TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-124-5p
miRNA Sequence: CGUGUUCACAGCGGACCUUGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521701 497 --42061 1350 825 313 11800
NM_000091chr252805 2425 996 852 62 1531 ----
NM_000109chrX32396 2348 979 1355 --1992
NM_000112chr5105328 4894 4112 3781 3756 3560 3422 1736 647 183 14056 --15153
NM_000125chr674255 3927 3219 2678 2635 1155 1024 1598 ----
NM_000208chr1954252 4217 3534 1484 1346 34298 4206 1788 22983 1411 --
NM_000214chr2011793 --21783 1250 11444
NM_000217chr1254158 2148 1929 514 507 23940 844 14478 12019
NM_000222chr461983 859 553 447 345 235 --1476 1138
NM_000237chr841395 1182 547 123 1434 --11314
NM_000259chr1565957 5268 5155 4600 623 151 --25985 1896 12190
NM_000314chr1032730 617 49 --22698 1271 11279
NM_000330chrX32290 1634 86 32226 1600 333 22306 2198 1665
NM_000332chr6177130 6295 5974 5850 5441 2675 2509 2269 2091 1820 1614 1474 1098 1028 851 777 600 14809 26480 5589 --
NM_000337chr576584 5903 5621 5311 2163 1509 819 187 15664 --
NM_000362chr2233050 1387 125 21057 433 32485 1195 58 --
NM_000461chr364611 3564 3315 1686 810 340 34172 2927 420 13387 --
NM_000555chrX87242 6546 6377 5918 2838 2058 1738 1145 ------
NM_000612chr1133456 3354 3348 52494 1275 1260 1142 933 --51482 1408 1350 978 916
NM_000615chr1153016 2699 2073 447 279 22094 1996 --11154
NM_000618chr1242528 2396 830 84 15729 22490 1203 11633
NM_000618chr1242528 2396 830 84 15729 22490 1203 11633
NM_000719chr12136114 6104 5756 5592 5491 5234 4899 4692 4650 2514 1870 1818 297 --14786 --
NM_000793chr1475149 4260 3837 3686 1739 347 131 1856 ----
NM_000809chr4108568 7892 7682 7128 5806 3489 2932 2714 2704 1981 58899 8803 2396 1594 235 13460 11160
NM_000813chr5135526 4793 4768 4092 3952 3932 3683 3599 1825 1603 1582 662 541 32224 2122 1029 22036 603 21322 181
NM_000826chr441019 653 618 371 12140 11766 --
NM_000831chr1106121 6102 5974 5665 4265 4217 2008 1566 1514 689 12489 --24343 2359
NM_000859chr541715 1287 106 28 ----1195
NM_000860chr441538 1323 331 73 --31389 1379 485 --
NM_000875chr1566150 5796 5099 1973 657 278 56295 5490 5421 2665 992 --1797
NM_000880chr8--1905 1228 1173
NM_000899chr1253380 3240 1303 1262 752 --1759 --
NM_000910chr451598 1421 1266 433 299 21228 790 ----
NM_000912chr863291 2777 803 589 497 260 23267 1210 2937 750 11058
NM_000919chr51599 ----1219
NM_000922chr114970 956 691 118 1945 1275 1846
NM_001001419chr574199 3926 3886 3625 1719 802 271 14416 21811 529 --
NM_001001420chr574199 3926 3886 3625 1719 802 271 14416 21811 529 --
NM_001001664chr253720 3495 2861 1284 1084 12812 13244 --
NM_001001665chr262083 1195 917 665 461 145 --23407 529 --
NM_001001974chr10----22378 2253 11927
NM_001002860chr1484060 3928 3233 3098 2954 2938 1601 218 ----11475
NM_001003652chr18158685 8217 8165 7750 7064 6426 6028 5343 3380 3224 2699 2682 2383 1807 170 27041 6871 28480 8224 --
NM_001003674chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_001003675chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_001003712chr1223611 936 ----1578
NM_001004065chr953714 3589 2762 1158 876 1767 1193 --
NM_001004317chr663841 3588 2906 2797 1625 169 --23124 1326 --
NM_001004360chr211377 ----31787 631 157
NM_001004419chr1263571 3436 922 607 601 143 24078 3340 --13611
NM_001005375chrY61865 1351 1258 1145 496 134 ----1462
NM_001005404chr1753935 3615 3206 1516 54 11375 139 24037 597
NM_001005473chr555993 5495 2551 209 27 11535 --12097
NM_001005781chr22605 218 ----1209
NM_001005782chr231054 724 667 ----1658
NM_001006623chr262577 2115 714 614 573 54 32235 2014 631 22583 852 1791
NM_001006938chrX--1759 --1680
NM_001006945chr15731 559 279 177 98 1145 ----
NM_001007023chr1475149 4260 3837 3686 1739 347 131 1856 ----
NM_001007097chr994423 3855 1886 1661 1143 1021 448 356 198 23956 3618 24671 1232 --
NM_001007559chr1891984 1969 1956 1479 510 474 446 315 233 11490 168 --
NM_001008239chr1843171 3036 2945 1255 ----1831
NM_001008539chr8114895 4761 4008 3952 3439 2167 2150 931 285 218 144 --11699 --
NM_001008564chr1342106 1992 1464 444 --31939 1643 165 1335
NM_001009554chr494372 4274 4104 3920 3356 1747 1263 1139 542 --11321 --
NM_001009554chr494372 4274 4104 3920 3356 1747 1263 1139 542 --11321 --
NM_001010853chr652858 2779 2758 900 882 --12057 --
NM_001010888chrX43792 1456 981 38 --11169 13126
NM_001010986chrX52148 824 444 329 208 --1566 11730
NM_001011513chr433901 2948 2920 --23503 3336 12838
NM_001011666chr796479 5875 5800 5072 4603 4299 4103 4032 700 --1916 16459
NM_001011713chr1431423 1134 484 1329 --11607
NM_001012393chr1185099 4817 4458 4290 3441 1627 542 25 --35162 4219 2004 --
NM_001012419chr951292 1212 1200 897 38 11315 ----
NM_001012755chrX65062 4882 4499 3809 3504 157 --25111 3087 --
NM_001012968chrX12482 ----31917 598 75
NM_001013620chr12107160 6590 2705 2561 2325 2265 1750 1331 212 70 --37265 6195 1808 26365 1858
NM_001014380chr1343988 3856 1460 145 1302 13959 15673
NM_001014797chr10117325 7246 7128 6383 6366 6234 5765 3138 870 469 291 36301 2313 2306 46377 5514 1600 655 46495 5934 1927 343
NM_001017440chr797032 5337 5269 3161 2789 1757 1654 1272 193 27041 2693 --46709 5978 1772 372
NM_001017926chr831670 1319 210 --1663 11842
NM_001018065chr945134 4107 2386 1199 --1341 21816 1168
NM_001018066chr945134 4107 2386 1199 --1341 21816 1168
NM_001018067chr195364 5154 4661 1687 1487 640 513 421 327 --44556 3703 3260 271 --
NM_001018068chr195364 5154 4661 1687 1487 640 513 421 327 --44556 3703 3260 271 --
NM_001018069chr195364 5154 4661 1687 1487 640 513 421 327 --44556 3703 3260 271 --
NM_001018111chr793910 3630 3073 2803 2594 2469 864 812 164 23821 1467 --23568 3020
NM_001024647chr1267701 7005 6565 6197 2813 55 15614 11198 27056 192
NM_001024948chr14635 559 373 153 --23384 1221 --
NM_001024956chr11125872 5837 5787 5559 5515 5139 1936 1847 1663 1237 1227 498 11757 24919 188 1621
NM_001025076chr1045803 5608 4085 1972 36036 5759 433 15769 23848 2040
NM_001025077chr1047161 6966 5443 419 37394 7117 1791 17127 15206
NM_001025108chr253301 2585 2574 558 130 1222 3695 113 63 13569
NM_001025580chrX74209 4002 3825 1625 1033 831 653 --23598 2759 --
NM_001029839chr361533 1322 576 398 259 227 157 11182 --
NM_001029840chr361533 1322 576 398 259 227 157 11182 --
NM_001030007chr16104019 3513 3453 2875 1329 1260 1124 801 676 512 --12519 11576
NM_001030055chr1464510 4403 3166 1259 311 35 1847 ----
NM_001031695chr2275409 5116 4767 2005 929 177 147 11861 23765 1315 --
NM_001031716chr241148 1134 710 199 --153 1966
NM_001031812chr542303 1833 293 277 --21636 807 --
NM_001032999chr2094435 4415 3675 3360 943 806 660 436 142 14051 ----
NM_001033045chr273911 3645 2880 1749 1347 606 244 12802 --12686
NM_001033059chr621631 1346 31322 472 38 --11724
NM_001033087chr2042722 2012 881 529 13290 1310 12424
NM_001033117chr374326 4312 1902 1773 1352 1283 993 --11675 1461
NM_001033507chr121952 1767 ----21726 175
NM_001037339chr141880 1780 736 44 --31760 447 27 --
NM_001037340chr141880 1780 736 44 --31760 447 27 --
NM_001037341chr141880 1780 736 44 --31760 447 27 --
NM_001037341chr141880 1780 736 44 --31760 447 27 --
NM_001039585chr123159 593 ----12632
NM_001039590chrX53389 3303 3047 876 512 ----12822
NM_001039591chrX53389 3303 3047 876 512 ----12822
NM_001039618chr1165321 3929 3683 1705 975 556 193 21972 988 --
NM_001039693chr253918 3404 1452 1139 733 --34100 3420 2667 23294 1264
NM_001039709chr2094435 4415 3675 3360 943 806 660 436 142 14051 ----
NM_001039840chrX65152 4049 3767 1514 398 311 12151 14307 --
NM_001039844chr1052859 2469 403 371 238 1382 --1390
NM_001040151chr1184428 4233 4066 3502 1565 1430 903 50 14498 2734 35 --
NM_001040152chr754837 4730 4194 658 400 1640 2584 428 1374
NM_001040157chr462723 2458 452 438 176 154 12764 1661 --
NM_001040202chr452108 1677 863 568 253 ----11888
NM_001040402chr473227 2515 2479 1075 698 682 443 12626 --1593
NM_001040441chr174963 3451 1523 1242 544 239 147 1450 11550 --
NM_001042355chr1665298 5270 5251 3389 2013 1876 --11841 --
NM_001042404chr131732 1265 660 11653 --21925 484
NM_001042412chr1665298 5270 5251 3389 2013 1876 --11841 --
NM_001042481chr1442371 2304 2265 1718 11660 1518 --
NM_001042555chr1264737 3617 3399 1508 182 122 12914 ----
NM_001042573chr1752068 1608 808 457 316 ----21788 1744
NM_001042599chr2107801 7289 7208 6750 2746 2589 2124 2002 1922 1643 27306 2819 36824 5674 166 --
NM_001042601chr352691 2645 2536 2465 2405 --43208 3110 843 492 --
NM_001042603chr1295294 5219 4272 3683 3652 1223 1045 940 598 ------
NM_001044385chr283936 3777 3205 2825 2810 1501 702 424 13314 22852 1146 11022
NM_001044722chr542303 1833 293 277 --21636 807 --
NM_001044723chr542303 1833 293 277 --21636 807 --
NM_001083620chr441018 652 617 370 12138 11764 --
NM_001099678chr395852 5811 4470 1473 1342 769 406 335 42 --25644 5533 --
NM_001100108chr1158019 7910 7808 7775 7419 7335 6846 5914 2878 1939 1914 1348 971 262 229 --21658 1557 13038
NM_001106chr3159545 8680 8604 8171 7710 7611 7378 7158 6862 6292 3758 3614 3508 1185 237 58777 8043 3063 947 454 12627 13882
NM_001113490chrX33101 1203 258 21294 355 1168 1864
NM_001117chr1832517 381 137 ----11635
NM_001128chr16104019 3513 3453 2875 1329 1260 1124 801 676 512 --12519 11576
NM_001160chr1232649 2233 147 ----32083 249 179
NM_001167chrX86756 6643 6600 5268 5237 2374 1591 597 ----1267
NM_001173chr1464510 4403 3166 1259 311 35 1847 ----
NM_001204chr2147644 7472 7301 6520 6402 5794 3000 2677 2395 1737 1386 1279 1049 481 1703 15327 36067 1920 466
NM_001206chr921965 821 1614 12560 1785
NM_001241chr252316 2274 2207 767 360 --2430 96 --
NM_001241chr252316 2274 2207 767 360 --2430 96 --
NM_001259chr795717 5544 5399 5223 4069 2027 1910 130 40 11698 --12322
NM_001304chr1733753 554 67 --12647 11000
NM_001343chr53680 377 311 ----11260
NM_001356chrX22294 1017 --11805 21665 697
NM_001386chr872442 2200 1942 804 542 505 44 --11717 --
NM_001412chrX63773 3437 3017 2375 2294 1485 --1664 --
NM_001417chr1241564 1546 449 49 ----11842
NM_001420chr1953076 2606 1080 1029 905 31244 849 827 21043 158 1954
NM_001429chr22--2190 118 --1355
NM_001453chr621435 1183 ----1675
NM_001483chr731020 976 693 11075 1685 --
NM_001491chr63802 724 560 1512 2975 160 11723
NM_001634chr621631 1346 31322 472 38 --11724
NM_001650chr1843441 3159 485 389 13153 13738 13970
NM_001656chr54694 548 232 198 ----11710
NM_001695chr884054 3212 2797 1714 1189 800 468 409 33417 3354 702 2751 492 --
NM_001709chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_001730chr131486 1156 --1645
NM_001730chr131486 1156 --1645
NM_001759chr1255323 3712 2117 2002 1270 34070 3806 2102 21315 1029 1663
NM_001858chr685046 3478 3438 3164 1527 1369 1313 712 13916 24730 4046 14535
NM_001918chr1118882 8199 8010 7677 7407 6566 6105 3473 2956 1848 175 ----17327
NM_001931chr1121272 844 ----1837
NM_001969chr1442400 1202 389 196 ----31291 1005 252
NM_001987chr1242867 478 164 131 --24090 3074 23662 1232
NM_002015chr1352793 2776 2491 777 538 --11070 12760
NM_002025chrX58600 7759 3340 2828 575 28138 443 26400 2027 --
NM_002033chr111790 --14024 34038 1338 655
NM_002092chr4125082 5048 5033 4982 4741 4488 3351 3305 3232 1556 1403 1064 --25098 1487 --
NM_002126chr1784165 3964 3846 2775 2607 1265 847 39 1693 23994 2568 --
NM_002214chr7155409 5352 4830 4138 3696 1827 1367 835 809 776 532 497 475 404 293 ----15450
NM_002223chr1263889 3462 2719 2463 85 58 22973 684 11031 --
NM_002247chr1052265 2151 818 610 310 --1683 1189
NM_002268chr371648 1426 1301 1201 690 470 330 --11355 21633 608
NM_002270chr555531 4371 1956 1772 1633 21065 127 23792 779 --
NM_002285chr253301 2585 2574 558 130 1222 3695 113 63 13569
NM_002310chr596168 5933 5652 5527 5382 5376 4286 2167 857 --36402 4946 4890 --
NM_002387chr555180 4857 3873 660 130 --23973 990 --
NM_002481chr1137372 7159 5905 5784 5297 4862 3141 2895 2612 2604 2101 757 112 22672 1750 1961 15119
NM_002545chr1185099 4817 4458 4290 3441 1627 542 25 --35162 4219 2004 --
NM_002547chrX54232 4197 2928 1506 1384 13661 2530 490 1797
NM_002600chr141880 1780 736 44 --31760 447 27 --
NM_002613chr16125219 4957 4643 4635 4605 4349 3538 3494 3319 2075 319 39 1111 ----
NM_002655chr875315 4743 3548 3431 1811 1474 422 --11705 14824
NM_002715chr511090 --1412 1327
NM_002731chr172764 2391 2271 2256 1974 961 873 --12820 --
NM_002737chr1766690 5559 5415 739 454 187 22588 2221 11860 --
NM_002745chr22104268 3547 3410 3303 2896 2787 1717 1613 1005 588 14364 --11743
NM_002748chr1541127 394 284 269 --11201 --
NM_002837chr1254510 4194 3932 2930 396 --1851 11508
NM_002844chr631213 1128 909 --1286 11016
NM_002892chr143684 378 43 --1415 1631
NM_002912chr63968 319 173 ----1837
NM_002959chr184135 3761 3651 3340 2797 1568 1361 531 --23510 186 --
NM_003010chr17--1384 1665 2411 244
NM_003016chr1721978 809 --1518 11817
NM_003022chrX1416 --1169 1151
NM_003028chr9103882 3254 2967 2686 1438 1372 1304 944 658 293 13749 13366 21035 853
NM_003034chr1268146 5959 3121 2966 1368 1023 22128 1075 27335 5022 --
NM_003042chr362220 2037 1945 666 478 424 11906 --11494
NM_003045chr1364656 4608 3549 1401 833 266 --34696 1656 1488 --
NM_003046chr8114895 4761 4008 3952 3439 2167 2150 931 285 218 144 --11699 --
NM_003199chr1875282 5054 4988 4078 4050 457 295 1940 --11214
NM_003262chr393375 1471 1258 1220 931 925 868 658 28 --13335 178
NM_003320chr1184471 3960 3036 2978 1085 849 785 307 34320 4248 3206 --13130
NM_003352chr231054 724 667 ----1658
NM_003369chr1142552 1068 1040 99 ----1357
NM_003392chr343714 3112 1359 314 --21628 806 1842
NM_003400chr21851 1590 --1303
NM_003442chr111141 ----1893
NM_003468chr263396 1213 963 732 442 435 13438 11506 11523
NM_003483chr1262693 2597 1951 1803 510 437 1255 11102 --
NM_003489chr2183460 3079 2929 1257 1124 971 853 806 ------
NM_003503chr131180 158 53 11138 1504 1892
NM_003506chr8----11002 11304
NM_003566chr1253052 2211 1397 829 281 --23234 95 --
NM_003574chr1895199 4627 4601 4330 4077 3908 2176 1107 195 14308 15215 12104
NM_003607chr123962 3585 13312 1935 23752 543
NM_003617chr194725 4124 4026 3901 3742 3092 3073 608 383 ----21667 640
NM_003672chr141912 776 491 132 11963 11683 --
NM_003913chr674347 3471 3193 2890 1286 1062 726 12870 ----
NM_003941chr762514 2271 1824 1775 1013 249 ----1462
NM_003943chr421100 72 21067 65 ----
NM_003966chr597837 7567 7120 6489 1711 1517 1485 1465 287 24938 1611 1917 37161 6902 2863
NM_003968chr32482 236 --1539 1432
NM_003994chr1253380 3240 1303 1262 752 --1759 --
NM_004006chrX32396 2348 979 1355 --1992
NM_004007chrX32396 2348 979 1355 --1992
NM_004009chrX32396 2348 979 1355 --1992
NM_004010chrX32396 2348 979 1355 --1992
NM_004011chrX32396 2348 979 1355 --1992
NM_004012chrX32396 2348 979 1355 --1992
NM_004013chrX32396 2348 979 1355 --1992
NM_004014chrX32396 2348 979 1355 --1992
NM_004015chrX32396 2348 979 1355 --1992
NM_004016chrX32310 2262 893 1269 --1906
NM_004017chrX32396 2348 979 1355 --1992
NM_004018chrX32310 2262 893 1269 --1906
NM_004020chrX32396 2348 979 1355 --1992
NM_004021chrX32310 2262 893 1269 --1906
NM_004022chrX32310 2262 893 1269 --1906
NM_004023chrX32310 2262 893 1269 --1906
NM_004028chr1843441 3159 485 389 13153 13738 13970
NM_004081chrY61865 1351 1258 1145 496 134 ----1462
NM_004094chr1452201 529 205 149 105 135 22702 918 --
NM_004124chr14113546 3338 3207 3133 2948 2913 2504 1144 978 470 151 --21249 765 --
NM_004171chr11129244 9184 8787 8487 7752 7375 5981 1807 1459 1264 384 29 47136 2909 1143 782 --28850 7611
NM_004232chr1833765 1023 442 ----12659
NM_004293chr963785 3319 2784 1371 1228 499 22563 2490 ----
NM_004338chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_004370chr611613 ----22114 42
NM_004384chr542303 1833 293 277 --21636 807 --
NM_004392chr135658 455 443 303 271 22423 1661 --21859 373
NM_004397chr1144116 2674 2614 1457 13055 22627 224 1339
NM_004412chr10115656 5323 4797 4654 4410 4291 3998 1947 1908 1250 299 15981 ----
NM_004432chr962275 1989 1559 583 209 203 --1727 --
NM_004438chr273110 3093 2535 2350 657 444 286 1893 11229 --
NM_004440chr61582 ----11640
NM_004464chr494310 4275 4191 3657 2961 1308 1177 924 452 3938 340 206 --190
NM_004491chr1974115 3074 1033 684 423 144 68 21749 1003 23229 1566 --
NM_004501chr183822 3681 3527 3088 2979 1538 1180 1153 --23808 2855 13561
NM_004586chrX105390 4550 3744 3484 2117 1432 1186 602 377 298 24624 797 24721 277 1270
NM_004598chr542884 2763 2740 1266 122 --13271
NM_004612chr994739 3747 3543 3501 2941 1448 1205 906 609 1554 1207 --
NM_004709chrX31509 1500 534 ----21538 118
NM_004726chrX75600 5476 5128 4766 4278 4227 114 15712 34959 4213 3548 --
NM_004734chr1373288 3161 2523 2129 2081 1221 275 11185 --13108
NM_004745chr856983 6424 6172 5863 1694 24915 137 31981 518 102 14450
NM_004748chr1574031 3822 717 637 346 180 148 11206 --11457
NM_004755chr1451136 771 376 190 171 1197 ----
NM_004798chr2083559 2607 1364 1311 1195 486 386 158 --1842 --
NM_004815chr144683 4217 3445 240 --34695 1966 1529 14613
NM_004834chr242962 2674 526 280 --1377 12279
NM_004842chr631338 1182 335 11465 11357 --
NM_004857chr1463787 3219 3158 1441 1342 458 --1308 14534
NM_004887chr521027 903 ----2817 389
NM_004904chr796479 5875 5800 5072 4603 4299 4103 4032 700 --1916 16459
NM_004976chr1194533 3804 3128 1859 1646 1538 1434 1207 1114 24939 1951 14671 11137
NM_004992chrX158117 7665 7303 6867 6741 6601 6219 6089 5144 3350 2682 1879 1547 894 388 38228 2927 841 26946 3312 --
NM_004992chrX158117 7665 7303 6867 6741 6601 6219 6089 5144 3350 2682 1879 1547 894 388 38228 2927 841 26946 3312 --
NM_004999chr653648 3450 3418 1690 115 13412 24031 2736 --
NM_005056chr1295538 5463 4516 3927 3896 1467 1289 1184 842 ------
NM_005065chr1465155 4241 3875 1393 788 58 24680 961 24488 1567 --
NM_005086chr1251815 1198 251 245 124 ------
NM_005093chr2094435 4415 3675 3360 943 806 660 436 142 14051 ----
NM_005116chr2084541 4184 3825 3633 3328 3291 1807 281 --32974 1044 614 14614
NM_005121chr1763589 3136 3102 2785 380 320 ------
NM_005156chr964832 4796 3670 2159 2087 1887 11914 --11993
NM_005164chr1221652 360 --1275 12505
NM_005188chr11137774 6392 5365 5288 5211 3046 2691 2005 1454 1057 1025 845 597 12487 11186 --
NM_005235chr2107801 7289 7208 6750 2746 2589 2124 2002 1922 1643 27306 2819 36824 5674 166 --
NM_005261chr8----2223 81 1948
NM_005359chr1876228 5443 4740 1475 947 938 333 ----21704 448
NM_005397chr793910 3630 3073 2803 2594 2469 864 812 164 23821 1467 --23568 3020
NM_005400chr222279 2084 1391 --2908 761
NM_005433chr1892825 2791 2591 1867 1820 1708 990 980 539 ------
NM_005436chr1043082 1170 957 906 --12538 11113
NM_005465chr141541 699 584 63 --1708 11423
NM_005504chr1274238 4181 2586 2426 2228 1500 567 34213 2348 1139 1752 11696
NM_005596chr975679 2454 2028 1255 981 188 32 ----2766 73
NM_005637chr1891984 1969 1956 1479 510 474 446 315 233 11490 168 --
NM_005638chrX41675 1605 1311 565 ----11366
NM_005665chr184592 3920 3709 3537 1590 1353 394 265 11099 24348 1079 --
NM_005668chr583676 3423 3345 3317 1855 1200 432 118 2368 232 ----
NM_005759chr2114737 4410 3903 3066 1675 1600 1565 1195 682 335 174 14222 ----
NM_005840chrX85944 5292 4905 2270 1493 1129 1049 451 --27117 283 15571
NM_005871chr105826 820 813 387 223 --1962 --
NM_005901chr18158685 8217 8165 7750 7064 6426 6028 5343 3380 3224 2699 2682 2383 1807 170 27041 6871 28480 8224 --
NM_005902chr1574536 4415 3293 3001 1793 268 185 53101 2842 1773 1451 611 1488 --
NM_005903chr574199 3926 3886 3625 1719 802 271 14416 21811 529 --
NM_005909chr573981 3771 3742 3091 1497 1048 107 1360 22628 256 --
NM_005935chr485089 4741 4301 1970 1860 1042 573 90 --24178 176 --
NM_005941chr853197 3191 3112 2968 1445 1612 --13864
NM_006007chr964327 3591 3004 1743 853 814 14377 14184 --
NM_006037chr2114283 3637 3517 3172 1566 1017 603 254 218 120 110 ------
NM_006047chr2053272 1229 608 484 422 1218 13541 --
NM_006094chr81433 --22267 891 11786
NM_006095chr464063 3890 1232 665 479 134 21754 760 13479 --
NM_006106chr1133032 2492 112 22871 1048 --12957
NM_006203chr595541 4858 4675 4378 1627 1579 521 204 120 13938 ----
NM_006206chr432671 907 847 ----11031
NM_006252chr1117328 6640 5870 5806 5747 5476 2329 2168 1690 717 669 --26964 1148 --
NM_006256chr142802 2791 449 269 --42510 965 243 206 --
NM_006275chr2042365 2243 508 36 11929 22406 396 --
NM_006282chr2074070 3844 3740 2915 1038 499 484 14397 11823 11080
NM_006300chr1942297 2271 773 201 --22350 574 1522
NM_006306chrX95493 5222 4897 4327 3998 1791 578 232 188 22220 611 ----
NM_006364chr141442 --1422 11178
NM_006366chr611264 11164 2908 239 1294
NM_006371chr394944 4833 4527 4196 1801 1607 1533 1338 1310 14269 --14084
NM_006386chr2232136 849 53 ----22055 859
NM_006420chr2072572 2433 2345 2273 1286 900 735 32722 1321 810 --23111 362
NM_006457chr433901 2948 2920 --23503 3336 12838
NM_006464chr274676 4237 3877 3182 2832 1195 34 13221 --1580
NM_006467chr592395 2191 645 585 413 315 261 114 54 11659 147 --
NM_006544chr1485945 5918 5535 5423 4728 4708 934 658 --45802 5591 1969 953 15934
NM_006546chr1796600 6187 5680 4817 4590 1790 1478 1288 100 --1935 --
NM_006561chr1045803 5608 4085 1972 36036 5759 433 15769 23848 2040
NM_006575chr1421237 38 ----1390
NM_006595chr1161841 1654 1560 698 677 58 --11781 --
NM_006599chr1648238 8123 6134 1050 1151 15299 38026 1896 1415
NM_006614chr322990 553 13182 21387 965 22931 891
NM_006620chr644675 3864 3573 645 ----33540 1257 1183
NM_006624chr1021672 707 ----1331
NM_006628chr1574521 3910 3101 2850 1484 889 647 14129 --12866
NM_006654chr1264737 3617 3399 1508 182 122 12914 ----
NM_006699chr12680 347 --32714 2366 1879 --
NM_006717chr96894 761 722 667 627 148 11008 12972 1169
NM_006729chrX75242 5073 4940 4781 3672 3587 2053 13794 --1194
NM_006750chr16116936 5102 2833 2547 2287 1682 1229 1173 1011 900 467 11294 15578 --
NM_006773chr261490 1255 1089 1025 652 27 --1143 --
NM_006775chr662442 2348 2256 1911 917 241 11221 --12969
NM_006827chr1443211 2102 957 49 --11181 11208
NM_006852chr1762670 2661 2646 1933 786 46 32262 619 76 21764 857 --
NM_006885chr1654205 3943 3914 3738 3019 --13210 13034
NM_006895chr241443 702 326 42 11351 11522 1390
NM_006918chr11125872 5837 5787 5559 5515 5139 1936 1847 1663 1237 1227 498 11757 24919 188 1621
NM_006924chr1764020 3875 3292 3243 3099 970 21536 418 11254 --
NM_007005chr93583 226 174 1594 --11106
NM_007007chr1274061 3709 1936 1851 1156 141 125 13159 11376 --
NM_007011chr15106851 6542 4562 2029 1483 1459 1081 956 918 324 12571 ----
NM_007030chr593593 3487 3422 3241 1536 1107 1090 1028 499 63904 3729 3694 3659 3416 1126 34655 4458 1461 1602
NM_007038chr2144889 4018 1396 67 35377 4446 4404 1228 13801
NM_007050chr20157959 7167 7092 6680 6495 6428 5984 5847 5455 3172 2616 2549 1580 1117 1060 27447 7366 27662 4903 16600
NM_007054chr583817 3402 2974 2952 2637 2583 123 54 ----23107 498
NM_007175chr873487 2701 2307 1264 1217 495 439 --11098 12382
NM_007203chr953714 3589 2762 1158 876 1767 1193 --
NM_007222chr831670 1319 210 --1663 11842
NM_007249chr13149219 8738 8726 8521 6785 6704 5998 5802 2942 2590 1926 1834 1016 776 58194 6043 2285 1554 460 23471 952 --
NM_007276chr741113 935 235 187 --1766 --
NM_012081chr573576 2921 2893 2508 1489 594 29 11289 12994 --
NM_012120chr672711 2577 2261 1972 655 268 113 ----11198
NM_012156chr2023260 605 --1260 22614 2605
NM_012164chr987303 6378 5624 4936 2530 1780 1004 981 11101 37269 6498 6101 22701 1741
NM_012193chr1164277 3389 2181 903 622 102 13757 --13880
NM_012214chr266086 5593 4556 3963 2022 671 --189 24474 1592
NM_012234chr383254 3178 1391 1311 1213 1166 573 99 --13618 1563
NM_012249chr213526 --1662 22737 567
NM_012262chr1125249 5114 5052 4945 4830 4539 4153 3582 1844 1775 1607 1190 34856 4060 1969 ----
NM_012281chr732471 2443 157 --1397 2319 241
NM_012288chr6105514 5492 5123 4432 4398 2244 1732 1612 760 280 ----11154
NM_012290chr291701 1310 1142 559 312 267 225 195 188 11191 ----
NM_012309chr1184930 4262 4096 3144 1104 972 470 93 --34399 3471 878 11649
NM_012333chr13216 82 52 ----1359
NM_012382chr5134544 4509 4452 4237 2780 1653 1556 1036 467 317 310 259 95 --1566 1273
NM_012388chr1542481 741 493 334 1685 1614 --
NM_012425chr1022180 290 ----22732 2634
NM_012465chr1063224 3068 2914 836 714 554 --22184 967 2705 563
NM_013229chr1232649 2233 147 ----32083 249 179
NM_013230chrY31388 694 177 --31684 1167 309 11797
NM_013231chr1433663 3490 858 34023 1322 52 1126 --
NM_013255chr7108787 7971 7156 6219 6201 5912 5794 2293 1360 837 22952 1774 18282 --
NM_013261chr432807 990 40 --23061 2578 1192
NM_013269chr1263498 3363 849 534 528 70 24005 3267 --13538
NM_013281chr2021409 1126 ----1217
NM_013374chr353117 2270 992 917 597 11076 --11257
NM_013381chr1252163 1782 1570 886 415 --1563 1918
NM_013396chr2121481 1072 ----21216 23
NM_013943chr183271 3217 3183 2768 2307 888 105 47 12091 12975 --
NM_013989chr1475149 4260 3837 3686 1739 347 131 1856 ----
NM_014089chr1342106 1992 1464 444 --31939 1643 165 1335
NM_014112chr845502 5209 4373 1541 1965 25330 1264 --
NM_014141chr734856 3626 1603 31747 1678 1196 23415 1862 21056 92
NM_014154chr33557 414 39 1123 11251 --
NM_014155chr1177230 2845 1968 1910 1770 1205 62 16465 27281 4670 --
NM_014263chr1041418 1385 1242 404 21451 46 11392 --
NM_014283chr121156 1108 --31561 1225 581 --
NM_014309chr2275399 5106 4757 1995 919 167 137 11851 23755 1305 --
NM_014319chr1231322 253 123 ----1113
NM_014363chr1331164 836 386 --2154 148 --
NM_014423chr595386 4828 4176 3877 3819 3658 1036 830 385 14008 25676 4128 --
NM_014445chr352130 1943 882 314 215 ----12247
NM_014614chr231332 348 211 ----11375
NM_014615chr1643611 3485 1168 65 32565 2407 565 1291 --
NM_014616chr322818 950 --2492 201 11017
NM_014647chr1632055 1665 1511 --12231 1162
NM_014667chr372135 2105 2007 1858 1772 224 57 --1755 --
NM_014702chr623095 766 12209 --11202
NM_014707chr751962 1951 1741 804 230 1572 1450 1561
NM_014721chr697055 5630 5008 4555 1600 1473 1143 559 289 25262 1109 ----
NM_014733chr552026 1635 1483 488 408 1722 ----
NM_014739chr653993 3559 1447 676 544 --2952 829 1457
NM_014746chr233072 1734 744 44404 3496 1235 23 1665 13698
NM_014797chr673226 2552 2435 2406 2192 1020 207 22357 861 22895 68 --
NM_014803chr103899 640 114 1892 21930 1001 1762
NM_014810chr183578 3184 3175 3071 997 558 422 23 --1615 --
NM_014812chr131732 1265 660 11653 --21925 484
NM_014819chr562181 2000 990 808 576 228 ------
NM_014826chr123962 3585 13312 1935 23752 543
NM_014850chr374326 4312 1902 1773 1352 1283 993 --11675 1461
NM_014873chr193643 3558 3528 2990 1958 1713 983 408 211 --24831 876 14447
NM_014877chr1776494 5687 5526 5440 5202 1055 708 16696 12637 --
NM_014898chr1952394 950 578 76 41 --22229 2207 1154
NM_014904chr1061581 547 476 413 234 33 --12854 12813
NM_014918chr1531563 246 151 --2315 198 1182
NM_014934chr1383931 3723 3629 3522 3200 3151 2556 800 --33787 2547 1581 1585
NM_014935chr153222 3205 1489 354 278 3954 804 389 1437 13303
NM_014953chr1394304 4067 2987 1743 1281 224 192 145 64 13229 --13284
NM_014982chr14165319 5170 4960 4280 4175 4011 3903 3897 3606 2155 1454 1419 764 603 501 397 --1841 11740
NM_014991chr452209 1203 856 197 149 21264 976 12279 --
NM_014999chr1231404 1306 1131 11662 21523 1042 11441
NM_015000chr1273113 2426 1950 1240 1105 498 479 ----12759
NM_015020chr1673278 3028 2921 1510 1461 1364 878 1801 ----
NM_015025chr24997 838 561 437 ----2378 187
NM_015026chr1284765 4455 4230 4190 4169 3609 3203 194 ----1747
NM_015049chr243229 2897 2084 825 1847 --2288 275
NM_015051chr972925 2563 2515 2459 2336 597 106 1915 ----
NM_015064chr1273365 2823 1180 1162 980 956 256 11236 21328 101 --
NM_015071chr574775 4703 4365 4306 2540 2197 283 3943 636 366 11164 --
NM_015110chr921765 71 ----22404 2260
NM_015115chr473227 2515 2479 1075 698 682 443 12626 --1593
NM_015192chr2082197 2157 953 878 828 709 433 419 1970 ----
NM_015199chr342146 1857 1045 286 --12099 12686
NM_015205chr13114518 4282 4203 4073 4054 3340 3270 1817 1055 963 29 ----33799 3637 1748
NM_015206chr1553634 3229 2671 282 252 --23480 1107 13021
NM_015208chr1863772 3030 2519 1027 873 65 ----13010
NM_015247chr1665298 5270 5251 3389 2013 1876 --11841 --
NM_015267chr1252189 2079 1514 174 114 11908 12039 --
NM_015291chr193486 3378 1358 879 708 669 463 91 57 12825 11048 --
NM_015310chr8148257 7766 7489 7319 7189 6798 6729 6408 5098 3132 2723 2483 390 77 --47098 6807 6790 477 --
NM_015317chr232831 2438 1892 --11872 11949
NM_015323chr621084 632 21285 696 21425 1176 --
NM_015336chr1231005 175 94 22023 182 12433 --
NM_015346chr1451473 1159 649 325 25 --11810 11657
NM_015347chr1222682 31 1289 2789 470 1444
NM_015365chrX74209 4002 3825 1625 1033 831 653 --23598 2759 --
NM_015396chr341068 590 322 167 ----1338
NM_015455chr593605 2954 1618 1203 1113 1097 781 674 312 --11496 159
NM_015458chr865335 4296 2048 1093 767 156 11361 13560 --
NM_015553chr664669 1920 1684 1508 1004 331 1162 --13598
NM_015576chr362802 1945 752 438 68 58 --12021 --
NM_015578chr192744 209 21956 824 157 11625
NM_015640chr195364 5154 4661 1687 1487 640 513 421 327 --44556 3703 3260 271 --
NM_015879chr18148472 8126 7905 7251 7070 6978 6631 6401 5875 3147 2221 1410 1195 60 47640 6832 2858 982 12028 17149
NM_015886chr842260 1847 1098 43 11545 --13802
NM_015888chr173112 2845 2302 1257 688 375 215 1207 ----
NM_015995chr15115084 4782 4716 3953 3519 1852 1069 718 620 352 285 13438 24385 261 23714 1577
NM_016075chr1332867 2768 1180 ----23222 3095
NM_016083chr6103988 3448 2666 1437 1080 949 709 526 322 231 --11424 --
NM_016124chr131508 1302 1088 1205 11051 11395
NM_016133chr231484 1092 379 ----11056
NM_016206chr348452 8009 2856 93 32166 2037 371 11695 --
NM_016227chr121156 1108 --31561 1225 581 --
NM_016231chr1741344 1289 1069 145 ----11103
NM_016248chr1363345 2933 1206 249 90 83 --23641 1489 --
NM_016255chr663092 2598 2479 2465 2300 246 1472 1639 --
NM_016257chr153107 2848 2835 887 93 --1524 22720 2654
NM_016260chr285335 5194 4906 4690 4675 2380 1834 1324 26362 494 11715 25547 2118
NM_016271chr1831683 728 383 --11491 11629
NM_016275chr362320 2161 2009 1028 964 405 ------
NM_016356chr672714 2461 2304 704 438 111 87 ------
NM_016376chr1784030 3973 3151 2771 2757 1665 1369 306 ------
NM_016377chr631338 1182 335 11465 11357 --
NM_016422chr1142528 2357 2064 436 12225 --12568
NM_016507chr1772711 2210 1053 1044 605 539 219 --1588 1616
NM_016531chr433860 1550 296 11686 32662 1477 220 13694
NM_016559chr321362 148 --21224 269 1443
NM_016577chr394142 4020 3933 3678 2951 2751 1801 1183 476 14420 23224 1768 1558
NM_016587chr741113 935 235 187 --1766 --
NM_016607chrX51597 1236 178 110 103 1495 ----
NM_016613chr462338 2183 1683 1089 1022 489 --2256 114 --
NM_016617chr1341599 490 474 327 --22059 1911 --
NM_016953chr2126126 5452 2446 1386 1376 1269 1196 1135 1111 339 333 301 21007 208 1240 1607
NM_017420chr1463785 3710 3031 2647 1281 769 167 --21465 782
NM_017610chr1521913 673 1566 22034 788 --
NM_017633chr663529 3292 3162 2475 1362 580 13077 --22842 2486
NM_017637chr999233 8308 8294 7344 6390 5891 3080 2491 1300 38887 6933 6068 15973 11283
NM_017644chr364975 4291 3395 3258 2080 1127 --35106 4336 3330 1964
NM_017650chr7105743 4798 1667 1457 942 887 744 524 428 143 ------
NM_017658chr1484128 3278 1842 1780 1275 1130 822 426 14079 54517 2915 1719 559 54 --
NM_017666chrX22188 480 1679 --22175 502
NM_017694chr241949 1382 1304 650 2101 56 11850 11345
NM_017813chr865842 5594 4616 3574 1669 523 --15246 --
NM_017824chr1041037 966 833 536 --11999 11743
NM_017845chr43850 581 532 1623 2775 65 --
NM_017847chr171641 1568 717 682 498 58 39 ------
NM_017919chr965827 2238 1734 1195 960 935 2471 87 45127 1780 1764 66 11424
NM_017944chr1153133 2299 1098 614 601 12956 --11216
NM_018036chr14104462 4387 4380 4315 3731 3493 3331 1100 1033 987 --12711 --
NM_018046chr561844 1782 1304 769 661 535 ----1671
NM_018084chr282949 2272 2199 2058 2035 281 205 159 12176 --12894
NM_018172chr1111376 11036 11415 6591 539 487 435 383 331
NM_018191chr1341879 1695 736 251 2152 132 --11366
NM_018243chr484033 3731 3432 2667 1529 515 388 305 13644 ----
NM_018263chr282637 2472 2297 973 937 891 470 178 1143 12567 --
NM_018351chr1254000 3667 1580 705 497 --24294 93 --
NM_018362chr1153735 3674 2523 1293 705 12720 22569 1543 1536
NM_018364chr174002 3976 3319 3091 2757 891 666 11043 1992 --
NM_018372chr15731 559 279 177 98 1145 ----
NM_018374chr755100 3528 3393 3372 97 24248 3193 ----
NM_018387chr92123 30 ----193
NM_018400chr1184428 4233 4066 3502 1565 1430 903 50 14498 2734 35 --
NM_018403chr383642 3593 1557 1360 662 451 81 75 13084 11296 1694
NM_018425chr1052293 2148 1759 1729 252 ----1854
NM_018429chr542094 835 820 297 12450 42722 2683 2251 124 --
NM_018440chr8108558 7502 7209 6809 3348 2818 2694 2087 947 220 38139 6928 895 15452 --
NM_018557chr241647 1586 306 300 11193 --1617
NM_018566chr1104950 4759 4753 3943 3745 1651 1644 988 784 486 ------
NM_018638chr1274191 4030 2033 1860 1350 1122 34 --14136 --
NM_018945chr663701 2298 1088 599 214 126 23251 453 ----
NM_018976chr1282544 2227 2206 1985 567 411 271 209 12681 ----
NM_019004chr732133 500 204 --1340 1129
NM_019022chr18112814 2434 2159 928 710 426 411 282 211 185 99 12385 ----
NM_019084chr1062410 2337 2175 1764 294 141 1844 ----
NM_019116chr1683743 3685 3499 3020 1174 745 287 273 12895 12718 1675
NM_019610chr121966 664 ----12140
NM_020119chr743979 3702 3327 931 ----22487 1320
NM_020122chr286047 4182 2357 2164 517 337 327 58 --11490 --
NM_020150chr1052062 1776 1482 885 476 ------
NM_020205chr142785 2671 2402 2182 31406 1313 71 12390 1470
NM_020337chr453142 3073 1077 1064 910 12303 ----
NM_020340chr642127 2026 1418 573 ----1911
NM_020341chr204543 348 215 78 --32021 815 605 --
NM_020390chr354043 4002 1377 871 293 13703 24098 23 --
NM_020420chrY61865 1351 1258 1145 496 134 ----1462
NM_020432chr742182 2129 2092 932 11682 ----
NM_020443chr134680 89 39 11133 44586 4433 1958 1378 15241
NM_020466chr663298 1981 1973 1492 1069 70 24356 3038 11841 21346 258
NM_020673chr2097703 7033 6643 6088 5759 4966 2791 1571 1065 22967 260 34791 2580 561 12613
NM_020718chr1644181 1425 935 413 14009 14126 14499
NM_020739chr1574031 3822 717 637 346 180 148 11206 --11457
NM_020766chrX51685 1339 957 759 724 21657 1404 2546 392 --
NM_020768chr532801 2400 1066 1117 --12557
NM_020772chr1758683 7177 2886 2074 261 28046 63 --25616 322
NM_020774chr18105811 5382 4536 4020 2184 1919 1779 1494 641 504 13900 ----
NM_020776chr1873047 3041 2813 2336 2261 772 139 12658 --12557
NM_020783chr1862430 2179 818 642 601 327 --1281 --
NM_020805chr1861886 1679 1441 1291 167 24 ----1790
NM_020810chr1482991 2436 2251 1311 802 688 526 250 1630 ----
NM_020841chr1223611 936 ----1578
NM_020859chr464007 3088 2700 1217 924 551 --2469 207 --
NM_020868chr211377 ----31787 631 157
NM_020917chr1983621 3116 3072 2563 1569 834 269 40 --1618 --
NM_020918chr1073585 3192 3076 3019 2965 1245 515 23204 948 --23685 340
NM_020921chr1463476 3370 2909 1478 784 253 --153 --
NM_021033chr1373410 3092 2450 2340 1087 791 136 ----11123
NM_021116chr788968 7961 1234 974 949 821 286 213 17789 28911 5657 15766
NM_021163chr7133627 3243 3227 3200 2771 2669 2480 1387 424 213 99 44 35 --11512 --
NM_021205chr132864 856 365 22148 953 1917 32466 1955 700
NM_021572chr65989 823 786 491 436 21019 968 11238 --
NM_021622chr10----22378 2253 11927
NM_021629chr343560 3515 3148 669 --64919 4776 4011 3950 1476 885 --
NM_021647chr494372 4274 4104 3920 3356 1747 1263 1139 542 --11321 --
NM_021813chr6135427 5011 4748 4694 4592 1987 1907 1862 1625 1177 1064 755 660 24524 103 ----
NM_021911chr5135526 4793 4768 4092 3952 3932 3683 3599 1825 1603 1582 662 541 32224 2122 1029 22036 603 21322 181
NM_021914chr14102459 1932 1881 1836 785 738 680 431 316 305 --21762 189 --
NM_021945chr6103384 3205 2681 2603 1410 1331 1041 713 387 74 --22969 2950 1983
NM_021954chr13103531 3498 3371 3293 3163 3051 3030 2991 1418 439 ----12429
NM_021956chr641438 1228 1118 1105 --1448 --
NM_021960chr152429 2075 2033 1868 644 --12671 --
NM_021961chr11106763 5604 5344 5146 1952 1647 1629 1001 708 297 12175 32075 1255 994 14842
NM_021964chr386196 5390 4909 2667 2240 1789 924 131 35969 5736 841 35938 5206 1195 14433
NM_021977chr641295 916 585 535 43431 3135 2425 207 43006 1328 768 475 --
NM_022048chr15106313 4699 4647 4073 2231 1526 1085 878 629 211 21869 618 24941 964 --
NM_022073chr1441648 662 559 458 21619 306 21302 1210 --
NM_022114chr164474 4005 2964 1889 1859 223 ----24649 3546
NM_022351chr833603 873 620 12397 13003 13563
NM_022456chr1267701 7005 6565 6197 2813 55 15614 11198 27056 192
NM_022461chr331234 188 35 ----21363 135
NM_022497chr353375 2753 2728 862 194 1400 33919 3696 835 --
NM_022719chr22103589 3057 2932 2451 1399 1044 946 798 401 249 ----13393
NM_022826chr231163 927 121 --1978 135
NM_022828chr561344 631 375 364 217 30 --1383 11734
NM_022918chr1142069 1993 846 783 11966 --2727 65
NM_023000chr143684 378 43 --1415 1631
NM_023001chr143684 378 43 --1415 1631
NM_023016chr252787 2040 769 648 559 --154 --
NM_024077chr92546 296 ----2713 253
NM_024345chr975883 5118 5072 2273 1204 435 381 15135 12119 2548 135
NM_024408chr141081 738 680 448 22997 1062 23750 3467 1243
NM_024423chr1864249 4185 4045 3628 3453 1126 --24076 2890 --
NM_024511chr483170 2571 1329 1172 882 193 170 105 ------
NM_024524chr342337 2118 1137 1104 ----12581
NM_024558chr143847 713 58 ----173
NM_024569chr142951 2824 2294 85 22196 95 --1799
NM_024653chr731514 333 273 ----21542 1152
NM_024744chr221633 66 ----1287
NM_024770chr2116545 6289 5904 5891 5668 4749 4369 2362 1302 1009 734 46363 6314 6276 767 14574 16596
NM_024831chr81173 ----1568
NM_024884chr1453444 3193 3161 3023 1531 23598 3172 --13180
NM_024930chr522762 2329 12001 1749 1364
NM_024947chr3169390 9032 7275 6775 6757 6015 3435 3226 2789 2646 2441 1490 1419 1002 929 551 59257 3851 3695 2106 1580 36846 6820 1261 46917 6767 3764 3290
NM_024989chr2158116 8089 7656 6722 6508 6429 3097 1690 1652 1493 1424 1387 1052 535 84 21873 64 38227 5114 704 --
NM_025040chr19102348 2200 1758 1611 1581 679 622 599 285 255 1105 --32102 339 188
NM_025134chr1652497 2438 354 324 107 11846 --1318
NM_025138chr1321384 63 1330 21288 173 --
NM_025160chr153060 1607 906 801 98 --1215 11427
NM_025164chr1121360 467 1627 1850 22135 1557
NM_025208chr1152502 2352 1991 1969 1896 11856 1942 1120
NM_025235chr1041999 876 671 133 21740 903 --1383
NM_030621chr1464136 4003 3918 3639 1583 463 --32694 1668 589 --
NM_030627chr544157 1413 606 380 ----1645
NM_030648chr465444 4115 3548 2072 1860 1717 25041 4450 11162 --
NM_030650chr2124233 3821 3642 3601 3471 3446 3106 2778 2706 1379 1071 758 --34209 3078 144 --
NM_030674chr1245470 3629 2363 2041 11402 11918 35485 3592 1635
NM_030755chr1442648 1214 799 95 21251 150 33025 2847 913 --
NM_030786chr131738 1587 192 --1488 1329
NM_030806chr189298 9196 9142 8805 8457 7816 7426 1447 13034 38906 8553 2563 --
NM_030881chr2232136 849 53 ----22055 859
NM_030885chr341501 435 172 114 11599 --1236
NM_030918chr1105183 4929 3706 1007 773 460 426 366 115 68 ----25030 1889
NM_030945chr592688 2570 1933 1887 998 986 853 159 72 1776 ----
NM_031216chr1851989 1706 1466 450 352 11943 --1809
NM_031268chr16125219 4957 4643 4635 4605 4349 3538 3494 3319 2075 319 39 1111 ----
NM_031365chr252867 2487 1058 914 124 1593 ----
NM_031366chr252867 2487 1058 914 124 1593 ----
NM_031418chr1132805 1787 1100 1804 --12458
NM_031427chr1465839 4697 4466 2106 1936 397 15742 15857 --
NM_031435chr1233348 2821 1343 --12815 13160
NM_031468chr797032 5337 5269 3161 2789 1757 1654 1272 193 27041 2693 --46709 5978 1772 372
NM_031469chr653467 3204 1427 1348 777 11232 11224 21625 1124
NM_031844chr183822 3681 3527 3088 2979 1538 1180 1153 --23808 2855 13561
NM_032102chr1142684 1943 314 225 ----22410 798
NM_032116chr1343988 3856 1460 145 1302 13959 15673
NM_032121chrX32485 540 246 22581 556 22531 965 --
NM_032139chr19------2214 72
NM_032228chr1143195 405 293 26 32899 763 325 --1184
NM_032281chr1953076 2606 1080 1029 905 31244 849 827 21043 158 1954
NM_032321chr293137 2570 2471 2324 2311 2303 2281 225 47 ------
NM_032373chr1045426 4938 4628 292 41432 967 587 96 ----
NM_032435chr131836 690 44 1217 --154
NM_032439chr1031163 1110 379 ----11247
NM_032446chr5103029 2599 1539 972 591 574 563 354 319 122 22490 463 1444 --
NM_032457chr443560 3548 2715 824 23128 356 21431 1405 12785
NM_032499chr1561770 1764 1233 1147 314 195 11404 1692 --
NM_032509chr832438 988 194 --135 1115
NM_032558chr941426 1214 1134 1046 ----11384
NM_032826chr7135481 5447 4719 4409 3880 3332 1965 1818 1483 1473 1463 308 229 --11064 --
NM_032869chr871965 1870 1294 834 434 202 64 11689 ----
NM_033055chr111083 ----1756
NM_033135chr1152502 2352 1991 1969 1896 11856 1942 1120
NM_033143chr4104641 4606 4522 3988 3292 1639 1508 1255 783 104 31269 671 537 --1421
NM_033181chr6103988 3448 2666 1437 1080 949 709 526 322 231 --11424 --
NM_033211chr531377 593 203 1128 1457 1156
NM_033224chr787047 5499 5165 2654 2604 1365 1359 585 1624 --17901
NM_033225chr893119 2812 2664 2628 2527 2110 1052 456 49 --1450 --
NM_033285chr834361 3816 3098 ----24101 456
NM_033290chrX73703 3661 3058 2662 1483 1365 731 ----12952
NM_033389chr1774881 3668 1489 944 908 263 72 ------
NM_033430chr484073 3899 3567 3419 3217 2912 2780 1057 ------
NM_033437chr484073 3899 3567 3419 3217 2912 2780 1057 ------
NM_033505chr2115869 5238 5101 5003 4900 2187 1613 1315 348 220 120 14931 --15947
NM_052832chr831978 683 367 ----22766 1964
NM_052879chr1263853 3352 3123 1356 960 832 --33269 1585 1006 --
NM_052885chr1254788 3995 3141 275 134 21711 1546 1648 --
NM_052905chr221897 1622 ----294 26
NM_052932chr1152354 1671 1602 994 888 2648 29 21984 1541 --
NM_053016chr987640 7007 6202 5053 2635 2154 1930 1322 11315 27349 2793 11795
NM_057175chr462196 2093 1932 1850 1708 1648 ----1426
NM_080645chr611613 ----22114 42
NM_080669chr1783860 3093 1375 1125 1097 1006 870 798 --31597 1428 46 11245
NM_080676chr2042722 2012 881 529 13290 1310 12424
NM_080759chr135658 455 443 303 271 22423 1661 --21859 373
NM_080760chr135658 455 443 303 271 22423 1661 --21859 373
NM_130438chr2193213 2788 2584 2524 2280 2136 435 366 147 ----12058
NM_130830chr352672 2608 1226 1202 964 ----23491 1004
NM_133170chr20157959 7167 7092 6680 6495 6428 5984 5847 5455 3172 2616 2549 1580 1117 1060 27447 7366 27662 4903 16600
NM_133265chrX33101 1203 258 21294 355 1168 1864
NM_133367chr643473 1186 700 184 23017 3003 12180 12209
NM_133493chr664525 3919 1332 1023 791 78 --23508 1093 --
NM_133646chr275384 5309 4178 2059 829 486 381 1805 1315 --
NM_138444chr1354175 3942 3652 3403 1596 ----14466
NM_138459chr673369 2771 2544 2468 1246 558 269 --12842 --
NM_138468chr286245 5924 5218 4277 2244 1011 163 113 --34738 945 640 --
NM_138633chr631338 1182 335 11465 11357 --
NM_138638chr14102459 1932 1881 1836 785 738 680 431 316 305 --21762 189 --
NM_138713chr1648238 8123 6134 1050 1151 15299 38026 1896 1415
NM_138714chr1648238 8123 6134 1050 1151 15299 38026 1896 1415
NM_138766chr51599 ----1219
NM_138821chr51599 ----1219
NM_138822chr51599 ----1219
NM_139312chr1041418 1385 1242 404 21451 46 11392 --
NM_144571chr476774 4711 2236 2098 1285 1279 940 --26806 6342 16630
NM_144578chr1465448 4972 3804 3387 1660 268 1962 15395 12143
NM_144599chr1574675 3807 3593 1872 1812 903 278 34762 1802 1432 43463 983 868 605 --
NM_144710chr271465 1273 1207 1129 992 203 117 --21122 260 --
NM_144721chr441998 1818 1043 652 22545 2091 2741 332 --
NM_144973chr1224428 283 1676 --25233 3471
NM_144974chr133903 60 54 127 1289 --
NM_145055chr1843171 3036 2945 1255 ----1831
NM_145165chr1432934 2902 2024 22913 274 --11110
NM_145176chr6102945 2707 2177 685 479 398 300 224 40 22 1468 12262 --
NM_145259chr285881 2696 1902 1410 1291 951 786 348 46466 6189 1945 338 2969 750 25443 1279
NM_145268chr73333 210 49 ----1742
NM_145307chr1084302 3820 3437 3351 3327 3015 1452 290 --11354 --
NM_145649chr63802 724 560 1512 2975 160 11723
NM_145655chr63802 724 560 1512 2975 160 11723
NM_145686chr242962 2674 526 280 --1377 12279
NM_145687chr242962 2674 526 280 --1377 12279
NM_145735chr1331941 1756 881 --2442 332 1969
NM_147150chr953714 3589 2762 1158 876 1767 1193 --
NM_148957chr1382691 1764 1751 699 509 321 198 78 1978 1678 --
NM_152261chr1242525 857 634 265 22560 170 ----
NM_152277chr532025 696 270 12014 --1364
NM_152280chr173316 3304 2839 2650 2365 2190 141 23291 1043 --11156
NM_152330chr1442371 2304 2265 1718 11660 1518 --
NM_152388chr283936 3777 3205 2825 2810 1501 702 424 13314 22852 1146 11022
NM_152406chr53551 514 335 ----1663
NM_152529chr273911 3645 2880 1749 1347 606 244 12802 --12686
NM_152563chr1111376 11036 11415 6591 539 487 435 383 331
NM_152588chr1241573 630 526 246 --11324 11633
NM_152622chr583458 3086 3030 2928 2728 2706 1077 604 --12124 --
NM_152624chr597376 7269 7080 5129 2960 2797 2424 1809 559 14574 15443 25677 428
NM_152699chr343609 3141 1362 1228 ----1353
NM_152724chr1022180 290 ----22732 2634
NM_152754chr782547 2527 1522 1286 1209 403 150 131 ------
NM_152756chr564119 3594 2904 847 724 144 --1279 --
NM_152758chr832462 2220 591 11086 22690 118 --
NM_152774chr772422 1085 994 751 630 573 109 --124 --
NM_152793chr7104870 4564 4521 3708 3639 3508 1958 1760 1707 1060 24127 3532 ----
NM_152838chr2053272 1229 608 484 422 1218 13541 --
NM_152902chr151955 1813 777 646 290 --143 1299
NM_152924chr15106851 6542 4562 2029 1483 1459 1081 956 918 324 12571 ----
NM_153013chr522242 544 ----1388
NM_153035chr192889 2563 2489 1302 1271 990 541 312 300 1222 22869 652 --
NM_153188chr555531 4371 1956 1772 1633 21065 127 23792 779 --
NM_153207chr1283976 3704 3502 1080 794 606 254 40 --11329 13459
NM_153371chr1351641 1580 1499 441 275 ----11485
NM_153456chr13166328 5762 5527 5482 5440 5220 4246 4107 1757 1576 1266 1167 1107 1073 122 40 15754 1728 --
NM_153619chr1553578 3115 1224 1062 200 ----12223
NM_153686chr462262 1798 926 849 371 55 --1840 --
NM_153712chr283800 3587 3568 3305 3196 731 259 144 --11440 13516
NM_153757chr41368 --1387 1202
NM_153810chr1094378 3833 3618 3611 3505 3461 1700 1631 1287 31674 73 42 44305 3340 1654 1067 13849
NM_170606chr731706 672 523 ----11861
NM_170665chr1264262 3258 3008 1688 845 481 11084 11456 21157 98
NM_170719chr1321384 63 1330 21288 173 --
NM_170731chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_170732chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_170733chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_170734chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_170735chr1161776 1766 947 735 715 164 1850 22217 1071 1957
NM_170768chr1161650 1637 1124 479 115 108 1369 --11221
NM_171998chrX31827 888 468 1548 1640 1376
NM_172070chr231764 1405 199 1805 11679 11994
NM_172071chr186965 6285 5885 5386 5007 2688 1593 994 169 ----
NM_172373chr133955 508 24 --144 --
NM_173083chr1--1297 --1274
NM_173214chr1648238 8123 6134 1050 1151 15299 38026 1896 1415
NM_173468chr476089 5642 4243 3910 1785 988 432 25626 587 ----
NM_173470chrX62851 2832 1862 1825 883 625 135 --1278
NM_173536chr4115105 4878 4843 4711 3295 1995 1848 1750 905 641 120 13840 11203 --
NM_173576chr1062195 1772 1498 1468 939 298 ----1660
NM_173595chr12104339 4064 3415 3347 1574 1494 1413 1201 200 95 --1485 14924
NM_173642chr1149201 6583 5996 5863 3618 2807 2647 2515 2472 2217 1350 1256 594 64 27465 1290 37161 6987 248 19074
NM_173667chr522426 352 --1572 1306
NM_173694chrX52214 890 510 395 274 --1632 11796
NM_173698chrX61590 719 630 528 254 213 1306 ----
NM_173808chr184332 3688 3582 3554 3548 3379 1123 360 ------
NM_173829chr5116123 5646 5273 4762 4702 4480 2429 2315 2240 1320 948 ------
NM_173851chr832951 2483 543 1329 1869 13807
NM_175056chr351909 1796 1454 725 223 ----11918
NM_175058chr1131001 424 121 1313 11349 11038
NM_175623chr1267701 7005 6565 6197 2813 55 15614 11198 27056 192
NM_175736chr1277559 7008 6518 5582 5166 4978 2817 17219 11459 11529
NM_175861chr1254867 4767 2071 1460 1053 --35589 2383 2313 --
NM_175921chr544301 1489 102 93 ----23022 435
NM_176081chr10115656 5323 4797 4654 4410 4291 3998 1947 1908 1250 299 15981 ----
NM_176083chr10115656 5323 4797 4654 4410 4291 3998 1947 1908 1250 299 15981 ----
NM_177398chr121952 1767 ----21726 175
NM_177399chr121952 1767 ----21726 175
NM_177438chr1464136 4003 3918 3639 1583 463 --32694 1668 589 --
NM_177947chrX51597 1236 178 110 103 1495 ----
NM_177948chrX51597 1236 178 110 103 1495 ----
NM_177972chr1184471 3960 3036 2978 1085 849 785 307 34320 4248 3206 --13130
NM_177990chr204543 348 215 78 --32021 815 605 --
NM_177996chr2023260 605 --1260 22614 2605
NM_178037chr1273365 2823 1180 1162 980 956 256 11236 21328 101 --
NM_178038chr1273365 2823 1180 1162 980 956 256 11236 21328 101 --
NM_178151chrX87242 6546 6377 5918 2838 2058 1738 1145 ------
NM_178152chrX87242 6546 6377 5918 2838 2058 1738 1145 ------
NM_178153chrX87242 6546 6377 5918 2838 2058 1738 1145 ------
NM_178505chr1093578 3511 2441 2418 2275 976 918 856 164 --23074 750 --
NM_178509chr1773940 3619 2781 1639 764 700 42 11157 43683 3055 3008 2573 33128 501 377
NM_178566chr941636 1338 1271 536 11688 ----
NM_178584chr271465 1273 1207 1129 992 203 117 --21122 260 --
NM_178585chr452209 1203 856 197 149 21264 976 12279 --
NM_178815chr1031776 955 747 1153 148 --
NM_180989chr1352427 959 541 514 104 11783 22493 712 --
NM_181351chr1153016 2699 2073 447 279 22094 1996 --11154
NM_181481chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_181482chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_181483chr18106936 6503 5692 5236 5006 4453 1505 1466 388 121 ----1933
NM_181489chr3156591 6010 5924 5761 5086 4637 4379 4257 2131 1820 1168 1110 935 830 330 --1690 --
NM_181521chr1666549 5492 2435 1990 1511 980 25012 1025 22711 1671 --
NM_181702chr8----2223 81 1948
NM_181836chr51162 12239 12250 12224
NM_181861chr1232649 2233 147 ----32083 249 179
NM_181868chr1232649 2233 147 ----32083 249 179
NM_181869chr1232734 2318 232 ----32168 334 264
NM_182485chr442891 2411 1445 845 --13565 12316
NM_182488chr13------2746 391
NM_182493chr1685141 4757 4509 4377 3870 2155 1035 873 31464 1417 1103 11003 --
NM_182503chr6105257 3558 1947 1786 1737 1663 702 658 388 45 1821 14459 1961
NM_182515chr1934801 1597 596 46211 6007 2597 1765 16020 --
NM_182643chr81433 --22267 891 11786
NM_182646chr442891 2411 1445 845 --13565 12316
NM_182734chr2092444 2404 1200 1125 1075 956 680 666 46 11217 ----
NM_182762chr7105708 5107 4551 4255 3880 2455 1854 1677 1293 391 22418 2311 24955 4449 --
NM_182763chr152418 2064 2022 1857 633 --12660 --
NM_182830chr1462114 1868 843 382 78 71 --1747 --
NM_182898chr796479 5875 5800 5072 4603 4299 4103 4032 700 --1916 16459
NM_182899chr796479 5875 5800 5072 4603 4299 4103 4032 700 --1916 16459
NM_182948chr172764 2391 2271 2256 1974 961 873 --12820 --
NM_182972chr142864 2175 830 302 12585 --21058 147
NM_183004chr1442400 1202 389 196 ----31291 1005 252
NM_183238chr1283833 3806 3137 2915 2802 2475 987 312 --1721 23588 2712
NM_194071chr7105405 5196 5145 5058 4747 4651 4582 4463 3587 945 --1479 24816 3551
NM_194247chr294520 4270 3828 3582 3120 1623 1542 1011 827 11335 ----
NM_194282chr453116 3080 2186 2177 58 12312 ----
NM_194291chr842549 1089 730 455 22895 2386 32666 2063 1031 --
NM_194314chr1105197 4560 4335 4099 3852 2116 1742 1526 691 175 25021 2232 1162 --
NM_194434chr1895199 4627 4601 4330 4077 3908 2176 1107 195 14308 15215 12104
NM_198128chr1831683 728 383 --11491 11629
NM_198181chr1512212 22873 2183 12501 --
NM_198195chr32482 236 --1539 1432
NM_198270chrX103092 2906 2474 2253 2180 1221 890 815 710 506 1549 22128 585 --
NM_198281chr433329 1365 672 1517 33444 3275 3068 --
NM_198391chr2021409 1126 ----1217
NM_198465chrX52467 2213 503 285 276 ----1754
NM_198503chr111668 1532 12160 1363
NM_198529chr173400 371 359 ------
NM_198581chr266091 5849 2308 1523 646 286 12592 12334 22670 2560
NM_198715chr1115400 5348 4737 4317 2026 1804 1717 807 686 613 243 14617 45809 4730 912 786 21046 334
NM_198794chr1421237 38 ----1390
NM_198859chr355177 3738 3523 3317 189 1627 35089 4584 4102 --
NM_198900chr1277559 7008 6518 5582 5166 4978 2817 17219 11459 11529
NM_198935chr2093135 3044 2941 2903 2581 2324 1211 736 354 --11137 1466
NM_198947chr111298 ----21020 899
NM_198968chr1383931 3723 3629 3522 3200 3151 2556 800 --33787 2547 1581 1585
NM_198992chr121113 --1169 1191
NM_199000chr792292 1987 1735 1505 1443 143 131 125 93 ------
NM_199072chr732149 935 324 11247 11171 22787 2331
NM_199188chr1263853 3352 3123 1356 960 832 --33269 1585 1006 --
NM_199190chr1263853 3352 3123 1356 960 832 --33269 1585 1006 --
NM_199320chr472939 2663 2333 1925 1160 742 366 --1258 --
NM_199320chr472939 2663 2333 1925 1160 742 366 --1258 --
NM_199454chr164474 4005 2964 1889 1859 223 ----24649 3546
NM_201263chr152044 1833 651 590 348 11889 22105 262 --
NM_203301chr1451746 1164 1085 631 586 ----11539
NM_203327chr2084541 4184 3825 3633 3328 3291 1807 281 --32974 1044 614 14614
NM_203406chr572439 2317 1065 842 758 135 78 ----12458
NM_203459chr192629 2488 2060 1820 1721 174 135 113 28 --12479 --
NM_203463chr2114667 3324 3042 1906 1254 1169 1078 1007 393 286 134 --24117 3567 --
NM_206853chr683829 3437 3143 2765 2739 1554 1203 444 --23380 658 --
NM_206854chr6145090 4698 4404 4026 4000 3657 3474 3462 3337 1705 927 742 354 249 126 44641 3403 1919 109 --
NM_206855chr6146055 5663 5369 4991 4965 4622 4439 4427 4302 1892 1707 1319 1214 873 1991 35606 4368 1074 --
NM_206909chr8148257 7766 7489 7319 7189 6798 6729 6408 5098 3132 2723 2483 390 77 --47098 6807 6790 477 --
NM_207406chr466342 6237 2139 2071 1388 1305 25507 5384 16163 11974
NM_207445chr1541764 1730 798 293 --1262 11781
NM_212558chr983941 3752 3584 2943 2719 646 409 205 1173 21124 959 --
NM_213651chr141787 1597 1109 296 --1536 1547
NM_213654chr33557 414 39 1123 11251 --