TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1245a
miRNA Sequence: AAGUGAUCUAAAGGCCUACAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000043chr102507 110 ------
NM_000052chrX73379 3266 3256 2822 1334 1276 1140 ------
NM_000081chr121662 1458 --11517 --
NM_000084chrX95658 5185 2107 1531 1450 1404 1140 390 321 --24920 2012 --
NM_000090chr2------1650
NM_000092chr294316 4140 4055 4015 3733 3250 378 326 313 23292 1086 ----
NM_000109chrX21755 798 ------
NM_000115chr1331827 428 393 21894 609 ----
NM_000125chr654155 3556 3351 3254 1374 11344 --13415
NM_000126chr15184 ------
NM_000129chr621100 280 ------
NM_000138chr1542591 841 798 620 --12188 --
NM_000151chr1721817 1652 11922 ----
NM_000153chr1431212 1095 367 11488 ----
NM_000165chr651678 1162 1128 691 680 21599 672 ----
NM_000167chrX21765 1425 21311 414 11664 --
NM_000176chr532468 511 196 --13265 --
NM_000208chr1964414 4104 3943 3628 3547 1802 ------
NM_000214chr204670 620 460 343 --11280 --
NM_000216chrX1456 --1492 --
NM_000217chr1235330 5063 3503 14437 34591 578 384 --
NM_000242chr1032541 2467 2035 1125 --1138
NM_000245chr762168 770 580 472 345 138 ------
NM_000248chr31945 ------
NM_000259chr1585724 4686 4662 4224 4081 2505 724 161 23867 548 11103 --
NM_000264chr913221 --2910 849 --
NM_000266chrX1875 ------
NM_000267chr1733232 1198 699 --13397 --
NM_000276chrX41736 1653 654 476 --1444 12190
NM_000280chr112853 835 ------
NM_000297chr42762 636 11661 --11813
NM_000304chr171874 2844 711 ----
NM_000318chr882511 2417 2048 1849 841 707 214 152 ------
NM_000321chr1321545 1397 1545 ----
NM_000332chr631988 1842 42 35340 2547 1108 157 16693
NM_000337chr5125658 5161 4447 4328 2446 2178 2054 1842 1585 1369 1335 1223 14834 11975 --
NM_000340chr31320 21202 382 1945 --
NM_000358chr5--1425 ----
NM_000378chr1141190 1114 815 304 ------
NM_000386chr17--1677 ----
NM_000390chrX33168 2653 1015 21133 848 11302 --
NM_000391chr1121175 628 --11091 --
NM_000393chr221929 1757 ------
NM_000401chr11--11118 ----
NM_000408chr243116 2803 758 428 --13285 --
NM_000430chr1773401 3193 3108 2649 1329 446 248 22955 867 ----
NM_000439chr532006 1850 197 ------
NM_000461chr322961 593 21549 260 ----
NM_000462chr1561535 1261 1150 560 351 332 --11472 --
NM_000492chr721527 1511 ------
NM_000523chr231164 1062 370 1467 ----
NM_000555chrX117226 6703 6471 5192 5049 4888 3094 3010 1108 814 49 27473 5454 27141 1376 --
NM_000618chr12146262 6005 5891 5868 5614 5562 5428 4745 4271 2553 2341 1714 1253 710 26521 2522 ----
NM_000618chr12146262 6005 5891 5868 5614 5562 5428 4745 4271 2553 2341 1714 1253 710 26521 2522 ----
NM_000633chr1884471 3734 1991 1497 1410 1228 395 224 --1435 --
NM_000663chr1642776 1198 1044 416 ------
NM_000686chrX1398 ------
NM_000719chr1276503 6221 2518 2091 1875 1717 992 --15744 --
NM_000721chr142600 2255 1968 264 ------
NM_000788chr421404 1335 ------
NM_000793chr1494644 3742 3579 3492 3240 1374 972 772 634 24511 354 ----
NM_000806chr511574 ------
NM_000807chr42725 539 ------
NM_000813chr575438 5034 4162 2142 2022 1145 446 1891 14428 --
NM_000814chr15113836 3619 3439 3378 2952 2689 1351 976 843 508 54 ------
NM_000826chr41812 ------
NM_000838chr662623 2552 2121 2075 423 225 --12544 --
NM_000857chr42483 188 1472 ----
NM_000859chr51666 11688 1118 --
NM_000860chr421481 335 11049 ----
NM_000868chrX12445 ------
NM_000872chr102355 200 ------
NM_000875chr1586212 6194 5604 5563 4679 4493 2488 1211 --36279 5985 5499 11825
NM_000901chr442558 1623 714 572 ------
NM_000902chr333097 257 213 --2572 96 --
NM_000912chr843078 2531 2297 2162 23162 1424 --176
NM_000933chr20--1614 11317 --
NM_000944chr4--21513 158 ----
NM_000950chrX41153 841 375 30 1170 ----
NM_000961chr2063575 3482 3349 3053 2709 854 --11307 --
NM_001001323chr1252880 2781 2327 541 282 ------
NM_001001342chr1021119 1002 ----1342
NM_001001419chr594802 4256 3770 1927 1529 1490 1356 977 743 --14513 --
NM_001001420chr594802 4256 3770 1927 1529 1490 1356 977 743 --14513 --
NM_001001433chr2092632 2305 2137 1972 1020 975 888 619 573 ------
NM_001001481chr863336 3009 2984 2804 2418 484 33490 3190 1193 3590 171 64 --
NM_001001484chr1022334 1706 1754 1112 --
NM_001001549chr73706 646 275 --2961 392 --
NM_001001550chr73706 646 275 --2961 392 --
NM_001001555chr73706 646 275 --2961 392 --
NM_001001664chr273861 2723 2586 1532 1188 1025 456 ------
NM_001001711chr113851 330 309 187 1205 --
NM_001001933chr12123 81 ------
NM_001001971chr1011019 --124 --
NM_001001974chr1052245 1868 1611 1457 697 1874 ----
NM_001002233chr831982 736 170 ------
NM_001002243chr2----1602 --
NM_001002257chr252933 2309 1005 397 370 1116 13260 13478
NM_001002296chr82521 93 1916 ----
NM_001002838chrX41769 1667 581 167 --11467 --
NM_001002860chr1453540 1743 1584 1158 796 13240 34096 1029 885 --
NM_001003652chr1866783 3468 2906 2559 1629 998 16175 --17152
NM_001003674chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_001003675chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_001003681chr2232040 621 396 ------
NM_001003712chr1222680 510 ------
NM_001003792chr32801 219 ----1924
NM_001003793chr32801 219 ----1924
NM_001003800chr943157 2708 2290 1183 --12757 --
NM_001003803chr14----134 --
NM_001003805chr14----1126 --
NM_001004127chr132364 97 ------
NM_001004303chr12673 622 ------
NM_001004303chr12673 622 ------
NM_001004304chr1232946 2932 1066 --13153 --
NM_001004317chr654515 4279 3175 809 147 13139 --13190
NM_001004346chr41129 ------
NM_001004419chr1213419 23499 196 24424 673 --
NM_001005375chrY31630 1335 54 11447 ----
NM_001005386chr231749 954 398 21577 751 1272 --
NM_001005473chr545157 4902 2219 160 1180 14095 --
NM_001005474chr341521 1379 1290 1081 ------
NM_001005502chr1295089 3825 3819 3349 1480 1184 797 598 469 --33640 1342 325 --
NM_001005732chr21159 ------
NM_001005733chr212381 59 ------
NM_001005845chr831327 615 126 1772 ----
NM_001005849chr173528 444 54 ------
NM_001006624chr151983 1735 1375 623 599 ------
NM_001007023chr1494644 3742 3579 3492 3240 1374 972 772 634 24511 354 ----
NM_001007033chr122800 35 ------
NM_001007097chr965093 5067 5019 4928 1940 577 ------
NM_001007102chr62651 137 ------
NM_001007156chr152603 212 11823 ----
NM_001007246chr2111691 ------
NM_001007257chr131430 1039 443 ------
NM_001007464chr61136 ------
NM_001007466chr685136 4331 4206 3911 1830 1430 1090 779 34771 4168 1019 ----
NM_001007527chr51212 ------
NM_001007559chr1821889 771 --1732 --
NM_001007565chr31126 ------
NM_001008239chr1843628 3435 2778 175 11420 ----
NM_001008391chr112272 144 ------
NM_001008401chr1941224 1164 491 464 --11021 --
NM_001008408chr795461 4108 1971 1791 1452 1055 862 611 325 ------
NM_001008495chr861884 1715 904 892 160 60 --21897 1468 --
NM_001008539chr875290 4709 4001 3775 1033 521 392 11645 34661 3736 3601 --
NM_001008541chr1021504 618 11984 ----
NM_001008541chr1021504 618 11984 ----
NM_001008564chr1372034 1725 740 701 569 249 243 ------
NM_001008738chr532073 1937 680 12308 22773 315 --
NM_001008801chr1941903 1839 1730 828 --11388 --
NM_001008925chr422509 2369 23056 2158 ----
NM_001009552chr81521 ------
NM_001009814chr13290 55 ------
NM_001009899chr396256 5889 5870 5281 2111 1758 1598 292 40 --24495 2001 --
NM_001010000chr1852891 2255 2169 888 279 ------
NM_001010846chr164397 3999 3218 1384 1167 415 21023 1007 ----
NM_001010853chr63779 644 315 ----12245
NM_001010861chr141805 1770 524 316 ----12037
NM_001010888chrX81612 1528 919 796 683 548 221 122 --1889 11089
NM_001010891chr5106292 6054 5217 5050 4818 4242 2771 2634 2337 1527 --11243 16078
NM_001010922chr143535 3502 754 34 23946 1212 ----
NM_001010923chr631314 428 122 ------
NM_001010986chrX52375 2130 707 411 385 ------
NM_001011546chr202664 581 ------
NM_001011553chr71647 --1816 --
NM_001011663chr102862 803 ------
NM_001011666chr776578 6273 4806 4209 2270 1394 1098 15823 11402 --
NM_001011713chr1411479 --1301 --
NM_001012267chr921505 349 ------
NM_001012393chr1144301 1216 305 226 ------
NM_001012398chr161185 --1438 --
NM_001012420chr1542513 1839 1006 850 ------
NM_001012751chr10135 11556 ----
NM_001012755chrX95044 4422 4001 1907 1874 1676 1456 1115 935 24142 1539 ----
NM_001012756chr1962861 2733 2606 2472 2073 350 --1535 --
NM_001012761chr512205 22243 2115 22311 639 --
NM_001013406chr73383 148 81 11385 1281 --
NM_001013415chr421079 505 1351 ----
NM_001013437chr181453 ------
NM_001013620chr12157769 7406 7220 6678 6185 5186 3095 2332 1827 1702 1642 1624 1585 427 251 47515 6355 5947 333 12803 --
NM_001013659chr19124566 4470 4431 4203 4080 3717 3581 1048 703 542 375 311 14903 ----
NM_001014283chr1352100 1704 1420 700 608 ------
NM_001014797chr10148083 7219 7098 7080 6945 6327 2973 2737 2145 1732 1531 1436 537 216 25655 1975 ----
NM_001014812chr15--1459 ----
NM_001014972chr2171 ------
NM_001015508chr83760 315 141 ------
NM_001015877chrX12383 ------
NM_001015887chr331693 1237 717 --21425 1251 --
NM_001017371chr231067 942 562 ------
NM_001017395chr312361 --3640 574 217 --
NM_001017423chr101510 ------
NM_001017523chr1241881 1528 735 729 --21626 314 --
NM_001017923chr1421305 608 --21222 1059 --
NM_001017930chrX31511 1002 269 ------
NM_001018008chr151676 ------
NM_001018009chr3175 ------
NM_001018064chr931953 554 493 1337 ----
NM_001018065chr995675 5265 4887 4486 4225 3652 1182 128 34 --46038 4567 3883 3702 --
NM_001018066chr995675 5265 4887 4486 4225 3652 1182 128 34 --46038 4567 3883 3702 --
NM_001018067chr1105165 5118 5018 4884 4200 4161 4099 3955 3494 3406 --24689 4038 --
NM_001018068chr1105165 5118 5018 4884 4200 4161 4099 3955 3494 3406 --24689 4038 --
NM_001018069chr1105165 5118 5018 4884 4200 4161 4099 3955 3494 3406 --24689 4038 --
NM_001018072chr1241881 1528 735 729 --21626 314 --
NM_001018074chr532468 511 196 --13265 --
NM_001018075chr532468 511 196 --13265 --
NM_001018076chr532468 511 196 --13265 --
NM_001018077chr532468 511 196 --13265 --
NM_001018089chr1562806 2659 2464 1440 1273 1055 --1578 --
NM_001023587chr31900 ------
NM_001024094chr532468 511 196 --13265 --
NM_001024218chr14145 ----1858
NM_001024455chrX32647 1943 307 11797 1922 --
NM_001024460chr62908 889 --11029 --
NM_001024463chr1511058 ------
NM_001024649chr532733 1004 852 11944 11859 --
NM_001024660chr32235 89 1593 ----
NM_001024948chr133368 2458 506 1976 ----
NM_001025068chr351742 1727 1632 1549 361 1627 ----
NM_001025069chr351742 1727 1632 1549 361 1627 ----
NM_001025076chr1066220 5946 5350 5198 4400 1799 14370 1401 --
NM_001025077chr1077578 7304 6708 6556 5758 5109 4609 15728 11759 --
NM_001025079chr353871 2789 1214 1066 386 13331 23473 1431 --
NM_001025233chr1232096 1917 297 12730 ----
NM_001025252chr833080 2039 1045 1663 ----
NM_001025253chr833080 2039 1045 1663 ----
NM_001025266chr364572 4556 4262 3426 1924 1847 14703 1558 --
NM_001025356chr1242667 2005 188 90 32648 445 65 ----
NM_001025580chrX94310 4082 4062 3941 1620 699 536 154 24 --13878 --
NM_001025595chr411553 11610 ----
NM_001025780chr91565 ----11249
NM_001029858chr682539 1115 1013 797 763 250 229 166 --1681 --
NM_001029860chr82323 301 ------
NM_001030007chr1642935 2909 1049 850 --13357 --
NM_001030055chr1444001 3833 1732 276 11201 14608 --
NM_001031684chr2--1373 --1128
NM_001031695chr2265370 5344 5105 1970 1454 1239 13370 1782 --
NM_001031710chr72873 177 1677 --1813
NM_001031723chr4----1345 --
NM_001031732chr483240 3048 3033 2572 2430 1367 1034 530 --13577 --
NM_001031804chr1654436 4017 3026 422 403 14361 12876 --
NM_001031812chr541662 936 581 519 1687 ----
NM_001032280chr621574 1125 ------
NM_001032394chr642728 2012 1775 885 1329 21925 1890 --
NM_001032395chr632595 1879 752 1196 21792 1757 --
NM_001033045chr2124461 4399 4092 3883 3291 3117 1735 1455 1449 961 544 406 21573 1048 11252 --
NM_001033057chr341780 1512 1442 748 1808 21308 359 --
NM_001033059chr61147 ------
NM_001033117chr344461 1706 1058 305 21949 1828 11490 --
NM_001033507chr141745 1711 775 742 1245 21654 65 --
NM_001033564chr631660 667 242 --21801 767 1263
NM_001033578chr852394 829 790 655 479 --21809 579 --
NM_001034954chr1041212 1046 372 50 13237 ----
NM_001034955chr1041212 1046 372 50 13237 ----
NM_001034956chr1041212 1046 372 50 13237 ----
NM_001034957chr1041212 1046 372 50 13237 ----
NM_001035005chr182484 28 1529 ----
NM_001037131chr2----11237 --
NM_001037174chr252250 1800 907 862 644 21749 791 11946 --
NM_001037317chr141805 1770 524 316 ----12037
NM_001037334chr18--12072 22329 56 --
NM_001037339chr131790 1410 661 --1295 --
NM_001037340chr131790 1410 661 --1295 --
NM_001037341chr131790 1410 661 --1295 --
NM_001037341chr131790 1410 661 --1295 --
NM_001037535chrX2247 71 11006 ----
NM_001037536chrX2247 71 11006 ----
NM_001037540chrX2247 71 11006 ----
NM_001037582chr42476 339 1684 --11467
NM_001037954chr1153385 3195 2899 1110 359 --21084 40 --
NM_001038702chr551916 954 567 350 170 --2586 396 --
NM_001039547chr377609 7435 7309 7071 5538 2882 2286 37850 6416 2764 36506 5397 2117 16547
NM_001039569chr253123 3084 2948 1327 1035 33305 2072 168 22437 1192 --
NM_001039590chrX33807 740 623 ------
NM_001039591chrX33807 740 623 ------
NM_001039618chr1195669 5610 5583 4848 3648 2368 1301 964 955 ------
NM_001039770chr362131 1952 559 435 240 126 --12267 1233
NM_001039840chrX95418 5359 4552 2256 2037 1520 620 516 358 --14066 --
NM_001039937chr1373452 3340 2815 2567 568 204 149 1868 11223 --
NM_001040001chr631712 1447 766 21889 1476 ----
NM_001040020chr72991 201 ------
NM_001040142chr221823 418 22335 1639 ----
NM_001040143chr221823 418 22335 1639 ----
NM_001040151chr11114095 4049 3863 3342 3190 2785 1552 1269 1134 400 106 23708 3114 ----
NM_001040152chr7104921 3396 3350 3328 1636 737 599 472 299 161 24720 550 22002 1040 11019
NM_001040159chr431270 1207 178 ------
NM_001040202chr421851 805 52329 1789 495 478 469 ----
NM_001040284chr1675774 5308 1744 995 676 576 153 11434 ----
NM_001040402chr43620 536 30 ------
NM_001040409chr21846 ------
NM_001040429chr1323168 2323 1604 1361 --
NM_001040441chr1145421 5366 5242 4875 4687 4649 3431 1692 1393 1011 838 622 585 529 34866 4419 608 25067 4514 --
NM_001040450chr1562841 2705 2661 2080 1092 594 --12563 --
NM_001040451chr52484 464 --1124 --
NM_001040452chr52484 464 --1124 --
NM_001040453chr1562841 2705 2661 2080 1092 594 --12563 --
NM_001040665chr744939 3436 1284 1215 14882 ----
NM_001040666chr71641 1584 ----
NM_001040708chr821069 858 ------
NM_001040709chr132302 1584 106 ------
NM_001040712chr933063 701 581 12341 12392 --
NM_001040876chr42758 257 --11555 --
NM_001042355chr1675095 3596 1349 1313 1184 393 281 15407 ----
NM_001042361chr103977 323 195 ------
NM_001042364chr103977 323 195 ------
NM_001042365chr103977 323 195 ------
NM_001042387chr103977 323 195 ------
NM_001042393chr103977 323 195 ------
NM_001042396chr103977 323 195 ------
NM_001042397chr103977 323 195 ------
NM_001042404chr131961 533 276 128 ----
NM_001042406chr6--169 1825 --
NM_001042412chr1675095 3596 1349 1313 1184 393 281 15407 ----
NM_001042413chr953861 3054 3017 2678 1181 32638 697 180 --11508
NM_001042414chr132293 200 ------
NM_001042425chr621574 1125 ------
NM_001042453chrX1165 ------
NM_001042473chr1031351 776 100 21962 595 1293 --
NM_001042481chr1472581 2468 2146 2048 1838 1015 79 --11950 --
NM_001042492chr1733232 1198 699 --13397 --
NM_001042494chr1543174 3055 2786 1418 176 13435 --
NM_001042495chr1543174 3055 2786 1418 176 13435 --
NM_001042496chr1543174 3055 2786 1418 176 13435 --
NM_001042497chr1543174 3055 2786 1418 176 13435 --
NM_001042510chr832066 1565 1363 1752 1585 --
NM_001042511chr832066 1565 1363 1752 1585 --
NM_001042533chr343287 2897 708 280 --12768 --
NM_001042555chr1234695 3302 1814 13590 1727 11723
NM_001042599chr2127789 7517 7390 7379 6974 5409 5238 4961 2720 2276 1631 310 11619 26550 6055 14938
NM_001042603chr1265019 4601 4038 3935 1673 637 --14892 --
NM_001042604chr374831 3268 1792 777 574 396 320 ------
NM_001042749chrX31798 1531 1400 ------
NM_001042750chrX31798 1531 1400 ------
NM_001042751chrX31798 1531 1400 ------
NM_001043318chr1433497 3385 2542 ------
NM_001043351chr142232 1667 1530 738 ----11923
NM_001044305chr62491 192 ------
NM_001044385chr253786 3681 3052 2494 659 13514 ----
NM_001044722chr541662 936 581 519 1687 ----
NM_001044723chr541662 936 581 519 1687 ----
NM_001046chr532641 2485 1937 1694 1806 --
NM_001049chr1431909 1835 361 32415 2347 2177 ----
NM_001071775chr132734 89 ------
NM_001077628chr11651 ------
NM_001083620chr41811 ------
NM_001099678chr386249 6053 5355 4969 4930 4794 885 514 24227 1392 ----
NM_001106chr377221 6761 6489 5951 3297 1442 1160 --29218 1740 --
NM_001109977chr42766 317 1839 ----
NM_001113490chrX2961 50 11379 1338 --
NM_001117chr1852296 1938 386 371 81 1453 ----
NM_001121chr1031660 1484 285 1215 --175
NM_001123chr102832 285 ----1726
NM_001128chr1642935 2909 1049 850 --13357 --
NM_001148chr411765 ------
NM_001149chr1041222 1171 218 25 1395 ----
NM_001153chr22591 371 182 1273 --
NM_001159chr22254 201 --1743 --
NM_001160chr123840 654 363 1210 12024 11934
NM_001167chrX126550 5875 5740 5410 4620 4213 4078 2636 2125 1231 963 881 26444 6423 25371 4414 11806
NM_001173chr1444001 3833 1732 276 11201 14608 --
NM_001186chr2162247 2084 1175 905 823 697 --12581 --
NM_001187chr211102 1178 1405 --
NM_001198chr661925 1844 1777 677 633 386 1317 ----
NM_001201chr443935 2941 2406 1052 140 23214 1320 --
NM_001204chr2167792 7573 6515 6186 6028 5641 5442 5059 4904 4882 4796 2499 1772 1477 1218 43 27008 6147 22810 2687 --
NM_001206chr932949 2581 119 11064 ----
NM_001253chr61215 ------
NM_001256chr1752614 2411 894 766 112 --1692 --
NM_001259chr775870 5849 1844 1767 1287 833 798 --15278 --
NM_001270chr52756 384 ------
NM_001290chr4------149
NM_001300chr102442 318 ------
NM_001310chr1232696 2310 2227 12755 42794 2717 2284 448 --
NM_001329chr102122 25 21388 464 ----
NM_001356chrX32390 155 21 --1292 1778
NM_001364chr1154279 4203 3944 3333 1863 ------
NM_001380chr1021057 380 ------
NM_001385chr81319 ------
NM_001400chr121234 1135 --11332 --
NM_001412chrX3771 329 65 12307 ----
NM_001423chr1221954 149 21648 777 ----
NM_001427chr731454 1441 152 ------
NM_001429chr22----21059 1035 --
NM_001432chr432754 1417 661 --13770 --
NM_001438chr121243 792 22510 2431 ----
NM_001446chr6------191
NM_001448chrX51675 1494 731 283 57 ------
NM_001449chrX41131 300 173 149 ------
NM_001453chr611614 --11744 --
NM_001482chr152193 152 ------
NM_001483chr71839 --1775 --
NM_001514chr11377 ------
NM_001527chr6154814 4710 4637 4324 3956 3885 3412 3257 3229 3168 3034 863 505 446 403 33928 365 34 ----
NM_001553chr41151 1213 ----
NM_001564chr4--1110 ----
NM_001587chrX41736 1653 654 476 --1444 12190
NM_001604chr112853 835 ------
NM_001616chr243250 1093 1080 567 11157 23162 3071 --
NM_001634chr61147 ------
NM_001650chr1853906 1550 1476 535 127 11347 11201 --
NM_001655chr1141457 804 747 623 --12092 --
NM_001656chr511947 21837 1807 22081 518 --
NM_001682chr1242594 2495 2041 255 ------
NM_001690chr352213 1895 890 756 538 --12325 --
NM_001701chr941056 469 423 217 --11242 --
NM_001706chr31273 ------
NM_001717chr152967 89 ------
NM_001730chr131328 ------
NM_001730chr131328 ------
NM_001742chr74363 226 104 41 --130 --
NM_001746chr532733 1004 852 11944 11859 --
NM_001753chr731779 1685 261 --2493 135 --
NM_001755chr1662196 2090 1829 1408 797 426 11462 ----
NM_001777chr353871 2789 1214 1066 386 13331 23473 1431 --
NM_001788chr71647 --1816 --
NM_001798chr121839 ------
NM_001804chr5--1838 1596 --
NM_001854chr121130 1098 ------
NM_001858chr654426 3281 3229 1229 431 13922 ----
NM_001859chr973893 3758 3622 1453 706 570 338 11552 ----
NM_001860chr921119 933 ------
NM_001873chr41116 ------
NM_001874chr1295089 3825 3819 3349 1480 1184 797 598 469 --33640 1342 325 --
NM_001884chr51176 ------
NM_001893chr171381 ------
NM_001894chr2221139 901 ------
NM_001902chr13410 313 152 ------
NM_001903chr53696 63 53 1578 1809 1834
NM_001918chr1168957 8626 8347 8234 7850 7354 7172 7037 3702 2418 2245 1856 1673 490 354 144 13123 21541 1254 19091
NM_001920chr12--1535 ----
NM_001924chr12562 101 ------
NM_001949chr62907 549 ------
NM_001964chr51293 1200 ----
NM_001977chr451427 675 548 477 291 ------
NM_001982chr12----2854 299 1504
NM_002006chr435736 4782 4425 25679 3540 22108 1977 --
NM_002015chr1382996 2832 2715 2273 2204 2185 999 501 12173 ----
NM_002024chrX--12077 1324 --
NM_002025chrX128935 7484 6670 6028 3110 2445 1517 1455 1229 1195 198 38 58401 3650 3351 2128 1020 48825 3597 3026 67 --
NM_002039chr42731 271 ------
NM_002040chr2172692 2491 2293 2235 2059 976 74 1530 21113 678 --
NM_002041chr15133 ------
NM_002045chr31276 ------
NM_002052chr811400 11308 ----
NM_002061chr181933 1894 1759 1464 1458 1419 1286 634 ----11683
NM_002069chr741519 1264 1217 1166 21840 408 ----
NM_002092chr4114660 4506 4421 4286 3390 3279 2038 1853 1362 1317 1296 --23955 540 --
NM_002094chr16----1370 --
NM_002126chr1744048 3759 3072 1638 1769 --13187
NM_002158chr273181 2844 2818 2720 1272 175 106 12768 ----
NM_002196chr202972 709 ------
NM_002196chr202972 709 ------
NM_002210chr263463 3005 2569 2515 1298 517 ------
NM_002214chr7105691 5443 4656 4054 2285 1433 1298 1082 764 300 2923 375 14687 --
NM_002221chr142807 2106 1038 214 11821 ----
NM_002252chr23336 293 89 ------
NM_002254chr242182 1782 1523 1452 --2877 258 --
NM_002264chr384747 4294 4174 3940 3884 1223 753 505 24255 3469 ----
NM_002270chr575682 5601 5253 5107 4660 686 178 14893 ----
NM_002310chr596413 5906 5774 4328 4318 2533 2247 2172 822 26491 3997 --12289
NM_002315chr111275 ------
NM_002336chr1254475 3360 3255 1082 339 13659 ----
NM_002345chr123622 87 77 ------
NM_002356chr672844 2100 1841 984 637 426 204 12709 ----
NM_002372chr54663 630 461 32 ------
NM_002381chr23830 404 134 ------
NM_002389chr1--21648 37 ----
NM_002395chr62507 280 1317 1558 --
NM_002398chr231424 1082 1047 ------
NM_002448chr41745 ------
NM_002460chr651467 1378 1309 429 181 --1439 --
NM_002467chr81462 ------
NM_002487chr152599 575 1694 1706 --
NM_002500chr22814 148 ------
NM_002507chr1711930 ------
NM_002515chr1451500 1472 1437 784 666 12046 ----
NM_002526chr631204 1194 350 --1162 --
NM_002545chr1144301 1216 305 226 ------
NM_002546chr82650 245 ------
NM_002572chr113387 285 55 ------
NM_002577chr342832 2523 740 73 1230 11314 --
NM_002581chr934148 2189 1921 --11723 15656
NM_002595chr1241895 1829 747 315 ------
NM_002600chr131790 1410 661 --1295 --
NM_002603chr8----1157 --
NM_002628chr33427 258 58 --1141 1291
NM_002645chr1162733 2219 2072 1260 857 598 --12791 11973
NM_002655chr8125085 4438 4208 4193 4130 3304 1757 1122 1113 1053 691 309 --23224 1806 --
NM_002656chr64966 803 699 317 ------
NM_002670chr341297 1149 387 293 11161 ----
NM_002677chr832246 1967 36 11044 ----
NM_002687chr142440 65 11045 ----
NM_002715chr521288 396 ------
NM_002716chr1153650 1317 973 412 139 23171 207 11141 --
NM_002718chr352583 2396 2154 2115 584 22414 965 11984 --
NM_002719chr1442167 2093 1529 907 22310 1733 ----
NM_002721chr92369 341 ------
NM_002731chr133076 1925 759 12150 ----
NM_002734chr1742219 2034 1959 1946 ------
NM_002736chr751732 1446 468 427 179 ----1697
NM_002737chr1776588 6223 5300 4947 4563 755 561 16430 26705 1465 --
NM_002740chr341083 787 387 343 1933 22667 652 --
NM_002745chr2244499 1366 716 406 33904 624 284 21499 736 --
NM_002748chr151936 21033 64 ----
NM_002752chr5----1236 --
NM_002806chr141323 ------
NM_002816chr171265 ------
NM_002822chr1251154 735 496 373 73 ------
NM_002829chr921207 203 ------
NM_002839chr933063 701 581 12341 12392 --
NM_002844chr621032 958 1195 1540 --
NM_002847chr741500 1483 1245 476 --11101 --
NM_002851chr7--1154 ----
NM_002858chr151266 922 491 393 284 11102 ----
NM_002860chr101510 ------
NM_002869chr1121656 128 11859 ----
NM_002874chr952017 1868 1803 750 610 --21629 635 --
NM_002886chr354725 4072 3947 3821 1430 --14475 --
NM_002892chr1421553 1544 ----11090
NM_002912chr62925 294 ------
NM_002922chr11574 ------
NM_002940chr42758 257 --11555 --
NM_002941chr351339 1263 643 145 44 ------
NM_002959chr133698 2710 1424 --12749 14204
NM_002994chr42706 307 ------
NM_002998chr832229 2165 1962 1662 135 --
NM_003011chr921678 1107 ------
NM_003014chr721471 1038 11268 ----
NM_003016chr1711880 1107 ----
NM_003022chrX1447 1320 1837 --
NM_003034chr12147322 7312 7061 6841 6762 6626 6492 6293 6176 2929 1850 1564 1435 1173 27509 1692 26872 5441 --
NM_003035chr12206 104 1658 2377 93 --
NM_003042chr321929 1691 --1287 --
NM_003046chr875290 4709 4001 3775 1033 521 392 11645 34661 3736 3601 --
NM_003048chr242452 940 340 57 12223 12816 --
NM_003051chr111393 --21978 771 --
NM_003068chr81354 1226 ----
NM_003071chr31138 ------
NM_003081chr201819 11123 ----
NM_003099chr1596492 4503 2573 2156 1999 1904 1582 1457 392 1739 ----
NM_003100chr52433 72 ------
NM_003106chr31869 ------
NM_003108chr237295 7151 1513 24642 359 ----
NM_003111chr231067 942 562 ------
NM_003112chr732900 644 85 33108 2416 2292 ----
NM_003128chr262575 915 769 559 482 80 ------
NM_003133chr11148 --1700 --
NM_003135chr51100 ------
NM_003144chr621464 268 ------
NM_003149chr331610 1413 1161 11337 ----
NM_003155chr8142 ------
NM_003161chr1762736 2655 869 787 668 325 12576 ----
NM_003162chr22950 695 ------
NM_003183chr21577 ------
NM_003188chr6----1826 --
NM_003199chr1835037 497 242 24108 1918 ----
NM_003220chr621574 1125 ------
NM_003248chr5----1138 --
NM_003255chr1732654 2640 1918 ------
NM_003262chr374680 4544 1923 1735 1521 1228 65 --34358 3651 1639 --
NM_003274chr2142510 1873 550 413 12826 --1771
NM_003275chr941517 1080 953 454 --1513 --
NM_003286chr20--11050 ----
NM_003298chr346027 1925 579 553 15053 ----
NM_003299chr12157 ------
NM_003304chr31632 --21328 1079 --
NM_003320chr1164113 3865 3639 2940 1203 892 24095 4074 ----
NM_003337chr551632 1260 698 440 33 --11392 --
NM_003338chr1031591 476 200 11833 ----
NM_003339chr531466 1335 1003 ------
NM_003340chr421396 56 ------
NM_003342chr1742959 2056 637 203 1673 ----
NM_003345chr161581 ------
NM_003348chr12129 --11178 --
NM_003369chr1122285 1957 22467 2417 1161 --
NM_003373chr1021508 1401 --21717 1691 --
NM_003385chr22356 253 ------
NM_003390chr1151141 770 218 85 61 1397 ----
NM_003404chr2061468 1291 468 383 191 35 --1246 --
NM_003406chr831477 1387 736 --1380 --
NM_003411chrY21345 479 185 ----
NM_003412chr382326 2000 1968 1126 601 589 69 48 ------
NM_003413chrX11238 --11958 --
NM_003419chr1941076 354 251 203 ------
NM_003431chr11462 ------
NM_003432chr5--1376 ----
NM_003439chr742689 2438 2301 1317 --1525 --
NM_003458chr343648 882 667 44 ------
NM_003463chr632913 1284 452 12080 ----
NM_003468chr294258 4065 4045 3964 3860 3715 3218 1612 1427 --177 --
NM_003471chr332377 1516 90 --11723 11655
NM_003478chr1132665 2221 102 12692 ----
NM_003483chr1252891 2855 2307 373 281 --12253 --
NM_003566chr1253290 3197 2815 403 203 13111 ----
NM_003574chr1864832 4801 4536 3576 1523 975 43955 3792 1625 221 1668 --
NM_003583chr1211117 21387 1211 1293 --
NM_003591chr10----136 --
NM_003601chr4--2196 25 ----
NM_003607chr1104355 4187 4054 3639 3436 1742 1722 1685 1487 305 23559 2960 14122 --
NM_003615chr353308 3302 1571 1010 952 21480 66 13541 --
NM_003622chr1232513 1790 576 12051 1679 --
NM_003630chr61702 ------
NM_003659chr24981 933 346 214 --11237 --
NM_003663chr363517 3406 3029 2668 902 358 --1350 --
NM_003671chr943385 3164 444 330 13017 ----
NM_003676chr13859 357 269 ------
NM_003679chr173196 2395 2355 2298 1224 1074 160 13025 ----
NM_003705chr21162 1773 ----
NM_003728chr41433 ------
NM_003749chr1332409 216 176 21499 51 --1697
NM_003750chr104689 241 163 48 --1627 --
NM_003759chr474002 2654 894 720 396 246 24 14162 ----
NM_003763chr2092632 2305 2137 1972 1020 975 888 619 573 ------
NM_003783chr141037 885 798 71 1415 ----
NM_003796chr191418 ------
NM_003812chr21326 ------
NM_003816chr83941 517 229 1386 ----
NM_003825chr1521381 26 ------
NM_003831chr1851495 1423 1350 1187 1148 1192 11852 --
NM_003848chr33231 124 65 1818 ----
NM_003850chr13--3569 474 50 ----
NM_003861chr1422704 1850 --22306 2010 --
NM_003864chr4--1202 ----
NM_003870chr1531950 529 245 ------
NM_003872chr262948 1109 1051 279 190 61 ----23049 419
NM_003887chr221502 872 1581 12197 --
NM_003913chr644027 3768 3437 1021 11263 ----
NM_003929chr171747 1708 1571 677 543 319 137 21296 1247 ----
NM_003930chr762325 2259 1585 939 375 113 32338 2216 291 ----
NM_003934chr9139 --1188 --
NM_003941chr752449 2155 1727 764 660 2568 517 ----
NM_003946chr162558 549 ------
NM_003998chr43560 440 119 ------
NM_004006chrX21755 798 ------
NM_004007chrX21755 798 ------
NM_004009chrX21755 798 ------
NM_004010chrX21755 798 ------
NM_004011chrX21755 798 ------
NM_004012chrX21755 798 ------
NM_004013chrX21755 798 ------
NM_004014chrX21755 798 ------
NM_004015chrX21755 798 ------
NM_004016chrX21669 712 ------
NM_004017chrX21755 798 ------
NM_004018chrX21669 712 ------
NM_004020chrX21755 798 ------
NM_004021chrX21669 712 ------
NM_004022chrX21669 712 ------
NM_004023chrX21669 712 ------
NM_004028chr1853906 1550 1476 535 127 11347 11201 --
NM_004035chr17165125 4965 4793 4575 4440 3764 3645 3478 3152 1908 1766 1643 1183 1123 855 349 11085 34166 3336 827 --
NM_004080chr721412 415 --11252 --
NM_004081chrY31630 1335 54 11447 ----
NM_004085chrX1257 1636 1813 --
NM_004094chr1422457 956 --33037 1957 1933 --
NM_004113chr332024 810 349 22060 1739 ----
NM_004117chr622196 321 ------
NM_004124chr1443332 572 418 406 12685 12513 13354
NM_004133chr852516 2223 2093 1887 872 22679 964 ----
NM_004136chr1563150 3117 2539 1017 590 583 43130 2658 890 840 --12488
NM_004156chr81521 ------
NM_004171chr11108456 8236 7673 3738 3226 3218 3136 2454 2210 1518 18988 19560 26646 1800
NM_004172chr552021 1395 808 250 214 ------
NM_004180chr2----2173 94 --
NM_004229chrX2844 168 ------
NM_004232chr1863128 3072 2981 2587 1522 841 ------
NM_004235chr91223 ------
NM_004238chr21244 ------
NM_004241chr101131 --145 --
NM_004253chr91331 1858 ----
NM_004261chr1----1714 1353
NM_004274chr1422806 119 22134 1269 12153 11180
NM_004288chr24936 918 838 170 ------
NM_004296chr1463928 1305 1138 532 385 337 13600 21494 104 --
NM_004329chr1011330 ------
NM_004331chr822155 348 ------
NM_004338chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_004342chr732016 550 263 1153 12238 11968
NM_004360chr1641901 1831 730 230 1441 ----
NM_004380chr1621056 830 --1686 --
NM_004384chr541662 936 581 519 1687 ----
NM_004385chr52446 33 ------
NM_004389chr21616 2608 352 ----
NM_004397chr1153592 2917 818 792 442 14010 11554 --
NM_004411chr71735 ------
NM_004436chr11559 ------
NM_004440chr641868 1814 424 30 1508 11300 --
NM_004442chr1----11496 --
NM_004447chr1211061 ------
NM_004457chr231277 483 114 ------
NM_004458chrX22400 104 ------
NM_004459chr1751942 1714 1680 1363 721 ------
NM_004464chr464267 4203 1366 1124 500 83 ------
NM_004480chr141763 1592 ----
NM_004496chr1421061 896 1210 11342 --
NM_004497chr191121 1717 ----
NM_004500chr14----11582 --
NM_004504chr272819 2666 2395 2356 581 430 43 ------
NM_004506chr6170 ------
NM_004520chr51630 ------
NM_004525chr211488 2972 963 --1331
NM_004540chr211861 ------
NM_004571chr2142795 2304 1164 344 --22687 2141 --
NM_004586chrX41717 1678 1541 243 25293 4347 12018 --
NM_004598chr563114 2615 2092 933 364 48 22044 542 ----
NM_004612chr921619 324 23314 380 23536 3205 --
NM_004661chr51919 --11028 --
NM_004663chr153280 101 85 --1310 11364
NM_004666chr641281 1109 582 364 1107 1978 --
NM_004671chr18130 ------
NM_004673chr141324 605 180 82 ------
NM_004685chr1352683 2226 1921 720 602 12246 22608 824 --
NM_004687chr171285 21780 1540 11713 --
NM_004725chr101517 176 ----
NM_004736chr152209 2178 2052 1468 1398 ------
NM_004745chr886770 6063 5260 4884 2753 2717 1424 1186 ------
NM_004748chr1563002 2644 1599 1387 1132 279 13691 1168 --
NM_004766chr31187 ----139
NM_004772chr521397 180 ------
NM_004788chr1122479 361 1251 ----
NM_004796chr1412374 12056 ----
NM_004798chr2043518 2231 1316 792 11236 ----
NM_004799chr1163 ------
NM_004801chr221464 969 ------
NM_004815chr153967 1368 1132 917 186 33813 3527 3000 13662 11799
NM_004834chr213393 --124 --
NM_004842chr651681 1657 1639 1189 430 --21383 1236 --
NM_004844chr3175 ------
NM_004846chr2130 --1173 --
NM_004857chr1453819 3387 1749 1195 188 34721 1783 1466 ----
NM_004859chr1772647 2386 2334 902 882 189 154 22612 1125 1809 --
NM_004866chr544156 3322 1468 164 11564 24903 4636 --
NM_004869chr184665 403 166 70 11761 ----
NM_004891chr21190 ------
NM_004898chr442025 1775 506 205 ------
NM_004904chr776578 6273 4806 4209 2270 1394 1098 15823 11402 --
NM_004912chr73383 148 81 11385 1281 --
NM_004921chr172553 2471 2178 2123 1586 580 257 1447 1330 --
NM_004924chr19--1770 ----
NM_004932chr51589 11529 ----
NM_004949chr1842159 2106 1471 416 11828 ----
NM_004956chr773774 3736 3719 3175 3116 3093 1826 --1264 --
NM_004962chr102250 117 1153 ----
NM_004966chr10134 --1633 --
NM_004985chr1274365 3476 2899 2822 1569 1500 1223 33072 686 396 2577 288 --
NM_004992chrX108299 7854 7715 7413 6822 6262 2944 2797 2720 868 --15665 --
NM_004992chrX108299 7854 7715 7413 6822 6262 2944 2797 2720 868 --15665 --
NM_004999chr654024 3889 3683 1508 1311 23184 2837 12869 --
NM_005000chr72338 80 1961 1409 --
NM_005014chr93305 157 80 ------
NM_005020chr7148 ------
NM_005023chr511345 --21336 397 --
NM_005040chr11--1102 ----
NM_005056chr1275263 4845 4282 4179 1917 881 130 --15136 --
NM_005068chr61365 --11398 --
NM_005079chr833080 2039 1045 1663 ----
NM_005109chr331891 815 151 11982 --1189
NM_005116chr2054390 4130 2906 777 138 ----1246
NM_005121chr1743584 2577 213 121 --23625 2976 --
NM_005126chr332249 2002 701 1409 ----
NM_005135chr1543174 3055 2786 1418 176 13435 --
NM_005151chr18--12072 22329 56 --
NM_005153chr161199 ------
NM_005156chr995331 4392 3543 3331 1876 1467 1025 425 402 --21837 1406 --
NM_005171chr1211129 1469 ----
NM_005180chr101484 11516 --11078
NM_005188chr1188120 5119 3262 3163 1461 1445 1417 54 --47416 3252 2446 819 --
NM_005197chr1446214 6135 4419 742 22054 1846 15239 --
NM_005233chr352521 874 498 296 179 11620 ----
NM_005235chr2127789 7517 7390 7379 6974 5409 5238 4961 2720 2276 1631 310 11619 26550 6055 14938
NM_005238chr1153508 2855 2429 507 305 ------
NM_005243chr221266 ------
NM_005244chr201507 ------
NM_005254chr1521211 413 ------
NM_005259chr231169 420 115 11308 ----
NM_005264chr105351 342 330 321 309 ------
NM_005277chr42530 473 --1673 --
NM_005279chr23582 309 277 ----1127
NM_005295chr7172 ------
NM_005311chr73706 646 275 --2961 392 --
NM_005316chr111999 ------
NM_005338chr783702 3677 3638 3502 3258 3083 1007 457 23269 1284 11456 --
NM_005339chr443474 3356 3044 1249 13818 ----
NM_005342chrX82846 2149 1974 1968 965 730 125 119 11734 --12481
NM_005359chr1895428 5051 4032 2349 2215 1182 881 349 275 --25948 1861 --
NM_005375chr631088 439 62 ----1398
NM_005398chr10----1423 --
NM_005399chr164362 3741 3709 1307 1279 389 24089 1139 11360 --
NM_005402chr73634 368 90 1121 ----
NM_005406chr181520 2381 214 ----
NM_005407chr1421198 161 11590 11437 --
NM_005433chr181303 11977 ----
NM_005436chr1042736 1179 1146 396 ------
NM_005465chr141770 1499 1484 45 1536 1751 --
NM_005475chr1232140 833 399 23188 2921 12887 --
NM_005486chr171255 1714 --1563
NM_005487chr2232040 621 396 ------
NM_005497chr17105527 5360 4966 4612 4416 2227 1716 1228 435 276 --26058 3871 15187
NM_005502chr943180 3064 2772 2750 --11250 --
NM_005504chr1296344 5484 4473 4191 4002 2243 1073 921 496 26207 4699 --15828
NM_005509chr52375 186 --173 --
NM_005513chr341493 1263 1241 386 1214 11222 --
NM_005523chr71198 ----1459
NM_005527chr61319 172 1398 --
NM_005530chr1551348 1016 572 269 32 --11395 --
NM_005540chr141495 1435 1251 537 ------
NM_005544chr21407 ------
NM_005559chr18131 ------
NM_005578chr343428 1779 1227 419 11870 14118 11829
NM_005584chr132785 555 ------
NM_005593chr122177 132 --1562 --
NM_005596chr976400 5434 5113 2230 1585 1135 333 31557 494 266 ----
NM_005602chr31337 --1940 --
NM_005604chr612333 ------
NM_005637chr1821889 771 --1732 --
NM_005665chr184087 3738 3331 1533 1496 1083 767 260 ----14049
NM_005668chr584608 3153 2820 1433 1136 927 495 313 33568 3370 286 ----
NM_005669chr542253 1641 1586 1527 ------
NM_005694chr3--1132 ----
NM_005721chr221057 59 ------
NM_005722chr231749 954 398 21577 751 1272 --
NM_005730chr1233631 1438 534 --23226 951 --
NM_005739chr1542136 2018 735 280 --22275 1512 --
NM_005746chr752200 1051 952 627 307 22232 591 --11734
NM_005749chr171146 ------
NM_005759chr294741 4202 3822 3670 3276 1081 1010 934 196 11340 11405 --
NM_005766chr1311354 --1476 --
NM_005776chr144723 667 314 240 ------
NM_005779chr573181 3032 1284 1187 786 626 66 33058 2527 303 ----
NM_005786chr18--11218 ----
NM_005788chr113814 287 213 ------
NM_005789chr1722119 1373 ------
NM_005807chr1--1139 ----
NM_005822chr632351 484 176 --11522 --
NM_005832chr341344 560 516 383 ------
NM_005840chrX56713 5251 1941 1397 364 16947 25111 782 1800
NM_005857chr121018 399 ------
NM_005862chr32977 223 ------
NM_005868chr762416 2094 2003 1730 765 732 ------
NM_005875chr32143 114 ------
NM_005891chr6--1225 ----
NM_005898chr1152690 2617 2495 942 827 1856 ----
NM_005901chr1866783 3468 2906 2559 1629 998 16175 --17152
NM_005903chr594802 4256 3770 1927 1529 1490 1356 977 743 --14513 --
NM_005904chr1821285 321 11318 ----
NM_005906chr61189 11084 ----
NM_005907chr621168 594 1521 ----
NM_005909chr534161 3493 3158 22786 153 13067 --
NM_005910chr1774156 3834 3109 2957 1190 150 132 --13765 --
NM_005930chr142797 80 ------
NM_005935chr474930 4897 4720 4597 1424 858 699 11792 1166 --
NM_005941chr864000 3612 2900 2731 958 846 44015 3988 3514 3083 11532 --
NM_005955chr195224 4833 3960 2113 1979 826 799 360 258 14330 21618 745 --
NM_005962chr1021504 618 11984 ----
NM_005962chr1021504 618 11984 ----
NM_005964chr1731170 360 234 ------
NM_005989chr721575 1523 --11410 --
NM_006007chr953916 3311 1602 1158 709 ------
NM_006015chr111279 ------
NM_006016chr61177 ------
NM_006040chr1611275 ------
NM_006042chr17------1488
NM_006070chr31126 ------
NM_006073chr612186 41396 1366 833 262 ----
NM_006080chr712916 1842 ----
NM_006095chr444538 3543 845 311 13260 11576 13060
NM_006106chr1121143 338 1574 ----
NM_006136chr751350 970 886 115 53 --126 --
NM_006139chr262144 1841 1013 604 401 57 12914 3886 793 163 --
NM_006141chr1652795 1963 785 555 342 ------
NM_006154chr1552921 2102 1014 785 172 11093 12616 --
NM_006157chr11----1286 --
NM_006158chr831787 1193 276 11385 1613 --
NM_006166chr1262425 2266 1669 954 560 292 11919 12094 --
NM_006180chr931953 554 493 1337 ----
NM_006195chr941374 419 315 164 21157 449 ----
NM_006203chr544780 2000 1659 85 35490 1350 1146 24350 1824 --
NM_006206chr432702 2229 1990 --11981 --
NM_006207chr81282 ------
NM_006210chr1931050 967 388 21188 961 ----
NM_006212chr175155 4693 4386 3335 2136 2042 1927 176 ----
NM_006226chr211418 --1364 --
NM_006241chr342248 1751 350 248 ----1873
NM_006246chr142910 232 2332 26 ----
NM_006253chr1221251 405 ------
NM_006256chr172178 1032 946 842 487 419 373 12040 11699 --
NM_006257chr103895 766 698 1245 ----
NM_006258chr1051356 1308 511 460 103 21466 1031 --1403
NM_006265chr841290 1211 514 341 ------
NM_006275chr2032216 2199 614 ----2986 516
NM_006279chr12326 296 ------
NM_006283chr864472 4410 3718 1806 1785 1597 14479 --14953
NM_006287chr262635 2088 1942 1689 338 225 42339 2118 2039 861 ----
NM_006290chr621344 734 ----11811
NM_006306chrX95952 5854 5504 5354 2028 1756 1324 854 747 11845 ----
NM_006315chr474051 3799 3479 3384 1733 1720 804 ------
NM_006320chr42848 281 1789 ----
NM_006330chr841515 1200 312 41 --11227 --
NM_006333chr21494 ----1165
NM_006346chr131373 ------
NM_006366chr621288 1086 ------
NM_006379chr762323 2004 1531 803 609 100 --1116 --
NM_006380chr1734286 3955 3576 13257 --13919
NM_006390chr1251273 1179 521 231 34 ------
NM_006403chr631800 1535 1456 11840 ----
NM_006434chr1041212 1046 372 50 13237 ----
NM_006459chr101785 2653 66 11733 --
NM_006469chr121515 272 11181 ----
NM_006474chr151983 1735 1375 623 599 ------
NM_006482chr1211117 21387 1211 1293 --
NM_006489chr1451500 1472 1437 784 666 12046 ----
NM_006496chr161390 748 739 553 473 240 ------
NM_006504chr1042829 2722 2289 271 ----12553
NM_006526chr2032138 481 347 ------
NM_006537chr154556 501 446 21 1537 ----
NM_006538chr252757 2671 1024 736 490 14028 13573 --
NM_006544chr1475314 4933 4924 4842 4274 1136 277 24438 1182 ----
NM_006547chr742145 1734 1577 1520 --12071 --
NM_006561chr1066220 5946 5350 5198 4400 1799 14370 1401 --
NM_006565chr161107 ------
NM_006575chr1411282 --1356 --
NM_006582chr1168 ------
NM_006595chr1131506 807 406 1298 ----
NM_006599chr16126830 6030 5826 5682 5220 5047 2949 2794 1263 1148 865 76 15411 23274 1216 --
NM_006603chrX31798 1531 1400 ------
NM_006609chr262329 1073 795 348 308 285 ------
NM_006614chr353538 3491 2582 2244 678 ------
NM_006618chr111130 11349 1141 --
NM_006624chr1031765 1337 495 11977 21406 35 --
NM_006625chr12871 457 ------
NM_006625chr12871 457 ------
NM_006625chr12871 457 ------
NM_006626chr92429 134 1992 11850 --
NM_006628chr1563570 3405 3391 1643 450 322 34498 1429 840 24385 3848 --
NM_006629chr1832843 441 129 22212 305 ----
NM_006636chr21846 ------
NM_006654chr1234695 3302 1814 13590 1727 11723
NM_006667chrX284 46 1137 ----
NM_006699chr172004 1914 1680 1024 940 447 254 1981 ----
NM_006708chr62330 300 --195 --
NM_006717chr942221 2098 970 578 23162 1092 ----
NM_006718chr64966 803 699 317 ------
NM_006721chr102832 285 ----1726
NM_006722chr31945 ------
NM_006729chrX84972 4892 4846 4360 4217 3850 246 208 24484 620 ----
NM_006746chrX2247 71 11006 ----
NM_006750chr16107450 6305 6282 5969 5793 5586 1574 932 913 601 35111 1287 892 16803 --
NM_006756chr821327 598 ------
NM_006775chr652536 776 712 488 285 31918 832 540 ----
NM_006777chrX21929 1839 ------
NM_006793chr104546 281 129 68 ------
NM_006805chr53519 492 266 ------
NM_006823chr851417 1363 950 569 262 11239 ----
NM_006826chr22932 335 ------
NM_006831chr112403 41 ------
NM_006832chr1441026 887 270 102 ------
NM_006851chr1242368 2264 2096 1114 2564 532 ----
NM_006870chr202664 581 ------
NM_006873chr263530 3172 2801 2781 2454 537 1695 32703 340 308 --
NM_006912chr142308 2129 1979 952 21811 786 ----
NM_006915chrX51981 1601 1007 388 152 ------
NM_006924chr1784398 3853 3074 2758 1526 1356 1333 429 --11455 --
NM_006937chr173528 444 54 ------
NM_006940chr1231849 1751 1328 ------
NM_006965chr1821180 263 1900 1350 --
NM_006981chr93859 553 85 ------
NM_007006chr1673415 3290 3069 2932 2843 2190 451 --23529 306 --
NM_007007chr12114473 4467 4445 3205 1612 944 655 395 387 261 21 11344 13066 --
NM_007011chr15126818 6549 6149 6126 5991 5842 5615 5440 5253 4831 4815 4425 11879 16800 26861 5207
NM_007017chr51853 ------
NM_007023chr21976 ------
NM_007034chr12652 317 ------
NM_007038chr21125927 5742 4510 4164 1941 1889 1726 1162 807 684 414 348 14024 11128 11714
NM_007047chr631767 407 226 12468 12004 1639
NM_007064chr32235 89 1593 ----
NM_007084chr1321539 1262 --1219 --
NM_007106chr132785 482 21863 884 12048 --
NM_007111chr131827 ------
NM_007114chr362448 2408 1146 1001 457 272 ------
NM_007129chr13187 --11024 --
NM_007146chr1752918 1153 612 349 189 22868 327 ----
NM_007157chrX12530 --1547 --
NM_007159chr331528 1403 351 ----11462
NM_007172chr2273093 2742 2151 2076 1228 1119 571 ------
NM_007173chr1142434 1534 936 209 ------
NM_007175chr863425 3280 2929 2834 2441 675 11206 13006 --
NM_007185chr1----1883 --
NM_007195chr1842473 1435 1301 230 1875 ----
NM_007212chr132219 798 76 32051 2002 1870 ----
NM_007240chr12177 66 ------
NM_007246chr41854 ------
NM_007249chr13118649 8140 6874 5944 5816 5790 2667 1879 869 590 342 11811 --16831
NM_007269chr11153 ------
NM_007276chr72315 256 ------
NM_007282chr34916 757 305 132 ------
NM_007287chr333097 257 213 --2572 96 --
NM_007288chr333097 257 213 --2572 96 --
NM_007289chr333097 257 213 --2572 96 --
NM_007292chr17165125 4965 4793 4575 4440 3764 3645 3478 3152 1908 1766 1643 1183 1123 855 349 11085 34166 3336 827 --
NM_007324chr1163 ------
NM_007331chr452692 2227 1922 766 632 11757 ----
NM_007345chr1841568 313 218 143 1610 ----
NM_007347chr1573166 2499 2362 1982 960 684 266 ------
NM_007350chr1263538 2884 1687 1651 1442 553 --14403 --
NM_007373chr1021740 498 21456 1199 ----
NM_012081chr563414 3084 2637 2461 1507 1267 1679 --12684
NM_012089chr131383 998 395 ------
NM_012095chr1063012 2463 1239 1135 781 731 22295 61 23057 2384 --
NM_012097chr252250 1800 907 862 644 21749 791 11946 --
NM_012104chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_012104chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_012115chr62189 137 ------
NM_012120chr632989 2496 930 32333 2168 420 1624 --
NM_012141chr1373452 3340 2815 2567 568 204 149 1868 11223 --
NM_012158chr1331860 1792 1206 11313 ----
NM_012164chr9157559 7507 7045 6968 6757 5255 4674 2620 2543 2477 2342 1601 1207 891 130 36903 5822 1989 14625 --
NM_012193chr1175401 4575 4434 4413 4317 4194 832 --33708 3586 260 --
NM_012214chr2116359 5759 5360 2535 2396 2092 1843 1777 1492 1318 1148 11179 15499 --
NM_012223chr21293 1305 ----
NM_012229chr1031049 558 400 11334 ----
NM_012234chr333705 889 236 --2823 184 --
NM_012242chr102783 196 1813 ----
NM_012249chr263377 3253 2650 2530 2311 559 11339 ----
NM_012252chr794849 4386 4237 3417 1978 1278 890 793 532 42037 1941 1890 1797 ----
NM_012255chr202311 35 ------
NM_012259chr621403 1379 ------
NM_012262chr154617 4392 4065 1260 1101 --23965 3176 --
NM_012287chr354079 3751 3323 3314 1504 33425 2784 1699 44309 3651 3277 366 --
NM_012289chr19149 ------
NM_012294chr743557 1510 613 271 23709 1046 1413 --
NM_012297chr452505 2389 2011 915 662 --1107 --
NM_012302chr121081 845 11219 ----
NM_012316chr174845 4806 4672 1773 1584 1551 1118 --14986 --
NM_012319chr183957 904 692 ------
NM_012329chr172387 132 1320 ----
NM_012330chr1031754 1547 1174 139 ----
NM_012333chr1----21520 1236 --
NM_012334chr553491 3255 1729 1032 1019 --14135 --
NM_012347chr662272 949 797 622 519 26 --11831 --
NM_012381chr61276 1258 ----
NM_012382chr533210 2870 916 ------
NM_012395chr753404 2541 2151 1057 46 ------
NM_012397chr1811710 ------
NM_012399chr2242024 1842 1733 1416 ----11601
NM_012413chr22117 61 ------
NM_012419chr6122 ------
NM_012431chr743456 3057 1364 90 ------
NM_012471chrX41805 1445 1316 179 ------
NM_012482chr11468 ------
NM_013229chr123840 654 363 1210 12024 11934
NM_013235chr52897 237 2602 133 ----
NM_013237chr5--177 ----
NM_013238chr131711 11570 --11158
NM_013243chr1511015 ------
NM_013250chr1151265 1156 419 160 23 2431 262 ----
NM_013255chr7108625 7743 7599 6145 6121 5458 3458 2965 2796 483 27764 1791 ----
NM_013257chr852394 829 790 655 479 --21809 579 --
NM_013261chr423455 3079 11005 ----
NM_013269chr1213346 23426 123 24351 600 --
NM_013281chr2021239 1137 11470 ----
NM_013283chr51208 ------
NM_013309chr1542595 845 836 276 2761 463 1687 --
NM_013322chr71657 --11730 --
NM_013354chr81271 11249 ----
NM_013357chr81764 ----1175
NM_013372chr1543228 2759 2530 2456 12336 12777 --
NM_013374chr352132 2120 519 473 173 --11926 --
NM_013377chr121226 ------
NM_013381chr1221536 567 12024 1602 --
NM_013386chr11667 2458 331 1140 --
NM_013436chr21238 --2564 140 --
NM_013438chr941528 1224 368 217 ------
NM_013447chr1973801 3574 3499 3408 3033 1099 1027 --2504 254 --
NM_013448chr14----1264 --
NM_013450chr21978 ------
NM_013958chr82313 140 ------
NM_013959chr82313 140 ------
NM_013961chr82313 140 ------
NM_013962chr82313 140 ------
NM_013986chr221266 ------
NM_013989chr1494644 3742 3579 3492 3240 1374 972 772 634 24511 354 ----
NM_014000chr1021508 1401 --21717 1691 --
NM_014023chr1042653 797 698 645 12818 12951 --
NM_014028chr643028 2611 1039 693 2794 270 12134 1297
NM_014034chr631547 1335 427 1303 ----
NM_014039chr11--11196 ----
NM_014089chr1372034 1725 740 701 569 249 243 ------
NM_014106chr1532753 838 705 --12844 --
NM_014112chr854789 3341 2049 450 226 15078 ----
NM_014117chr162911 247 ------
NM_014155chr1177452 7202 5952 2768 2760 2536 2358 1650 11521 1582
NM_014157chr1643776 3527 2503 963 11527 13134 --
NM_014232chr1741294 1241 1114 647 2607 206 ----
NM_014232chr1741294 1241 1114 647 2607 206 ----
NM_014250chr2232040 621 396 ------
NM_014251chr72825 145 --2746 177 --
NM_014253chrX32459 2353 2290 12052 ----
NM_014267chr112919 319 1907 1683 --
NM_014283chr11257 --1199 --
NM_014290chr9--1208 ----
NM_014309chr2265360 5334 5095 1960 1444 1229 13360 1772 --
NM_014317chr101103 ------
NM_014319chr1211215 ------
NM_014322chr12970 302 ------
NM_014325chr1272290 2284 2208 1844 1454 890 875 ------
NM_014331chr477264 6662 6431 4749 4743 1404 1235 36138 6031 285 ----
NM_014333chr1132517 2127 717 --12535 --
NM_014342chr1131092 419 105 21432 388 ----
NM_014345chr621066 36 --1774 --
NM_014350chr54992 439 94 29 ------
NM_014363chr133956 490 256 ------
NM_014382chr32529 418 11609 2575 53 --
NM_014393chr842105 1858 1488 593 ------
NM_014415chr341326 1314 1068 347 11372 ----
NM_014423chr575116 4740 4403 2044 877 616 160 24819 3713 ----
NM_014430chr14131 ------
NM_014445chr342282 2232 1795 433 ------
NM_014447chr411552 11609 ----
NM_014452chr621011 31 ------
NM_014454chr621069 792 ------
NM_014456chr1041767 1751 355 284 --11492 --
NM_014458chr121384 422 11069 11328 --
NM_014494chr1632131 1495 804 ------
NM_014497chr2171 ------
NM_014552chr211519 ------
NM_014572chr1321531 191 11782 1120 --
NM_014574chr1431550 184 60 ------
NM_014586chr2174847 4424 3180 1695 1574 486 227 1190 11870 --
NM_014607chr252163 743 677 376 31 ------
NM_014612chr941311 1259 513 419 ------
NM_014614chr231005 287 115 11161 1219 --
NM_014615chr1632252 832 654 --23501 1071 1327
NM_014616chr343290 820 575 61 --12937 --
NM_014630chr1553475 3117 2971 2851 518 11340 ----
NM_014646chr1821009 300 13138 --12242
NM_014659chr1511058 ------
NM_014666chr53834 394 212 1455 ----
NM_014677chr81338 ------
NM_014679chr1121433 281 ------
NM_014682chr811611 22027 321 ----
NM_014702chr622844 2491 11300 12615 --
NM_014707chr741982 516 417 276 1867 ----
NM_014720chr1021398 1136 1337 ----
NM_014721chr6107340 7128 6008 5884 5486 4684 2120 1745 302 37 14721 11656 16705
NM_014729chr852140 1891 1705 735 143 ------
NM_014733chr5--1158 ----
NM_014735chrX11913 ------
NM_014739chr634194 4110 1435 --33134 2877 2614 --
NM_014742chr2011707 21740 1734 1380 --
NM_014743chr442837 2186 284 55 1339 ----
NM_014746chr233731 3535 3248 1460 ----
NM_014748chr2--1387 ----
NM_014753chr10--1290 ----
NM_014771chr161866 ------
NM_014779chr31138 ------
NM_014781chr82500 69 ------
NM_014787chr142695 2415 1020 619 11955 ----
NM_014788chr972515 2434 2116 1079 1038 706 249 --12985 --
NM_014790chr51415 ------
NM_014795chr211200 1323 11092 --
NM_014812chr131961 533 276 128 ----
NM_014824chr115448 368 345 339 24 --11498 --
NM_014826chr1104355 4187 4054 3639 3436 1742 1722 1685 1487 305 23559 2960 14122 --
NM_014827chr11643 --188 --
NM_014829chr522281 2209 11890 22186 381 --
NM_014830chr1223866 2916 --1467 --
NM_014832chr1331811 775 669 --1559 --
NM_014835chr2021409 220 --21970 584 --
NM_014838chr2231123 987 735 ------
NM_014839chr11858 11646 ----
NM_014850chr344461 1706 1058 305 21949 1828 11490 --
NM_014873chr194805 4753 4190 4134 3747 3346 3046 3019 27 31737 1110 975 13297 13286
NM_014877chr1776173 5389 2963 2718 2656 1883 1553 --16388 --
NM_014885chr4--2211 25 ----
NM_014888chr72991 201 ------
NM_014897chr1742731 1152 418 130 12364 11069 --
NM_014898chr1952067 1933 1566 1527 940 22191 2136 ----
NM_014899chr522072 2027 --22037 1052 --
NM_014904chr1073578 3476 3404 2483 1170 680 193 1931 ----
NM_014912chr1043074 2377 283 168 23261 504 1516 1852
NM_014914chr2----11237 --
NM_014920chr643647 3375 2526 1292 ------
NM_014923chr1322190 123 11649 ----
NM_014926chr311119 2997 266 1328 1218
NM_014946chr232632 952 221 12369 ----
NM_014947chr182411 2238 1984 1183 678 379 124 101 ------
NM_014950chr1441206 700 573 188 1429 2639 177 --
NM_014953chr1394340 4035 2811 1594 1487 1471 1438 1133 233 23979 3298 31606 649 280 --
NM_014961chr412151 ------
NM_014962chr2042268 1903 1786 328 1556 ----
NM_014974chr1011222 --1225 --
NM_014978chr1011431 163 1408 157
NM_014982chr1475205 3424 1461 1286 796 178 95 21547 1529 ----
NM_014988chr432045 1741 773 1942 126 --
NM_014990chr1431353 1272 873 ------
NM_014991chr422841 2459 23163 2311 1144 --
NM_014999chr121503 --148 --
NM_015000chr1231905 1230 366 12673 ----
NM_015002chr122568 320 1706 ----
NM_015008chr312361 --3640 574 217 --
NM_015017chr161216 810 492 358 112 36 11063 ----
NM_015020chr1643787 3494 378 241 13474 2620 178 --
NM_015025chr242504 2393 460 423 ------
NM_015026chr1284460 3678 2922 1800 1638 1328 973 670 14408 13977 --
NM_015035chr2096421 6272 5729 5607 5461 5325 4480 1207 464 ------
NM_015040chr243004 1305 1129 1103 23154 804 ----
NM_015045chr1041965 1837 1712 115 ------
NM_015049chr242467 2173 2066 464 12580 12261 --
NM_015052chr71361 1287 ----
NM_015064chr1273634 3589 3459 3299 2724 2694 43 --12957 --
NM_015071chr586014 5430 4938 4910 3991 1650 172 157 --11836 --
NM_015076chr634016 3438 695 1336 ----
NM_015090chr146218 5613 5038 1866 11857 ----
NM_015092chr1653268 3203 1572 891 819 13845 11870 --
NM_015097chr352266 1905 1683 1628 268 12197 ----
NM_015107chrX22362 661 ------
NM_015110chr941824 1542 512 367 ------
NM_015115chr43620 536 30 ------
NM_015129chrX21757 341 --1240 --
NM_015138chr1532257 2233 631 ------
NM_015143chr431326 291 93 --11212 --
NM_015149chr11819 --2384 97 --
NM_015156chr1483455 3193 2907 1456 1310 1132 946 819 --1660 --
NM_015170chr842224 1936 410 122 1165 ----
NM_015173chr471763 1398 1382 1283 702 373 311 --41362 682 501 232 --
NM_015185chrX62891 2446 2368 1175 925 835 1577 ----
NM_015186chr91453 ------
NM_015187chr42620 228 ------
NM_015192chr2072772 2415 2396 2370 1992 1170 637 --175 --
NM_015199chr342670 2530 2449 967 11092 ----
NM_015200chr442032 1600 777 150 ------
NM_015206chr1573219 3140 2989 2968 1472 581 500 23131 2503 ----
NM_015208chr1823862 1072 13495 ----
NM_015215chr163075 2149 2122 839 511 266 ------
NM_015247chr1675095 3596 1349 1313 1184 393 281 15407 ----
NM_015251chr1642010 1933 1757 616 1450 2930 790 --
NM_015265chr231748 865 281 12626 12174 --
NM_015268chr3--1500 1694 --
NM_015271chr483573 2976 2845 1086 518 474 428 109 14330 23340 794 --
NM_015272chr1641760 862 492 80 ----12028
NM_015291chr123517 2975 13098 ----
NM_015296chr1341201 816 197 126 ------
NM_015310chr8117800 7640 7301 6637 5806 5228 3096 3026 2816 2570 1497 12296 26674 2337 --
NM_015313chr1133762 885 612 33217 1087 1062 ----
NM_015328chr733043 278 269 1493 ----
NM_015336chr1232521 2441 1744 ------
NM_015344chr83475 382 341 ------
NM_015347chr1252670 2411 654 240 181 ------
NM_015349chr653067 2832 2621 2191 192 ------
NM_015355chr1741787 690 535 191 1497 ----
NM_015360chr52133 52 ------
NM_015361chr21673 --1847 --
NM_015365chrX94310 4082 4062 3941 1620 699 536 154 24 --13878 --
NM_015375chr1115043 4350 3952 3818 3616 3091 1968 1929 925 886 751 13718 ----
NM_015382chr14--1797 ----
NM_015385chr1041212 1046 372 50 13237 ----
NM_015387chr271951 1556 655 293 286 61 30 ------
NM_015396chr331098 1051 263 ------
NM_015429chr3249 33 --1269 --
NM_015436chr422328 2188 12875 ----
NM_015455chr521284 505 --21377 382 --
NM_015457chr11----1298 --
NM_015460chr342114 841 785 627 1441 ----
NM_015464chr7--1304 ----
NM_015472chr32509 149 ------
NM_015472chr32509 149 ------
NM_015483chr71866 11097 ----
NM_015484chr12909 605 1755 ----
NM_015508chr331267 465 242 ------
NM_015509chr1231350 1273 162 11501 ----
NM_015520chr342478 2210 2140 384 --22006 1057 --
NM_015525chr62435 96 1851 ----
NM_015530chr22867 612 174 ----
NM_015534chr131021 707 55 1934 1176 --
NM_015535chr263957 3924 1012 706 677 132 ------
NM_015541chr351340 1222 1206 211 89 ------
NM_015542chr1021098 783 ------
NM_015550chr772944 2930 2630 2408 2340 1164 855 --1106 --
NM_015553chr674289 3163 1995 1447 1295 987 436 11049 ----
NM_015554chr1552113 1069 1036 785 291 --11027 --
NM_015565chr2151932 1582 841 724 101 ------
NM_015569chr154810 4450 3964 2976 141 131 34056 1150 269 --
NM_015571chr612255 --12277 --
NM_015575chr263182 3061 2818 359 123 97 --1246 --
NM_015576chr352965 2187 384 329 120 --22154 796 --
NM_015601chr102786 344 ------
NM_015602chr131606 186 149 ------
NM_015605chr103977 323 195 ------
NM_015630chr25870 776 335 308 87 1177 ----
NM_015640chr1105165 5118 5018 4884 4200 4161 4099 3955 3494 3406 --24689 4038 --
NM_015641chr731276 903 255 ------
NM_015652chr102607 537 ----1577
NM_015678chr1311616 11390 11408 --
NM_015713chr883556 3296 2881 2848 2482 1163 454 207 ------
NM_015726chr131503 1470 625 --11510 11335
NM_015850chr822189 1902 --11997 --
NM_015866chr131430 1039 443 ------
NM_015878chr821534 745 ------
NM_015885chr111133 ------
NM_015888chr132926 2363 1284 ----12267
NM_015891chr632060 1978 1325 --2814 32 --
NM_015906chr153612 1594 780 651 371 34528 2963 1841 11228 --
NM_015952chr61136 ------
NM_015975chrX31661 1600 283 1409 ----
NM_015984chr11508 1392 ----
NM_015995chr1585251 4249 4190 4115 4033 3585 2034 792 24276 851 11827 15389
NM_015999chr11673 ------
NM_016009chr174674 4232 3935 3550 3414 1814 1045 --1896 13741
NM_016022chr121043 831 ------
NM_016023chr821917 1506 1521 ----
NM_016037chr121054 75 11106 ----
NM_016072chr121740 --1515 --
NM_016083chr663976 3664 2699 2627 925 876 33819 1452 1303 1137 --
NM_016090chr111250 ------
NM_016094chr3263 35 ------
NM_016096chr832066 1565 1363 1752 1585 --
NM_016097chr183443 202 56 1852 ----
NM_016099chr82521 93 1916 ----
NM_016100chr201100 ------
NM_016104chr61136 ------
NM_016107chr531112 943 528 --11012 --
NM_016120chrX4433 245 140 58 ------
NM_016127chr82524 54 --1498 1249
NM_016128chr31122 ------
NM_016131chr221840 310 11540 ----
NM_016133chr21167 11393 ----
NM_016144chr51129 --1161 --
NM_016195chr102700 101 --2728 661 --
NM_016217chr641333 1146 715 45 1557 ----
NM_016224chr621822 412 1406 ----
NM_016227chr11257 --1199 --
NM_016230chr61348 --2426 340 --
NM_016231chr17--11504 21687 1268 --
NM_016248chr1363932 3534 3525 3262 1437 154 ------
NM_016255chr643146 2418 1143 107 --1736 --
NM_016260chr297303 7257 6401 5895 4757 946 486 299 122 26095 4882 15348 11762
NM_016271chr1822207 2013 ------
NM_016275chr332636 2262 610 1298 2901 45 --
NM_016277chr651374 1314 1258 1189 1054 ------
NM_016279chr51428 ------
NM_016282chr931712 654 116 11648 ----
NM_016287chr161985 1793 1522 1476 1432 695 ------
NM_016289chr261883 1467 919 584 412 93 --12133 --
NM_016297chr263517 2644 2605 2348 1394 108 23793 3097 ----
NM_016308chr151409 1361 1293 700 169 11829 ----
NM_016315chr251328 499 472 205 69 1750 --1540
NM_016322chr923167 442 12248 1728 --
NM_016356chr682562 2474 2057 1994 1858 634 186 31 --1300 --
NM_016377chr651681 1657 1639 1189 430 --21383 1236 --
NM_016396chr1542803 916 79 23 ------
NM_016399chr121910 ------
NM_016401chr11190 1187 ----
NM_016410chr91410 1520 ----
NM_016413chr133342 91 45 --1357 --
NM_016422chr1122326 1175 1840 21005 137 --
NM_016424chr1721804 1515 ------
NM_016436chr2042547 2207 1034 448 --11760 --
NM_016442chr542324 2216 2133 650 ------
NM_016467chr2----11311 --
NM_016472chr1451311 1254 1184 568 113 41276 530 272 219 ----
NM_016485chr651392 612 377 81 57 ------
NM_016507chr172638 80 --12770 1273
NM_016513chr643647 3375 2526 1292 ------
NM_016522chr1121103 603 ------
NM_016525chr91701 1889 ----
NM_016530chr1563023 770 664 651 472 69 1520 --11412
NM_016531chr453864 3788 3264 3101 928 11376 13797 13816
NM_016542chrX1165 ------
NM_016544chr243038 1556 1211 286 ------
NM_016587chr72315 256 ------
NM_016605chr522619 2125 12109 ----
NM_016607chrX--1184 1676 --
NM_016626chr18----2574 533 --
NM_016651chr1411090 11055 ----
NM_016654chr1521211 413 ------
NM_016655chr15133 ------
NM_016824chr1031660 1484 285 1215 --175
NM_016834chr1774156 3834 3109 2957 1190 150 132 --13765 --
NM_016835chr1774156 3834 3109 2957 1190 150 132 --13765 --
NM_016841chr1774156 3834 3109 2957 1190 150 132 --13765 --
NM_016929chr663947 3586 1188 833 588 85 --13789 --
NM_016950chr431270 1207 178 ------
NM_016952chr1173296 3244 3056 2967 2646 2486 698 1109 11559 --
NM_016953chr296005 2318 2312 2135 1819 1684 1412 1246 1203 33886 1876 1866 --1896
NM_017412chr821371 1182 --11070 --
NM_017420chr1443331 2563 273 153 ------
NM_017423chr421784 323 22071 1493 ----
NM_017426chr42698 146 ------
NM_017447chr2131581 1016 188 23863 226 1534 1161
NM_017449chr1----11496 --
NM_017489chr851311 1125 967 499 175 --149 --
NM_017544chrX1296 --1399 --
NM_017548chr351497 1406 630 397 375 ------
NM_017553chr1521131 516 11146 ----
NM_017599chr1241487 806 765 300 ------
NM_017610chr1541449 1415 731 227 1398 ----
NM_017628chr444724 3795 1743 824 --1811 --
NM_017634chr861868 1650 1380 675 665 54 1730 ----
NM_017635chr1111384 11329 ----
NM_017637chr949484 9191 5947 1035 12173 13644 --
NM_017643chr1722871 964 --12946 --
NM_017644chr355196 3921 2064 1532 408 14234 13872 --
NM_017649chr101360 1291 ----
NM_017650chr765421 5226 4803 2354 2091 305 13697 25831 5271 13781
NM_017657chr2----1602 --
NM_017658chr1464630 3183 1807 1249 1066 181 ------
NM_017666chrX31701 1578 406 11914 ----
NM_017672chr1541314 476 60 21 21346 1001 ----
NM_017703chr194614 239 159 42 ------
NM_017709chr154251 3862 1494 1270 996 13008 --14224
NM_017737chr122077 551 ------
NM_017744chr162051 1886 877 757 604 104 ------
NM_017745chrX1134 ------
NM_017752chrX51434 488 390 341 145 2808 360 ----
NM_017754chr684900 4890 2006 1872 1433 1036 663 397 34239 1758 98 24917 3963 --
NM_017769chr1453049 2696 930 352 84 12887 1549 --
NM_017770chr662880 1004 727 506 456 121 ------
NM_017778chr811339 3374 318 120 ----
NM_017811chr932729 1939 1032 2866 240 ----
NM_017812chr72650 150 ------
NM_017824chr1032655 915 434 171 1621 --
NM_017847chr15598 592 552 294 28 1252 ----
NM_017848chrX33366 3257 3119 24392 3655 13397 --
NM_017851chr1521212 1037 1418 1492 --
NM_017875chr31687 ------
NM_017910chr2171 1104 ----
NM_017919chr9125332 5054 4882 4595 3783 3725 2298 2058 1848 1802 1509 1391 35643 1697 1649 ----
NM_017938chrX12154 11603 2729 591 --
NM_017958chr252803 2734 2162 807 110 ------
NM_017964chr2189 1335 ----
NM_017975chr15----1328 --
NM_017988chr122723 645 ------
NM_018011chr131447 --1203 --
NM_018017chr1021056 941 1765 ----
NM_018051chr72401 303 ------
NM_018064chr6--1245 ----
NM_018084chr253185 2649 970 367 116 ------
NM_018120chr841067 411 122 114 1544 11100 --
NM_018133chr31511 12070 21879 106 --
NM_018155chr362828 935 828 510 165 47 32873 2776 2751 ----
NM_018169chr121532 ------
NM_018178chr1293 62 ------
NM_018182chr172855 474 --1107 --
NM_018184chr3------1737
NM_018200chr1582359 2139 2039 1702 986 973 570 419 --1851 --
NM_018211chr142073 1787 1573 60 ----11559
NM_018229chr146958 909 778 761 281 104 ------
NM_018241chr42964 785 145 1369 --
NM_018243chr453957 2907 1168 992 754 24056 2562 33981 3358 2632 --
NM_018247chr672663 2362 896 738 481 393 209 ------
NM_018254chr132392 1517 91 145 ----
NM_018257chr2052551 998 521 505 83 ------
NM_018287chr102987 874 ------
NM_018293chr342624 2259 1994 1019 ----1122
NM_018299chr863336 3009 2984 2804 2418 484 33490 3190 1193 3590 171 64 --
NM_018302chr442404 2322 990 667 --22427 2076 --
NM_018312chr1131992 1345 92 --11754 --
NM_018315chr421079 505 1351 ----
NM_018323chr431893 604 292 ------
NM_018326chr71549 ------
NM_018339chr941358 1230 684 57 1293 ----
NM_018340chr16104881 4703 4031 3822 3749 3290 1872 1763 1589 429 --33568 3412 1724 --
NM_018348chr162481 119 11302 ----
NM_018351chr1274371 3777 3307 2966 1901 1468 786 1939 11693 --
NM_018362chr11113877 3490 3440 2961 2733 2560 1607 738 675 512 155 21530 1197 34015 3697 1454 --
NM_018364chr153436 1484 1013 921 832 23334 2523 22669 1538 --
NM_018373chr1465552 5112 4039 1846 1517 1338 36342 5989 4731 --12460
NM_018374chr7123904 3367 3239 1801 1720 1255 1131 1119 714 559 405 391 24633 319 ----
NM_018400chr11114095 4049 3863 3342 3190 2785 1552 1269 1134 400 106 23708 3114 ----
NM_018403chr373873 3762 3227 2982 2943 1469 1398 23997 3301 1250 --
NM_018409chr452774 2573 900 382 27 11213 --12133
NM_018434chr5169 ------
NM_018440chr8128645 6374 6335 6128 5669 5576 3418 2734 2077 2063 1352 932 25528 3361 38480 6197 5464 11206
NM_018452chr6_random33807 3164 642 ------
NM_018475chr42455 154 ------
NM_018488chr171764 ------
NM_018489chr122163 836 21660 889 ----
NM_018490chr1151235 715 515 113 100 ------
NM_018555chr1912091 --1839 11627
NM_018557chr2----151 --
NM_018566chr134553 4524 3911 24383 2033 ----
NM_018590chr1021123 129 11326 ----
NM_018602chr1561703 1497 1198 1078 620 77 ------
NM_018638chr1284564 4488 4129 3788 2273 1734 1405 474 1873 11063 --
NM_018684chrX3927 856 552 --11138 --
NM_018700chr541299 1124 1102 85 ----11558
NM_018717chr452721 2685 2242 816 311 12374 ----
NM_018723chr16188 ------
NM_018841chr143731 3341 2873 2430 --23355 1427 13811
NM_018846chr72873 177 1677 --1813
NM_018898chr5----12160 --
NM_018899chr5----12160 --
NM_018900chr5----12160 --
NM_018901chr5----12160 --
NM_018902chr5----12160 --
NM_018903chr5----12160 --
NM_018904chr5----12160 --
NM_018905chr5----12160 --
NM_018906chr5----12160 --
NM_018907chr5----12160 --
NM_018908chr5----12160 --
NM_018909chr5----12160 --
NM_018910chr5----12160 --
NM_018911chr5----12160 --
NM_018970chr72985 939 22108 315 1932 --
NM_018976chr1242274 1098 767 714 ------
NM_018979chr1222237 856 ------
NM_018999chr1064241 4134 3478 1953 197 172 14801 ----
NM_019001chr374831 3268 1792 777 574 396 320 ------
NM_019004chr742427 1877 959 943 --11637 12149
NM_019005chr71123 ------
NM_019006chr151530 --1228 --
NM_019008chr2253589 3529 1515 206 117 1999 1130 --
NM_019022chr1842968 2929 2394 2336 13162 --12304
NM_019026chr1128 ------
NM_019035chr411908 1472 ----
NM_019036chr6--169 1825 --
NM_019050chr422101 592 1216 --11612
NM_019053chr102283 156 ------
NM_019063chr231518 256 92 1236 ----
NM_019072chr584227 4154 4140 4030 2848 2803 1628 1461 11014 13581 1230
NM_019080chr1331287 1018 55 11441 ----
NM_019084chr1011817 12423 --12222
NM_019087chr51629 11548 1374 --
NM_019106chr2222690 1322 --23072 2749 12718
NM_019114chr942479 2203 631 204 21970 539 ----
NM_019117chrX53453 3115 705 598 128 22703 270 ----
NM_019556chrX41500 1328 930 536 1449 ----
NM_019610chr11382 --22163 1855 --
NM_019842chr6151 ------
NM_019903chr1031660 1484 285 1215 --175
NM_020116chr41287 ------
NM_020122chr285994 4760 3724 3685 2340 1882 161 106 --12110 --
NM_020123chr10--1238 1447 --
NM_020144chr721752 1662 ------
NM_020152chr212766 280 1207 --1190
NM_020159chr421756 236 21531 1262 ----
NM_020177chr543198 1206 1023 109 13246 22741 1215 --
NM_020184chr231973 295 278 11998 ----
NM_020186chr73522 460 401 ----1160
NM_020198chr1711424 ------
NM_020240chr551916 954 567 350 170 --2586 396 --
NM_020245chr685042 4237 4112 3817 1736 1336 996 685 34677 4074 925 ----
NM_020336chr2031319 629 98 13598 176 --
NM_020337chr452979 1974 805 545 141 ------
NM_020342chr252527 2295 2153 355 27 ------
NM_020346chr1141669 1606 358 191 1299 ----
NM_020374chr1211429 --1770 --
NM_020382chr12----1108 --
NM_020390chr331366 1191 300 44770 4547 3981 1650 1547 --
NM_020420chrY31630 1335 54 11447 ----
NM_020443chr166294 6005 5870 2301 1708 1392 25278 1562 12038 --
NM_020449chrX2512 183 --1573 --
NM_020455chr642728 2012 1775 885 1329 21925 1890 --
NM_020463chr231258 1167 398 1486 ----
NM_020482chr61313 148 1675 1858
NM_020651chr2----11579 --
NM_020673chr20107745 6556 6386 6367 6350 6235 6099 5723 5307 435 14821 ----
NM_020686chr1642776 1198 1044 416 ------
NM_020689chr2031488 1327 426 --11481 --
NM_020718chr16156449 6302 6277 5424 5146 5131 4725 4622 4506 4374 2095 2057 1437 940 803 1834 14444 --
NM_020728chr742844 461 326 173 ------
NM_020734chr1222590 2247 ------
NM_020739chr1563002 2644 1599 1387 1132 279 13691 1168 --
NM_020742chrX21793 842 --11916 --
NM_020752chr1012004 11088 ----
NM_020760chr211998 31468 1266 669 11530 --
NM_020766chrX54419 4271 1260 351 147 21789 1249 33787 3387 852 --
NM_020771chr641397 1268 1088 135 ------
NM_020772chr1758181 7930 7443 2571 1895 45733 1276 1188 935 ----
NM_020774chr1884339 4049 2279 2217 1901 1660 1274 663 25972 4833 1861 --
NM_020777chr412524 ------
NM_020782chr1241484 273 159 113 24535 385 13330 --
NM_020783chr1832132 1651 241 ------
NM_020794chr121593 1488 21109 1002 ----
NM_020801chr572354 2266 2034 852 829 150 106 1363 ----
NM_020806chr14145 ----1858
NM_020809chr1141922 928 568 116 ------
NM_020810chr1472427 2408 1403 1245 884 852 136 13029 11340 --
NM_020819chr61229 ------
NM_020824chr103284 271 123 1157 ----
NM_020826chr1173467 3166 2666 2490 1446 1018 194 12929 ----
NM_020830chr232705 2190 231 --12381 --
NM_020834chr14----21897 524 --
NM_020841chr1222680 510 ------
NM_020854chr1831343 490 157 --1412 --
NM_020858chr1531791 966 470 12436 11825 --
NM_020859chr473974 2713 1422 807 781 562 228 22926 2502 2285 32 1505
NM_020860chr42227 216 ------
NM_020865chr3153 ------
NM_020870chr442192 1713 864 32 ----12079
NM_020871chrX52502 2344 2245 1805 110 ------
NM_020873chr31849 1232 ----
NM_020918chr1032666 577 328 13550 ----
NM_020922chrX41769 1667 581 167 --11467 --
NM_020935chr283942 3805 1612 1606 1567 1399 1285 602 31434 1392 812 --13968
NM_020937chr14165 --1187 --
NM_020948chr132520 1350 1335 ------
NM_020951chr1972058 1980 1898 1769 1596 447 326 --11705 --
NM_020977chr411765 ------
NM_020987chr1041222 1171 218 25 1395 ----
NM_021005chr151251 ------
NM_021007chr221823 418 22335 1639 ----
NM_021032chr332024 810 349 22060 1739 ----
NM_021033chr1332524 1316 823 23332 2581 11221 --
NM_021038chr323344 2076 ----12744
NM_021072chr522105 1735 3609 463 251 ----
NM_021083chrX73334 2827 2627 2344 1275 467 255 ----1442
NM_021097chr242962 2036 1916 481 23007 453 12474 12207
NM_021127chr1851399 1356 567 328 189 ----1550
NM_021145chr71932 ------
NM_021148chr752407 2258 2165 969 224 ------
NM_021180chr11713 ------
NM_021183chrX62595 2362 2180 1932 1685 563 --11940 --
NM_021190chr12463 144 ------
NM_021239chr1421085 225 --11388 --
NM_021245chr10128 ------
NM_021252chr1041989 1817 367 355 ------
NM_021255chr1473963 3717 3484 2985 2569 1561 1277 --22544 1649 --
NM_021622chr1052245 1868 1611 1457 697 1874 ----
NM_021629chr354080 3601 3376 3248 572 2976 688 11775 --
NM_021728chr141744 --2922 231 --
NM_021813chr625577 4626 15865 ----
NM_021814chr621724 356 11708 ----
NM_021821chr123838 611 96 --1155 --
NM_021911chr575438 5034 4162 2142 2022 1145 446 1891 14428 --
NM_021912chr15113836 3619 3439 3378 2952 2689 1351 976 843 508 54 ------
NM_021914chr1422291 145 1932 12275 --
NM_021940chr62491 192 ------
NM_021947chr172402 327 11327 ----
NM_021954chr1393671 3158 3067 2851 2839 2816 2754 1397 1182 32793 2335 1481 ----
NM_021961chr1197516 7350 6342 6323 5085 2840 1270 192 132 16558 ----
NM_021963chrX1713 --1730 --
NM_021964chr3106668 5311 5077 4567 4442 2440 826 701 641 224 15042 ----
NM_021992chrX1404 ------
NM_021999chr131281 ------
NM_022037chr21150 ------
NM_022048chr1566376 5885 5049 4969 2462 2100 12280 ----
NM_022079chr102786 344 ------
NM_022133chr811647 --11459 --
NM_022166chr1615876 --14287 --
NM_022173chr21150 ------
NM_022444chr741940 1920 1745 435 ------
NM_022474chr1422204 1813 1397 ----
NM_022476chr161185 --1438 --
NM_022477chr2031691 1365 146 ------
NM_022482chr2041688 1585 898 294 --11719 --
NM_022494chr10143 164 ----
NM_022497chr34938 878 829 543 13133 22586 66 --
NM_022550chr52361 156 ------
NM_022557chr171244 ------
NM_022640chr171242 ------
NM_022726chr64682 659 355 325 2392 248 --11421
NM_022763chr352549 2440 1239 532 372 21211 827 ----
NM_022771chr12193 11090 ----
NM_022776chr311229 ------
NM_022781chr943193 3102 2606 300 --2766 278 --
NM_022802chr102122 25 21388 464 ----
NM_022824chr511811 --133 --
NM_022826chr23853 477 72 --1327 --
NM_022828chr5--1418 ----
NM_022836chr131376 667 529 ----11442
NM_022843chr1321531 1209 --11307 --
NM_022845chr1652150 2044 1783 751 380 11416 ----
NM_022893chr22902 707 12955 ----
NM_022894chr251388 671 398 218 38 11361 ----
NM_022898chr1454524 4322 3192 3178 1119 ------
NM_022918chr1142114 1499 414 329 --21573 225 --
NM_022977chrX22400 104 ------
NM_023000chr1421553 1544 ----11090
NM_023001chr1421553 1544 ----11090
NM_023016chr242163 1909 1869 643 ----12322
NM_023071chr1231106 889 111 ----1757
NM_023074chr1951355 1330 922 191 23 ------
NM_023105chr822189 1902 --11997 --
NM_023106chr822189 1902 --11997 --
NM_023110chr822189 1902 --11997 --
NM_023111chr822189 1902 --11997 --
NM_023927chr521328 1064 ------
NM_023929chr842349 2173 389 211 ------
NM_024007chr532293 704 310 12169 ----
NM_024052chr172356 294 12954 --1672
NM_024080chr22832 47 12103 11371 --
NM_024408chr143407 2759 2560 711 --1546 --
NM_024423chr1824117 2845 23484 607 23855 3374 13516
NM_024424chr1141190 1114 815 304 ------
NM_024425chr1141190 1114 815 304 ------
NM_024426chr1141190 1114 815 304 ------
NM_024482chr1168 ------
NM_024525chr12141 99 ------
NM_024574chr42360 55 ------
NM_024595chr121209 1170 --11033 1484
NM_024596chr873834 1118 838 592 522 508 356 14145 1984 --
NM_024607chr874323 4096 4026 1775 1184 1009 181 --12738 --
NM_024611chr1562806 2659 2464 1440 1273 1055 --1578 --
NM_024613chr821747 1190 ------
NM_024617chr91914 ------
NM_024635chr91273 ------
NM_024639chr622207 1948 22549 2415 1252 --
NM_024641chr63972 873 539 22988 2221 ----
NM_024645chr821055 988 --1619 1479
NM_024646chr193834 3345 2927 2793 2425 1209 516 497 216 23505 3372 ----
NM_024665chr354403 3890 3536 3088 1077 43697 3271 1683 1407 ----
NM_024674chr193180 3114 2873 2664 2625 2498 2490 2355 848 ------
NM_024692chr221436 414 1450 --1650
NM_024715chr541862 1483 1378 126 --21657 770 --
NM_024740chr11123675 3559 3360 3250 3198 3062 2734 2559 1576 1327 1230 1048 ------
NM_024745chr1621023 62 --1745 --
NM_024757chr91745 ------
NM_024770chr286128 5476 4755 2636 2565 2109 1972 1693 14831 1838 --
NM_024817chr1585357 5232 4773 4372 4125 4071 1823 35 15130 ----
NM_024852chr1--1191 ----
NM_024884chr1443092 2860 1194 1058 --2739 510 --
NM_024896chr942506 1658 426 109 12243 22197 474 --
NM_024899chr183642 625 63 ------
NM_024900chr452169 2036 1845 1759 637 12373 ----
NM_024900chr452169 2036 1845 1759 637 12373 ----
NM_024911chr11806 --1251 --
NM_024913chr731546 1431 550 11771 ----
NM_024920chr411021 --1345 --
NM_024930chr552478 1929 1804 871 761 2562 349 ----
NM_024947chr3149040 8037 7886 7692 7571 6656 6456 6067 3424 3073 2260 1985 1700 689 26924 314 39562 8187 7643 --
NM_024953chr1212488 12633 ----
NM_024969chr22603 77 ------
NM_024989chr277768 6734 2802 2447 1971 1171 213 16213 11121 1250
NM_024991chr1041212 1046 372 50 13237 ----
NM_024993chr221549 1110 181 21306 1099 11202
NM_024996chr32757 260 ------
NM_025054chr823964 3817 --13012 --
NM_025073chr144221 4206 3997 885 ------
NM_025074chr422272 37 ------
NM_025146chr31995 12103 --1897
NM_025151chr831982 736 170 ------
NM_025158chr52484 464 --1124 --
NM_025160chr123604 1602 --12884 --
NM_025191chr153524 3038 2585 898 869 --1278 --
NM_025222chr362842 2312 2167 1889 240 169 --191 --
NM_025235chr1031915 1871 1481 ----21653 753
NM_030621chr1434199 2580 812 24053 3885 23666 3398 --
NM_030623chr231310 1069 53 --126 --
NM_030625chr1072457 2154 2134 713 567 482 277 ------
NM_030627chr563023 2944 2928 2911 1037 177 11517 ----
NM_030637chr142588 199 ------
NM_030647chr796229 5104 4282 2506 1652 1255 728 692 603 ------
NM_030648chr484381 3931 3679 3632 1292 1109 668 167 1439 11895 11070
NM_030650chr264067 3901 3892 2906 1395 114 ------
NM_030664chr1022334 1706 1754 1112 --
NM_030751chr102628 381 ------
NM_030751chr102628 381 ------
NM_030762chr121758 11893 ----
NM_030773chr2021762 1472 11794 ----
NM_030791chr1431488 1446 155 1507 ----
NM_030795chr82523 513 ------
NM_030799chr542138 834 627 453 --11380 --
NM_030806chr1118494 7448 7079 6164 6051 5913 3577 2928 2152 710 703 ------
NM_030816chr143577 3396 3026 1156 --11084 --
NM_030817chr1293394 3095 2724 2714 2628 2492 1109 747 171 1813 ----
NM_030920chr151808 786 180 150 54 --1309 --
NM_030934chr121664 253 11494 ----
NM_030939chr61159 ------
NM_030940chr941493 1205 325 192 --1206 1309
NM_030953chr531575 496 333 --31655 1136 257 11330
NM_030959chr62709 47 ------
NM_031208chr162977 743 ------
NM_031296chr482741 2461 2132 1980 1066 1052 919 164 32495 2206 741 ----
NM_031314chr14----11582 --
NM_031411chr5----12160 --
NM_031419chr341521 1379 1290 1081 ------
NM_031427chr14125795 5785 5585 5523 4651 3896 3637 2309 1718 1582 1449 1434 --45704 4192 720 125 11242
NM_031439chr841758 1726 1201 780 --11743 --
NM_031442chrX33127 757 52 22412 2388 11144 --
NM_031445chr293416 2629 2569 1249 797 505 272 101 58 --1719 13002
NM_031461chr852174 1532 742 677 80 ------
NM_031469chr644096 3255 1577 82 --23567 3158 --
NM_031483chr2043431 1219 619 544 ------
NM_031849chr5----12160 --
NM_031857chr5----12160 --
NM_031860chr5----12160 --
NM_031866chr102907 863 11079 ----
NM_032013chr2031691 1365 146 ------
NM_032021chr1141213 1057 197 161 ------
NM_032042chr532104 831 682 22171 1812 ----
NM_032047chr332371 167 34 --12254 11724
NM_032102chr1172947 2249 2210 2075 860 237 54 ----12563
NM_032121chrX32746 2353 135 12037 ----
NM_032145chr61111 1455 11274 11346
NM_032149chr41167 ------
NM_032154chr102862 803 ------
NM_032160chr1884315 4043 3879 3746 844 811 788 522 12795 ----
NM_032181chr2------1362
NM_032199chr1033801 2461 564 --1249 --
NM_032217chr431244 224 88 ------
NM_032221chr2021679 113 ----1512
NM_032228chr1163325 2785 2513 1166 596 517 ------
NM_032229chr132377 235 --1161 --
NM_032231chr15--1335 ----
NM_032236chr121031 902 --1973 --
NM_032352chr14------11267
NM_032373chr1045615 5442 4260 733 22329 849 13951 14385
NM_032379chr112898 160 ------
NM_032383chr31351 21245 410 ----
NM_032410chr821249 1200 11008 1810 --
NM_032423chr1951519 1386 1152 154 136 ------
NM_032424chr1121455 1375 1466 11388 --
NM_032438chr62651 137 ------
NM_032440chr106941 712 427 69 55 24 12307 12455 --
NM_032445chr1551985 1759 1615 811 557 --1391 --
NM_032457chr493718 3625 3555 3227 1205 1144 852 740 400 23791 1390 ----
NM_032458chrX22713 2162 --12087 --
NM_032466chr841293 1129 660 93 21285 501 ----
NM_032468chr841293 1129 660 93 21285 501 ----
NM_032482chr1921988 212 ------
NM_032505chr362631 1989 1846 1827 243 27 1408 ----
NM_032521chr2042278 1975 1133 550 13171 22290 306 12821
NM_032523chr21584 ------
NM_032547chr4----143 --
NM_032564chr11147 --1971 --
NM_032574chr2----180 --
NM_032582chr1741839 484 175 79 ------
NM_032595chr171481 ------
NM_032622chr42222 132 1504 1489 --
NM_032626chr163117 48 22 ------
NM_032632chr1431485 353 237 ------
NM_032663chr1212078 --11461 --
NM_032689chr1961561 1513 1277 1026 529 364 ------
NM_032737chr1922417 65 ------
NM_032765chr5----1260 --
NM_032778chr343287 2897 708 280 --12768 --
NM_032858chr1178 2234 98 1308 --
NM_032859chr1383379 3215 2961 2941 2911 1008 913 719 ------
NM_032873chr1153579 3269 3024 2972 1714 1540 24288 1764 --
NM_032943chr112898 160 ------
NM_032961chr441094 963 375 292 ----11067
NM_032967chrX21020 339 ----180
NM_032968chrX43490 924 844 318 13007 ----
NM_032969chrX43490 924 844 318 13007 ----
NM_032971chrY31047 663 366 ----1107
NM_032972chrY31047 663 366 ----1107
NM_032973chrY43486 924 844 318 13002 ----
NM_033020chr153612 1594 780 651 371 34528 2963 1841 11228 --
NM_033028chr153864 820 809 ------
NM_033030chr231309 552 418 11529 ----
NM_033081chr2031427 264 121 11143 --1920
NM_033083chr312950 ----13427
NM_033138chr732016 550 263 1153 12238 11968
NM_033139chr732016 550 263 1153 12238 11968
NM_033140chr732016 550 263 1153 12238 11968
NM_033143chr474598 4534 2941 1697 1455 831 414 ------
NM_033157chr732016 550 263 1153 12238 11968
NM_033181chr663976 3664 2699 2627 925 876 33819 1452 1303 1137 --
NM_033211chr521284 194 ----11664
NM_033224chr777394 6729 5580 5308 1479 1221 1059 26472 3005 17156 --
NM_033225chr81983 11965 ----
NM_033227chr51477 --1611 --
NM_033228chr51517 1407 1651 --
NM_033290chrX83797 3688 3624 2809 2438 1071 280 263 12323 ----
NM_033300chr11335 ------
NM_033331chr943385 3164 444 330 13017 ----
NM_033337chr31614 --1246 --
NM_033360chr1274486 3597 3020 2943 1690 1621 1344 33193 807 517 2698 409 --
NM_033364chr311458 --11367 --
NM_033389chr1773583 3467 1441 1199 1114 938 215 --13203 --
NM_033406chr11------1369
NM_033425chr1153385 3195 2899 1110 359 --21084 40 --
NM_033429chr1543173 2493 2397 323 --11103 --
NM_033430chr4104061 4005 3631 3542 3437 2569 1638 740 683 641 23847 1452 --12819
NM_033437chr4104061 4005 3631 3542 3437 2569 1638 740 683 641 23847 1452 --12819
NM_033480chr662272 949 797 622 519 26 --11831 --
NM_033481chr662272 949 797 622 519 26 --11831 --
NM_033505chr2106621 6482 6271 5330 5207 4571 1984 1498 677 480 24955 2363 15489 --
NM_033624chr122568 320 1706 ----
NM_033632chr421079 505 1351 ----
NM_033656chr2165377 4556 4247 1973 638 317 --25608 564 --
NM_044472chr1------1262
NM_052827chr121839 ------
NM_052840chr151329 ------
NM_052851chr1341803 1738 681 245 1848 11781 --
NM_052855chr172135 22 ------
NM_052867chr1341134 1041 262 189 ------
NM_052879chr121428 ------
NM_052885chr12114999 4546 4380 4030 3884 3010 1493 1484 1477 1422 810 1893 ----
NM_052898chr831673 1595 135 21279 323 11815 --
NM_052904chr631379 1329 977 11164 ----
NM_052910chr13--11791 ----
NM_052932chr1132042 325 294 1452 11632 --
NM_052937chr852711 2143 1737 471 125 --12069 11710
NM_052958chr8194 --1257 --
NM_052978chr1421251 347 ------
NM_053002chr311028 --1745 --
NM_053016chr9137491 7289 6216 5505 5245 3185 2666 2560 2080 1049 915 563 253 27441 2485 36785 2069 1447 --
NM_053024chr331053 580 380 --1463 1613
NM_053043chr795461 4108 1971 1791 1452 1055 862 611 325 ------
NM_053064chr1442078 578 462 255 12134 22386 899 --
NM_058241chr2--1591 1900 --
NM_058241chr2--1591 1900 --
NM_078469chr1031214 913 252 1520 --1279
NM_078625chr63971 952 862 162 11092 --
NM_079420chr2197 ------
NM_079422chr2197 ------
NM_080546chr942238 1861 1414 501 11514 ----
NM_080599chr1021098 783 ------
NM_080617chr202693 79 --2290 68 --
NM_080629chr121130 1098 ------
NM_080630chr121130 1098 ------
NM_080738chr121661 1632 ------
NM_080867chr1464954 4785 4759 3831 3436 678 --33507 1879 719 1632
NM_080872chr833740 1345 1180 13403 22625 447 --
NM_080874chr43594 175 113 1271 11795 11425
NM_130386chr181119 ------
NM_130391chr933063 701 581 12341 12392 --
NM_130392chr933063 701 581 12341 12392 --
NM_130393chr933063 701 581 12341 12392 --
NM_130434chr1521096 87 1248 ----
NM_130435chr1042829 2722 2289 271 ----12553
NM_130439chr1021504 618 11984 ----
NM_130439chr1021504 618 11984 ----
NM_130798chr1521381 26 ------
NM_130809chr572916 2897 2743 2268 1092 952 114 1492 ----
NM_130811chr201819 11123 ----
NM_130838chr1561535 1261 1150 560 351 332 --11472 --
NM_130839chr1561535 1261 1150 560 351 332 --11472 --
NM_133264chr1743245 851 832 412 12735 23513 3163 --
NM_133265chrX2961 50 11379 1338 --
NM_133329chr221722 268 11895 ----
NM_133334chr455547 5341 4143 1043 78 --15119 --
NM_133370chr483240 3048 3033 2572 2430 1367 1034 530 --13577 --
NM_133372chr532073 1937 680 12308 22773 315 --
NM_133468chr732340 2235 163 1636 ----
NM_133493chr654243 4075 884 592 292 13910 ----
NM_133496chr164188 3473 1193 944 459 430 24317 102 ----
NM_133503chr12--1535 ----
NM_133504chr12--1535 ----
NM_133505chr12--1535 ----
NM_133506chr12--1535 ----
NM_133507chr12--2713 606 ----
NM_133631chr351339 1263 643 145 44 ------
NM_133638chr541436 1351 96 24 ----1272
NM_133645chr61479 ------
NM_133646chr265324 4708 3981 3845 1725 358 --24353 1839 11534
NM_133647chr1543174 3055 2786 1418 176 13435 --
NM_134447chr191418 ------
NM_138286chr1984307 3882 3492 1693 1378 1244 1094 261 ------
NM_138288chr1432162 1673 1361 21882 363 --1801
NM_138316chr1021288 388 ------
NM_138357chr1021809 686 1459 11404 --
NM_138423chr1562318 2052 2026 1551 545 51 ------
NM_138426chr72755 604 12012 ----
NM_138444chr1364935 4318 4016 3247 880 61 24674 4457 11373 --
NM_138468chr2125433 5269 4449 3914 2538 2101 2095 2065 1997 1964 1417 1236 ----11119
NM_138473chr1244625 4204 3947 1418 13311 2748 378 --
NM_138576chr1454524 4322 3192 3178 1119 ------
NM_138621chr252757 2671 1024 736 490 14028 13573 --
NM_138633chr651681 1657 1639 1189 430 --21383 1236 --
NM_138638chr1422291 145 1932 12275 --
NM_138713chr16126830 6030 5826 5682 5220 5047 2949 2794 1263 1148 865 76 15411 23274 1216 --
NM_138714chr16126830 6030 5826 5682 5220 5047 2949 2794 1263 1148 865 76 15411 23274 1216 --
NM_138715chr881589 1356 399 348 277 187 129 35 41904 1892 1816 1810 ----
NM_138727chr162051 1886 877 757 604 104 ------
NM_138728chr162051 1886 877 757 604 104 ------
NM_138731chr1443340 1373 338 34 14070 --1308
NM_138735chr221446 969 ------
NM_138773chr51843 1900 ----
NM_138927chr211175 ------
NM_138931chr31273 ------
NM_138959chr186500 5962 5858 5693 4210 2216 1102 547 11690 ----
NM_138969chr8--11412 ----
NM_138970chr1412374 12056 ----
NM_138971chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_138971chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_138972chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_138972chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_138973chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_138973chr1173501 3349 2750 2621 1328 243 64 --23436 2961 --
NM_139057chr1542917 2537 2408 307 12613 ----
NM_139062chr171463 ------
NM_139070chr5----1236 --
NM_139135chr111279 ------
NM_139136chr123858 439 402 1699 ----
NM_139168chr561824 1761 1729 1708 1323 721 --11513 --
NM_139207chr1231630 753 417 ------
NM_139323chr2061468 1291 468 383 191 35 --1246 --
NM_144498chr2021409 220 --21970 584 --
NM_144571chr475409 5321 4518 2044 669 197 167 --14320 --
NM_144574chr141164 ------
NM_144578chr1465300 4519 3693 2159 388 210 15274 --14327
NM_144582chr262399 2309 2190 1850 1624 951 --22511 1971 --
NM_144583chr251368 1273 662 558 527 1362 ----
NM_144599chr1584928 4423 3964 2093 1991 810 671 92 --1380 --
NM_144633chr321290 469 11527 ----
NM_144778chr1362218 2016 1830 1090 1010 465 31993 1695 1044 ----
NM_144967chrX2818 811 11071 11004 --
NM_144973chr1294630 4401 3599 3249 1853 1691 572 254 88 1566 13345 --
NM_144974chr133859 687 49 ------
NM_144978chr21105 ------
NM_145024chr16--162 ----
NM_145037chr31541 --21501 1154 --
NM_145049chr51815 174 ----
NM_145055chr1843628 3435 2778 175 11420 ----
NM_145115chr732357 1664 30 --1810 --
NM_145203chr131371 ------
NM_145206chr10277 67 12889 23111 674 --
NM_145243chr1153 ------
NM_145263chr42388 255 ------
NM_145284chrX62465 2016 1913 1687 598 133 --12479 --
NM_145307chr1043702 3638 1602 985 13549 14547 --
NM_145320chr772944 2930 2630 2408 2340 1164 855 --1106 --
NM_145321chr772944 2930 2630 2408 2340 1164 855 --1106 --
NM_145322chr772944 2930 2630 2408 2340 1164 855 --1106 --
NM_145330chr22116 37 ------
NM_145331chr6----1826 --
NM_145332chr6----1974 --
NM_145333chr6----1974 --
NM_145341chr1041767 1751 355 284 --11492 --
NM_145686chr213393 --124 --
NM_145687chr213393 --124 --
NM_145690chr831477 1387 736 --1380 --
NM_145693chr252537 2469 2061 1576 110 1808 ----
NM_145698chr1031351 776 100 21962 595 1293 --
NM_145739chr21584 ------
NM_145793chr105351 342 330 321 309 ------
NM_145861chr121661 1632 ------
NM_145891chr1631090 538 88 ------
NM_145892chr1631090 538 88 ------
NM_145893chr1631212 660 210 ------
NM_147175chrX1798 ----11865
NM_148174chr821534 745 ------
NM_148955chr1596492 4503 2573 2156 1999 1904 1582 1457 392 1739 ----
NM_148957chr1342655 2574 2078 1695 12613 ----
NM_148977chr1021288 388 ------
NM_148978chr1021288 388 ------
NM_152221chr2221139 901 ------
NM_152261chr121592 21873 830 ----
NM_152277chr511665 ----1840
NM_152280chr162645 2194 821 717 496 361 --13163 --
NM_152291chr41105 21051 127 ----
NM_152292chr432054 1622 611 ----12168
NM_152305chr361918 1731 1491 453 325 303 12163 1507 --
NM_152330chr1472581 2468 2146 2048 1838 1015 79 --11950 --
NM_152344chr17--1203 ----
NM_152388chr253786 3681 3052 2494 659 13514 ----
NM_152389chr2--11169 --1541
NM_152392chr2126 ------
NM_152400chr45716 684 609 171 150 ----11517
NM_152402chr44720 672 242 204 1646 ----
NM_152407chr552846 2174 2079 741 561 22112 1196 23248 444 --
NM_152409chr533161 2706 236 2845 283 2956 434 --
NM_152420chr92691 571 ------
NM_152436chr122887 361 ------
NM_152437chr1282486 2242 2162 2088 1979 691 449 303 22214 905 1978 --
NM_152441chr122601 109 2613 457 ----
NM_152446chr142343 195 --1709 --
NM_152448chr152503 155 ------
NM_152523chr22612 555 ------
NM_152529chr2124461 4399 4092 3883 3291 3117 1735 1455 1449 961 544 406 21573 1048 11252 --
NM_152538chr331693 1237 717 --21425 1251 --
NM_152556chr742472 2439 2277 2149 ------
NM_152570chr9121 175 ----
NM_152588chr1221807 635 --11272 1132
NM_152594chr1552180 1741 1580 458 107 ------
NM_152608chr152352 1655 1642 980 749 11992 11698 --
NM_152622chr512982 ------
NM_152629chr953861 3054 3017 2678 1181 32638 697 180 --11508
NM_152630chrX----11008 --
NM_152636chr1173113 2525 2494 2368 2037 329 230 ------
NM_152653chr33733 559 549 1578 ----
NM_152665chr111169 --1997 --
NM_152673chr363717 1387 907 773 568 285 14376 14416 --
NM_152678chr372644 2333 2092 1762 1009 970 173 --2835 570 --
NM_152682chr441557 624 477 462 171 ----
NM_152688chr61741 --1135 --
NM_152734chr664926 3911 3751 3394 1739 447 --11915 --
NM_152737chr621386 481 31511 1463 603 ----
NM_152739chr71722 ------
NM_152745chr72733 80 ----1789
NM_152754chr773601 3516 3254 3207 3047 2955 414 ------
NM_152756chr531267 828 740 --14114 13182
NM_152758chr832766 2397 889 ------
NM_152826chr1596492 4503 2573 2156 1999 1904 1582 1457 392 1739 ----
NM_152829chr731276 903 255 ------
NM_152835chr172590 2056 1964 1828 1141 1050 646 --11038 --
NM_152836chr811647 --11459 --
NM_152837chr811647 --11459 --
NM_152871chr102507 110 ------
NM_152872chr101430 21057 270 ----
NM_152875chr101547 21174 387 ----
NM_152876chr101547 21174 387 ----
NM_152896chr91322 ------
NM_152902chr122061 397 11272 11826 --
NM_152919chr1973801 3574 3499 3408 3033 1099 1027 --2504 254 --
NM_152924chr15126818 6549 6149 6126 5991 5842 5615 5440 5253 4831 4815 4425 11879 16800 26861 5207
NM_152989chr1231849 1751 1328 ------
NM_152994chr21417 1565 ----
NM_152996chr121433 30 21929 1844 1625 --
NM_152999chr744939 3436 1284 1215 14882 ----
NM_153013chr542250 1923 1791 395 --130 --
NM_153042chr63693 386 156 ------
NM_153182chr343287 2897 708 280 --12768 --
NM_153184chr32179 168 ----1295
NM_153188chr575682 5601 5253 5107 4660 686 178 14893 ----
NM_153207chr1293279 3271 2910 1624 966 851 658 210 57 ------
NM_153235chr622146 1897 1722 ----
NM_153259chr141099 944 928 694 --21004 300 --
NM_153260chr1521151 978 21481 266 ----
NM_153262chr142664 704 228 60 ------
NM_153267chr91138 1671 1232 --
NM_153321chr171874 2844 711 ----
NM_153322chr171874 2844 711 ----
NM_153331chr31480 1253 ----
NM_153332chr82807 694 1378 22731 24 --
NM_153365chr462735 2620 2398 832 656 265 --12024 --
NM_153607chr51262 ----13050
NM_153616chr1531791 966 470 12436 11825 --
NM_153617chr1531791 966 470 12436 11825 --
NM_153618chr1531791 966 470 12436 11825 --
NM_153619chr1533029 623 590 23674 803 13063 --
NM_153645chr2273093 2742 2151 2076 1228 1119 571 ------
NM_153649chr142232 1667 1530 738 ----11923
NM_153686chr432031 493 134 1122 1184 12422
NM_153687chr1211064 2290 35 ----
NM_153689chr222379 455 1827 ----
NM_153748chr123858 439 402 1699 ----
NM_170662chr31457 1623 ----
NM_170709chr852394 829 790 655 479 --21809 579 --
NM_170724chr61977 ------
NM_171998chrX72274 2247 1875 1688 1560 1013 946 ------
NM_172069chr252349 2081 1588 642 246 1561 ----
NM_172070chr232171 1483 33 1758 12153 11829
NM_172071chr156661 4954 4556 2705 2423 24916 1091 21073 744 1606
NM_172110chr201507 ------
NM_172111chr201507 ------
NM_172112chr201507 ------
NM_172113chr201507 ------
NM_172127chr482035 1940 1510 1354 699 683 589 260 ----11639
NM_172128chr481991 1896 1466 1310 655 639 545 216 ----11595
NM_172159chr332377 1516 90 --11723 11655
NM_172160chr332377 1516 90 --11723 11655
NM_172193chr1441326 315 290 120 11072 ----
NM_172238chr6167 ------
NM_172337chr141744 --2922 231 --
NM_172344chr221722 268 11895 ----
NM_172354chr1--21648 37 ----
NM_172373chr131461 11260 21159 1073 --
NM_173082chr61434 1585 154 --
NM_173177chr21494 ----1165
NM_173198chr93859 553 85 ------
NM_173200chr93859 553 85 ------
NM_173214chr16126830 6030 5826 5682 5220 5047 2949 2794 1263 1148 865 76 15411 23274 1216 --
NM_173468chr4105665 4995 4853 4803 4647 3957 3738 2184 1951 1017 23935 1875 11143 1459
NM_173470chrX2815 598 22195 166 ----
NM_173495chrX82415 2281 2083 1809 1750 1727 797 603 ------
NM_173511chr253206 3190 1537 1330 991 --155 --
NM_173519chr812082 11382 --2832 639
NM_173552chr322335 165 ------
NM_173554chr102270 94 ------
NM_173560chr62405 131 163 ----
NM_173576chr1052287 393 370 351 136 ------
NM_173582chr1185714 5328 5289 5154 1684 1531 1296 1228 15891 ----
NM_173602chr1263521 3339 3197 2690 2433 505 22831 242 ----
NM_173632chr19103381 3133 2424 2199 1128 912 444 223 139 57 22556 374 ----
NM_173642chr1137551 6873 6619 6023 3409 3281 2765 2683 2347 1538 1462 1373 893 17599 28880 6642 --
NM_173644chr2051872 1866 1605 1565 567 ------
NM_173683chr821489 1320 --1390 --
NM_173694chrX52441 2196 773 477 451 ------
NM_173808chr164420 3018 1160 911 244 124 11069 ----
NM_173809chr1021119 1002 ----1342
NM_173822chr22516 441 --2434 98 --
NM_173829chr584851 3815 3776 2437 2035 2019 601 253 14214 ----
NM_173851chr843736 3288 1611 652 13775 13481 --
NM_174916chr1532030 1979 871 --1398 --
NM_174937chr103490 255 64 --2538 154 --
NM_174963chr12326 296 ------
NM_174964chr12326 296 ------
NM_174965chr12345 315 ------
NM_174966chr12326 296 ------
NM_174967chr12345 315 ------
NM_174968chr12326 296 ------
NM_174969chr12326 296 ------
NM_174970chr12345 315 ------
NM_174971chr12326 296 ------
NM_175061chr71215 11980 ----
NM_175607chr32450 109 ------
NM_175612chr32450 109 ------
NM_175736chr12117869 7841 7236 7068 6677 6364 5392 1906 1636 1146 239 --26659 1627 --
NM_175767chr531492 1330 613 --11795 1114
NM_175856chr51234 ------
NM_175861chr1285745 5135 4223 4213 2282 2176 2079 1746 21487 732 ----
NM_175866chr131404 376 308 ------
NM_175921chr553507 3054 1435 535 301 31327 564 252 --13490
NM_176823chr193865 3843 3371 2737 1111 1041 665 326 166 12436 ----
NM_176863chr1722119 1373 ------
NM_177398chr141745 1711 775 742 1245 21654 65 --
NM_177399chr141745 1711 775 742 1245 21654 65 --
NM_177422chr1--1191 ----
NM_177424chr142012 1888 115 78 ------
NM_177438chr1434199 2580 812 24053 3885 23666 3398 --
NM_177538chr2288694 8567 8066 7984 7564 7260 6743 6704 6570 6372 6058 5756 3522 2922 2748 2471 2044 1908 1749 1710 1438 1336 994 715 578 442 94 23 --32432 1397 205 --
NM_177947chrX--1184 1676 --
NM_177948chrX--1184 1676 --
NM_177966chr341264 1214 597 462 ------
NM_177968chr242130 1957 876 149 21731 134 11405 --
NM_177972chr1164113 3865 3639 2940 1203 892 24095 4074 ----
NM_177974chr1562318 2052 2026 1551 545 51 ------
NM_177985chr252250 1800 907 862 644 21749 791 11946 --
NM_178006chr1341803 1738 681 245 1848 11781 --
NM_178007chr1341803 1738 681 245 1848 11781 --
NM_178010chr1231849 1751 1328 ------
NM_178011chr1031249 1172 861 ------
NM_178037chr1273634 3589 3459 3299 2724 2694 43 --12957 --
NM_178038chr1273634 3589 3459 3299 2724 2694 43 --12957 --
NM_178123chr22936 174 ------
NM_178151chrX117226 6703 6471 5192 5049 4888 3094 3010 1108 814 49 27473 5454 27141 1376 --
NM_178152chrX117226 6703 6471 5192 5049 4888 3094 3010 1108 814 49 27473 5454 27141 1376 --
NM_178153chrX117226 6703 6471 5192 5049 4888 3094 3010 1108 814 49 27473 5454 27141 1376 --
NM_178154chr141763 1592 ----
NM_178155chr141763 1592 ----
NM_178156chr141763 1592 ----
NM_178157chr141763 1592 ----
NM_178313chr242126 2119 608 286 22061 1499 ----
NM_178423chr751131 1025 1004 973 43 ------
NM_178424chr52590 262 ------
NM_178425chr751131 1025 1004 973 43 ------
NM_178450chr52531 140 1667 ----
NM_178507chr114764 600 588 527 ------
NM_178554chr323430 535 33423 2879 2670 23547 3092 --
NM_178566chr921645 713 21239 1215 ----
NM_178582chr2031385 1249 22 ------
NM_178585chr422841 2459 23163 2311 1144 --
NM_178586chr1442167 2093 1529 907 22310 1733 ----
NM_178812chr821269 537 ------
NM_180989chr1362309 2060 2051 1818 1531 500 --1374 --
NM_181054chr146897 522 399 340 121 42 ------
NM_181291chr141736 ------
NM_181302chr141164 ------
NM_181308chr141164 ------
NM_181332chrX21793 842 --11916 --
NM_181354chr831532 488 98 1675 ----
NM_181358chr194093 4042 3275 3058 1491 1346 1199 639 471 22765 2697 13417 --
NM_181361chr341344 560 516 383 ------
NM_181427chr15133 ------
NM_181443chr2042268 1903 1786 328 1556 ----
NM_181481chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_181482chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_181483chr1856551 5375 4440 2430 809 37078 6428 1351 11973 --
NM_181527chr201100 ------
NM_181528chr201155 ------
NM_181571chr104741 327 119 99 ------
NM_181644chr131747 1397 45 1180 2385 333 --
NM_181645chr113715 688 647 ------
NM_181670chr1241514 1308 483 475 11252 ----
NM_181672chrX21976 1840 ----1798
NM_181673chrX21976 1840 ----1798
NM_181704chr2121080 929 21115 75 ----
NM_181714chr631592 617 154 ------
NM_181787chr862901 2728 2613 2478 1101 175 21298 869 ----
NM_181789chr1573235 3055 2549 2364 871 848 772 --1894 --
NM_181836chr522356 2158 11974 ----
NM_181837chr61276 1258 ----
NM_181838chr531466 1335 1003 ------
NM_181839chr851417 1363 950 569 262 11239 ----
NM_181861chr123840 654 363 1210 12024 11934
NM_181868chr123840 654 363 1210 12024 11934
NM_181869chr123925 739 448 1295 12109 12019
NM_181886chr421396 56 ------
NM_181887chr421396 56 ------
NM_181888chr421396 56 ------
NM_181889chr421396 56 ------
NM_181890chr421396 56 ------
NM_181891chr421396 56 ------
NM_181892chr421443 103 ------
NM_181893chr421396 56 ------
NM_181897chr352583 2396 2154 2115 584 22414 965 11984 --
NM_182484chr2121080 929 21115 75 ----
NM_182490chr19--1425 --1380
NM_182515chr19166455 6393 6300 5911 5603 5298 4739 4066 2520 1983 1850 987 854 758 76 37 --14605 --
NM_182551chr252933 2309 1005 397 370 1116 13260 13478
NM_182641chr1751942 1714 1680 1363 721 ------
NM_182648chr14----1264 --
NM_182691chr741036 949 458 88 ------
NM_182692chr741036 949 458 88 ------
NM_182717chr1041146 524 504 176 ----1404
NM_182718chr104741 327 119 99 ------
NM_182719chr104741 327 119 99 ------
NM_182720chr1041146 524 504 176 ----1404
NM_182721chr1041146 524 504 176 ----1404
NM_182722chr1041146 524 504 176 ----1404
NM_182723chr1041146 524 504 176 ----1404
NM_182724chr104741 327 119 99 ------
NM_182725chr104741 327 119 99 ------
NM_182734chr2073019 2662 2643 2617 2239 2036 884 --1322 --
NM_182765chr1071995 1889 947 852 467 266 195 12003 21513 801 --
NM_182769chr104741 327 119 99 ------
NM_182770chr104741 327 119 99 ------
NM_182771chr104741 327 119 99 ------
NM_182772chr104741 327 119 99 ------
NM_182796chr51208 ------
NM_182797chr20--1634 11337 --
NM_182830chr141265 11885 11537 --
NM_182848chr132317 179 ------
NM_182850chr104741 327 119 99 ------
NM_182853chr1041146 524 504 176 ----1404
NM_182898chr776578 6273 4806 4209 2270 1394 1098 15823 11402 --
NM_182899chr776578 6273 4806 4209 2270 1394 1098 15823 11402 --
NM_182907chr661925 1844 1777 677 633 386 1317 ----
NM_182948chr133076 1925 759 12150 ----
NM_182972chr13993 729 32 11729 ----
NM_182976chr12314 259 ------
NM_183011chr1041146 524 504 176 ----1404
NM_183012chr1041146 524 504 176 ----1404
NM_183013chr1041146 524 504 176 ----1404
NM_183060chr104741 327 119 99 ------
NM_183075chr442703 2612 2136 1856 22450 608 ----
NM_183227chr651374 1314 1258 1189 1054 ------
NM_183353chrX4433 245 140 58 ------
NM_183376chr1542590 2251 1919 549 1987 ----
NM_183381chr34916 757 305 132 ------
NM_183383chr34916 757 305 132 ------
NM_183384chr34916 757 305 132 ------
NM_183397chr2084093 3670 1943 1904 1596 1434 972 306 21529 1104 2933 815 --
NM_194247chr244482 4332 3547 710 1498 1487 --
NM_194250chr21138 ------
NM_194259chr161581 ------
NM_194260chr161581 ------
NM_194261chr161581 ------
NM_194278chr1433497 3385 2542 ------
NM_194282chr472671 2517 2484 1984 1212 540 86 12534 1755 --
NM_194291chr872697 2213 2151 2048 576 404 196 --12295 --
NM_194292chr141138 457 401 323 --11569 --
NM_194301chr1421181 1100 ------
NM_194314chr154901 4125 3816 3727 1206 1566 ----
NM_194328chr943193 3102 2606 300 --2766 278 --
NM_194329chr943193 3102 2606 300 --2766 278 --
NM_194330chr943193 3102 2606 300 --2766 278 --
NM_194332chr943193 3102 2606 300 --2766 278 --
NM_194356chr1262192 1956 1924 1509 759 620 11569 21812 1798 --
NM_194434chr1864832 4801 4536 3576 1523 975 43955 3792 1625 221 1668 --
NM_194454chr73383 148 81 11385 1281 --
NM_194455chr73383 148 81 11385 1281 --
NM_194456chr73383 148 81 11385 1281 --
NM_197939chr1741077 1061 147 78 ------
NM_197970chr231309 552 418 11529 ----
NM_198077chr12423 408 1438 ----
NM_198128chr1822207 2013 ------
NM_198158chr31945 ------
NM_198159chr31945 ------
NM_198173chr11713 ------
NM_198174chr11713 ------
NM_198177chr31945 ------
NM_198178chr31945 ------
NM_198182chr211519 ------
NM_198215chr1011019 --124 --
NM_198256chr252099 2036 1957 1584 26 --2473 167 --
NM_198268chr194093 4042 3275 3058 1491 1346 1199 639 471 22765 2697 13417 --
NM_198269chr194093 4042 3275 3058 1491 1346 1199 639 471 22765 2697 13417 --
NM_198270chrX83483 2861 2818 2610 869 741 379 110 11040 ----
NM_198320chr1295089 3825 3819 3349 1480 1184 797 598 469 --33640 1342 325 --
NM_198391chr2021239 1137 11470 ----
NM_198399chr351742 1727 1632 1549 361 1627 ----
NM_198400chr1552921 2102 1014 785 172 11093 12616 --
NM_198465chrX42977 2168 343 267 22781 2664 ----
NM_198467chr71234 ------
NM_198503chr1----1146 --
NM_198513chr841692 758 270 46 11428 ----
NM_198569chr632595 1879 752 1196 21792 1757 --
NM_198581chr286165 5737 5409 2603 1466 1043 532 378 --24911 4722 --
NM_198715chr186289 5017 4671 4355 4278 2048 440 360 44457 2032 1015 51 15512 25852 1093
NM_198793chr353867 2785 1210 1062 382 13327 23469 1427 --
NM_198794chr1411282 --1356 --
NM_198889chr431244 224 88 ------
NM_198896chr1121656 128 11859 ----
NM_198900chr12117869 7841 7236 7068 6677 6364 5392 1906 1636 1146 239 --26659 1627 --
NM_198990chr722679 285 --2692 547 --
NM_199000chr73696 666 216 32138 1972 1499 ----
NM_199003chr811493 --1381 --
NM_199044chr143014 2930 2612 1023 --52873 2381 2240 1117 803 --
NM_199076chr101360 1291 ----
NM_199132chr1941903 1839 1730 828 --11388 --
NM_199168chr103340 324 256 ------
NM_199188chr121428 ------
NM_199190chr121428 ------
NM_199280chr21126 ------
NM_199320chr421985 161 ------
NM_199320chr421985 161 ------
NM_199324chr443612 2558 1468 988 --23523 2511 --
NM_199346chr22175 143 ------
NM_199355chr1611639 ------
NM_199418chr11--1102 ----
NM_199421chr1464954 4785 4759 3831 3436 678 --33507 1879 719 1632
NM_199436chr232632 952 221 12369 ----
NM_199461chr1043516 2472 2305 715 33275 2615 1422 1972 --
NM_199462chr1115043 4350 3952 3818 3616 3091 1968 1929 925 886 751 13718 ----
NM_199482chr271951 1556 655 293 286 61 30 ------
NM_201266chr262948 1109 1051 279 190 61 ----23049 419
NM_201279chr262948 1109 1051 279 190 61 ----23049 419
NM_201437chr821327 598 ------
NM_201591chr42530 473 --1673 --
NM_201592chr42530 473 --1673 --
NM_201613chr122244 187 ------
NM_201624chr161216 810 492 358 112 36 11063 ----
NM_203303chrX1186 ------
NM_203327chr2054390 4130 2906 777 138 ----1246
NM_203341chr1----1787 1426
NM_203350chr12542 338 ------
NM_203354chr142797 80 ------
NM_203355chr142797 80 ------
NM_203356chr142797 80 ------
NM_203364chr111873 --1862 --
NM_203372chr231277 483 114 ------
NM_203390chr821578 478 11501 ----
NM_203391chrX21765 1425 21311 414 11664 --
NM_203406chr542753 2338 2305 2028 ------
NM_203437chr2----1602 --
NM_203446chr2122465 282 22498 2064 ----
NM_203458chr143525 3219 1012 971 53863 2739 2523 1052 565 ----
NM_203459chr151921 839 468 336 317 ------
NM_203463chr284976 3878 3233 1439 1284 989 822 411 13158 ----
NM_203500chr19149 ------
NM_203504chr452505 2389 2011 915 662 --1107 --
NM_203505chr452505 2389 2011 915 662 --1107 --
NM_205842chr21238 --2564 140 --
NM_205864chr6129 161 1147 --
NM_206594chr121243 792 22510 2431 ----
NM_206595chr121243 792 22510 2431 ----
NM_206853chr644091 3261 3054 2568 --33368 2983 964 --
NM_206854chr685352 4522 4315 3829 3749 3440 725 392 13316 24629 4244 --
NM_206855chr6146317 5487 5280 4794 4714 4405 4140 1690 1357 903 807 537 486 254 14281 35594 5209 453 --
NM_206866chr2162247 2084 1175 905 823 697 --12581 --
NM_206909chr8117800 7640 7301 6637 5806 5228 3096 3026 2816 2570 1497 12296 26674 2337 --
NM_206927chr112898 160 ------
NM_206928chr112898 160 ------
NM_206929chr112898 160 ------
NM_206930chr112898 160 ------
NM_206933chr192114 1984 1841 1147 1020 470 398 270 69 ----12067
NM_207012chr1063012 2463 1239 1135 781 731 22295 61 23057 2384 --
NM_207042chr11559 ------
NM_207045chr11559 ------
NM_207046chr11559 ------
NM_207122chr11--11118 ----
NM_207123chr42731 271 ------
NM_207170chr12909 605 1755 ----
NM_207292chr323344 2076 ----12744
NM_207293chr323344 2076 ----12744
NM_207294chr323344 2076 ----12744
NM_207295chr323344 2076 ----12744
NM_207296chr323344 2076 ----12744
NM_207297chr323369 2101 139 --12769
NM_207303chr1093918 3710 3472 3436 1625 1234 857 252 192 ------
NM_207304chr1362105 1903 1717 977 897 352 21880 931 ----
NM_207306chr1124503 3015 2882 1142 962 890 750 678 606 534 79 69 --11716 --
NM_207372chr1022414 565 32006 1861 1849 ----
NM_207396chr161542 716 666 530 362 226 11653 ----
NM_207406chr475857 2628 2334 2232 1664 1211 255 34494 1538 531 26044 2011 21273 245
NM_207517chr15----11721 --
NM_207578chr12256 211 ------
NM_212471chr1742219 2034 1959 1946 ------
NM_212472chr1742219 2034 1959 1946 ------
NM_212554chr1031641 1130 1024 ------
NM_213589chr284164 3379 1604 1066 946 367 63 39 14556 ----
NM_213651chr11667 2458 331 1140 --