495 277 ------
NM_004998chr153916 889 645 --1383 --
NM_004999chr674467 3983 1460 1369 1238 1028 654 11393 1946 1548
NM_005010chr721952 463 --1839 --
NM_005012chr1------1144
NM_005020chr71592 --140 --
NM_005026chr141731 404 384 125 ------
NM_005028chr1052269 2079 2058 1676 1551 --12312 --
NM_005032chrX31004 396 76 1762 ----
NM_005033chr4------1143
NM_005036chr2286903 6470 6039 3288 2403 1248 550 360 38341 866 300 11327 27937 2315
NM_005044chrX94456 4317 4014 3299 2948 1497 634 282 91 --34369 3959 1112 13882
NM_005045chr71204 ------
NM_005056chr12175010 4900 4403 4270 4116 3950 3797 3593 3512 2066 1648 1545 1212 1124 1002 823 28 11560 21929 447 14481
NM_005057chr161268 1198 542 399 379 108 1766 ----
NM_005060chr12995 532 ------
NM_005063chr1083735 3500 3422 3125 2906 2798 2510 171 ----12941
NM_005065chr1484374 4289 2158 1838 1510 1444 466 158 11756 12052 --
NM_005066chr11311 ------
NM_005067chr33649 335 88 ----1619
NM_005068chr621432 1284 ------
NM_005069chr2171712 1705 1426 646 628 516 296 11228 ----
NM_005070chr21246 ------
NM_005076chr143069 2719 832 320 --13140 --
NM_005077chr91389 ------
NM_005079chr831146 910 355 22875 312 23200 102 --
NM_005080chr223694 369 201 --1941 --
NM_005087chr3154 --1214 --
NM_005093chr2094973 4704 4563 3827 1659 1605 1448 1339 49 14207 15245 --
NM_005094chr93721 277 161 ------
NM_005095chr112088 --1769 --
NM_005099chr131063 512 484 ------
NM_005102chr22723 682 ------
NM_005104chr63656 619 553 1724 ----
NM_005109chr341928 973 274 245 1315 ----
NM_005110chr5----2157 142 --
NM_005112chr43771 755 159 ------
NM_005113chr142395 34 ------
NM_005116chr2051730 1615 469 176 164 13278 ----
NM_005117chr11169 ------
NM_005119chr141204 1086 1007 826 ------
NM_005121chr1743687 1344 598 528 2537 477 ----
NM_005124chr6151 ------
NM_005126chr332180 2024 1585 11684 ----
NM_005128chr211477 --193 --
NM_005133chr111381 ------
NM_005134chr185988 658 652 349 271 --122 --
NM_005135chr1533348 3262 22 ------
NM_005151chr184790 623 323 284 1432 --12270
NM_005154chr151496 --1534 --
NM_005156chr9125381 5106 4243 3910 3803 3611 3587 1716 1441 1236 1068 674 --14072 11058
NM_005159chr1582273 2195 1892 1458 1397 874 238 134 21966 152 11560 --
NM_005161chr1172223 1804 1516 770 428 340 59 1152 12200 --
NM_005168chr271784 1580 1558 1487 1388 582 320 11472 11613 --
NM_005171chr12------1816
NM_005180chr1061547 1489 1342 1215 1190 111 --1417 --
NM_005187chr1631585 369 77 ------
NM_005188chr11277984 7886 7611 7460 7352 7292 6895 6768 6186 5999 5943 5675 5582 5435 5350 2865 2853 2829 2682 2502 2237 1710 1704 1681 1332 961 378 16079 67192 7000 6246 5927 1915 1175 --
NM_005189chr1792422 2391 1677 797 689 442 396 301 204 12489 32322 1847 1620 --
NM_005190chr6168 --1839 --
NM_005197chr1486193 5691 5374 5183 4047 4040 1680 1481 15047 24798 902 --
NM_005204chr104996 844 264 141 ------
NM_005206chr172899 374 --11164 --
NM_005207chr2273379 2737 1430 1019 598 417 28 11492 12289 --
NM_005208chr17195 ------
NM_005214chr23902 775 417 --1817 --
NM_005217chr82112 38 ------
NM_005219chr53333 126 68 1274 21256 396 --
NM_005220chr1721462 336 --11048 --
NM_005222chr73958 837 244 ------
NM_005225chr2031022 937 438 ------
NM_005227chr11455 ------
NM_005231chr113919 175 148 11293 11193 --
NM_005233chr342507 983 680 219 2615 141 ----
NM_005235chr2137822 7768 7314 7271 7158 6730 6290 5137 4785 3104 1972 512 151 25918 2888 ----
NM_005238chr1132734 2533 1372 22818 1175 33373 2957 334 --
NM_005241chr331349 1325 430 194 ----
NM_005244chr20----2666 492 1612
NM_005245chr44706 489 83 24 1591 ----
NM_005249chr142647 256 1818 ----
NM_005252chr141296 ------
NM_005254chr1521103 1013 21257 1234 1870 --
NM_005256chr112838 353 1359 ----
NM_005257chr1841154 880 347 58 11258 1119 --
NM_005259chr21988 1331 ----
NM_005275chr62105 43 ------
NM_005277chr451922 1759 730 610 96 --21835 1327 11729
NM_005279chr2161 ------
NM_005302chr7----1163 --
NM_005308chr101527 ------
NM_005311chr752566 2546 2452 1070 1058 1967 22757 750 --
NM_005316chr1131119 350 329 --1839 --
NM_005318chr2221262 1159 --1893 --
NM_005324chr1731805 1754 1584 ------
NM_005327chr4166 --3657 527 257 --
NM_005328chr8--1304 ----
NM_005329chr1652313 2044 1660 1444 643 --11715 1569
NM_005336chr252167 1885 1733 902 749 21985 823 12147 --
NM_005338chr733455 1157 416 --1881 --
NM_005339chr494223 4020 3547 2855 1703 1426 741 595 432 1996 14008 --
NM_005342chrX92777 2764 2638 2353 1039 565 478 189 82 ------
NM_005348chr141199 ----1684
NM_005359chr18156422 5743 5099 4828 4550 4346 4225 4171 2541 2484 1820 1718 1269 602 138 24070 101 14872 --
NM_005370chr193914 339 48 ------
NM_005375chr611158 11094 ----
NM_005376chr131121 381 29 ------
NM_005378chr22738 341 ------
NM_005385chr352571 988 871 755 748 ------
NM_005386chr202811 730 ------
NM_005387chr111155 ------
NM_005397chr733177 2450 212 33903 3090 3010 21082 429 --
NM_005399chr1144292 4188 3778 3477 3273 1699 1612 1581 1009 980 953 893 146 98 12814 24257 3793 --
NM_005400chr242255 1105 595 476 22952 2835 1640 --
NM_005402chr731733 396 380 2600 534 --11801
NM_005406chr182278 146 1617 ----
NM_005407chr143591 167 93 --21576 1336 --
NM_005410chr51236 2639 269 ----
NM_005415chr21154 ------
NM_005417chr2021696 1530 ----11842
NM_005418chr111138 --2256 32 --
NM_005429chr41121 ------
NM_005433chr1821844 525 ----12518
NM_005435chr72500 177 --1171 --
NM_005436chr1073932 3648 3135 2805 2744 2672 1517 34076 3662 3261 23611 3182 --
NM_005437chr1011125 11062 1990 --
NM_005442chr32102 69 --1430 --
NM_005443chr4188 1152 ----
NM_005447chr12128 ------
NM_005455chr161587 1284 1142 653 231 221 11526 11668 2639 178
NM_005458chr922159 1942 12193 ----
NM_005461chr2041762 1483 1235 388 ------
NM_005465chr11803 21905 250 ----
NM_005471chr531244 1152 63 11105 ----
NM_005474chr1741535 1386 636 462 1402 2371 210 --
NM_005475chr1243024 2879 2826 2022 ----1875
NM_005476chr92206 63 ------
NM_005479chr1031509 1455 1329 1410 1516 --
NM_005487chr2241895 601 595 180 3419 410 281 21481 779 --
NM_005488chr222643 93 --1735 --
NM_005493chr62794 306 ----1758
NM_005494chr72246 210 1615 ----
NM_005497chr1765616 3916 1964 1312 740 500 21335 919 2240 27 --
NM_005501chr171303 --11166 --
NM_005502chr962724 2557 1190 691 633 206 --1191 --
NM_005503chr154774 284 258 183 --1317 --
NM_005509chr521166 101 1154 1728 --
NM_005512chr1151696 1677 1531 633 401 ------
NM_005520chr52520 486 ------
NM_005521chr101831 ------
NM_005523chr71482 --1592 --
NM_005530chr1531183 223 203 ------
NM_005536chr8134 ------
NM_005537chr133780 160 65 1895 ----
NM_005539chr1031001 904 556 ------
NM_005541chr231071 1056 274 --11186 1413
NM_005542chr731467 1448 398 ------
NM_005544chr211015 ------
NM_005552chr142530 111 --1576 --
NM_005558chr12726 402 ------
NM_005563chr11634 ------
NM_005566chr111418 ------
NM_005575chr5----1177 --
NM_005578chr3104772 4542 4374 4095 2060 2045 1933 1862 1244 946 34042 494 125 1392 14173
NM_005594chr12129 ------
NM_005595chr11945 ------
NM_005596chr995857 5834 5685 4911 4774 4344 4208 1939 1047 1430 31879 1489 1330 --
NM_005598chr11510 --1674 --
NM_005604chr662500 2249 2163 1873 630 258 21864 636 ----
NM_005610chr14939 919 810 370 ------
NM_005613chr132162 1621 437 11979 --194
NM_005614chr711104 --11005 --
NM_005626chr12147 124 ------
NM_005634chrX2536 111 ------
NM_005638chrX31746 441 415 1167 11359 --
NM_005639chr1221849 1478 ------
NM_005644chr11415 198 ----
NM_005647chrX53139 3125 696 669 620 --13466 1924
NM_005650chr2221098 151 ------
NM_005652chr1631222 1188 865 --11141 --
NM_005655chr8------1947
NM_005665chr163645 3144 1896 1121 811 165 13374 24924 4381 --
NM_005667chr22161 50 ------
NM_005668chr532916 947 532 11424 12800 14188
NM_005677chr331321 1105 1051 1192 11269 --
NM_005682chr1611344 ------
NM_005686chr161411 981 633 511 353 300 ----11497
NM_005688chr331103 935 96 ------
NM_005692chr71158 ------
NM_005704chr121020 79 --1939 --
NM_005707chr1531225 169 137 ------
NM_005715chr622753 1790 22601 1018 1978 --
NM_005717chr161267 1171 1101 932 123 115 1871 ----
NM_005718chr35725 303 277 197 145 ------
NM_005720chr73200 77 22 --1185 --
NM_005721chr2----1961 --
NM_005722chr24991 349 243 37 --1142 --
NM_005725chr142390 1698 639 502 2798 240 ----
NM_005730chr12173602 3279 3025 2917 2740 2719 2306 2229 1297 1289 1235 1147 967 680 629 468 94 21444 1324 21081 58 --
NM_005731chr21166 ------
NM_005734chr113804 280 186 ----1556
NM_005736chr1021356 1145 ------
NM_005737chr232689 2050 763 12424 1723 --
NM_005738chr75340 322 181 155 71 ------
NM_005740chr223910 338 120 ------
NM_005742chr21621 ------
NM_005746chr71492 1345 ----
NM_005748chr1243378 2911 2426 1252 --13202 --
NM_005749chr171548 ----1694
NM_005751chr7----174 --
NM_005754chr53979 922 337 1947 1802 --
NM_005756chrX31457 1314 389 --11165 --
NM_005759chr253679 3550 3140 3074 1787 13974 11861 --
NM_005761chr121125 ------
NM_005765chrX2668 143 ----177
NM_005766chr132995 35 11361 ----
NM_005767chr132306 261 --164 --
NM_005768chr122199 131 1535 ----
NM_005775chr82475 256 ------
NM_005776chr14--1619 ----
NM_005778chr32390 92 ------
NM_005779chr553206 3141 2957 2635 522 --1818 --
NM_005786chr181986 --1423 --
NM_005789chr1762077 1912 1854 1417 1335 56 1752 1324 --
NM_005795chr2135 1767 12238 --
NM_005808chr373440 3228 3221 2877 1060 782 231 22401 482 1404 --
NM_005813chr242308 923 778 301 ------
NM_005819chr163433 3002 2343 2182 594 279 11164 ----
NM_005822chr651686 940 803 81 48 --1856 --
NM_005826chr11241 1409 ----
NM_005828chr17164544 3878 3763 1933 1840 1367 1121 1046 1022 634 592 439 351 331 112 102 21728 550 34276 1392 977 --
NM_005832chr32948 169 ------
NM_005839chr11795 --1877 --
NM_005840chrX117088 6894 6842 6457 4696 2469 2312 2169 1611 554 170 24727 2825 37390 7139 383 11035
NM_005841chr4--1934 1954 --
NM_005842chr131142 1500 ----
NM_005851chr111354 --1393 --
NM_005853chr161604 1188 ----
NM_005857chr141435 1389 1302 1178 --11453 --
NM_005859chr5----11508 --
NM_005863chr1021121 1001 1542 ----
NM_005864chr142652 231 --1157 --
NM_005871chr101351 ------
NM_005875chr32404 66 ------
NM_005880chr161288 ----181
NM_005882chr41891 ------
NM_005884chr191819 ------
NM_005885chr531042 632 520 ------
NM_005895chr1294146 4092 3176 2781 2733 1543 912 253 116 11560 14007 --
NM_005896chr2133 ------
NM_005898chr1142823 2329 2126 625 ------
NM_005899chr1731497 578 308 ------
NM_005901chr18158489 8203 7367 6916 6638 3425 2976 2884 2748 2580 2362 1829 1580 553 192 66465 6441 3142 2100 875 249 28623 473 --
NM_005903chr565079 2059 1449 998 796 276 13849 45176 4681 1901 1070 --
NM_005904chr183469 422 83 11378 11200 --
NM_005907chr621659 537 1377 ----
NM_005909chr543670 3581 3434 3281 54146 2640 1300 943 315 24227 1173 --
NM_005910chr1753617 1483 1029 846 143 --23749 1564 --
NM_005911chr22454 281 --21414 1048 --
NM_005917chr21132 ------
NM_005920chr153789 3048 2633 2393 113 ------
NM_005924chr73429 276 218 1918 ----
NM_005927chr531157 869 837 ------
NM_005928chr15133 ------
NM_005933chr1152788 2471 831 755 741 --12225 --
NM_005934chr1932479 1741 467 1103 ----
NM_005935chr485104 4808 4751 4511 4341 4235 1220 27 23571 3285 44005 3821 3478 937 --
NM_005937chr17103801 3780 3683 3305 3232 3011 2963 1176 1041 806 13252 13836 --
NM_005938chrX1358 1104 ----
NM_005941chr853833 2691 1378 564 226 1454 ----
NM_005944chr351108 1098 1080 936 502 1817 ----
NM_005955chr195079 4797 1876 1707 1576 1315 883 756 559 14169 1430 --
NM_005962chr1021864 818 ------
NM_005962chr1021864 818 ------
NM_005964chr1721308 1212 ----21133 121
NM_005966chr212429 ----11920
NM_005967chr121469 ------
NM_005969chr113986 315 90 ------
NM_005977chr131393 --1138 --
NM_005984chr221202 --1355 --
NM_005985chr202660 315 ------
NM_005986chr1332774 2503 2007 ------
NM_005990chr542302 1938 554 150 --22603 2496 --
NM_006007chr953155 2912 1354 381 335 44169 3181 1027 129 ----
NM_006009chr123208 149 28 ------
NM_006010chr31217 ------
NM_006011chr1594182 3981 3689 3409 1139 1059 1048 846 830 13350 14004 --
NM_006016chr641514 1413 499 316 1229 --21659 658
NM_006020chr142554 142 ------
NM_006024chr7198 1216 ----
NM_006033chr1862242 2038 1755 1733 405 282 ------
NM_006036chr262546 2528 889 718 355 126 --1697 --
NM_006037chr264781 3757 1314 1078 417 45 2897 740 21825 676 --
NM_006042chr17----1465 --
NM_006047chr2053492 2583 2367 576 432 11293 ----
NM_006054chr1121584 1408 11295 11247 --
NM_006067chr162943 709 --1130 11070
NM_006068chr43278 106 88 ------
NM_006079chr61702 ------
NM_006080chr762299 1898 1142 770 605 283 31103 881 716 --11131
NM_006089chrX1279 ------
NM_006091chr1541548 1156 631 582 ------
NM_006095chr473781 3465 3453 2750 1486 1463 516 1902 11044 --
NM_006106chr1183232 3139 3019 2770 2703 2254 1156 1001 22419 1362 22938 2579 --
NM_006108chr1141887 1700 1535 737 1665 ----
NM_006113chr122071 303 2508 372 1715 --
NM_006133chr114686 680 466 65 --11519 --
NM_006135chr141297 506 186 163 --11249 --
NM_006136chr73333 292 219 --136 --
NM_006141chr1682761 2372 2365 2032 1949 797 717 656 21028 860 ----
NM_006145chr191461 --1342 1437
NM_006147chr12366 188 ------
NM_006148chr1792646 1190 1141 1131 1080 863 714 83 24 ------
NM_006153chr33575 543 84 ------
NM_006154chr1572578 1806 1106 898 865 231 216 1536 12039 --
NM_006156chr141213 ------
NM_006158chr841777 1578 1421 1401 ------
NM_006159chr121219 ------
NM_006160chr1741351 1319 252 36 ------
NM_006162chr1821748 1567 1618 --21409 406
NM_006166chr1282548 2046 1608 1054 882 663 457 434 ------
NM_006167chr852166 1964 1583 54 41 --12128 --
NM_006178chr1741559 1231 1169 187 21103 76 ----
NM_006180chr931675 441 425 ------
NM_006186chr221201 1032 ------
NM_006194chr141111 1273 ----
NM_006195chr931444 434 35 1120 ----
NM_006196chr21386 ------
NM_006197chr832253 863 114 ------
NM_006201chrX3436 409 246 ------
NM_006203chr544973 1302 1173 23 24117 1285 --23470 1006
NM_006206chr432707 2013 289 --12266 --
NM_006212chr1124556 4495 4406 4316 4285 4026 1659 942 826 598 543 482 14789 1348 --
NM_006216chr23629 597 432 ------
NM_006224chr1752291 1787 1599 944 356 --22506 921 --
NM_006226chr231259 1168 445 ------
NM_006237chr1321621 169 1502 ----
NM_006238chr651980 1859 495 398 203 ------
NM_006241chr352258 1768 814 473 196 2802 303 ----
NM_006243chr121092 48 --1378 --
NM_006245chr63745 684 89 ----1967
NM_006246chr1421266 387 1978 ----
NM_006252chr1127458 7431 4768 4619 2967 1566 1244 1008 775 742 351 204 26899 6436 37343 6172 1205 --
NM_006254chr31428 ------
NM_006256chr12899 614 1567 12265 --
NM_006258chr1041003 286 114 27 11171 ----
NM_006265chr831368 121 43 11138 ----
NM_006268chr113814 280 137 --11158 --
NM_006275chr201883 1501 12419 12513
NM_006282chr2094388 2995 2968 2881 1647 1602 1336 962 741 ----1802
NM_006283chr884427 4159 3654 1859 1693 1641 1541 813 44319 1721 1427 71 ----
NM_006287chr282602 2516 1633 613 585 514 161 89 22197 898 ----
NM_006293chr151822 ------
NM_006300chr191617 ----1195
NM_006301chr122619 606 1525 ----
NM_006306chrX105912 5847 5063 4074 3938 1413 1212 899 603 521 15936 ----
NM_006312chr12----1757 --
NM_006313chr1241591 1333 1273 1218 11540 ----
NM_006315chr493852 3434 3074 2809 1346 473 441 322 244 --13059 --
NM_006320chr421089 955 ----1724
NM_006321chr33831 499 84 2895 623 ----
NM_006325chr121116 ------
NM_006330chr81443 11106 ----
NM_006335chr11263 ------
NM_006338chr12164 110 ------
NM_006345chr421020 487 1951 --11317
NM_006350chr5--173 ----
NM_006352chr191919 1629 1576 1502 1374 829 460 318 283 1611 ----
NM_006353chr631375 338 142 --11220 --
NM_006357chr21120 ------
NM_006359chrX52000 1964 1711 672 467 ------
NM_006363chr202574 161 --1232 --
NM_006366chr641144 836 822 200 1101 ----
NM_006367chr13807 795 138 ------
NM_006371chr3155197 5065 4855 4771 3814 3686 3522 3327 751 612 591 570 530 457 168 14216 24235 1545 --
NM_006372chr6----2358 326 --
NM_006375chrX61523 746 519 461 298 244 --1506 --
NM_006378chr92494 28 ------
NM_006379chr72352 48 ----185
NM_006380chr1733308 2995 1225 13381 --13737
NM_006386chr222149 59 --21760 513 1450
NM_006389chr1131212 485 447 --1934 --
NM_006390chr1271695 1636 1485 1373 1296 684 92 --1361 1655
NM_006391chr11129 ------
NM_006393chr1084164 3967 2968 2870 1734 1251 429 216 11616 13457 --
NM_006400chr121275 ------
NM_006401chr91402 ------
NM_006403chr6----31689 1547 259 --
NM_006410chr11----1484 --
NM_006420chr2043459 2567 958 677 12505 ----
NM_006421chr82262 106 ------
NM_006439chr42546 388 ------
NM_006451chr511012 2810 708 ----
NM_006454chr452738 2483 2160 1880 794 ------
NM_006457chr454052 2756 2533 1291 983 33997 839 394 12764 --
NM_006458chr111407 ------
NM_006459chr1011893 --11747 --
NM_006460chr1731593 617 209 --31361 632 169 --
NM_006465chr1562282 1905 1882 774 470 389 --11975 --
NM_006467chr521479 272 12053 12171 --
NM_006469chr131031 642 527 ----1562
NM_006482chr1253220 2662 847 789 734 32926 2470 190 12819 --
NM_006489chr1412057 ------
NM_006496chr121254 1237 --21685 1566 11270
NM_006504chr1062966 2565 642 622 328 168 1126 ----
NM_006516chr141608 1275 1239 359 ------
NM_006517chrX31487 667 193 --12195 --
NM_006526chr202802 45 1592 11560 --
NM_006527chr41758 1143 ----
NM_006529chr421378 49 ------
NM_006532chr1941733 1391 420 317 ------
NM_006534chr2053409 2680 1230 882 327 --12198 --
NM_006536chr131021 681 236 1721 ----
NM_006537chr152581 400 1216 ----
NM_006538chr253800 3756 3521 1365 238 22892 471 13500 --
NM_006540chr841404 1055 396 77 ------
NM_006544chr14106049 5673 5278 4978 1821 1563 1358 1029 667 204 153 ----
NM_006546chr1786544 5945 5117 4332 2510 2386 1269 534 12633 14210 --
NM_006548chr331487 1150 456 ------
NM_006554chr22142 101 --1350 --
NM_006555chr722003 1822 ------
NM_006557chr941765 1491 672 641 11169 ----
NM_006559chr11249 181 ----
NM_006560chr113479 387 68 ------
NM_006561chr1095470 5206 4208 3794 2161 1984 1790 790 139 14910 --16053
NM_006565chr1631117 434 428 ------
NM_006570chr9286 40 ------
NM_006574chr31135 ------
NM_006575chr14--31201 371 97 ----
NM_006577chr22972 105 ------
NM_006584chr171118 ------
NM_006587chr421335 460 ------
NM_006590chr21295 ------
NM_006595chr1152048 1809 626 263 157 --11451 --
NM_006597chr11--1214 ----
NM_006599chr16128049 7832 7287 6942 5727 5668 5262 2651 2449 2167 1730 1408 26020 998 25615 5038 11198
NM_006601chr121904 ------
NM_006602chr20--1563 ----
NM_006603chrX21864 281 11410 ----
NM_006609chr242367 2217 2003 24 12591 12382 --
NM_006614chr352847 2235 1102 837 688 --13286 --
NM_006618chr141386 1273 1169 1059 ----1632
NM_006620chr653901 3494 1515 832 226 34845 1274 636 11001 --
NM_006621chr121659 1580 ------
NM_006622chr51544 ------
NM_006624chr101757 ------
NM_006625chr13463 420 330 ------
NM_006625chr13463 420 330 ------
NM_006625chr13463 420 330 ------
NM_006626chr932447 1059 1004 1616 22302 1935 --
NM_006628chr1564590 4557 1235 1167 600 502 12996 ----
NM_006629chr1812387 11785 ----
NM_006633chr51718 --1157 --
NM_006640chr1751869 1852 1388 1338 1182 --1632 --
NM_006644chr132488 188 ------
NM_006646chr1362182 1979 1967 529 400 260 ------
NM_006650chr533838 2429 1317 --11244 --
NM_006653chr62295 101 ------
NM_006654chr1254365 1872 559 237 64 44730 4626 889 876 44389 1781 1752 600 --
NM_006656chr1131197 347 234 1156 ----
NM_006660chr15--1266 ----
NM_006662chr161281 ------
NM_006667chrX3992 732 67 --11181 --
NM_006682chr742829 2449 1874 76 22379 1013 ----
NM_006690chr2031953 757 200 ------
NM_006695chr173305 231 118 --1279 --
NM_006698chr2021212 593 --1179 --
NM_006699chr142615 2511 1004 829 --22647 233 --
NM_006700chr123638 597 36 --1144 --
NM_006703chr6--1331 ----
NM_006704chr132425 412 1318 --1131
NM_006706chr51171 --1547 --
NM_006713chr52782 54 ------
NM_006717chr973020 2298 2237 1054 1015 372 75 13047 --1549
NM_006718chr61192 11061 ----
NM_006720chr1055028 4339 3744 1610 1598 --11217 15142
NM_006721chr102688 339 ------
NM_006722chr31840 2491 123 ----
NM_006726chr431223 777 443 ------
NM_006729chrX95488 5371 4883 4494 3432 2118 1961 1587 597 24272 2035 14821 --
NM_006734chr62537 324 --2989 246 --
NM_006736chr231368 575 99 ------
NM_006738chr15124277 3166 2814 1829 1511 1444 1418 1291 1285 947 517 365 13341 43739 3410 1744 1732 --
NM_006749chr81457 --11044 --
NM_006750chr16187777 7735 7325 7207 7042 5546 4960 3038 2722 2400 2238 2194 1892 1262 726 666 489 393 18124 47369 7216 859 107 --
NM_006754chr761225 1074 887 420 277 136 11212 1157 --
NM_006763chr181888 1739 763 749 645 588 254 234 11770 1212 --
NM_006766chr842576 2567 2502 2308 ------
NM_006769chr1----271 30 --
NM_006775chr642517 2171 1191 1107 --12930 11160
NM_006777chrX32251 2162 427 ------
NM_006788chr1832123 1455 330 12133 2462 109 --
NM_006790chr51353 ------
NM_006791chr152551 439 --2419 83 --
NM_006800chrX3663 567 183 ------
NM_006802chr131048 259 57 11094 ----
NM_006805chr521513 302 ------
NM_006807chr1721213 74 11356 --1155
NM_006811chr202665 105 --1635 --
NM_006814chr2032547 2110 221 12047 ----
NM_006815chr12--1555 11121 --
NM_006816chr52255 234 ------
NM_006823chr831304 1132 357 ------
NM_006827chr1433139 2971 64 --43195 3077 2865 2258 --
NM_006828chr62197 89 --1456 --
NM_006832chr141822 1127 ----
NM_006838chr123675 387 341 --11911 --
NM_006846chr51343 1102 ----
NM_006851chr1232793 923 387 --12209 --
NM_006852chr1782692 2572 2471 2282 1045 402 352 132 --1118 --
NM_006854chr751925 1752 755 671 367 21568 189 --11486
NM_006861chr1262108 1945 1820 1747 692 343 ------
NM_006870chr202742 108 --2694 673 --
NM_006873chr232627 388 177 13088 1528 --
NM_006884chr31782 ------
NM_006885chr16113393 3109 2981 2656 1693 1292 1145 985 493 311 195 21541 657 ----
NM_006887chr23575 486 204 ------
NM_006888chr1432979 1294 910 22650 1248 12847 13164
NM_006892chr201554 --11365 --
NM_006892chr201554 --11365 --
NM_006895chr231459 738 599 --22086 460 --
NM_006897chr121606 ------
NM_006908chr711207 --31099 1065 963 --
NM_006914chr92970 449 --1980 --
NM_006915chrX12258 1977 ----
NM_006916chr21102 11168 --1299
NM_006918chr11105760 4315 4307 3791 3605 1906 1718 1366 378 344 14783 33847 2044 1451 13562
NM_006920chr241764 1689 1606 137 --1676 --
NM_006922chr252096 855 763 648 131 1819 11016 --
NM_006924chr1794167 4153 4099 3745 758 626 610 396 346 24060 2794 34228 357 170 --
NM_006925chr141200 1372 198 --
NM_006931chr1221592 763 11325 --12012
NM_006936chr2131144 998 84 ------
NM_006937chr171509 ------
NM_006939chr1441055 890 358 207 --21161 323 --
NM_006943chr2053324 3151 2769 2697 2303 1695 12313 --
NM_006947chr411311 2544 408 ----
NM_006948chr2122085 1918 1156 12282 --
NM_006950chrX4787 754 748 660 ------
NM_006951chr102769 724 --1241 --
NM_006981chr942826 2638 2441 374 22707 630 22874 1942 1428
NM_006990chr171896 1788 632 536 255 158 50 --21995 981 --
NM_006999chr551689 1285 697 318 228 --1394 --
NM_007005chr921426 1053 21215 1081 11257 11419
NM_007006chr1623112 385 22598 1091 --1727
NM_007007chr1254725 3872 1736 1138 686 23757 1228 1620 --
NM_007008chr22606 169 ------
NM_007011chr15116352 5338 4439 2672 1253 1144 944 337 319 279 190 12535 11394 --
NM_007013chr81813 1360 ----
NM_007017chr53654 169 137 ------
NM_007019chr201125 ------
NM_007033chr131420 590 64 12252 12304 --
NM_007038chr21106091 5723 5563 4849 2315 1853 1786 1753 1593 329 14050 15934 --
NM_007039chr1432094 2046 898 11755 ----
NM_007040chr191771 ------
NM_007050chr20147649 7252 6978 6406 6049 5828 5813 5317 5022 2668 1794 760 700 306 12497 16584 --
NM_007064chr321259 1064 ------
NM_007067chr1741308 1097 1070 364 1524 21355 343 --
NM_007073chr674190 4033 3765 2667 1519 315 227 23738 97 140 --
NM_007084chr131288 ------
NM_007096chr91244 ------
NM_007097chr5165 ------
NM_007106chr1362648 2536 1903 1007 628 40 12323 ----
NM_007107chr341977 902 241 33 12402 ----
NM_007118chr52610 151 ------
NM_007121chr191354 ------
NM_007124chr611530 21643 805 11764 --
NM_007125chrY31466 1059 1013 1463 ----
NM_007126chr91464 ------
NM_007129chr13----1763 --
NM_007137chrX105057 4647 4312 3746 3637 3609 1734 1689 1606 879 ------
NM_007144chr1721248 308 ------
NM_007145chr19--11223 ----
NM_007146chr1722768 2444 21004 888 22539 1862 --
NM_007149chr62392 96 ------
NM_007150chrX41974 696 528 130 11395 ----
NM_007157chrX52941 2301 2005 886 258 11955 1753 --
NM_007158chr121187 873 2460 412 ----
NM_007159chr331448 1384 439 1142 ----
NM_007166chr1121600 238 --11170 --
NM_007174chr1272028 2011 1545 1517 672 626 206 --11740 11727
NM_007175chr863317 3214 3157 1335 450 101 13513 2892 552 1803
NM_007185chr12817 287 ------
NM_007187chr1341035 726 226 28 1913 ----
NM_007189chr721422 1114 1150 ----
NM_007191chr12--1714 1217 --
NM_007195chr1883125 2926 2850 2800 2792 2782 2636 914 12642 13618 --
NM_007200chr15124277 3166 2814 1829 1511 1444 1418 1291 1285 947 517 365 13341 43739 3410 1744 1732 --
NM_007203chr973931 2929 2636 944 728 243 34 ------
NM_007212chr121815 1777 --1773 --
NM_007214chr611128 --2963 163 --
NM_007222chr821332 708 1509 ----
NM_007231chrX32296 1705 187 1924 ----
NM_007236chr1552137 482 442 371 160 ----12440
NM_007245chr161325 ------
NM_007246chr431052 276 136 ------
NM_007249chr1379272 9244 8096 8065 2867 2774 2440 28763 3314 27939 1115 --
NM_007260chr12724 215 ------
NM_007269chr11194 --1226 --
NM_007271chr651444 1153 670 228 56 --11268 --
NM_007275chr341114 755 390 324 ------
NM_007292chr17104948 4910 4782 4331 4299 4057 3410 3309 2052 1623 14756 ----
NM_007294chr1721131 458 ------
NM_007295chr1721131 458 ------
NM_007296chr1721131 458 ------
NM_007297chr1721131 458 ------
NM_007298chr1721131 458 ------
NM_007299chr1721131 458 ------
NM_007300chr1721131 458 ------
NM_007302chr1721131 458 ------
NM_007303chr1721131 458 ------
NM_007304chr1721131 458 ------
NM_007305chr1721131 458 ------
NM_007308chr41179 ------
NM_007315chr2--1457 11419 --
NM_007322chr192405 37 ------
NM_007325chrX31540 716 228 --1814 1173
NM_007345chr1862354 2152 1759 1586 277 148 --12078 --
NM_007347chr1513091 ------
NM_007349chr71108 ------
NM_007350chr1251608 1316 1141 794 72 34528 3923 1267 ----
NM_007353chr7132581 2541 2132 1966 1943 1199 1139 650 578 545 512 366 280 --11124 --
NM_007357chr14585 505 404 116 ------
NM_007358chr121912 1680 22001 1482 ----
NM_007363chrX1855 ------
NM_007365chr151752 1738 1683 855 235 --21892 145 --
NM_007372chr17168 --1724 --
NM_007373chr1021590 1345 ------
NM_007375chr161954 1837 1780 1715 904 628 ------
NM_012064chr1231088 1050 277 ------
NM_012069chrX3731 695 194 ------
NM_012074chr1431040 918 122 ------
NM_012081chr563383 3342 2529 1362 513 406 43275 1350 639 460 11445 --
NM_012083chr1041299 1118 983 218 --1850 --
NM_012084chrX2570 231 ------
NM_012086chr2----155 --
NM_012090chr11977 2336 132 ----
NM_012093chr12472 169 ------
NM_012095chr10113462 3403 3274 2700 1397 1144 1082 1050 972 789 112 2755 496 1824 --
NM_012096chr343499 3355 2365 378 --1650 --
NM_012097chr231930 1437 181 ------
NM_012098chr921458 585 1419 ----
NM_012102chr142244 2207 1034 820 11890 12361 --
NM_012104chr1153478 1333 1218 996 138 33532 2521 481 --11312
NM_012104chr1153478 1333 1218 996 138 33532 2521 481 --11312
NM_012105chr214777 287 154 138 ------
NM_012110chr4141 --155 --
NM_012115chr62583 390 ------
NM_012117chr121113 ------
NM_012120chr632745 833 553 12391 ----
NM_012124chr112167 158 1919 ----
NM_012129chr742172 1946 1638 912 ----1701
NM_012137chr182858 2424 2201 2157 487 370 344 291 1852 ----
NM_012141chr132693 610 13905 33580 2540 1233 --
NM_012142chr152108 65 1274 ----
NM_012153chr1152321 2309 789 682 322 12197 ----
NM_012154chr82841 150 ------
NM_012156chr2032872 2863 694 --1932 --
NM_012158chr1331853 1506 1408 ------
NM_012160chr61467 1389 136 --
NM_012161chr42930 796 21080 266 1987 --
NM_012164chr9107440 7104 6064 6026 6019 5714 5387 4727 2453 547 37360 6574 6058 14917 17000
NM_012174chr1262969 2927 1935 1120 620 420 22935 761 ----
NM_012175chr112819 177 ------
NM_012176chr52259 96 ------
NM_012180chr41488 ------
NM_012191chr3126 ------
NM_012193chr1195340 4983 3634 3562 1660 1443 1335 680 22 21692 1568 21131 598 --
NM_012197chr931462 1031 54 --11471 --
NM_012199chr1114548 4075 3278 2919 2854 2828 1724 1701 747 302 122 13336 1779 11203
NM_012207chr101271 1729 1992 --
NM_012210chr921065 404 11465 ----
NM_012214chr276223 4862 2441 2415 1412 905 534 --16352 --
NM_012215chr1031846 1765 541 ------
NM_012218chr1992442 2339 2237 2049 981 886 559 356 316 1398 1202 --
NM_012223chr221018 222 ------
NM_012233chr231043 1037 942 ------
NM_012234chr343497 2733 1448 541 43716 3105 2516 996 ----
NM_012238chr101615 21362 1217 ----
NM_012242chr101704 ------
NM_012244chr1451493 1223 341 107 60 11695 ----
NM_012247chr103748 165 98 --2359 308 --
NM_012249chr232608 2488 422 22590 1391 1609 12422
NM_012250chr112932 271 ------
NM_012252chr764735 4036 3812 3445 456 85 24622 3492 13553 15278
NM_012255chr201166 1435 ----
NM_012257chr72916 167 1220 ----
NM_012261chr201531 ------
NM_012262chr194940 4687 4681 3707 3689 3337 3225 393 49 11816 14242 1912
NM_012281chr722058 526 ------
NM_012286chrX1426 ------
NM_012287chr364290 2929 1539 1230 839 382 43543 1481 1205 83 13798 --
NM_012288chr6115645 5604 5522 4252 3948 3712 3548 1959 889 341 126 23680 328 25637 1302 14323
NM_012294chr7114073 3904 3780 3695 1529 1164 908 838 708 539 74 ------
NM_012295chr221411 ------
NM_012296chr1133777 3729 3088 --23640 2485 12435
NM_012297chr42852 411 --1899 --
NM_012300chr572415 2346 2130 1780 829 737 369 ------
NM_012301chr721744 159 11977 ----
NM_012302chr141173 1041 925 823 ------
NM_012307chr182695 353 ------
NM_012308chr1182370 2116 2056 1995 1905 1014 621 375 --1847 --
NM_012309chr1164050 3934 3616 1186 942 399 11209 64853 4735 4455 3837 3313 198 --
NM_012316chr1115439 5288 4592 3555 1913 1760 1604 1508 1074 764 274 11743 ----
NM_012319chr184972 944 297 288 ------
NM_012325chr2051322 1270 1214 480 53 1401 ----
NM_012326chr2143 --1102 --
NM_012327chr1821571 1127 ------
NM_012328chr711004 --3908 547 247 --
NM_012329chr1731291 1240 1041 ----11207
NM_012330chr1061552 1497 541 465 404 298 ------
NM_012333chr151558 1475 1061 610 442 1520 ----
NM_012339chr101134 1625 1496 --
NM_012341chr103427 366 130 ------
NM_012342chr101198 --1382 --
NM_012383chr9263 41 1329 ----
NM_012388chr1593164 2951 2368 2035 958 417 380 143 134 --12700 186
NM_012399chr2221426 141 ------
NM_012402chr112970 541 --1898 --
NM_012405chr163655 3597 2533 1352 826 541 13565 ----
NM_012413chr2----1135 --
NM_012414chr13711 565 103 ------
NM_012416chr91213 1225 ----
NM_012417chr172639 90 ------
NM_012421chr1----1401 --
NM_012424chr11772 --1655 --
NM_012425chr1012144 1407 ----
NM_012428chr152679 238 1133 ----
NM_012433chr2156 ------
NM_012434chr631513 1364 94 --2607 67 --
NM_012446chr5--1473 1643 --
NM_012448chr1762207 2104 1622 966 521 495 ----1360
NM_012453chr7----1217 --
NM_012454chr6--1391 ----
NM_012460chr14--151 ----
NM_012463chr1221823 561 1111 ----
NM_012464chr44897 764 667 534 32797 798 419 --12933
NM_012475chr1----191 --
NM_012479chr732049 1844 137 --12594 --
NM_012486chr12429 398 ------
NM_013229chr1282795 2423 860 605 498 403 381 282 32516 2386 484 ----
NM_013231chr1442746 1579 1141 224 --13603 12707
NM_013232chr51324 --1289 1387
NM_013233chr211339 1203 ----
NM_013236chr2241184 845 476 217 ------
NM_013238chr1331875 448 167 21691 1652 ----
NM_013243chr1541001 502 404 268 11161 ----
NM_013253chr1141289 396 265 198 --1475 168
NM_013255chr7158077 7567 7059 6455 5496 5480 2680 2325 1486 1257 1204 976 578 563 426 47016 6411 3101 2482 11980 18583
NM_013256chr192549 140 ------
NM_013257chr822043 99 ------
NM_013261chr473384 3137 2738 1350 1319 342 264 ----13190
NM_013262chr641464 1033 925 509 11277 ----
NM_013263chr16164 ------
NM_013266chr10125 159 ----
NM_013279chr1122367 709 21916 1651 12004 1693
NM_013281chr2011441 --11320 --
NM_013293chr72278 257 ------
NM_013304chr161241 ------
NM_013309chr152824 444 2860 29 --22274 307
NM_013313chr2282800 2443 2205 1121 677 513 326 304 12246 ----
NM_013322chr731193 510 464 1167 --11459
NM_013336chr31173 ------
NM_013346chrX176 ------
NM_013348chr1911287 --1821 --
NM_013351chr173721 701 263 ------
NM_013354chr81133 --11009 --
NM_013363chr32420 42 ------
NM_013365chr223715 528 122 ----1759
NM_013368chr192166 148 1230 ----
NM_013372chr1572932 2917 2588 2373 941 455 173 1250 12405 --
NM_013373chr225991 933 661 635 242 1720 ----
NM_013377chr122572 493 1473 ----
NM_013381chr1222003 746 ------
NM_013390chr921273 452 11535 ----
NM_013396chr2151288 1037 292 259 59 ------
NM_013400chr73990 371 78 ------
NM_013403chr192286 177 --1319 --
NM_013410chr131161 219 182 ------
NM_013423chrX----2505 321 --
NM_013427chrX----2505 321 --
NM_013433chr1931352 748 138 --11466 --
NM_013437chr831422 1013 387 ------
NM_013438chr91305 21698 73 11682 --
NM_013443chr91106 --1217 --
NM_013444chrX----21116 971 --
NM_013446chr741340 365 144 75 ------
NM_013449chr12112907 2650 2253 2103 1985 1853 1204 1160 1062 694 548 ------
NM_013450chr221060 882 1497 ----
NM_013951chr221678 885 --12525 --
NM_013952chr221755 962 --12602 --
NM_013953chr221755 962 --12602 --
NM_013958chr8125 ----175
NM_013959chr8125 ----175
NM_013961chr8125 ----175
NM_013962chr8125 ----175
NM_013981chr5--1169 ----
NM_013982chr5--1169 ----
NM_013983chr5--1169 ----
NM_013989chr14115112 5055 5029 4056 3855 3555 3508 3424 3386 399 318 --13290 --
NM_013992chr221755 962 --12602 --
NM_013995chrX41751 591 580 264 ----1775
NM_013996chr71490 --1358 --
NM_013996chr71490 --1358 --
NM_013997chr71490 --1358 --
NM_013997chr71490 --1358 --
NM_013998chr71490 --1358 --
NM_013998chr71490 --1358 --
NM_014000chr1031662 694 448 --11804 --
NM_014007chr91787 1909 --1924
NM_014011chr232324 478 171 12472 --1697
NM_014016chr341610 1223 170 105 ------
NM_014021chr133029 1236 135 --12341 --
NM_014023chr1072879 2771 1178 863 629 397 196 --1116 11982
NM_014028chr673155 2531 2270 2228 2090 1236 666 32588 2396 704 ----
NM_014034chr61325 --11229 --
NM_014038chr71344 ------
NM_014041chr3255 26 ------
NM_014043chr331146 591 417 2604 513 ----
NM_014048chr1655306 5105 5070 3764 1629 24952 4635 11706 --
NM_014057chr92658 362 ------
NM_014059chr13----1290 --
NM_014079chr31163 --3264 256 248 --
NM_014080chr1541327 482 425 39 ------
NM_014089chr1342280 2227 1378 904 11579 ----
NM_014106chr1542229 2165 1827 713 21958 1880 ----
NM_014109chr82879 463 ------
NM_014110chr12844 186 11024 ----
NM_014112chr885267 4805 4072 2169 2041 1912 1528 845 34039 112 72 ----
NM_014117chr1632260 1953 351 12135 ----
NM_014141chr755309 5021 4210 1662 245 33301 990 290 ----
NM_014154chr3----1167 --
NM_014155chr11157273 6865 6207 6110 5895 5742 5455 5157 2401 2188 999 319 313 255 210 37576 6692 5636 27509 6377 --
NM_014170chr33402 330 170 --1148 --
NM_014171chr22784 49 ------
NM_014181chr242775 1130 820 777 1673 1738 --
NM_014188chr11294 --1285 --
NM_014212chr122310 230 ------
NM_014217chr11246 ----1480
NM_014231chr1252101 2082 1936 714 246 --1609 --
NM_014232chr1731414 1119 271 ------
NM_014232chr1731414 1119 271 ------
NM_014233chr1722135 1661 --21515 492 --
NM_014234chr61141 ------
NM_014240chr322650 1111 11354 64094 2614 1347 567 201 143 --
NM_014241chr10----125 --
NM_014243chr451411 763 587 569 161 ----1795
NM_014246chr2232198 707 575 1434 --11601
NM_014250chr2241895 601 595 180 3419 410 281 21481 779 --
NM_014252chr132123 116 ------
NM_014253chrX62485 1698 966 497 424 130 12304 12405 --
NM_014263chr1021272 126 --1338 --
NM_014264chr41475 ------
NM_014267chr111139 ------
NM_014268chr18----1433 --
NM_014271chrX2195 60 1679 ----
NM_014282chr92930 105 --21221 370 --
NM_014283chr161568 1075 1063 1007 492 476 11331 1370 --
NM_014285chr93311 195 151 1860 ----
NM_014289chrX2999 324 11437 11422 --
NM_014292chr2211563 --1102 --
NM_014293chr2232654 1336 122 ------
NM_014294chr82213 45 ----2986 539
NM_014300chr152338 109 ------
NM_014309chr22124648 4335 3559 2183 2177 2171 1909 950 607 555 296 194 23937 3326 --14567
NM_014315chr141156 ------
NM_014319chr12283 67 --11505 11493
NM_014320chr6186 --2140 94 --
NM_014325chr1242155 810 391 50 ------
NM_014329chr161341 ------
NM_014331chr457045 6739 5381 4952 2362 47319 6291 5813 540 17669 --
NM_014333chr1152817 1883 1109 773 490 --1299 --
NM_014342chr1121370 137 ------
NM_014345chr62888 764 --1326 --
NM_014352chr1151406 268 139 88 66 ------
NM_014361chr11123 134 ----
NM_014368chr931889 1371 460 12130 12118 --
NM_014372chr111820 1532 12031 --
NM_014374chr73990 371 78 ------
NM_014376chr532299 1902 730 --1247 --
NM_014382chr341766 1749 1705 690 1665 ----
NM_014392chr431355 1318 139 ------
NM_014393chr851864 866 333 311 267 21615 548 1849 --
NM_014396chr752272 919 908 849 199 --11848 --
NM_014397chr91461 146 ----
NM_014405chr1732364 1466 462 --1601 --
NM_014410chr182357 290 ------
NM_014415chr31227 2577 519 21615 1354 --
NM_014423chr5105597 5178 4719 4182 3862 2097 1635 1595 665 210 12149 21082 956 11423
NM_014426chr201707 1622 ----
NM_014431chr1041397 1238 1163 56 ------
NM_014432chr62113 22 21230 1135 ----
NM_014445chr341954 1663 1546 494 --21601 194 21907 1652
NM_014447chr431646 1507 1467 ------
NM_014452chr641193 932 308 165 1921 ----
NM_014454chr641049 782 306 237 ------
NM_014455chr11322 1438 ----
NM_014456chr1011358 1472 1438 --
NM_014458chr131392 877 113 ------
NM_014460chr2231335 163 143 --1502 --
NM_014469chr113620 612 153 ------
NM_014470chr121751 ------
NM_014472chr103592 480 168 ------
NM_014480chr192682 540 ------
NM_014491chr721083 879 ------
NM_014494chr1641500 858 503 262 ------
NM_014500chrX153 ------
NM_014504chr751500 538 473 312 273 12012 11801 --
NM_014517chr341785 1638 783 315 ------
NM_014521chr241641 1450 1397 621 --21777 630 --
NM_014548chr1541526 1310 1218 295 ------
NM_014552chr241494 593 352 346 --11184 --
NM_014554chr1241623 599 253 160 12009 11443 --
NM_014562chr21224 1779 ----
NM_014563chrX12096 ------
NM_014572chr1331648 1447 562 ------
NM_014573chr1731832 1720 587 ------
NM_014574chr1411285 2503 377 1272 --
NM_014577chr22--1593 ----
NM_014584chr1431303 117 23 11516 ----
NM_014585chr221023 53 11120 1120 --
NM_014587chr1641517 536 471 108 --21586 1308 --
NM_014588chr20--1145 ----
NM_014591chr1021306 344 1958 ----
NM_014600chr271630 1281 600 581 438 424 353 --11192 --
NM_014603chr1721551 1442 21681 1373 ----
NM_014606chr431416 627 371 ------
NM_014607chr231877 1393 543 187 ----
NM_014608chr152180 40 --1116 --
NM_014613chr532908 686 365 12243 11015 --
NM_014614chr21577 ------
NM_014615chr1683493 3439 3387 3359 1321 964 772 414 ------
NM_014616chr34867 813 427 262 32597 1391 839 ----
NM_014620chr12--1239 ----
NM_014630chr15133979 3604 3273 2674 2624 2436 1544 1400 748 539 427 367 129 13142 22741 48 --
NM_014633chr112578 399 ------
NM_014634chr2273576 2947 2532 2486 2259 1164 607 13040 32632 674 116 1948
NM_014636chr924134 2849 2699 592 2710 323 --
NM_014637chr831000 532 172 11055 ----
NM_014646chr1892526 2129 1204 1133 903 796 411 145 113 ------
NM_014647chr1631860 903 457 11676 1588 --
NM_014659chr1521064 241 ------
NM_014660chr74362 333 272 161 ------
NM_014665chr8103243 2888 2456 2432 2297 794 536 388 311 159 ------
NM_014666chr52950 886 ------
NM_014667chr32702 474 --1369 1804
NM_014670chr221594 1199 ------
NM_014671chr73505 199 41 --1563 --
NM_014674chr3103863 3500 3299 3081 2678 2573 1292 1240 1017 370 12740 22585 894 11117
NM_014677chr8----1104 --
NM_014679chr1131239 536 384 ------
NM_014682chr821470 1433 ------
NM_014683chr1732157 1990 50 22186 187 ----
NM_014685chr163491 208 130 ----1509
NM_014686chr1932174 1871 1805 --22480 1993 --
NM_014690chr772565 2389 2336 1898 990 431 24 ------
NM_014693chr32177 170 ----1629
NM_014701chr1522343 1351 13423 1184 --
NM_014702chr622774 2117 33432 2736 943 --13146
NM_014705chr731950 1769 579 11846 11599 --
NM_014707chr722270 771 ------
NM_014709chr2187 ----1509
NM_014711chr1631700 425 219 --21988 1372 11724
NM_014717chr19----1661 --
NM_014720chr101626 11740 ----
NM_014721chr6106725 6148 5999 5305 5278 4799 1953 1863 1833 728 15527 21991 1439 17049
NM_014723chr2031023 675 338 --22089 2062 --
NM_014726chr173451 338 294 ------
NM_014729chr892072 1974 1855 1624 1536 1528 892 724 64 2871 290 ----
NM_014730chr12135286 4505 4336 3937 3791 3334 2116 1912 1159 1020 890 737 195 11667 23783 3641 14628
NM_014730chr12135286 4505 4336 3937 3791 3334 2116 1912 1159 1020 890 737 195 11667 23783 3641 14628
NM_014731chr202543 380 ------
NM_014733chr551911 1738 670 577 386 ------
NM_014735chrX91860 1817 1573 1503 1496 598 511 137 35 12074 11693 --
NM_014739chr684090 4007 2927 2686 1553 1260 1200 280 22642 1266 --13864
NM_014742chr2021773 232 ------
NM_014743chr442990 466 289 267 1273 1562 --
NM_014746chr284259 4000 3672 1492 870 767 695 551 1100 11321 14344
NM_014747chr1165431 5118 4597 4570 4498 4267 4062 3829 3780 1387 1299 1232 458 446 425 45 --2282 86 --
NM_014751chr832144 1709 61 11512 --12059
NM_014752chr1141851 1255 557 241 --21820 639 --
NM_014754chr8136 --1805 --
NM_014755chr282859 2767 2651 1449 1270 1027 145 95 13728 54147 3459 2930 2872 165 1822
NM_014757chr522102 911 --11538 --
NM_014761chr163986 248 174 1832 ----
NM_014764chr123954 456 308 172 1122 --
NM_014765chr132686 2308 1035 11043 --12010
NM_014766chr783792 3276 2652 2605 1303 647 624 521 --22988 534 13551
NM_014771chr161774 ------
NM_014772chr1833598 2730 725 --11077 --
NM_014774chr172748 2606 2557 2155 1003 862 411 32407 890 374 ----
NM_014775chr221107 ------
NM_014776chr1273142 3026 2748 2267 2046 1923 199 1189 ----
NM_014779chr33954 821 100 ------
NM_014781chr8----1907 --
NM_014782chrX182 ------
NM_014786chr115892 216 132 116 42 ------
NM_014787chr132798 1745 532 11751 ----
NM_014790chr5122 ------
NM_014791chr91211 ------
NM_014795chr221356 95 ------
NM_014810chr173032 2317 1381 978 607 179 95 21469 763 ----
NM_014812chr131675 598 122 ------
NM_014813chr12438 394 199 ----
NM_014819chr531926 660 440 ------
NM_014822chr42594 60 ------
NM_014824chr1121743 1380 --21976 178 --
NM_014826chr154030 1124 1077 348 255 14177 13148 14228
NM_014827chr141588 672 495 375 ------
NM_014828chr1452542 1637 460 200 94 --12205 --
NM_014830chr1233306 546 101 1909 1865 --
NM_014838chr2242277 1058 829 145 22403 409 12132 1157
NM_014839chr152185 1818 868 667 572 ----12336
NM_014840chr1263194 2986 2851 1061 850 386 33274 2651 235 11254 --
NM_014841chr6----1281 --
NM_014847chr1----1528 --
NM_014850chr384874 4839 3544 3455 3297 399 130 79 13809 13910 --
NM_014853chr1731430 1009 237 11436 ----
NM_014859chr173959 252 238 ------
NM_014862chr1554194 1418 1359 1015 631 --1625 --
NM_014864chr153651 3645 980 415 136 13048 ----
NM_014868chr123816 192 65 ------
NM_014871chr121569 ------
NM_014872chr952002 822 436 220 73 2486 442 11820 --
NM_014873chr153663 2996 1508 1196 819 --24567 662 14179
NM_014876chr2232195 2074 1417 ------
NM_014877chr17137800 7612 6887 6637 5722 5665 2937 1684 1234 1143 1042 808 134 25004 2592 32686 1967 1642 --
NM_014883chr411628 1163 --12413
NM_014884chr19------167
NM_014893chrY21674 1469 1244 22066 715 --
NM_014897chr1742422 841 777 320 32761 2100 1170 ----
NM_014898chr1922043 653 ------
NM_014903chr122894 35 1827 ----
NM_014904chr10113385 3210 3073 3020 2928 2616 2569 1397 1086 999 921 12625 ----
NM_014906chr1763366 1237 918 397 231 93 21356 833 21190 721 --
NM_014909chr1473789 3504 3448 2957 990 357 300 --12726 --
NM_014912chr1033431 2167 1330 --13250 --
NM_014913chr1821504 341 ------
NM_014917chr1--1974 ----
NM_014918chr152497 174 ----11442
NM_014923chr133265 142 72 1484 21495 729 --
NM_014925chr121774 ------
NM_014926chr3----3364 235 28 --
NM_014932chr311810 ------
NM_014936chr642719 2126 770 738 31762 1107 653 22901 29 --
NM_014939chr1831221 574 447 ----11296
NM_014942chr641669 934 430 108 --22032 443 --
NM_014944chr141137 282 142 32 ------
NM_014945chr531879 312 120 11939 ----
NM_014946chr242387 1134 386 212 21094 444 ----
NM_014947chr182645 1972 889 783 698 472 418 169 ------
NM_014949chr12685 260 ------
NM_014950chr141108 11364 ----
NM_014951chr1052481 2441 2364 2194 74 --1608 12304
NM_014952chr1521840 1655 1839 ----
NM_014953chr1342652 1017 672 509 1938 14206 --
NM_014956chr114851 314 74 57 ------
NM_014961chr461639 1449 872 602 478 337 ----11744
NM_014962chr2032765 2538 460 12419 1272 --
NM_014964chr1761893 1651 1615 966 357 143 1845 12056 --
NM_014969chr1----1177 --
NM_014978chr1041663 1313 495 89 ------
NM_014982chr14105302 5284 5044 3709 3599 1124 996 925 861 646 1308 11831 --
NM_014988chr4----12182 --
NM_014989chr6--22016 1955 12033 --
NM_014991chr432833 2717 625 --1991 --
NM_014992chr142771 77 ------
NM_014997chr762137 1123 561 524 187 137 22929 1140 12351 --
NM_014999chr1211145 21199 1032 ----
NM_015000chr1243018 2314 2287 108 ------
NM_015001chr11352 1208 ----
NM_015005chr1441718 323 136 50 ------
NM_015008chr383279 2699 1358 1248 1068 969 808 396 22504 2220 ----
NM_015017chr131318 866 253 197 ----
NM_015023chr171644 1267 1159 674 343 268 88 11395 ----
NM_015024chr821235 320 ------
NM_015025chr252242 2212 2159 2113 148 3551 338 154 ----
NM_015026chr1284612 3073 2934 1703 1069 1053 978 637 14117 14020 --
NM_015027chr1651583 572 283 140 111 --11736 --
NM_015032chr1332754 2358 300 1170 11032 11812
NM_015035chr20165958 5943 5629 5211 5107 2623 2199 2180 1930 1728 1709 1227 842 746 627 440 1712 11331 --
NM_015040chr263379 3205 2599 2280 634 345 --1945 --
NM_015042chr1553764 3529 3306 2848 1430 --31315 876 498 --
NM_015045chr1052236 1432 1422 484 478 1304 ----
NM_015046chr962688 2469 2393 1821 1697 536 --11788 --
NM_015049chr242014 1154 1096 268 12423 12850 --
NM_015051chr922092 864 --1361 --
NM_015052chr731181 413 167 1859 ----
NM_015054chr121430 ------
NM_015055chr1172711 2389 1866 804 585 442 419 11811 22536 1908 --
NM_015056chr2142633 2551 2080 33 11910 1695 --
NM_015057chr132641 40 ------
NM_015059chr1563032 2983 1396 520 242 133 23044 995 21453 907 --
NM_015061chr95823 602 235 215 113 ------
NM_015064chr1252939 1349 936 549 541 1375 1817 --
NM_015068chr763850 3433 1411 1227 1064 739 13063 ----
NM_015069chr162605 521 --1233 --
NM_015073chr1942074 2051 1465 261 ------
NM_015074chr1114531 4285 3995 3309 3215 1880 1868 1553 1502 937 925 ------
NM_015075chrX22237 1567 --11485 --
NM_015076chr654455 4434 3808 1270 1054 11371 13724 1651
NM_015079chr1583028 2770 1987 1305 1148 1107 436 305 1595 21019 738 1531
NM_015080chr111953 ------
NM_015082chr562301 2123 870 504 341 210 1685 ----
NM_015090chr1115400 5392 4818 4188 4174 3874 3839 2158 1549 895 578 21337 363 ----
NM_015091chr14184 1706 ----
NM_015092chr1674131 4011 3136 3114 3027 2944 263 24476 3699 13037 11306
NM_015093chr641467 535 521 515 21197 661 ----
NM_015094chr2261734 1289 1072 422 416 396 --1859 --
NM_015097chr33812 397 290 11957 ----
NM_015100chr161977 1889 1781 1581 731 427 ------
NM_015101chr142885 2843 1858 1027 ------
NM_015107chrX92393 2054 2034 1554 390 294 205 120 44 ------
NM_015110chr982513 2475 2395 2384 1579 766 643 120 ------
NM_015115chr483008 2979 2381 2366 2326 1241 831 193 --22824 2529 --
NM_015116chr133563 106 80 11075 11198 --
NM_015124chr2222527 227 --21581 670 --
NM_015129chrX31789 1705 716 --11581 --
NM_015132chr771773 1764 1660 1517 1444 110 90 ----2683 200
NM_015133chr162986 521 11485 ----
NM_015137chr832587 234 217 22578 492 21837 766 --
NM_015138chr1592804 2739 2484 1728 1033 930 402 273 255 ------
NM_015143chr461432 1285 929 324 284 160 11302 ----
NM_015144chr1623283 3113 1951 --1116
NM_015149chr142152 2130 1790 1782 12095 ----
NM_015150chr32906 318 ------
NM_015153chr6--1544 ----
NM_015155chr1053142 526 370 221 105 11322 12944 --
NM_015156chr1483307 2566 1475 1249 1073 832 723 716 33528 1502 157 23701 854 1904
NM_015157chr11----2790 729 --
NM_015158chr92320 94 ----1827
NM_015161chr1631458 1018 272 1355 1172 --
NM_015163chr1431674 1291 284 --11767 --
NM_015170chr832039 1868 1547 --12238 --
NM_015172chr121033 221 11117 --11143
NM_015173chr431557 1325 102 --11235 --
NM_015176chr121243 496 11349 ----
NM_015180chr141785 1564 ----
NM_015184chr3172 ------
NM_015185chrX4706 401 353 324 --12840 --
NM_015187chr43610 366 103 ----1347
NM_015191chr1122654 1880 11063 21044 506 --
NM_015192chr2042845 2568 2484 508 --33009 2470 310 --
NM_015197chr1463099 3036 2984 2916 2529 554 ------
NM_015199chr322286 2212 12795 21950 49 --
NM_015200chr462378 2182 1008 636 387 128 ------
NM_015206chr1563757 3713 1367 1217 812 573 13628 1912 --
NM_015208chr184962 503 93 71 ------
NM_015209chr14894 682 462 38 --11767 --
NM_015215chr143027 2165 640 40 33171 2503 815 22092 2030 --
NM_015216chr511449 --21085 439 --
NM_015219chr1752048 1816 878 669 169 ------
NM_015221chr1091462 1350 1237 1045 1004 509 464 40 34 ------
NM_015225chr953072 2640 2615 210 29 1875 ----
NM_015233chr1342351 829 635 463 11882 ----
NM_015236chr421151 363 ------
NM_015246chr1651423 1364 630 514 466 ------
NM_015247chr1674830 3402 1476 1189 419 158 105 --1365 --
NM_015250chr911912 --21268 532 --
NM_015251chr1682342 1596 1559 840 586 494 235 139 22323 2016 ----
NM_015252chr22845 602 ------
NM_015254chr892863 1001 831 557 507 316 310 211 122 22775 373 43173 2930 1976 402 --
NM_015263chr15173 11059 ----
NM_015265chr262476 2307 2150 311 126 52 11652 11712 --
NM_015268chr32740 89 ------
NM_015270chr1291782 1711 1655 1649 1455 710 471 455 143 ------
NM_015271chr474267 4004 3874 3276 855 727 540 24234 3881 11380 --
NM_015272chr161652 ------
NM_015275chr122637 602 1667 --1144
NM_015277chr1831352 267 188 --11500 --
NM_015278chr663044 2778 2466 896 876 571 32944 1369 597 ----
NM_015282chr252611 2578 2322 257 48 ------
NM_015284chr13830 479 145 ------
NM_015288chr573483 2624 2370 1527 1149 928 170 ------
NM_015289chr1541846 1818 1801 286 --11375 --
NM_015291chr151281 1003 977 813 803 --21401 324 --
NM_015292chr126711 548 304 247 42 34 ------
NM_015294chr1741098 1090 452 380 ------
NM_015296chr132182 157 ----1352
NM_015299chr1473605 3347 2748 1415 1268 687 665 21123 233 1118 --
NM_015305chr1461898 1694 1285 747 393 346 11360 ----
NM_015308chr112222 208 1670 ----
NM_015310chr8126474 6188 3118 2992 2885 1983 1843 1780 1646 706 187 165 38112 7231 5147 36740 5657 5630 --
NM_015313chr1173996 3698 3469 3099 435 392 57 13456 14455 --
NM_015314chr742502 1966 1950 327 11959 --11719
NM_015315chr593459 3388 2742 2125 1154 1058 1007 858 693 23429 920 ----
NM_015317chr252703 2345 1111 1000 886 --11792 --
NM_015320chr21168 1810 ----
NM_015321chr19114897 4891 4268 3502 1921 1909 1819 1288 1192 576 434 ------
NM_015326chr142922 2295 973 351 12159 ----
NM_015328chr7102613 2597 2459 2070 711 658 583 503 401 165 --12315 --
NM_015329chr1932786 2377 89 --22847 1894 --
NM_015335chr1211841 --22024 541 --
NM_015336chr1242198 534 53 40 11639 164 --
NM_015339chr2051054 327 283 92 75 ------
NM_015344chr821876 238 --22047 672 --
NM_015347chr1222793 2499 22225 701 12852 --
NM_015349chr632907 702 274 --1670 --
NM_015353chr17102536 2439 2333 1927 1097 1004 979 940 826 227 ------
NM_015354chr91359 ------
NM_015355chr17----21863 1335 --
NM_015358chr21--1957 ----
NM_015359chr862644 2620 2069 1929 1901 209 11983 1624 --
NM_015361chr2------1815
NM_015365chrX93665 3477 3361 3052 2781 2681 1509 326 284 --21518 872 --
NM_015367chr22--1437 41628 1455 1422 1389 --
NM_015374chr2231293 448 334 ------
NM_015375chr1134707 4700 4119 3994 3848 3459 1602 1534 1203 1036 310 236 116 --13792 --
NM_015378chr163007 2707 2522 2098 2023 692 --12783 --
NM_015379chr71212 ------
NM_015381chr2221444 445 ------
NM_015387chr241994 1756 1499 135 1445 ----
NM_015393chr443604 3013 2647 53 31158 996 966 12987 --
NM_015396chr321230 1077 ------
NM_015397chr951421 735 475 419 184 11730 ----
NM_015416chr123790 698 652 ------
NM_015423chr1141749 1495 638 530 1664 ----
NM_015429chr32924 728 ------
NM_015435chr811108 ------
NM_015436chr433161 2132 211 3940 452 317 ----
NM_015443chr1771508 1477 1445 1426 1389 1272 1045 ------
NM_015444chr3180 --152 --
NM_015446chr131674 1301 1123 --21168 278 --
NM_015453chr321681 1563 1837 ----
NM_015455chr594142 3439 2843 2522 1574 1056 942 350 232 22725 194 24099 1239 --
NM_015458chr854971 3225 2069 1945 1025 11381 1496 --
NM_015460chr32475 301 1209 158 --
NM_015464chr73895 118 111 2142 45 1952 --
NM_015469chr93648 211 62 1308 1154 --
NM_015470chr221112 100 --2911 210 --
NM_015475chr21255 1853 11078 --
NM_015477chr153981 834 92 ------
NM_015483chr721080 392 --140 --
NM_015488chr231759 1522 1503 1465 11470 --
NM_015493chr1952128 1985 1927 1734 1474 --21539 1485 --
NM_015507chrX1138 1169 ----
NM_015508chr33989 470 147 ------
NM_015516chr1131475 1401 1185 --1294 --
NM_015520chr322279 881 ------
NM_015523chr111240 ------
NM_015525chr61991 ------
NM_015530chr23915 645 54 1862 ----
NM_015532chr1562179 556 358 315 172 148 --12484 12494
NM_015534chr1193 ------
NM_015535chr283573 3094 2651 2591 1123 909 338 204 1468 21335 560 --
NM_015541chr311417 --11440 1376
NM_015542chr1041041 1030 929 414 ------
NM_015548chr61143 ------
NM_015549chr141458 --1414 --
NM_015550chr793223 3105 2968 2922 2906 2832 1092 113 45 31059 662 342 --11129
NM_015553chr6105184 4909 4842 3863 3781 3591 3333 1173 1086 514 25061 3232 1536 11972
NM_015554chr1552910 2686 1988 1817 251 12398 --11895
NM_015555chr61127 1587 11347 --
NM_015559chr1831067 1056 737 ------
NM_015560chr372630 2490 2047 1115 1081 637 472 21955 306 12041 12718
NM_015564chr543203 2574 1047 1014 --12768 --
NM_015565chr2142078 1426 599 183 1535 ----
NM_015567chr1311207 --1113 --
NM_015568chr2073048 2998 2841 2813 1252 1004 115 ------
NM_015569chr174713 4665 4627 4469 3106 1823 301 14291 14220 --
NM_015571chr622446 541 ----12195
NM_015575chr242805 1341 1060 348 --21003 224 --
NM_015576chr352889 2739 1143 1064 763 ----12488
NM_015577chr541799 1447 420 42 1561 ----
NM_015601chr10------1826
NM_015602chr131745 1264 122 ------
NM_015605chr102615 141 ------
NM_015608chr101232 --272 39 --
NM_015609chr142844 2427 2135 2059 --12327 --
NM_015610chr742151 1998 1957 1902 --22882 1004 --
NM_015626chr1741155 1149 887 289 1930 ----
NM_015627chr171812 1801 1567 1459 1362 740 205 --11175 11836
NM_015630chr23946 403 252 ------
NM_015634chr101202 1505 ----
NM_015635chr962011 1897 1455 739 605 76 1391 ----
NM_015640chr131359 942 443 15056 13323 --
NM_015642chr31256 ------
NM_015651chr992259 2224 2070 1953 859 837 227 221 120 --41691 1437 516 339 --
NM_015652chr103494 275 75 ------
NM_015657chr21675 ----1989
NM_015680chr22630 537 ------
NM_015686chrX42470 2303 1988 1958 ------
NM_015691chrX62303 2162 2037 994 671 78 12969 ----
NM_015695chr652030 1966 1720 649 528 ------
NM_015696chr12382 76 ------
NM_015713chr883274 2769 2699 2620 1426 678 201 195 12191 ----
NM_015714chr11321 ------
NM_015716chr173213 158 100 ------
NM_015723chr72479 137 ------
NM_015726chr111194 21498 114 11552 --
NM_015850chr8102294 2240 1638 1603 680 526 456 449 375 149 12061 22261 413 --
NM_015872chr111375 ----11738
NM_015878chr821576 384 --1470 --
NM_015879chr18128648 8590 8577 8461 7159 6299 3185 3140 3125 2768 900 128 21726 92 --13133
NM_015881chr1141289 396 265 198 --1475 168
NM_015885chr111193 ------
NM_015889chr222131 118 ------
NM_015891chr621940 1639 ------
NM_015904chr23569 531 218 ------
NM_015905chr7------1408
NM_015906chr133686 3140 1604 1972 ----
NM_015907chr42143 22 134 ----
NM_015912chr842482 2213 1634 68 --1151 --
NM_015915chr14185 ------
NM_015934chr21148 ------
NM_015955chr2--1187 ----
NM_015980chr521670 1080 ------
NM_015981chr562562 2396 2384 795 628 313 ------
NM_015982chr171310 ------
NM_015984chr12218 128 1376 ----
NM_015987chr125397 360 78 46 38 ------
NM_015990chr43942 840 121 1906 ----
NM_015995chr1555028 4963 4799 2176 457 1595 11728 --
NM_015999chr1----144 --
NM_016003chr742151 1998 1957 1902 --22882 1004 --
NM_016009chr154821 4608 4540 4252 485 --14462 14942
NM_016018chr841932 1751 904 462 12804 ----
NM_016019chr72332 299 ----1911
NM_016021chr663008 1126 826 812 234 168 ------
NM_016022chr11139 ------
NM_016023chr872081 2031 1632 1584 854 732 385 1563 1178 --
NM_016027chr83446 203 36 ------
NM_016032chrX11426 ------
NM_016039chr141151 ------
NM_016048chr511003 --1234 --
NM_016060chr1721110 722 --21038 131 1274
NM_016061chr221687 661 11638 ----
NM_016072chr1241811 1681 379 326 22422 2361 ----
NM_016075chr1342751 2114 2107 483 12484 12950 --
NM_016076chr173014 2846 2225 1987 909 646 350 22508 1292 --11111
NM_016078chr17----122 11082
NM_016083chr653329 2519 1338 1044 329 --12454 --
NM_016096chr831404 1368 79 32178 545 372 22002 1651 --
NM_016098chr61365 1174 ----
NM_016100chr201323 141 ----
NM_016107chr531371 403 353 1316 1293 --
NM_016120chrX4842 791 126 64 1310 ----
NM_016129chr41313 ------
NM_016131chr21404 1783 1944 1515
NM_016132chr1553356 3132 2906 1131 913 ------
NM_016133chr241432 1341 1322 374 --1481 --
NM_016141chr3296 60 2748 620 ----
NM_016147chr113942 393 356 11054 ----
NM_016152chr331246 475 392 --1381 --
NM_016156chr1152247 2146 804 796 658 ------
NM_016162chr122738 323 ------
NM_016179chr132198 192 1212 ----
NM_016185chr173764 534 128 ------
NM_016192chr22190 101 ------
NM_016201chr351838 1701 830 698 509 ------
NM_016203chr71172 ----1359
NM_016205chr421399 396 ------
NM_016206chr3108471 7968 7631 5965 3550 2874 2321 2071 776 261 --23324 577 --
NM_016210chr32984 49 ------
NM_016217chr673549 3305 3281 2493 2325 439 162 22868 1222 1728 --
NM_016224chr631908 1358 551 1328 2737 36 --
NM_016227chr161568 1075 1063 1007 492 476 11331 1370 --
NM_016228chr42482 460 ------
NM_016230chr6--1372 ----
NM_016231chr17----1195 --
NM_016235chr1621386 1100 --162 --
NM_016248chr1313838 12509 11226 1815
NM_016252chr22986 637 --1192 --
NM_016255chr652394 2291 2127 914 443 11232 11281 --
NM_016257chr163294 3060 2860 2577 1388 211 23495 350 ----
NM_016258chr12771 297 --1532 --
NM_016260chr277429 5933 2911 2703 2255 2101 288 16086 16895 --
NM_016271chr1842072 2030 1678 311 12346 ----
NM_016275chr381999 1844 1831 1813 1756 675 640 119 12093 1395 --
NM_016281chr121151 1349 ----
NM_016284chr161385 1157 ----
NM_016287chr141489 310 185 85 11830 1174 --
NM_016289chr221734 606 ------
NM_016297chr252775 2684 2521 690 674 --12850 2991 594
NM_016303chrX2184 48 ------
NM_016307chr91289 ------
NM_016308chr141859 1848 1331 46 --21762 287 --
NM_016316chr22636 49 ------
NM_016322chr973178 3134 2610 1006 589 476 80 21053 545 22851 2761 --
NM_016329chr32469 394 165 ----
NM_016339chr1731463 696 345 --2624 505 --
NM_016352chr751473 1409 1276 1090 421 ------
NM_016356chr652783 2514 1167 644 514 22809 957 ----
NM_016359chr151676 1669 ----
NM_016374chr141415 1042 230 184 ------
NM_016374chr141415 1042 230 184 ------
NM_016376chr1744260 2748 2703 1654 13451 1102 --
NM_016396chr1572514 2212 1974 1967 947 610 115 ------
NM_016410chr91177 --1473 --
NM_016418chr2273583 2859 2695 2529 842 311 231 --23502 372 --
NM_016422chr1142713 1098 727 171 --22771 871 --
NM_016423chr141470 --1449 --
NM_016424chr1731403 531 248 2524 428 ----
NM_016436chr2062671 2483 2012 1843 608 532 ------
NM_016441chr232131 866 681 11908 ----
NM_016442chr552277 2182 2171 715 41 1753 ----
NM_016448chr141626 678 502 122 ------
NM_016470chr202475 118 127 ----
NM_016480chr52730 299 --1720 --
NM_016485chr622022 1902 ----2766 651
NM_016486chr11181 ------
NM_016492chr17--1144 ----
NM_016506chr113663 244 119 ------
NM_016507chr171577 ------
NM_016516chr22351 224 ------
NM_016519chr42357 173 ------
NM_016522chr1131428 1188 205 11401 ----
NM_016525chr9--1813 ----
NM_016530chr1531322 1177 477 ------
NM_016531chr433222 3180 594 11195 ----
NM_016542chrX31446 1126 257 --198 --
NM_016544chr273912 3681 3364 3356 2725 1502 467 11056 12554 --
NM_016545chr12926 253 --1745 --
NM_016561chr1621008 122 1635 ----
NM_016575chr12145374 5293 5266 5175 4517 4228 3933 3811 3371 1872 1551 1018 243 85 14282 ----
NM_016592chr202390 320 ------
NM_016598chr321479 590 ----11004
NM_016599chr42495 210 11436 1540 --
NM_016603chr532216 1560 414 ------
NM_016605chr511715 12227 --1358
NM_016607chrX1212 ------
NM_016612chr83502 492 237 1131 ----
NM_016613chr442593 2207 1738 587 22320 1948 12565 --
NM_016615chr12384 32 24 ------
NM_016618chr21172 ------
NM_016620chr111437 --11178 --
NM_016621chr1194524 3708 3595 1843 1733 1701 1671 1477 304 12984 ----
NM_016623chr81105 ------
NM_016626chr1821339 428 ------
NM_016631chr211940 ------
NM_016641chr1621735 1345 --11265 --
NM_016644chr51384 ------
NM_016651chr143981 403 109 --1172 --
NM_016654chr1521103 1013 21257 1234 1870 --
NM_016823chr172471 244 --11034 --
NM_016824chr1021823 1710 1454 ----
NM_016830chr122463 444 ------
NM_016831chr161932 1864 1505 948 394 237 11878 ----
NM_016834chr1753617 1483 1029 846 143 --23749 1564 --
NM_016835chr1753617 1483 1029 846 143 --23749 1564 --
NM_016836chr25703 675 556 535 492 1612 --2583 86
NM_016839chr25703 675 556 535 492 1612 --2583 86
NM_016841chr1753617 1483 1029 846 143 --23749 1564 --
NM_016929chr684516 4489 3925 3602 1061 855 513 90 24314 347 ----
NM_016930chr43818 812 309 --159 --
NM_016932chr25935 372 365 309 28 ------
NM_016936chr161157 11949 1752 --
NM_016946chr172381 2337 1296 988 597 524 102 33495 94 39 ----
NM_016950chr42326 184 1434 1979 --
NM_016952chr1183572 3487 3350 2727 2579 1482 1158 606 21009 183 1821 --
NM_016954chrX2651 486 ----1148
NM_017409chr124583 576 523 64 ------
NM_017412chr851008 321 147 101 61 ------
NM_017415chr5124295 3643 3350 2967 2892 1545 1340 1282 1208 1088 673 485 12905 23325 1224 --
NM_017420chr1433720 2732 1375 23049 1096 23110 987 23610 3283
NM_017423chr472051 2025 1410 544 511 311 202 --2433 271 --
NM_017447chr2173723 3394 3182 1774 1610 926 582 34173 1680 1401 ----
NM_017449chr11592 --11062 --
NM_017450chr173322 305 130 --11013 --
NM_017451chr17--11003 ----
NM_017452chr2031174 557 65 ------
NM_017453chr2031174 557 65 ------
NM_017454chr2031174 557 65 ------
NM_017455chr152679 238 1133 ----
NM_017456chr1751990 1703 787 771 623 ------
NM_017459chr11151 --173 --
NM_017491chr43771 755 159 ------
NM_017514chrX----2831 172 1817
NM_017520chr133623 537 166 ------
NM_017522chr131447 428 25 ------
NM_017540chr522559 989 23051 239 22078 2017 1402
NM_017544chrX----3838 718 210 --
NM_017545chr203541 385 162 ------
NM_017546chr22197 139 --2875 208 --
NM_017548chr321756 832 --1791 --
NM_017549chr761527 1461 1161 1069 345 149 ------
NM_017551chr1062607 2249 2226 655 606 413 12178 12669 --
NM_017553chr152197 174 ------
NM_017577chr351451 1245 1049 512 339 11601 ----
NM_017580chr1031676 1484 953 --1668 --
NM_017582chr141791 1468 554 378 11552 ----
NM_017583chr1141510 1128 285 187 ------
NM_017588chr941971 1700 1447 1295 --2575 69 --
NM_017593chr41459 ------
NM_017596chr194020 3871 3600 3536 3126 3120 2898 1688 1374 --33413 1560 1487 --
NM_017602chrX1654 ------
NM_017610chr1531863 1533 1490 1320 ----
NM_017628chr444547 4500 797 695 11027 65113 4879 4827 4647 1592 83 --
NM_017629chr12783 512 --11497 --
NM_017632chr42465 101 ------
NM_017633chr653752 3031 2508 832 824 --1531 --
NM_017634chr851768 1631 1397 308 244 11564 ----
NM_017635chr1121547 1525 ------
NM_017637chr9159360 9267 8920 8756 8460 8338 8227 7963 7567 3637 3436 3302 3128 1825 467 22466 760 46085 3311 903 191 --
NM_017640chr62276 152 --139 1106
NM_017641chr124980 317 267 181 21116 233 ----
NM_017643chr1732240 1101 977 12382 ----
NM_017644chr375181 5066 5024 4030 3600 1540 1336 34993 4359 609 54710 3591 1084 325 130 14487
NM_017649chr1011220 --1376 --
NM_017650chr7105879 5595 5530 5092 4534 4305 3872 2033 1900 1848 14040 22209 1917 --
NM_017657chr23641 273 31 1691 ----
NM_017658chr14114191 3129 1192 1114 1045 899 676 617 501 325 97 44350 4298 1836 397 ----
NM_017660chr1972936 1285 1206 1135 473 439 266 22322 450 ----
NM_017661chr1521148 822 --11206 --
NM_017662chr92473 30 21703 283 ----
NM_017664chr132356 269 1821 ----
NM_017666chrX51901 760 337 276 245 --12235 --
NM_017672chr15--11120 ----
NM_017673chr11801 ------
NM_017679chr171586 ------
NM_017684chr1512004 171 ----
NM_017686chr11808 ----1986
NM_017697chr83470 453 375 ----1168
NM_017700chr42496 124 ------
NM_017709chr184187 3841 3329 3015 2795 1183 851 123 21635 1164 13422 --
NM_017714chr20------1330
NM_017715chr72478 181 ------
NM_017719chr342230 534 422 341 2756 585 --12075
NM_017728chr1711971 --11140 --
NM_017730chr32633 579 ------
NM_017737chr191875 1853 1631 891 492 435 414 344 56 21550 878 --1317
NM_017738chr921246 837 11165 ----
NM_017742chr182635 175 --1268 --
NM_017744chr151526 958 739 438 215 --12206 --
NM_017745chrX1239 ------
NM_017752chrX52151 1612 1559 579 106 --11534 --
NM_017754chr683677 3230 3090 1965 917 860 570 249 23645 3461 44663 3853 3262 150 --
NM_017757chr183834 749 459 ------
NM_017758chr1731225 1082 373 ------
NM_017762chr1532413 1744 568 --22222 652 --
NM_017772chr641624 603 354 32 ------
NM_017776chrX31142 1048 421 ------
NM_017778chr841169 1087 1018 436 1171 11289 --
NM_017779chr152734 2275 2010 1912 1103 21725 571 1727 --
NM_017780chr83939 269 239 ------
NM_017784chr311188 --11177 --
NM_017787chr1052368 2314 896 700 504 ------
NM_017798chr204888 360 119 65 ------
NM_017799chr1431576 1373 1357 1564 11691 --
NM_017801chr3153 21697 353 --11613
NM_017811chr913101 ------
NM_017813chr8105721 3819 1250 1238 1055 1040 942 206 193 187 15203 15627 13885
NM_017822chr123778 516 328 ------
NM_017824chr1022660 1963 ------
NM_017830chr44924 800 758 75 1996 ----
NM_017831chr1844532 4357 4128 3430 31159 858 161 34577 4259 1615 --
NM_017842chr121535 1678 ----
NM_017845chr4193 ------
NM_017847chr12389 165 1180 1886 --
NM_017848chrX34481 1657 884 --34410 3163 1875 --
NM_017866chr821068 66 1311 ----
NM_017873chr952943 2501 2226 2170 717 --1630 --
NM_017896chr20113348 3253 3152 2957 2951 2539 2449 2368 2339 776 379 --22603 2412 --
NM_017902chr10155743 5447 5238 5191 4783 4699 4590 4410 4381 2205 1561 1540 869 612 432 --25213 2213 35150 4350 4093
NM_017905chr132532 266 ------
NM_017915chr121323 ------
NM_017916chr19282 21 ------
NM_017919chr995822 5427 4073 4042 3920 3621 1122 827 703 21689 1401 13589 --
NM_017922chr142506 108 ------
NM_017923chr42514 283 ------
NM_017925chr941491 1204 534 232 11530 ----
NM_017926chr145936 923 905 318 304 ----1780
NM_017933chr21591 21573 364 ----
NM_017938chrX22180 513 32073 2056 1971 ----
NM_017944chr1132208 2199 1189 11933 12076 --
NM_017952chr284380 3936 3544 2803 1555 854 733 370 ----14001
NM_017955chr1441153 1097 262 228 1379 1855 --
NM_017972chr145936 923 905 318 304 ----1780
NM_017987chr1061937 1801 1786 892 579 343 1264 ----
NM_017994chr751007 894 779 279 139 --2657 203 13007
NM_018003chr1542471 1687 568 347 1673 1510 --
NM_018009chr122159 118 ------
NM_018018chr122764 438 2499 278 ----
NM_018027chr1043235 2195 2041 1053 1174 ----
NM_018030chr1821064 270 ------
NM_018036chr14124331 4241 4213 4169 3941 3801 3264 3050 2874 2717 1042 321 13197 13015 13669
NM_018047chr53841 693 151 --1833 --
NM_018061chr1155 11273 2406 150 --
NM_018062chr21402 --1415 --
NM_018070chr11442 ------
NM_018077chr72262 80 ------
NM_018084chr263067 3031 2547 2521 2082 357 32963 2708 2419 --1809
NM_018085chr1117903 7227 7186 7108 7041 5370 2809 950 933 842 459 27178 5912 11028 15644
NM_018086chr221553 354 21670 1398 --1368
NM_018087chr12212 194 ------
NM_018095chr113663 244 119 ------
NM_018100chr673409 3231 2386 1345 1187 798 50 ----1182
NM_018112chr91957 1210 ----
NM_018114chr31110 ------
NM_018115chr42746 255 1695 ----
NM_018120chr831010 453 203 11218 2505 430 --
NM_018121chr1093209 2694 2670 2502 2489 2469 2230 1238 924 --12632 --
NM_018131chr101841 ------
NM_018133chr341729 1714 428 310 ----11778
NM_018150chr12871 808 ------
NM_018155chr352956 1096 880 598 223 11042 1729 --
NM_018156chr163007 2707 2522 2098 2023 692 --12783 --
NM_018157chr1273247 2532 2344 2208 1229 1217 97 134 12302 --
NM_018171chr121137 --1215 --
NM_018178chr111534 --1289 --
NM_018179chr12--1237 --1635
NM_018181chr1841490 586 523 417 --1580 1504
NM_018184chr361850 1838 1743 1549 658 111 1237 ----
NM_018189chr33332 172 164 11685 ----
NM_018195chr1161829 1393 842 459 145 110 11935 1474 --
NM_018200chr1592602 2177 2002 1936 1924 1032 927 820 452 11653 ----
NM_018201chr952523 2365 1008 912 376 12469 1685 1741
NM_018202chr11280 --1694 --
NM_018211chr132207 2015 1657 2602 66 ----
NM_018214chr621273 881 1281 133 1158
NM_018217chr20158 ------
NM_018221chr21129 ------
NM_018222chr1131837 1177 583 174 ----
NM_018234chr262235 2171 2153 2077 1755 600 --1844 --
NM_018241chr42762 71 1280 ----
NM_018243chr4103916 3575 3451 3377 3017 2726 645 459 245 40 13782 ----
NM_018244chr2021169 63 ------
NM_018247chr653043 2892 847 305 252 12910 12511 --
NM_018254chr152259 2122 1878 862 569 11839 12135 --
NM_018257chr2052222 2186 2155 1852 1606 --1966 --
NM_018263chr242370 1777 769 112 12241 ----
NM_018266chr31326 11091 ----
NM_018270chr201266 1744 ----
NM_018285chr152511 28 ------
NM_018287chr1021222 181 ------
NM_018290chr41350 11243 --1296
NM_018293chr372947 2854 2266 2236 2046 1898 1831 12171 1664 --
NM_018299chr823238 199 ------
NM_018302chr441806 1763 474 417 11631 1836 --
NM_018303chr651514 1390 1366 592 469 ------
NM_018307chr171810 162 ----
NM_018312chr1132004 1435 850 11485 11934 --
NM_018313chr341996 1067 512 330 --1565 --
NM_018315chr411553 ------
NM_018320chr111108 ------
NM_018323chr421595 1277 31899 736 466 11539 --
NM_018328chr21519 ------
NM_018330chr101567 ------
NM_018334chr71520 ------
NM_018335chr142369 183 ------
NM_018339chr941766 1725 1489 1239 ------
NM_018354chr20--129 ----
NM_018361chr844076 3983 3949 791 23291 2556 1935 --
NM_018364chr183602 3398 3237 3174 2732 1091 600 347 23619 1381 24023 410 --
NM_018371chr81222 ------
NM_018374chr794926 4236 3707 3185 1955 1505 1428 1280 943 14857 13436 --
NM_018375chr1421488 653 ----1458
NM_018383chr221672 426 21778 432 ----
NM_018386chr132387 126 ------
NM_018387chr92370 82 ------
NM_018388chrX31398 966 582 179 ----
NM_018403chr353878 3634 3329 2521 326 --32579 1585 1227 --
NM_018413chr12132 ------
NM_018416chr1242631 2562 1910 1641 --12119 --
NM_018424chr921705 1503 --2101 64 --
NM_018425chr1042077 1938 958 462 1654 ----
NM_018426chr61116 ------
NM_018429chr542111 1902 593 233 22693 98 ----
NM_018433chr21374 ------
NM_018439chr1862338 2225 1872 945 682 407 11946 1317 --
NM_018440chr8188694 8315 8211 7641 7432 7337 7302 6582 6515 6294 5654 3185 2176 2154 1527 663 555 41 32329 737 103 --11870
NM_018441chr2--1798 138 --
NM_018442chr11371 ------
NM_018444chr822390 2102 12299 1250 --
NM_018445chr151374 166 ----
NM_018448chr122991 89 ------
NM_018449chr93740 579 301 ------
NM_018452chr6_random73483 2435 2423 1515 1360 908 385 12608 --1541
NM_018454chr151676 1669 ----
NM_018456chr3--195 ----
NM_018460chr2139 ------
NM_018464chr101150 ------
NM_018476chrX147 ------
NM_018482chr852597 2053 828 172 53 1653 --12379
NM_018489chr122062 793 ------
NM_018553chr1741558 581 436 378 --1314 --
NM_018555chr193589 401 302 ------
NM_018566chr184307 2050 1077 1029 779 637 501 191 11257 14088 --
NM_018569chr471487 1257 1092 258 205 198 77 11410 11437 --
NM_018571chr22569 54 --1471 --
NM_018584chr111256 --11014 --
NM_018593chr62509 35 ------
NM_018602chr153614 550 297 --1141 --
NM_018638chr1285564 5215 5065 4283 4010 3568 1937 1930 53702 3611 1540 847 117 ----
NM_018640chr1262521 2339 2299 2187 810 422 --1843 --
NM_018649chr10162 --2589 441 --
NM_018650chr141755 846 679 337 11607 ----
NM_018653chr171376 1397 ----
NM_018667chr1642599 2585 2307 87 ------
NM_018682chr71150 ------
NM_018685chr72905 318 194 ----
NM_018686chr12156 --1269 --
NM_018689chr1572562 2313 2107 1746 277 260 190 12728 ----
NM_018691chr52788 148 ------
NM_018693chr23294 274 67 ------
NM_018695chr521588 661 ------
NM_018697chr762291 1907 1868 1658 402 63 --1675 --
NM_018698chrX31993 1884 1643 1203 ----
NM_018700chr551312 1212 1191 254 180 2420 53 2452 161 --
NM_018704chr12505 390 --11970 --
NM_018710chr8137 ------
NM_018712chr1141301 236 114 50 ------
NM_018713chr151081 973 775 207 162 --1816 --
NM_018715chr172240 2127 1990 1518 1449 494 188 12263 ----
NM_018718chr752315 2244 2127 592 391 11555 1698 --
NM_018836chr12252 51 ------
NM_018840chr201333 ------
NM_018841chr193927 3908 3661 3485 3234 2933 1024 1010 471 23706 1464 23621 1035 --
NM_018845chr1--2547 524 ----
NM_018847chr921931 233 --11212 --
NM_018890chr711207 --31099 1065 963 --
NM_018898chr552035 1838 1467 340 142 --22285 2200 --
NM_018899chr552035 1838 1467 340 142 --22285 2200 --
NM_018900chr552035 1838 1467 340 142 --22285 2200 --
NM_018901chr552035 1838 1467 340 142 --22285 2200 --
NM_018902chr552035 1838 1467 340 142 --22285 2200 --
NM_018903chr552035 1838 1467 340 142 --22285 2200 --
NM_018904chr552035 1838 1467 340 142 --22285 2200 --
NM_018905chr552035 1838 1467 340 142 --22285 2200 --
NM_018906chr552035 1838 1467 340 142 --22285 2200 --
NM_018907chr552035 1838 1467 340 142 --22285 2200 --
NM_018908chr552035 1838 1467 340 142 --22285 2200 --
NM_018909chr552035 1838 1467 340 142 --22285 2200 --
NM_018910chr552035 1838 1467 340 142 --22285 2200 --
NM_018911chr552035 1838 1467 340 142 --22285 2200 --
NM_018912chr531725 1371 709 --11532 --
NM_018913chr531725 1371 709 --11532 --
NM_018914chr531725 1371 709 --11532 --
NM_018915chr531725 1371 709 --11532 --
NM_018916chr531725 1371 709 --11532 --
NM_018917chr531725 1371 709 --11532 --
NM_018918chr531725 1371 709 --11532 --
NM_018919chr531725 1371 709 --11532 --
NM_018920chr531725 1371 709 --11532 --
NM_018921chr531725 1371 709 --11532 --
NM_018922chr531725 1371 709 --11532 --
NM_018923chr531725 1371 709 --11532 --
NM_018924chr531725 1371 709 --11532 --
NM_018925chr531725 1371 709 --11532 --
NM_018926chr531725 1371 709 --11532 --
NM_018927chr531725 1371 709 --11532 --
NM_018928chr531725 1371 709 --11532 --
NM_018929chr531725 1371 709 --11532 --
NM_018945chr683559 3451 3439 2927 2730 1036 1023 748 12263 ----
NM_018947chr784859 4777 4656 4637 2006 891 714 635 23821 390 1773 --
NM_018948chr151449 1103 1030 940 123 ------
NM_018951chr75951 412 333 301 60 ------
NM_018959chr193608 581 247 ------
NM_018970chr712765 1822 --12614
NM_018972chr842329 670 518 292 3502 178 83 22096 1884 12291
NM_018976chr1272279 2253 2144 1854 592 496 353 --1822 --
NM_018977chrX1937 --11069 --
NM_018979chr1252654 2594 1833 371 249 12086 1909 1572
NM_018981chr241154 968 907 280 ------
NM_018992chr1621084 99 ------
NM_018999chr1034020 3116 1633 13568 11050 --
NM_019000chr521497 1470 --11546 --
NM_019004chr711661 ------
NM_019008chr22103663 3580 2791 2697 1045 794 453 402 342 81 11487 2372 108 --
NM_019015chr71133 ------
NM_019016chr17--1206 128 --
NM_019024chr22433 120 ------
NM_019027chr441871 1789 947 475 12538 1235 1736
NM_019028chr112427 372 ------
NM_019030chr5--127 ----
NM_019035chr421947 118 ------
NM_019036chr6--1999 1918 --
NM_019042chr721153 241 173 1966 --
NM_019045chrX----1313 --
NM_019048chr2--174 ----
NM_019049chr13762 525 267 --1195 --
NM_019050chr442157 2136 1928 734 1519 1616 --
NM_019054chr105582 571 195 89 57 --1494 1599
NM_019063chr23840 626 549 ------
NM_019074chr151193 --1393 --
NM_019080chr1321546 984 21509 1092 -