TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1245b-3p
miRNA Sequence: UCAGAUGAUCUAAAGGCCUAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531843 1320 354 ----22045 707
NM_000043chr101111 --11056 --
NM_000051chr1193500 1231 1066 987 882 854 837 724 689 ------
NM_000052chrX33334 2816 1371 12507 23013 141 --
NM_000067chr82523 123 --1589 --
NM_000068chr1941438 1161 392 35 ------
NM_000074chrX1935 2375 223 ----
NM_000081chr141663 1636 1582 1254 --1138 --
NM_000084chrX116732 6175 5721 5046 5035 4730 4707 1962 1844 1422 759 25532 2675 12176 26496 6135
NM_000089chr74701 695 676 309 ------
NM_000091chr252912 2269 952 698 352 12690 12012 --
NM_000092chr2114198 3955 3907 3709 3262 3110 1551 1491 1323 1144 93 11818 14327 11809
NM_000096chr31142 1866 --1927
NM_000108chr741667 709 544 529 --11894 --
NM_000109chrX2917 671 ----1632
NM_000110chr121038 146 ------
NM_000112chr595013 4834 3748 3462 1497 1319 1248 323 148 --15553 --
NM_000115chr1352470 2024 1859 72 28 --1934 --
NM_000125chr643718 1490 1226 564 --22754 145 --
NM_000129chr651409 540 359 281 34 --11102 --
NM_000138chr151549 --12471 --
NM_000139chr1142638 2190 1822 729 --22822 2292 --
NM_000158chr33679 565 228 ------
NM_000161chr1441877 1699 1685 735 ------
NM_000163chr552273 1889 1867 1497 1463 ----1790
NM_000165chr61628 ------
NM_000168chr743094 2032 760 112 --1866 --
NM_000170chr92378 76 155 ----
NM_000176chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_000189chr292296 2080 1938 837 784 585 564 553 266 ------
NM_000208chr1944374 3944 3245 143 11551 21605 873 14796
NM_000210chr232342 2198 1995 12026 ----
NM_000216chrX113917 3625 3549 3052 3003 2809 2669 774 493 284 163 1844 23487 2832 --
NM_000217chr12105304 5201 4779 4338 4289 4065 3816 3666 3589 1786 --1979 --
NM_000222chr421651 1355 1708 11637 --
NM_000230chr761118 940 932 898 713 253 ----1658
NM_000231chr131615 ------
NM_000248chr343076 2656 2504 236 --1602 1920
NM_000252chrX21143 68 11131 159 --
NM_000259chr1566214 4082 2304 604 199 110 --1540 15727
NM_000264chr943339 3069 2880 2586 13108 12260 --
NM_000266chrX1232 ------
NM_000267chr1753233 1375 779 356 225 ------
NM_000276chrX32229 1630 563 1745 ----
NM_000280chr115854 732 274 246 222 ------
NM_000282chr132263 46 ------
NM_000284chrX1492 --11901 --
NM_000286chr17--1159 ----
NM_000288chr62346 332 ------
NM_000291chrX2379 165 1210 ----
NM_000297chr461960 1946 1856 1613 1502 353 1611 1808 --
NM_000304chr172718 429 ----1396
NM_000314chr1033253 3224 1308 ------
NM_000317chr111320 ------
NM_000321chr1321471 1104 11222 ----
NM_000332chr6146619 6508 6045 5735 5690 4861 4767 4419 2198 1721 1701 1480 730 97 26447 2266 21990 44 26110 5405
NM_000337chr5115987 5819 5734 4796 4723 2526 1671 1612 1451 382 269 22273 495 12210 --
NM_000340chr361486 1227 1133 603 321 51 ------
NM_000345chr41149 1684 ----
NM_000346chr1731290 798 92 --21470 1243 --
NM_000361chr2042134 1828 848 706 --12097 --
NM_000362chr2262442 2307 1169 1012 746 220 1338 --11232
NM_000368chr953885 3793 3295 1034 224 --14124 --
NM_000369chr1441831 1439 613 150 ------
NM_000376chr1262837 2603 2589 1265 934 101 ------
NM_000378chr112807 264 ------
NM_000382chr1732009 1884 232 ------
NM_000393chr251930 1653 1607 1427 1339 ------
NM_000397chrX81935 1788 1666 978 797 680 478 220 1581 12097 --
NM_000408chr2103076 2829 2502 2138 868 743 730 703 259 234 ----11310
NM_000421chr172319 64 ------
NM_000430chr1793428 3286 2768 1125 696 687 568 361 320 1950 22905 389 --
NM_000435chr192382 300 ------
NM_000441chr731611 1573 782 12288 12084 --
NM_000446chr731044 1003 221 ------
NM_000448chr11113021 2440 2270 1274 1234 1193 823 540 461 443 382 11242 1691 1230
NM_000449chr121401 965 --183 --
NM_000461chr373524 2825 1368 875 594 483 50 23612 865 ----
NM_000480chr1161640 1599 1559 1425 1086 394 --21646 1186 --
NM_000484chr211978 ------
NM_000489chrX113414 3061 2937 2829 2618 2559 2159 774 638 567 181 ------
NM_000492chr751550 1198 537 149 32 ------
NM_000503chr831803 1761 1509 --11667 --
NM_000509chr41167 ----146
NM_000522chr751097 945 930 448 403 ----1898
NM_000523chr24863 746 400 246 --1149 --
NM_000533chrX51965 1908 1338 699 201 ------
NM_000538chr1381413 1297 1266 656 341 211 138 37 ------
NM_000544chr6_cox_hap163300 3120 2235 2177 1138 1027 22922 2418 1424 --
NM_000555chrX127882 7860 7847 7626 7142 6300 5638 3017 2678 2191 1703 1286 27222 7036 26115 5160 24891 1379
NM_000573chr11472 ----12177
NM_000574chr141246 1152 495 106 --21257 68 --
NM_000582chr42423 395 ------
NM_000585chr41223 ------
NM_000594chr61275 ----1667
NM_000598chr71505 ------
NM_000599chr243961 954 877 91 --11243 11421
NM_000602chr741232 507 286 117 --125 --
NM_000609chr1072213 2068 1264 1249 1236 789 189 1153 12307 12681
NM_000610chr1142437 2399 800 677 12759 42850 2767 569 551 --
NM_000615chr1152545 2525 2197 1043 131 --11930 --
NM_000618chr12196524 6394 6046 5896 5199 5080 4746 4324 2554 2156 1903 1802 1619 1308 1206 1030 711 600 591 11589 36117 4282 1284 --
NM_000618chr12196524 6394 6046 5896 5199 5080 4746 4324 2554 2156 1903 1802 1619 1308 1206 1030 711 600 591 11589 36117 4282 1284 --
NM_000619chr12----1534 --
NM_000621chr1351078 448 133 121 57 ----11317
NM_000627chr23887 586 371 ------
NM_000633chr1894809 4358 4008 3461 3268 2071 1913 1490 225 23173 402 34581 1740 1564 --
NM_000651chr11472 ----12177
NM_000679chr51512 ------
NM_000684chr1021161 523 ----1110
NM_000686chrX21344 399 ------
NM_000693chr1521517 1422 ------
NM_000719chr12126674 6627 5464 5364 4143 1718 1422 1038 993 376 190 120 12321 --12020
NM_000721chr122256 2111 --21970 1656 --
NM_000726chr241355 991 123 70 11086 128 --
NM_000735chr6----1198 --
NM_000747chr171676 ----1195
NM_000756chr8196 ------
NM_000759chr172679 31 ------
NM_000783chr102543 167 ------
NM_000788chr441336 1070 1033 522 ------
NM_000792chr12952 764 --2908 859 --
NM_000793chr1483690 3430 3300 2017 1375 777 520 118 21433 308 1637 --
NM_000800chr541437 1358 399 380 ----11616
NM_000801chr204432 267 251 131 ------
NM_000806chr531475 134 78 --1335 1719
NM_000807chr41160 ------
NM_000811chr52765 527 ------
NM_000813chr585164 3900 2143 2051 827 631 366 154 15088 2423 342 --
NM_000814chr1584086 3513 3441 3326 1589 1124 347 33 11209 ----
NM_000824chr42864 179 1122 1771 --
NM_000826chr432333 793 298 21016 832 ----
NM_000829chr1131654 786 730 --12225 11469
NM_000831chr175517 4860 4624 4347 4194 4167 946 55697 5417 4320 4137 2089 34242 1700 1677 --
NM_000833chr1651352 1119 1085 478 24 ------
NM_000838chr622046 589 --12077 --
NM_000857chr41484 ------
NM_000859chr521638 676 --1518 --
NM_000860chr451531 1486 641 336 299 11393 --170
NM_000866chr31688 1712 ----
NM_000868chrX82473 2446 2216 520 474 425 349 336 12099 12337 --
NM_000872chr101202 --134 --
NM_000875chr15196249 6103 6000 5986 5504 5348 5130 5117 4919 2808 2620 2208 1817 1253 1244 1200 1186 507 169 1680 26550 5153 --
NM_000876chr631402 916 262 ------
NM_000880chr84855 831 736 61 1139 ----
NM_000885chr242148 1726 1349 407 11516 11461 11780
NM_000891chr1773605 3194 3019 2918 1093 843 683 ----12690
NM_000899chr12103829 3661 3510 3473 3119 2939 1551 333 274 211 11341 33733 1099 126 --
NM_000902chr363138 2112 1272 573 538 214 ------
NM_000908chr54775 192 174 129 ------
NM_000926chr11229406 9075 8863 8654 8310 8206 7893 7861 7655 7094 6589 6202 5724 3085 2599 2593 2278 2220 1668 1408 1395 1112 39096 2746 1190 49157 7993 7357 1960 23331 2230
NM_000933chr2011790 2661 113 11708 --
NM_000935chr321228 1017 1140 ----
NM_000944chr452360 2042 1939 1879 693 12423 ----
NM_000945chr22565 288 ------
NM_000950chrX93551 3447 3044 2972 1438 1309 510 183 31 ------
NM_000956chr143977 49 38 --1940 11113
NM_000962chr952780 2236 493 464 91 11025 31124 235 154 --
NM_000965chr311145 ------
NM_001001132chr212497 173 ------
NM_001001323chr1283192 3035 2943 2549 2328 2172 1036 596 --13213 --
NM_001001331chr332747 2705 1991 --12684 --
NM_001001344chrX42095 2036 967 152 1396 22488 750 --
NM_001001349chr1711701 --11056 --
NM_001001389chr1142437 2399 800 677 12759 42850 2767 569 551 --
NM_001001390chr1142437 2399 800 677 12759 42850 2767 569 551 --
NM_001001391chr1142437 2399 800 677 12759 42850 2767 569 551 --
NM_001001392chr1152483 2445 846 723 63 12805 42896 2813 615 597 --
NM_001001394chr22724 480 ----1628
NM_001001395chr12122816 2785 2768 2587 2402 2196 698 682 361 350 153 50 ------
NM_001001419chr564299 1631 982 717 165 141 23629 3364 ----
NM_001001420chr564299 1631 982 717 165 141 23629 3364 ----
NM_001001433chr2052039 1974 702 479 420 12511 ----
NM_001001436chr16------1822
NM_001001481chr853010 2985 2776 1083 940 ----12489
NM_001001484chr1032192 1979 113 1908 --12337
NM_001001557chr862016 1817 1594 1445 736 669 ------
NM_001001664chr283932 3253 3073 2779 2567 559 277 218 11457 ----
NM_001001668chr1984205 3265 3177 3123 2711 1367 866 34 --21297 89 --
NM_001001870chr173800 764 90 1609 ----
NM_001001890chr2143388 728 533 207 23350 2773 13460 11225
NM_001001924chr861603 1479 1289 804 597 500 ------
NM_001001925chr861603 1479 1289 804 597 500 ------
NM_001001931chr861603 1479 1289 804 597 500 ------
NM_001001933chr13448 183 47 ------
NM_001001938chr9104047 3907 3549 3420 2705 2509 1284 1071 844 621 13230 ----
NM_001001974chr1082354 2150 1890 1632 1519 909 661 362 22229 1831 1231 --
NM_001001995chrX3708 432 416 --11436 --
NM_001002257chr243462 3430 3009 1246 --33565 2333 1177 --
NM_001002762chr1032953 2841 1021 ------
NM_001002814chr853667 3288 3155 2777 1418 --12983 --
NM_001002838chrX21699 386 ----1109
NM_001002843chr1551185 1097 1053 264 45 ------
NM_001002860chr1494336 4310 4213 3975 3459 3387 581 404 199 --34566 4191 21 --
NM_001002909chr1752011 1381 628 616 420 --11990 11938
NM_001002926chr742540 2172 2069 948 --1684 --
NM_001003652chr18137731 6339 6256 5393 5382 2843 2779 2727 1865 1649 1630 1547 1218 28716 6819 38613 7536 2253 --
NM_001003665chr142535 1404 344 160 11077 ----
NM_001003674chr18126919 6647 6612 6315 6241 5955 5605 5595 5376 2643 2431 197 16094 24591 1711 --
NM_001003675chr18126919 6647 6612 6315 6241 5955 5605 5595 5376 2643 2431 197 16094 24591 1711 --
NM_001003681chr2251957 1859 1770 1548 405 ------
NM_001003682chr131104 547 487 11128 ----
NM_001003688chr421074 795 ------
NM_001003694chr3198 --2519 485 --
NM_001003698chr6----21282 576 1335
NM_001003699chr6----21282 576 1335
NM_001003712chr1293641 3426 3111 2876 2813 2768 1396 535 157 33786 3720 864 1512 --
NM_001003760chr631163 1048 746 1333 21216 774 --
NM_001003792chr31220 1312 1950 --
NM_001003793chr31220 1312 1950 --
NM_001003800chr93756 682 36 23438 533 13452 --
NM_001003803chr141212 ----137
NM_001003805chr142304 127 ------
NM_001004019chr31392 ------
NM_001004127chr132365 98 --187 --
NM_001004303chr14770 623 566 201 1273 ----
NM_001004303chr14770 623 566 201 1273 ----
NM_001004317chr694458 4242 4044 3962 3225 3033 1484 1041 811 1166 34402 3695 2745 --
NM_001004330chr1241521 1412 736 567 ------
NM_001004360chr231991 347 323 1152 1375 --
NM_001004419chr1283420 3404 3263 1497 1478 999 710 537 13440 24108 548 --
NM_001004440chr1----1496 --
NM_001004720chr23731 154 146 1967 ----
NM_001004722chr23900 323 315 11136 ----
NM_001005158chr31516 ------
NM_001005159chr31516 ------
NM_001005242chr1231574 1327 475 ------
NM_001005266chr152729 480 ------
NM_001005267chr152729 480 ------
NM_001005268chr152729 480 ------
NM_001005269chr152729 480 ------
NM_001005335chr192276 206 128 ----
NM_001005340chr72619 148 ------
NM_001005353chr121311 977 ------
NM_001005353chr121311 977 ------
NM_001005366chr122797 237 ------
NM_001005375chrY51322 706 699 538 235 --1346 11338
NM_001005386chr222482 2419 12293 ----
NM_001005404chr1774212 4094 1699 1503 1484 748 198 ----14514
NM_001005463chr1022605 589 --22564 1773 11034
NM_001005473chr5116668 6409 6391 5893 5499 4773 4266 2323 1993 194 65 24687 203 --15345
NM_001005474chr351468 1049 218 78 63 1234 1421 --
NM_001005476chr2----1493 --
NM_001005526chr21103 ------
NM_001005527chr3--1222 ----
NM_001005609chrX53854 3657 2873 2443 741 1390 --11223
NM_001005739chr22772 185 ----132
NM_001005746chr241355 991 123 70 11086 128 --
NM_001005747chr241355 991 123 70 11086 128 --
NM_001005845chr851792 1476 1328 323 75 ------
NM_001005849chr172438 131 ------
NM_001005862chr171594 ------
NM_001006600chr531841 1540 743 ------
NM_001006610chr1621035 69 --1971 --
NM_001006612chrX1298 --1136 --
NM_001006613chrX1298 --1136 --
NM_001006614chrX1298 --1136 --
NM_001006636chr22700 149 ------
NM_001006641chr941766 1261 1157 1145 1605 ----
NM_001006642chr941766 1261 1157 1145 1605 ----
NM_001006643chr941766 1261 1157 1145 1605 ----
NM_001006665chr12760 286 --2791 689 --
NM_001006684chrX1203 ----197
NM_001006945chr11566 1624 ----
NM_001007023chr1483690 3430 3300 2017 1375 777 520 118 21433 308 1637 --
NM_001007024chr17104364 3953 3702 3133 1481 1330 1095 979 939 783 22946 1017 --1903
NM_001007025chr17104364 3953 3702 3133 1481 1330 1095 979 939 783 22946 1017 --1903
NM_001007097chr995126 5094 5020 4898 4387 4126 3533 3442 533 23171 1844 1115 --
NM_001007102chr651559 1542 1508 242 211 11658 1473 --
NM_001007156chr1541831 1667 1601 1204 ------
NM_001007237chr142603 2026 717 296 1485 ----
NM_001007246chr2121586 1309 11872 11693 1357
NM_001007257chr131099 427 174 ------
NM_001007277chr1121037 383 ------
NM_001007278chr13105131 4808 4656 4620 4208 3987 3981 3920 3690 2116 --12102 --
NM_001007466chr6104712 4445 3825 3711 1918 1664 634 329 317 262 1579 14333 --
NM_001007471chr92640 357 1180 ----
NM_001007527chr54731 225 213 67 ------
NM_001007538chr1341886 1855 1784 389 --1121 --
NM_001007546chr221669 1036 --11228 --
NM_001007553chr141161 1110 496 333 ------
NM_001007559chr183813 733 634 ------
NM_001007595chr152281 137 ------
NM_001008220chr531058 1045 1009 11509 23064 670 --
NM_001008222chrX21401 881 ------
NM_001008225chr71483 ----1746
NM_001008239chr1873363 3075 2917 2698 2524 405 111 22654 754 13068 --
NM_001008392chr362947 2884 2463 851 706 682 23471 3083 ----
NM_001008397chr54700 657 202 60 1683 ----
NM_001008401chr1931479 1225 1165 ------
NM_001008408chr785447 5087 2558 1840 1803 1423 665 414 16023 16357 --
NM_001008491chr241534 1421 467 375 --2586 574 --
NM_001008492chr241534 1421 467 375 --2586 574 --
NM_001008495chr871957 1720 1649 1565 1469 1399 161 11805 ----
NM_001008541chr1022207 568 ------
NM_001008541chr1022207 568 ------
NM_001008564chr1341931 1726 1506 345 --11855 --
NM_001008567chr9299 33 ------
NM_001008660chr1141436 1402 1194 435 ------
NM_001008726chr1441449 1138 624 239 ----1415
NM_001008738chr51783 2249 107 ----
NM_001008756chr362452 2029 1951 986 102 23 1212 12295 --
NM_001008801chr1942159 1904 1854 297 ------
NM_001008895chr1341319 1297 1107 143 ------
NM_001008925chr473104 2405 1324 1094 952 524 267 --12922 --
NM_001009552chr82609 508 ------
NM_001009554chr494281 4122 3685 3457 3360 3168 1533 1413 609 11730 43903 3436 1786 1289 --
NM_001009554chr494281 4122 3685 3457 3360 3168 1533 1413 609 11730 43903 3436 1786 1289 --
NM_001009555chr471434 612 544 442 359 319 266 --11592 --
NM_001009894chr1251471 1368 1239 396 114 ------
NM_001009899chr395871 4476 4439 4402 1027 918 294 188 128 11258 35879 2371 1827 1609
NM_001009959chr231791 966 219 12230 ----
NM_001009960chr731111 980 304 154 ----
NM_001009993chr254041 3980 3755 3652 3041 23487 478 23235 1669 --
NM_001010853chr653059 2980 2852 1002 316 12783 --23300 2755
NM_001010861chr12980 146 ----12589
NM_001010862chrX82925 2851 2023 1123 763 649 266 175 ------
NM_001010888chrX94353 4218 3909 3834 3809 3522 1814 1070 123 24128 884 13088 12813
NM_001010895chr962049 2026 1983 1642 732 625 --11707 --
NM_001010923chr631415 1322 1315 1467 ----
NM_001010924chr1031080 888 379 ------
NM_001010927chr62453 37 ------
NM_001010971chr12953 302 ------
NM_001010986chrX42376 2132 413 41 ------
NM_001011513chr4144040 3945 3933 3836 3825 3636 3268 2797 2650 2631 2579 927 446 275 --14001 --
NM_001011515chr42258 46 ------
NM_001011516chr42258 46 ------
NM_001011537chr342357 2024 1990 1883 11597 1246 1680
NM_001011553chr73817 656 617 ------
NM_001011663chr104704 386 353 179 ------
NM_001011666chr7136559 6323 6025 4807 4436 4355 4334 4177 2271 2054 1823 652 127 45115 4568 4100 1831 14211 --
NM_001011708chr252920 2514 2240 2084 1949 3411 319 48 ----
NM_001011713chr1441034 606 302 172 --1263 11420
NM_001011720chr851452 1377 1152 985 479 1542 1172 --
NM_001011885chr1541575 1443 1239 461 --11724 --
NM_001012267chr941973 1506 426 74 1242 ----
NM_001012393chr11104335 4134 4117 1429 1067 1028 872 856 634 504 1849 2448 352 --
NM_001012398chr163800 301 215 ----1441
NM_001012418chr6134291 4207 4078 4031 3798 3062 1696 1237 853 777 638 528 21 ----13097
NM_001012420chr1562662 2514 2097 891 578 83 --2691 150 22651 94
NM_001012423chr1562662 2514 2097 891 578 83 --1691 12651
NM_001012751chr102512 430 11776 1607 --
NM_001012755chrX95045 4423 4382 3961 3500 3302 3176 1986 691 11892 1715 --
NM_001012761chr542661 2206 1676 588 ------
NM_001012968chrX41927 1818 1075 652 12276 21764 1045 --
NM_001012977chrX31422 1268 262 ------
NM_001012979chrX171 ------
NM_001012980chrX--1194 127 --
NM_001012989chrX1265 ------
NM_001013031chr1042424 2168 765 477 --13132 --
NM_001013398chr71505 ------
NM_001013406chr731490 1220 1120 ------
NM_001013415chr43474 458 210 --11038 --
NM_001013437chr185409 187 170 79 55 ------
NM_001013438chr331019 691 276 --1706 --
NM_001013439chr33865 537 122 --1552 --
NM_001013615chr131034 814 139 1880 ----
NM_001013659chr1942054 1550 875 376 13841 ----
NM_001013690chr1222457 2426 2664 344 ----
NM_001013693chr132904 2567 786 ------
NM_001013693chr132904 2567 786 ------
NM_001013699chr12199 ------
NM_001014283chr1341888 680 609 581 22155 1637 11339 1600
NM_001014434chr11151 1701 ----
NM_001014797chr10108223 8034 7709 6947 3078 2727 2548 2418 987 330 --28155 6177 --
NM_001014831chr191655 ------
NM_001014832chr191655 ------
NM_001014834chr191655 ------
NM_001014835chr191655 ------
NM_001014972chr2172 ------
NM_001015045chr451984 631 604 332 132 12126 1701 --
NM_001015508chr82260 142 ------
NM_001015877chrX52671 2384 2243 992 725 --1549 --
NM_001015881chrX3789 366 87 ----11019
NM_001015887chr351860 1832 1191 1155 616 11712 ----
NM_001017371chr231068 509 346 --11308 --
NM_001017395chr343194 2613 1363 218 ----12770
NM_001017405chr41190 1225 ----
NM_001017415chr13642 183 88 ------
NM_001017416chr13642 183 88 ------
NM_001017423chr103511 254 60 ------
NM_001017424chr131319 483 138 21640 585 ----
NM_001017425chr131319 483 138 21640 585 ----
NM_001017440chr7128144 6390 5739 5352 5013 2645 2100 1198 986 312 306 178 17005 15772 --
NM_001017523chr1231566 1555 504 1675 21883 1628 --
NM_001017535chr1262837 2603 2589 1265 934 101 ------
NM_001017923chr1411230 21422 421 --1332
NM_001017926chr821735 1337 ------
NM_001017977chr11356 ------
NM_001017979chr41558 ------
NM_001017995chr544168 3421 1437 783 14806 11515 --
NM_001017999chr162159 2091 1561 795 505 255 ------
NM_001017999chr162159 2091 1561 795 505 255 ------
NM_001018000chr162159 2091 1561 795 505 255 ------
NM_001018000chr162159 2091 1561 795 505 255 ------
NM_001018001chr162159 2091 1561 795 505 255 ------
NM_001018008chr152677 429 ------
NM_001018009chr3176 --11120 --
NM_001018057chr111153 ------
NM_001018065chr965979 5666 5163 4356 1611 569 11939 34651 1282 95 --
NM_001018066chr965979 5666 5163 4356 1611 569 11939 34651 1282 95 --
NM_001018067chr1125314 5147 4843 4657 3504 1982 1854 1434 1242 951 657 553 24950 2043 33408 360 145 --
NM_001018068chr1125314 5147 4843 4657 3504 1982 1854 1434 1242 951 657 553 24950 2043 33408 360 145 --
NM_001018069chr1125314 5147 4843 4657 3504 1982 1854 1434 1242 951 657 553 24950 2043 33408 360 145 --
NM_001018072chr1231566 1555 504 1675 21883 1628 --
NM_001018074chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_001018075chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_001018076chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_001018077chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_001018111chr763608 2895 2516 1255 718 395 ----11566
NM_001018159chr16----1128 --
NM_001018160chr16----1128 --
NM_001020658chr121222 454 --1408 --
NM_001020658chr121222 454 --1408 --
NM_001020825chr531348 1311 180 --1262 --
NM_001023567chr1562463 2044 894 438 232 83 --1694 194
NM_001023587chr321157 392 ------
NM_001024094chr563873 3836 2705 1174 791 562 --32787 664 115 --
NM_001024226chr131144 1038 755 ------
NM_001024227chr131144 1038 755 ------
NM_001024228chr131144 1038 755 ------
NM_001024380chr862384 2257 2050 1641 126 59 ----22229 602
NM_001024381chr862384 2257 2050 1641 126 59 ----22229 602
NM_001024455chrX42016 753 551 84 ----12134
NM_001024460chr611000 ------
NM_001024593chr102107 22 ------
NM_001024649chr512431 --1499 --
NM_001024808chr1222854 289 ------
NM_001024847chr351931 1719 904 703 268 1475 ----
NM_001024934chr62695 195 ------
NM_001024935chr62695 195 ------
NM_001024936chr62695 195 ------
NM_001024937chr172663 486 1296 ----
NM_001024947chr52845 155 21098 113 ----
NM_001024948chr183472 3346 2644 1197 916 742 513 507 1840 ----
NM_001024956chr11145891 5131 4560 4515 4346 4210 4135 3836 3817 2035 1443 1397 588 340 14967 1119 --
NM_001025068chr311596 11145 ----
NM_001025069chr311596 11145 ----
NM_001025076chr10145959 5884 5351 4913 4672 4516 4032 4007 2048 1673 1457 996 218 31 14090 ----
NM_001025077chr10197317 7242 6709 6271 6030 5874 5390 5365 4723 4610 3031 2815 2354 1576 1142 1098 1066 299 31 25448 4696 --11120
NM_001025079chr333892 3524 3369 --12563 --
NM_001025105chr571506 1473 1403 1084 967 373 51 --11362 --
NM_001025107chr162379 2282 2214 944 550 247 --21690 425 --
NM_001025107chr162379 2282 2214 944 550 247 --21690 425 --
NM_001025205chr31422 ------
NM_001025252chr822986 1046 --12802 --
NM_001025253chr822986 1046 --12802 --
NM_001025266chr333509 1916 235 2983 869 21099 657 --
NM_001025356chr12103028 2668 2423 2323 2159 2120 684 423 390 338 12270 --1583
NM_001025366chr621735 1444 ------
NM_001025366chr621735 1444 ------
NM_001025367chr621735 1444 ------
NM_001025367chr621735 1444 ------
NM_001025368chr621735 1444 ------
NM_001025368chr621735 1444 ------
NM_001025369chr621751 1460 ------
NM_001025369chr621751 1460 ------
NM_001025370chr621735 1444 ------
NM_001025370chr621735 1444 ------
NM_001025389chr1161640 1599 1559 1425 1086 394 --21646 1186 --
NM_001025390chr1161640 1599 1559 1425 1086 394 --21646 1186 --
NM_001025580chrX74311 3355 1488 1055 700 452 183 --23393 1372 12939
NM_001025595chr451627 1381 1083 632 436 11062 ----
NM_001025603chr121401 965 --183 --
NM_001025777chr221327 1185 2138 34 ----
NM_001029858chr642363 2300 2289 59 12451 1799 --
NM_001029859chr1141981 814 717 362 1904 12418 --
NM_001029860chr81324 ----146
NM_001029863chr652676 2169 1092 594 39 ------
NM_001029875chr552734 1959 1940 959 538 135 21888 131 --
NM_001030006chr1752054 937 338 241 189 --1569 1666
NM_001030007chr1693682 3153 2964 2936 2784 1138 1127 1038 482 --12912 --
NM_001030055chr14104609 4257 3834 3648 1612 1583 1386 1358 706 570 ------
NM_001030272chr111333 ------
NM_001030273chr111333 ------
NM_001031665chr191389 ------
NM_001031677chr51401 ------
NM_001031679chr1253421 3265 2763 512 70 12342 12314 --
NM_001031685chr11312 ------
NM_001031689chr9--158 ----
NM_001031690chr762824 2695 2500 2108 1936 373 --1586 --
NM_001031692chr71211 174 ----
NM_001031695chr2294675 4619 3823 3624 1468 1217 783 640 417 21832 380 ----
NM_001031700chr441702 805 605 307 3781 680 260 1994 11603
NM_001031710chr741016 960 279 242 ----11096
NM_001031711chr531524 1441 1413 ------
NM_001031712chr63316 157 56 --1364 --
NM_001031716chr211140 ----1789
NM_001031722chr6----1135 --
NM_001031723chr41346 ------
NM_001031732chr463578 3562 2837 2388 881 783 ------
NM_001031804chr1663800 3260 2936 1165 881 473 13733 23455 2878 --
NM_001031806chr1732065 1940 288 ------
NM_001031812chr572124 1942 1765 1731 500 140 69 --146 --
NM_001032280chr621575 1225 ----11128
NM_001032282chr83484 468 203 ------
NM_001032283chr122284 63 --1883 --
NM_001032284chr122284 63 --1883 --
NM_001032288chr202144 62 1183 11129 --
NM_001032296chr1362717 1830 960 866 449 226 ----1860
NM_001032363chr12734 371 1146 --12201
NM_001032363chr12734 371 1146 --12201
NM_001032380chr102149 84 21848 1549 11956 --
NM_001032393chrX4547 299 158 51 ------
NM_001032394chr652729 2282 624 509 485 ------
NM_001032395chr652596 2149 491 376 352 ------
NM_001032999chr20105252 4903 4769 4391 4126 975 937 918 898 848 ----31179 1062 717
NM_001033047chr452453 2355 2199 229 61 --22086 577 --
NM_001033057chr331847 1781 360 3761 143 98 --1850
NM_001033059chr62590 148 ------
NM_001033087chr2063137 3021 2289 2113 2104 665 --23232 162 1975
NM_001033088chr151336 ------
NM_001033117chr343352 1160 1059 117 ------
NM_001033507chr121697 1371 ------
NM_001033518chr742510 1017 370 178 1882 ----
NM_001033519chr742510 1017 370 178 1882 ----
NM_001033520chr742510 1017 370 178 1882 ----
NM_001033557chr21939 ------
NM_001033561chr171197 ------
NM_001033564chr641292 658 353 244 11917 21298 60 11482
NM_001033578chr831859 580 104 ------
NM_001033602chr1342523 2414 798 403 ----12306
NM_001033659chr1721366 240 ------
NM_001033723chr851849 1796 942 839 432 1489 12410 --
NM_001033756chr621669 1378 ------
NM_001033756chr621669 1378 ------
NM_001033925chr1031862 704 330 21675 465 ----
NM_001034837chr52638 259 --1595 --
NM_001034838chr52638 259 --1595 --
NM_001034841chr1664708 4361 3631 3625 3491 701 1735 25509 1486 --
NM_001034850chr531554 1409 1313 11251 ----
NM_001034852chr1431788 1614 173 ------
NM_001034915chr83444 414 171 11550 ----
NM_001034954chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_001034955chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_001034956chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_001034957chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_001035chr121257 967 ------
NM_001035003chr431166 405 226 --2568 354 --
NM_001035004chr431166 405 226 --2568 354 --
NM_001035005chr183600 229 29 ----191
NM_001035260chr1061470 1106 1037 602 219 65 --21571 1144 --
NM_001035511chr132044 1662 645 ------
NM_001035512chr152151 1769 752 74 25 ------
NM_001035513chr152151 1769 752 74 25 ------
NM_001037132chr731898 749 691 --22063 1459 --
NM_001037133chr731898 749 691 --22063 1459 --
NM_001037164chr762007 1814 1303 1292 233 22 ------
NM_001037165chr788938 8886 8865 8722 7381 6312 3397 961 31609 674 156 --27416 2753
NM_001037172chr331279 1142 421 11392 ----
NM_001037174chr222251 1808 ------
NM_001037317chr12980 146 ----12589
NM_001037334chr1872430 2303 895 435 310 186 57 --21895 115 --
NM_001037339chr131791 1443 359 ------
NM_001037340chr131791 1443 359 ------
NM_001037341chr131791 1443 359 ------
NM_001037341chr131791 1443 359 ------
NM_001037494chr121199 ------
NM_001037495chr121199 ------
NM_001037553chr2184687 4462 4031 1447 1410 1370 684 353 34157 1808 659 15129 --
NM_001037954chr1192968 2654 1343 1329 1307 1258 1111 978 174 --32145 334 216 --
NM_001038640chr153159 143 82 1170 1761 --
NM_001038702chr562247 815 568 440 397 351 1767 12222 --
NM_001039091chrX3429 250 170 --21337 1189 --
NM_001039350chr741774 1737 1602 1379 ------
NM_001039395chr942352 2246 867 542 11620 --1294
NM_001039538chr2112897 1317 1301 1247 1151 857 806 753 533 360 193 1611 ----
NM_001039547chr3116483 6462 6404 6300 5845 3130 2551 1268 1252 831 260 11478 27126 2941 12120
NM_001039577chr144494 4077 1202 608 --33679 848 511 11485
NM_001039580chr484538 4378 3536 1232 1179 839 490 351 11275 2989 606 --
NM_001039590chrX23365 2638 32652 2444 1265 1143 --
NM_001039591chrX23365 2638 32652 2444 1265 1143 --
NM_001039618chr11165772 5599 5483 5310 5023 5004 4964 4518 4177 4126 3988 2342 2186 2088 1688 1535 ------
NM_001039649chr132310 208 ------
NM_001039693chr283831 3423 2694 2637 1331 1277 756 456 ----12858
NM_001039709chr20105252 4903 4769 4391 4126 975 937 918 898 848 ----31179 1062 717
NM_001039715chr12952 764 --2908 859 --
NM_001039716chr121016 828 --2972 923 --
NM_001039762chr1062207 786 678 648 449 436 ------
NM_001039840chrX186058 5916 5769 5563 5052 3994 3849 3824 2299 2198 2160 1961 1521 1500 1457 804 359 38 21865 913 ----
NM_001039888chr13689 321 234 ------
NM_001039937chr1392789 2720 2713 2568 1090 569 172 150 84 24057 3387 --13833
NM_001039938chr1331490 171 34 ------
NM_001040057chr721345 1339 ------
NM_001040058chr42423 395 ------
NM_001040060chr42423 395 ------
NM_001040097chr71159 ------
NM_001040098chr71159 ------
NM_001040099chr71159 ------
NM_001040101chr431573 242 104 11482 ----
NM_001040108chr1452300 2030 1316 1209 372 --1220 --
NM_001040142chr222345 1566 12302 ----
NM_001040143chr222345 1566 12302 ----
NM_001040152chr7104486 3653 3547 3368 3172 3148 1388 414 91 59 24507 3437 --1319
NM_001040153chr132912 699 ------
NM_001040157chr452400 1140 426 294 123 ------
NM_001040158chr52119 103 ------
NM_001040159chr4173 --1180 --
NM_001040202chr492474 2459 2408 2057 1852 1729 656 357 295 31902 989 250 ----
NM_001040214chr652325 2183 2147 812 806 11666 ----
NM_001040260chr431095 478 273 --2912 901 --
NM_001040261chr431095 478 273 --2912 901 --
NM_001040272chr92935 85 --12016 --
NM_001040284chr16165972 5657 5141 4936 4777 4635 4511 4133 3994 3937 3849 1097 893 851 638 265 1412 ----
NM_001040402chr421973 621 --22535 538 --
NM_001040409chr231031 645 366 --1848 --
NM_001040429chr1333616 2878 1421 32409 1434 135 32778 905 643 --
NM_001040441chr154876 4048 3432 1394 887 ------
NM_001040446chr531933 1763 198 12740 --12451
NM_001040450chr152587 88 --12243 11096
NM_001040453chr152587 88 --12243 11096
NM_001040458chr541317 276 122 31 ------
NM_001040619chr11499 1331 ----
NM_001040653chr352533 2404 873 787 194 1177 12517 --
NM_001040665chr784852 4835 4799 4466 1913 1014 743 700 13498 ----
NM_001040708chr821070 162 --1728 --
NM_001040709chr131879 1628 490 3940 931 505 11993 --
NM_001040712chr953590 3075 2551 622 543 1236 33102 2758 670 1704
NM_001040876chr431556 731 537 1452 ----
NM_001042355chr16105182 4876 4636 4173 3299 2033 1754 1422 1406 394 35129 4811 4350 13279 --
NM_001042361chr1021479 978 1526 1197 --
NM_001042364chr1021479 978 1526 1197 --
NM_001042365chr1021479 978 1526 1197 --
NM_001042387chr1021479 978 1526 1197 --
NM_001042393chr1021479 978 1526 1197 --
NM_001042396chr1021479 978 1526 1197 --
NM_001042397chr1021479 978 1526 1197 --
NM_001042403chr123807 315 80 --1408 --
NM_001042404chr131888 1219 787 11717 1410 --
NM_001042412chr16105182 4876 4636 4173 3299 2033 1754 1422 1406 394 35129 4811 4350 13279 --
NM_001042414chr132294 201 --173 --
NM_001042424chr452601 791 532 392 186 1203 1821 --
NM_001042425chr621575 1225 ----11128
NM_001042440chr551936 1643 1523 30 23 --1378 1805
NM_001042441chr551936 1643 1523 30 23 --1378 1805
NM_001042442chr551936 1643 1523 30 23 --1378 1805
NM_001042443chr551936 1643 1523 30 23 --1378 1805
NM_001042444chr551936 1643 1523 30 23 --1378 1805
NM_001042445chr551936 1643 1523 30 23 --1378 1805
NM_001042446chr551936 1643 1523 30 23 --1378 1805
NM_001042453chrX21277 166 1582 11551 --
NM_001042459chr31262 ------
NM_001042473chr1032126 777 318 --1295 --
NM_001042481chr1432517 1951 958 ----2694 310
NM_001042492chr1753233 1375 779 356 225 ------
NM_001042494chr1543394 3162 1191 430 2249 174 ----
NM_001042495chr1543394 3162 1191 430 2249 174 ----
NM_001042496chr1543394 3162 1191 430 2249 174 ----
NM_001042497chr1543394 3162 1191 430 2249 174 ----
NM_001042506chrX41383 1324 1279 262 --11318 --
NM_001042510chr852046 1542 586 289 131 --1537 --
NM_001042511chr852046 1542 586 289 131 --1537 --
NM_001042517chr13----1933 --
NM_001042537chrX52465 2013 1898 1636 1549 1535 1914 --
NM_001042555chr12104430 3677 3557 3029 2923 843 820 654 75 69 1745 11002 1669
NM_001042599chr2207380 7249 7011 6918 6893 6811 6461 6406 5925 5623 2725 1962 1768 1632 1289 854 654 414 404 220 --12174 --
NM_001042601chr373142 3121 2180 1997 894 739 392 ------
NM_001042604chr3124850 4661 4514 4454 3988 3656 3158 1833 1479 654 579 130 11290 33650 1569 1473 --
NM_001042681chr152151 1866 1062 858 533 12624 ----
NM_001042682chr152151 1866 1062 858 533 12624 ----
NM_001042682chr152151 1866 1062 858 533 12624 ----
NM_001042749chrX51368 1286 585 328 36 ------
NM_001042750chrX51368 1286 585 328 36 ------
NM_001042751chrX51368 1286 585 328 36 ------
NM_001042762chr751062 1025 404 334 250 1142 1986 --
NM_001043318chr1423293 674 --23776 1552 --
NM_001043351chr12846 322 --11738 --
NM_001044305chr62193 109 --21546 614 --
NM_001044385chr2123787 3682 3594 2865 2788 2737 2708 2622 764 641 403 202 --13144 --
NM_001044722chr572124 1942 1765 1731 500 140 69 --146 --
NM_001044723chr572124 1942 1765 1731 500 140 69 --146 --
NM_001046chr542793 921 807 523 12682 12900 --
NM_001071775chr133735 642 327 ----21620 1332
NM_001077628chr11652 ------
NM_001083620chr432331 792 297 21015 831 ----
NM_001083621chr1104412 4152 3579 3233 1712 1469 1168 1058 794 619 1184 ----
NM_001099678chr375814 2395 2207 227 150 98 92 --15398 15200
NM_001100108chr1168245 7656 7506 6657 6354 5141 5104 5069 2933 2147 1846 1711 1337 1295 768 160 1583 26966 5364 --
NM_001106chr3149776 8664 8084 7825 7391 7139 7016 6789 6481 3298 3004 2242 1741 354 38288 7914 1299 19567 28375 7549
NM_001111chr162379 2282 2214 944 550 247 --21690 425 --
NM_001113490chrX93237 3212 3007 2708 2679 705 618 339 51 --23017 963 --
NM_001116chr1652909 2829 362 167 123 12916 23042 2888 --
NM_001117chr181464 ------
NM_001121chr1051661 308 274 175 168 --1536 11885
NM_001122631chr113637 452 239 ----1595
NM_001123chr102276 174 --191 --
NM_001126chr13997 804 68 --2875 217 --
NM_001128chr1693682 3153 2964 2936 2784 1138 1127 1038 482 --12912 --
NM_001135chr151146 ------
NM_001148chr421766 1434 --21686 1597 --
NM_001149chr1051032 929 314 294 225 --21224 908 --
NM_001153chr23669 85 60 ----1628
NM_001159chr22744 202 ------
NM_001167chrX135915 5721 4986 4730 4621 2683 1825 1452 1361 1272 1111 846 102 --25233 323 --
NM_001173chr14104609 4257 3834 3648 1612 1583 1386 1358 706 570 ------
NM_001174chrX32028 317 78 ------
NM_001178chr111333 ------
NM_001186chr2182763 1176 1044 974 889 839 736 80 11111 ----
NM_001198chr631778 498 216 ----1636
NM_001201chr493936 3215 2692 2481 2407 1470 1351 787 358 ----11369
NM_001204chr2207590 7128 6657 6442 6430 5922 5861 5787 5642 5557 4931 2500 2274 2085 1729 1372 1320 936 472 44 25940 2238 26905 1850 35167 2599 1170
NM_001206chr942719 2194 2051 639 12397 ----
NM_001211chr153359 298 267 ------
NM_001215chr11383 ------
NM_001219chr742281 2094 831 21 ------
NM_001222chr10--11883 11443 --
NM_001227chr1041262 1142 1051 915 --1201 --
NM_001231chr11498 ----1162
NM_001233chr752063 1967 777 612 85 12091 ----
NM_001237chr43408 182 92 21169 466 ----
NM_001237chr43408 182 92 21169 466 ----
NM_001241chr242466 1853 673 279 ------
NM_001241chr242466 1853 673 279 ------
NM_001254chr1721070 64 ------
NM_001256chr1762132 1956 1864 671 431 315 12655 ----
NM_001257chr162371 172 ------
NM_001259chr7136396 6193 5651 5279 4904 4502 2539 2471 2457 1064 799 544 101 1293 35393 4103 210 12286
NM_001260chr131337 ------
NM_001261chr911194 179 ----
NM_001262chr11246 --177 --
NM_001270chr52951 451 ------
NM_001278chr101286 --51134 900 829 769 752 --
NM_001282chr1752054 937 338 241 189 --1569 1666
NM_001289chrX--21215 550 1210 --
NM_001290chr42981 734 ------
NM_001300chr101443 ------
NM_001304chr1793670 2975 2783 2729 2604 1457 1264 818 572 ----11133
NM_001310chr1242660 1887 1118 115 --13002 22797 2090
NM_001331chr1152160 1758 1142 628 23 12463 ----
NM_001332chr521085 575 --11075 --
NM_001333chr92243 58 ------
NM_001343chr531731 1240 689 --1124 --
NM_001351chr33603 531 147 11312 1250 --
NM_001356chrX22241 866 12291 1294 --
NM_001364chr1184610 4281 4204 3335 1847 1009 555 406 1888 ----
NM_001378chr21193 ------
NM_001380chr102998 326 ------
NM_001385chr83426 320 276 ------
NM_001390chr1833179 2395 974 13431 13044 --
NM_001391chr1831013 428 226 ------
NM_001396chr2122309 2225 1650 1332 --
NM_001399chrX53854 3657 2873 2443 741 1390 --11223
NM_001400chr141333 1048 965 915 --1309 --
NM_001401chr941328 532 370 203 ------
NM_001408chr131284 417 324 1133 11447 11334
NM_001412chrX93499 2939 2830 2557 2490 2390 2332 684 176 --23537 331 --
NM_001416chr171105 --1340 --
NM_001418chr11--162 ----
NM_001418chr11--162 ----
NM_001419chr1944227 3383 1035 82 1907 11613 --
NM_001422chr113149 84 25 1861 ----
NM_001427chr751875 1644 1580 1442 153 1182 ----
NM_001430chr24735 669 386 66 --1616 --
NM_001438chr173539 3473 2974 2277 1446 326 202 1825 ----
NM_001440chr882094 2047 994 771 580 557 161 90 --11982 --
NM_001448chrX51396 662 457 315 270 --1526 11148
NM_001449chrX31284 1255 301 137 ----
NM_001451chr1631326 1205 450 11261 ----
NM_001457chr331480 1320 66 --1426 --
NM_001460chr1103188 2463 2429 2216 1150 1130 966 918 221 108 11264 1659 --
NM_001463chr21778 1722 ----
NM_001482chr154827 691 637 113 1801 ----
NM_001483chr72916 304 --1777 --
NM_001497chr922275 89 --11844 --
NM_001530chr142254 207 ----1735
NM_001533chr192276 206 128 ----
NM_001542chr142603 2026 717 296 1485 ----
NM_001543chr564651 4036 3891 3419 3077 553 --14242 --
NM_001546chr621116 238 ------
NM_001554chr12480 251 ------
NM_001558chr1151559 1370 1284 705 484 --11702 --
NM_001560chrX22448 62 --32558 378 69 --
NM_001570chr331195 144 115 11393 ----
NM_001584chr1111094 1184 ----
NM_001587chrX32229 1630 563 1745 ----
NM_001604chr115854 732 274 246 222 ------
NM_001614chr17127 1144 ----
NM_001614chr17127 1144 ----
NM_001616chr283310 3251 3177 2565 988 820 440 402 ------
NM_001621chr732655 541 465 ------
NM_001621chr732655 541 465 ------
NM_001634chr62590 148 ------
NM_001635chr75990 921 814 726 392 --11046 --
NM_001650chr1884150 3939 1381 1239 1095 947 598 252 ----13008
NM_001655chr1121917 1784 11407 1807 --
NM_001656chr522082 1773 ------
NM_001658chr131144 1038 755 ------
NM_001660chr32816 97 ------
NM_001661chr174698 635 566 494 ------
NM_001663chr1432555 479 377 1249 ----
NM_001664chr35895 716 180 126 87 --1362 --
NM_001665chr111508 ------
NM_001668chr132256 1851 1509 --1876 --
NM_001677chr12391 366 ------
NM_001679chr3151 ------
NM_001681chr123645 525 290 ------
NM_001682chr1282906 2749 2657 2263 2042 1886 750 310 --12927 --
NM_001683chr332747 2705 1991 --12684 --
NM_001690chr33946 319 77 ----1221
NM_001695chr853707 3219 1696 650 315 1747 31652 902 834 --
NM_001701chr981587 1458 1338 1225 1214 470 424 218 --1478 --
NM_001709chr1172324 2282 2185 1074 665 446 47 12213 1195 --
NM_001714chr124572 488 357 27 ------
NM_001717chr1511186 --191 --
NM_001718chr621142 56 --11347 --
NM_001720chr172008 1752 866 751 658 632 187 --21733 41 --
NM_001721chrX162 ------
NM_001723chr64869 347 312 209 ------
NM_001729chr4------158
NM_001730chr1361539 1300 1074 329 243 186 ------
NM_001730chr1361539 1300 1074 329 243 186 ------
NM_001731chr123944 814 674 ----127
NM_001742chr741861 1370 585 42 --1106 --
NM_001746chr512431 --1499 --
NM_001748chr12935 84 ------
NM_001750chr551936 1643 1523 30 23 --1378 1805
NM_001752chr113525 247 205 ------
NM_001753chr751666 1186 389 181 112 ------
NM_001754chr2143388 728 533 207 23350 2773 13460 11225
NM_001755chr1662220 2205 2044 479 427 375 ------
NM_001759chr1294563 4463 4298 3508 3495 1649 1100 527 191 --15220 --
NM_001777chr333892 3524 3369 --12563 --
NM_001788chr73817 656 617 ------
NM_001789chr331546 1282 103 ------
NM_001792chr182456 397 1850 ----
NM_001797chr163641 575 102 ------
NM_001798chr121840 ------
NM_001806chr1942682 996 264 187 12462 ----
NM_001810chr201230 ------
NM_001830chrX93933 3184 1096 920 821 813 667 481 46 13815 23081 601 --
NM_001839chr13654 538 80 ------
NM_001854chr1--1454 1411 11133
NM_001855chr91757 ------
NM_001858chr674427 4370 4336 3393 2054 572 402 --43365 1962 809 82 13284
NM_001859chr932977 2928 277 13875 22947 341 --
NM_001866chrX--1116 ----
NM_001873chr42208 117 ------
NM_001884chr52379 131 1428 ----
NM_001892chr571506 1473 1403 1084 967 373 51 --11362 --
NM_001893chr171382 ------
NM_001895chr202875 788 ------
NM_001901chr62976 62 ------
NM_001904chr31276 ------
NM_001920chr123691 203 21 1670 ----
NM_001935chr281030 1011 933 884 243 157 59 44 ------
NM_001936chr741774 1737 1602 1379 ------
NM_001938chr161889 1764 1629 682 351 147 21850 475 179 --
NM_001939chrX63242 3229 3075 2812 1031 610 23607 3292 11359 --
NM_001944chr1832294 1476 320 ----12066
NM_001945chr53935 302 206 ------
NM_001946chr121365 21075 1057 ----
NM_001949chr632824 2107 63 --12113 --
NM_001950chr164666 655 645 631 ------
NM_001964chr52305 294 ------
NM_001967chr31380 1445 ----
NM_001968chr41178 ------
NM_001969chr14133505 3042 2911 2820 2759 2655 1371 999 670 537 512 376 256 23718 1564 ----
NM_001970chr172605 545 ------
NM_001977chr43647 478 59 ------
NM_001980chr1252237 1547 1431 73 48 ------
NM_001981chr131936 771 171 --1672 --
NM_001987chr1274328 3881 3159 2748 1368 367 267 2809 383 12960 --
NM_001995chr411148 11236 11256 --
NM_001998chr31392 ------
NM_001999chr531195 1127 236 161 ----
NM_002006chr4114963 4824 4185 3622 2252 1812 1224 1075 264 214 27 1722 13832 --
NM_002009chr1572589 2059 1981 1743 998 739 359 --12407 1332
NM_002010chr131389 ------
NM_002014chr122184 118 ------
NM_002015chr1342433 2240 2059 900 --11136 --
NM_002017chr1111004 ------
NM_002023chr161620 1553 1371 569 438 46 ------
NM_002024chrX72234 1931 1727 1417 516 510 430 --11599 1842
NM_002025chrX159091 8958 7437 7423 6912 6110 6029 5762 2471 2371 1769 1456 1422 1230 207 22825 226 59042 7188 3336 1142 136 --
NM_002026chr22870 707 1777 ----
NM_002028chr1421261 1165 1326 1530 --
NM_002031chr62736 617 ------
NM_002033chr1184059 3110 2907 1138 1115 797 589 344 --23816 3747 --
NM_002035chr1863719 3568 3528 2895 1259 771 1218 13445 --
NM_002039chr42293 241 1178 ----
NM_002040chr2192835 2536 2236 2163 2140 2094 1171 1114 475 1322 12493 --
NM_002048chr921092 831 --1265 --
NM_002052chr821401 406 --11515 --
NM_002056chr23865 820 789 --1600 --
NM_002063chrX11281 1477 ----
NM_002069chr761591 1455 1393 1218 501 114 --11600 --
NM_002076chr1233207 2390 1006 --11032 13218
NM_002077chr931435 334 279 --12118 --
NM_002080chr165976 867 764 201 107 1141 ----
NM_002086chr1712245 12111 ----
NM_002092chr4104744 4062 3956 3876 3682 3537 1854 1631 1582 366 34756 2018 1639 44389 1686 885 50 24692 4509
NM_002094chr161327 ------
NM_002101chr21434 --1387 --
NM_002106chr42314 25 ------
NM_002107chr11329 --1189 --
NM_002126chr17104053 3834 3571 3026 2940 2699 1200 577 248 142 1844 14142 --
NM_002129chr4--1438 ----
NM_002130chr541472 1328 275 82 ------
NM_002137chr732008 1491 113 11981 ----
NM_002140chr931179 421 368 1156 1104 --
NM_002143chr11777 ------
NM_002147chr173829 365 185 ------
NM_002158chr253192 2698 983 639 361 --21274 880 --
NM_002160chr91108 ------
NM_002182chr362750 1914 759 738 618 417 ----12759
NM_002193chr211796 21628 1501 ----
NM_002202chr521101 330 ----1937
NM_002203chr533288 1170 775 --22815 1103 14007
NM_002210chr223104 2481 22390 2271 ----
NM_002211chr10--11053 ----
NM_002214chr7115215 5190 4851 4819 4771 4482 3760 3644 1567 1038 911 --14658 13679
NM_002221chr182760 2239 2107 1880 1802 1177 620 158 --11040 --
NM_002222chr361309 1151 1122 888 390 110 --21302 209 1924
NM_002227chr1170 1368 1294 --
NM_002232chr11269 ------
NM_002233chr111423 ------
NM_002235chr1221321 67 21192 320 ----
NM_002242chr231380 773 359 21903 608 2489 366 --
NM_002245chr12250 72 ------
NM_002247chr105849 748 158 47 37 1552 ----
NM_002252chr22308 90 ------
NM_002253chr441434 897 239 110 1101 ----
NM_002254chr271557 1510 878 812 506 241 66 --172 --
NM_002264chr3134176 4053 3737 3157 3072 1370 1305 1290 1234 1224 803 403 161 23990 1886 33869 3629 126 11141
NM_002265chr1721227 300 ------
NM_002268chr331404 516 376 --1172 --
NM_002270chr575646 5219 3999 3781 1579 962 214 --34938 4465 1585 --
NM_002271chr1321591 706 11863 ----
NM_002293chr182274 2241 2090 1043 912 546 478 200 11072 12538 --
NM_002296chr131238 561 51 11419 1441 --
NM_002312chr133780 406 200 ------
NM_002336chr1274932 4806 3362 3256 1083 767 354 1470 23626 3333 --
NM_002349chr251672 1408 1219 470 264 ------
NM_002356chr682803 2051 2039 1842 1014 896 681 655 ----12847
NM_002358chr42491 66 ------
NM_002373chr151379 2900 251 ----
NM_002374chr2112897 1317 1301 1247 1151 857 806 753 533 360 193 1611 ----
NM_002382chr1431195 1161 47 ------
NM_002387chr5104975 4937 4512 4493 4398 4169 936 702 396 343 13291 11671 --
NM_002395chr631184 976 281 ------
NM_002397chr551969 1839 1728 737 357 --11397 --
NM_002399chr1521462 452 ------
NM_002408chr142701 190 --1225 1301
NM_002409chr2253180 3154 472 395 226 ------
NM_002430chr2222464 2031 ------
NM_002440chr12278 84 ------
NM_002444chrX1560 --11594 --
NM_002445chr831340 1156 600 --175 1612
NM_002448chr44746 667 537 274 ------
NM_002449chr541280 1253 1176 402 ------
NM_002460chr633254 2755 1073 1359 11259 --
NM_002465chr12184 ----1313
NM_002480chr124475 153 135 105 11444 11173 11122
NM_002486chr94736 663 519 459 1509 ----
NM_002487chr152600 576 --1164 --
NM_002499chr1522392 554 1475 ----
NM_002500chr2------1300
NM_002507chr1731931 1235 578 ------
NM_002515chr1472038 1831 1791 1763 1672 1311 725 21300 613 21440 668 --
NM_002520chr5268 49 ------
NM_002522chr1773918 3512 1512 1407 490 381 182 1752 13663 --
NM_002523chr721151 263 --2988 754 --
NM_002524chr141037 999 754 744 ----1305
NM_002539chr21261 ------
NM_002542chr32248 207 ------
NM_002545chr11104335 4134 4117 1429 1067 1028 872 856 634 504 1849 2448 352 --
NM_002546chr82651 220 --1631 1717
NM_002547chrX134201 4126 3901 3127 3103 2782 1602 1351 1309 1181 944 582 92 13003 24292 1441 --
NM_002577chr342944 1586 1266 690 12465 23453 396 11317
NM_002581chr9125481 5449 5027 4669 4648 4280 2172 1739 834 372 329 278 ------
NM_002582chr16165 ------
NM_002590chr132523 416 ------
NM_002594chr2062374 2280 1967 1764 1580 316 ------
NM_002595chr1241647 1532 1385 404 --11831 --
NM_002600chr131791 1443 359 ------
NM_002603chr8------1160
NM_002605chr1521170 1057 --148 --
NM_002607chr72860 186 ------
NM_002610chr282872 2359 2247 1983 976 961 336 147 12259 ----
NM_002612chr731784 1598 285 ------
NM_002613chr16104682 4126 3918 3847 3745 3590 3402 2028 1348 1130 --24614 1174 --
NM_002618chr2198 ------
NM_002623chr201116 ------
NM_002627chr101210 ------
NM_002628chr341161 840 479 377 --2178 143 11183
NM_002629chr102150 96 ----1859
NM_002639chr1841011 901 882 80 --1909 --
NM_002641chrX31695 1676 34 ------
NM_002645chr1162966 2792 2322 1954 793 166 ------
NM_002648chr6------11253
NM_002649chr721224 389 --2364 231 --
NM_002655chr8124402 4309 3540 3330 3240 1205 1123 1033 766 368 332 178 --13397 --
NM_002657chr2093259 3000 2793 2633 2591 1519 864 718 65 ----1786
NM_002660chr2031152 1132 249 ------
NM_002667chr64995 819 510 504 --1172 1843
NM_002677chr832616 1968 37 ------
NM_002687chr1451198 1032 940 441 261 ------
NM_002697chr11206 ------
NM_002703chr42595 72 21490 1202 ----
NM_002706chr21222 ------
NM_002709chr252483 769 530 517 339 33456 2576 91 ----
NM_002710chr123351 151 58 ------
NM_002711chr75681 349 327 119 54 ------
NM_002713chr141136 1000 300 106 --11086 --
NM_002718chr332075 1688 750 --1120 --
NM_002719chr1442291 908 723 305 ------
NM_002731chr132735 1960 1058 22527 22 --12661
NM_002734chr1742050 1489 755 502 --21961 1948 --
NM_002736chr751763 1400 728 469 291 ----12209
NM_002737chr17126553 6004 5164 5061 4994 4393 794 756 722 337 251 192 26370 4384 1659 --
NM_002738chr1631126 706 29 --11120 --
NM_002740chr382668 1815 1771 1721 388 316 271 158 ------
NM_002742chr142174 69 1144 ----
NM_002745chr22124272 3795 3578 3335 2883 2765 1625 1533 1500 1074 843 676 --13972 --
NM_002748chr1581182 852 762 488 178 105 79 22 --1196 --
NM_002752chr52426 237 ------
NM_002755chr152772 156 ------
NM_002763chr11160 ------
NM_002765chrX3429 250 170 --21337 1189 --
NM_002806chr141337 --1325 --
NM_002816chr17------2268 215
NM_002822chr1241694 1209 1193 675 ------
NM_002825chr72602 98 1632 ----
NM_002828chr182390 342 ------
NM_002829chr941208 901 372 204 11161 1383 --
NM_002837chr1242980 2964 1199 900 24430 3716 ----
NM_002839chr953590 3075 2551 622 543 1236 33102 2758 670 1704
NM_002840chr121532 402 ------
NM_002841chr32191 176 ------
NM_002843chr1132954 1138 719 --23109 209 1666
NM_002844chr621033 541 1126 ----
NM_002847chr731512 1484 1464 11177 1358 11543
NM_002849chr123755 293 188 ------
NM_002850chr192810 485 --11265 --
NM_002851chr71720 131 188 --
NM_002857chr152387 1964 1943 824 47 ------
NM_002858chr121013 429 --1395 --
NM_002860chr103511 254 60 ------
NM_002865chr8--1213 ----
NM_002868chr1242397 2322 2138 475 ------
NM_002869chr1121576 377 12084 ----
NM_002874chr932337 1985 1917 --12186 --
NM_002882chr22197 ------
NM_002886chr3125162 4828 4476 4196 4030 3848 3399 3243 2062 1468 1442 1270 31968 1705 690 24075 3606 --
NM_002892chr1421570 1082 ------
NM_002893chrX1278 ------
NM_002894chr181183 ------
NM_002902chr153651 256 123 ------
NM_002906chr1172205 2049 1665 1636 885 707 676 1301 1448 --
NM_002912chr64926 829 735 347 ----2285 116
NM_002927chr11503 --1617 --
NM_002940chr431556 731 537 1452 ----
NM_002941chr351490 1326 635 480 146 ------
NM_002953chr12760 286 --2791 689 --
NM_002955chr6----21282 576 1335
NM_002956chr1241162 466 458 385 1500 1873 11170
NM_002959chr173043 2750 1773 1474 1015 507 378 11257 ----
NM_002970chrX1279 ------
NM_002973chr12189 ------
NM_002977chr283271 3250 1354 654 631 389 312 301 1868 ----
NM_002988chr172173 117 ------
NM_002994chr471654 1314 707 680 653 585 455 --1256 --
NM_002998chr821838 193 --2389 332 --
NM_003001chr152151 1769 752 74 25 ------
NM_003010chr1751964 1805 1783 628 312 --1905 --
NM_003011chr931163 461 230 --11109 --
NM_003016chr1741271 689 521 267 ----1677
NM_003017chr611216 ----147
NM_003020chr15------1361
NM_003026chr941224 1130 1124 873 1363 1989 1228
NM_003028chr963458 2499 1075 1006 864 683 --22789 1138 --
NM_003030chr331895 1548 1538 --12015 --
NM_003031chr1621035 69 --1971 --
NM_003036chr131211 952 877 1391 1462 --
NM_003042chr331719 390 288 --22142 1582 11541
NM_003043chr354273 4120 3907 1185 403 21627 992 ----
NM_003045chr1375028 4740 3979 1743 1231 846 345 14530 ----
NM_003051chr141610 1591 348 109 151 --11690
NM_003071chr3------11292
NM_003074chr331816 404 396 ------
NM_003079chr171639 11023 ----
NM_003081chr205820 282 262 255 75 --3451 220 140 --
NM_003088chr7----11107 --
NM_003099chr1596152 5930 5556 2443 2166 2075 1875 1867 167 ----11907
NM_003100chr5173 ------
NM_003108chr287300 7025 6610 4842 1459 1423 1264 485 --15766 14812
NM_003111chr231068 509 346 --11308 --
NM_003112chr772925 2285 2239 2226 2172 852 655 ------
NM_003113chr21346 ------
NM_003118chr552061 1540 1348 387 245 --11548 --
NM_003128chr272764 1068 944 876 551 545 180 12236 11752 --
NM_003130chr751277 1116 905 536 359 ------
NM_003131chr612305 ------
NM_003133chr14760 350 226 124 ------
NM_003135chr52133 101 ------
NM_003136chr142337 315 ------
NM_003140chrY1132 ------
NM_003142chr2127 ------
NM_003143chr7----130 --
NM_003144chr652187 1929 1526 712 174 11424 12157 --
NM_003149chr351513 1418 1143 601 60 1138 ----
NM_003150chr1722090 208 ----191
NM_003152chr1731235 485 376 --1319 --
NM_003155chr832646 2471 43 1492 --11009
NM_003157chr31720 --183 --
NM_003161chr1753557 3427 3385 2522 788 13412 ----
NM_003162chr23951 129 85 ----11021
NM_003170chr17------1586
NM_003174chr103844 767 241 ------
NM_003178chr352286 2107 1897 602 293 11947 21918 1654 --
NM_003182chr71495 --135 --
NM_003182chr71495 --135 --
NM_003183chr2----1579 --
NM_003184chr831032 450 131 1148 ----
NM_003185chr203460 397 224 --11368 --
NM_003188chr63827 689 213 ------
NM_003189chr193072 2886 2305 2292 2238 1307 1223 1029 914 ----1364
NM_003199chr18155501 4671 4607 4520 3765 3734 3479 2125 2081 2041 1883 1842 1590 328 66 14887 1697 11392
NM_003211chr1221366 252 --2700 464 11735
NM_003216chr2262981 2938 2416 902 772 493 ----12609
NM_003217chr1241892 238 196 53 --11526 --
NM_003220chr621575 1225 ----11128
NM_003221chr663607 3104 1571 877 838 226 34116 3731 3677 24051 2765 12921
NM_003223chr161619 --1112 --
NM_003236chr273285 2910 2439 1336 1229 1111 173 23453 1347 1435 --
NM_003242chr351931 1719 904 703 268 1475 ----
NM_003246chr1541469 1358 1327 538 --21724 1528 --
NM_003248chr51139 ------
NM_003253chr2121678 166 21764 385 ----
NM_003255chr1742322 2088 954 437 12003 ----
NM_003257chr1521136 124 2920 336 ----
NM_003262chr3154893 4337 3831 3799 1814 1610 1589 1353 986 871 665 639 248 155 87 2618 217 14126 --
NM_003268chr1274 26 ------
NM_003274chr2182925 2310 2184 2117 1893 1867 351 326 12274 ----
NM_003290chr1941245 1205 1149 308 ------
NM_003291chr132620 595 ------
NM_003298chr385727 5571 5181 4401 2112 1926 768 554 --2643 134 1816
NM_003299chr12158 ------
NM_003304chr341501 1360 1011 479 ------
NM_003319chr251013 701 630 189 147 ------
NM_003320chr1163828 3519 2963 2829 2805 1666 1674 24422 1660 --
NM_003334chrX173 ------
NM_003336chrX2870 259 1941 ----
NM_003337chr52675 506 ------
NM_003338chr1051805 1494 1390 254 201 2742 112 11923 --
NM_003339chr531350 459 107 179 ----
NM_003340chr431397 1315 106 ----2362 160
NM_003341chr33668 449 267 ------
NM_003342chr1733160 3081 572 12612 12559 12582
NM_003344chr72217 177 --11130 --
NM_003348chr1221199 265 11557 31180 1138 213 11126
NM_003349chr202144 62 1183 11129 --
NM_003350chr83907 227 130 ------
NM_003359chr43982 477 69 ------
NM_003368chr13642 183 88 ------
NM_003369chr1152789 2386 2144 467 381 --11120 12230
NM_003373chr1021982 599 ------
NM_003376chr621735 1444 ------
NM_003376chr621735 1444 ------
NM_003385chr221037 254 --1182 --
NM_003387chr252931 2881 2012 1873 958 12199 11893 12033
NM_003390chr111182 11010 1995 --
NM_003392chr344366 4120 3299 642 --13535 --
NM_003400chr21196 --1691 --
NM_003404chr2031840 1673 1661 1478 2823 470 --
NM_003406chr851675 650 490 209 55 --1200 --
NM_003409chr1821432 932 ------
NM_003410chrX62526 2072 739 494 392 56 1547 ----
NM_003411chrY4662 556 398 53 1500 ----
NM_003412chr353114 3051 2836 2304 775 23093 2608 ----
NM_003413chrX31959 1275 298 1209 11698 --
NM_003418chr3----1774 --
NM_003423chr1922600 933 1762 ----
NM_003452chr91216 1168 1975 --
NM_003453chr13----1686 --
NM_003463chr632121 1362 453 12418 32836 2257 241 --
NM_003466chr221635 562 12336 ----
NM_003469chr22173 156 ------
NM_003471chr381966 1724 1478 876 859 609 312 210 21457 171 --11875
NM_003472chr621304 140 ------
NM_003478chr1143129 2570 2222 415 1905 ----
NM_003483chr1232550 777 659 --1110 --
NM_003487chr171114 ------
NM_003489chr2193088 3014 3006 2125 1301 1056 965 779 118 --12569 --
NM_003505chr721809 1731 1374 ----
NM_003507chr22753 634 --11828 --
NM_003558chr91479 --1209 --
NM_003566chr1293244 2771 2632 2293 2146 2136 2130 579 194 --1699 --
NM_003574chr1885142 4855 4822 3919 2023 1913 1495 1242 24097 905 1360 --
NM_003576chr1362717 1830 960 866 449 226 ----1860
NM_003581chr23731 154 146 1967 ----
NM_003583chr1273891 3412 3185 2974 2921 825 157 --32682 1299 113 --
NM_003589chr1341319 1297 1107 143 ------
NM_003590chr2163872 3395 3234 3137 2942 2913 2840 1605 1571 1264 1237 803 570 453 339 216 ------
NM_003591chr10150 --1102 --
NM_003592chr72411 394 ------
NM_003601chr41226 ------
NM_003603chr442132 1937 1632 1420 11986 --1854
NM_003607chr1134123 4059 3619 3489 3114 3074 1715 1686 1488 961 893 701 65 32965 1017 855 ----
NM_003613chr152273 35 ------
NM_003615chr3123904 3769 3542 3309 2832 2598 1327 1158 1145 1088 975 491 23580 2638 ----
NM_003618chr221267 1122 --1332 --
NM_003626chr1131029 1018 235 153 ----
NM_003628chr2----1493 --
NM_003629chr152295 2236 1315 1098 529 13293 --12352
NM_003630chr63265 133 36 --1704 --
NM_003631chr102967 117 ------
NM_003632chr172783 81 --1247 --
NM_003633chr522191 594 21038 354 ----
NM_003651chr121426 ------
NM_003659chr251200 982 236 215 105 ------
NM_003663chr3143347 3293 3247 2782 2737 2669 2484 1386 1360 755 743 251 91 74 --23031 984 13121
NM_003664chr53538 96 74 ------
NM_003668chr12195 ------
NM_003671chr943319 3121 2569 489 13550 ----
NM_003672chr121920 630 21635 1383 155 --
NM_003676chr14864 775 270 254 ------
NM_003677chr1222000 1804 --1406 --
NM_003681chr2196178 5941 5550 4593 4074 2490 910 133 76 --14929 --
NM_003687chr531183 1056 168 --1915 --
NM_003688chrX----144 --
NM_003692chr91707 ------
NM_003701chr1321021 354 ----1377
NM_003705chr22667 348 --1164 --
NM_003713chr121734 1373 ------
NM_003714chr593034 2592 2356 1019 760 754 610 274 53 32990 992 914 22344 2222 12403
NM_003718chr72523 29 --136 --
NM_003725chr122305 121 --1126 --
NM_003728chr4------1436
NM_003743chr272245 2218 1859 1799 1757 534 121 12107 1311 --
NM_003746chr121199 ------
NM_003750chr102676 314 1357 1243 --
NM_003756chr8----1189 --
NM_003758chr1531425 508 26 1264 ----
NM_003758chr1531425 508 26 1264 ----
NM_003759chr463808 3590 3068 1272 232 172 23674 335 2787 188 --
NM_003763chr2052039 1974 702 479 420 12511 ----
NM_003768chr121640 187 ------
NM_003772chr113979 807 377 1127 1160 --
NM_003774chr1262948 1308 998 855 576 143 --1115 --
NM_003783chr151038 856 381 362 304 ------
NM_003787chr1821390 530 ------
NM_003794chr31964 11047 ----
NM_003795chr6----1582 --
NM_003799chr18144457 4238 4122 3650 3023 3015 2849 1318 1240 1010 407 253 152 63 21343 847 14576 --
NM_003800chr662358 2146 2126 1668 568 466 1118 1663 1225
NM_003816chr831406 1090 942 ------
NM_003825chr1521253 27 21502 1464 ----
NM_003829chr93999 184 148 ------
NM_003831chr1841853 1496 1292 202 11504 1246 --
NM_003840chr851908 1610 1552 576 36 11545 ----
NM_003850chr132438 207 ------
NM_003860chr111305 ------
NM_003861chr1462705 2442 2307 1946 1938 1002 --12245 --
NM_003870chr155537 467 376 233 169 --12127 --
NM_003872chr232631 1160 267 125 12638 --
NM_003873chr1072463 2314 2007 1914 1886 1870 277 ----1225
NM_003884chr341818 1604 1167 534 ------
NM_003885chr1732561 2091 943 ------
NM_003887chr241701 1622 1583 1543 ----12321
NM_003888chr1561500 1379 1106 506 376 40 ------
NM_003902chr11584 ------
NM_003905chr16----1128 --
NM_003909chr853024 2422 1014 133 67 22970 523 21966 1073 11045
NM_003913chr6103930 3549 3243 2912 2639 1295 954 862 343 283 24289 2832 34080 3770 994 --
NM_003916chrX21331 1276 11369 ----
NM_003921chr141452 651 589 347 194 21286 83 --
NM_003924chr41176 ------
NM_003930chr731747 1693 118 1268 12261 12249
NM_003931chr62695 195 ------
NM_003932chr2241678 1168 484 310 11764 --1417
NM_003934chr941282 455 189 79 ------
NM_003938chr191982 --1156 1174
NM_003941chr742450 1728 1622 158 --12332 --
NM_003947chr331311 997 401 ------
NM_003948chr442429 2084 1031 108 22361 1825 ----
NM_003958chr683793 3275 2902 2527 2510 1581 1318 449 32653 759 24 43405 3023 2830 2669 1784
NM_003966chr5187727 7629 7263 6608 6212 6092 6085 6011 5597 4872 4764 2655 2328 1983 1646 1035 1023 549 37348 7190 4896 46746 5399 5134 4853 11505
NM_003968chr33500 459 77 --1571 --
NM_003972chr1011306 ------
NM_003980chr631287 1032 121 --11107 --
NM_003983chr1654453 4258 1108 555 241 ------
NM_003994chr12103829 3661 3510 3473 3119 2939 1551 333 274 211 11341 33733 1099 126 --
NM_004004chr131324 1130 1453 --
NM_004006chrX2917 671 ----1632
NM_004007chrX2917 671 ----1632
NM_004009chrX2917 671 ----1632
NM_004010chrX2917 671 ----1632
NM_004011chrX2917 671 ----1632
NM_004012chrX2917 671 ----1632
NM_004013chrX2917 671 ----1632
NM_004014chrX2917 671 ----1632
NM_004015chrX2917 671 ----1632
NM_004016chrX2831 585 ----1546
NM_004017chrX2917 671 ----1632
NM_004018chrX2831 585 ----1546
NM_004019chrX1320 ------
NM_004020chrX2917 671 ----1632
NM_004021chrX2831 585 ----1546
NM_004022chrX2831 585 ----1546
NM_004023chrX2831 585 ----1546
NM_004024chr11408 1240 ----
NM_004028chr1884150 3939 1381 1239 1095 947 598 252 ----13008
NM_004040chr22951 122 --1903 --
NM_004050chr1412393 ----12716
NM_004067chr731140 562 517 --11495 --
NM_004068chr31422 ------
NM_004074chr11174 ------
NM_004077chr1211146 1107 ----
NM_004079chr142280 2036 901 459 12450 ----
NM_004081chrY51322 706 699 538 235 --1346 11338
NM_004089chrX3789 366 87 ----11019
NM_004094chr1482996 2591 2152 2071 957 671 488 228 --12969 --
NM_004096chr1052165 1868 1331 717 691 11322 --21348 175
NM_004100chr652190 1987 1939 1831 675 1338 1871 --
NM_004113chr331884 1790 470 ------
NM_004114chrX31063 807 141 --1909 --
NM_004117chr652197 1699 1458 1438 272 ------
NM_004124chr1492737 2235 1332 1047 962 855 699 577 166 23241 915 2430 136 --
NM_004132chr1041140 908 462 171 --11129 --
NM_004133chr832581 2315 834 1207 1294 --
NM_004156chr82609 508 ------
NM_004157chr31912 ------
NM_004161chr21194 1495 ----
NM_004162chr331140 923 463 ------
NM_004170chr951811 1724 1407 505 56 21579 107 1232 --
NM_004171chr11248717 8408 8237 8161 7384 7307 7061 6050 5959 3795 3710 3360 3281 3137 2897 2822 2797 1828 1209 1108 1051 994 968 553 27196 1538 58289 6639 3740 2668 1688 --
NM_004177chr1121305 553 ----1695
NM_004215chr82562 64 ------
NM_004225chr831282 1012 454 144 ----
NM_004226chr2----123 --
NM_004229chrX61923 1553 1495 1464 596 386 12084 21781 852 --
NM_004232chr1893881 3753 3303 2743 2588 2484 1392 1314 672 --1902 --
NM_004237chr53831 612 216 ------
NM_004238chr21245 ------
NM_004253chr94948 743 701 364 158 ----
NM_004261chr12944 221 1758 1716 --
NM_004263chr21142 1253 11761 1441
NM_004274chr1483030 2972 2154 1057 692 592 230 33 1508 22667 2170 --
NM_004279chr74941 533 303 85 --1499 --
NM_004280chr62369 311 ------
NM_004282chr64647 639 506 190 ------
NM_004286chr2262820 2516 1761 418 258 43 ------
NM_004296chr1442567 1210 439 69 12870 --11104
NM_004311chr1083127 2906 2132 749 574 397 195 95 12380 ----
NM_004319chr172471 2249 900 747 284 183 59 ------
NM_004323chr972592 2211 2083 1814 529 187 113 --12226 --
NM_004326chr11185 ------
NM_004329chr1021419 1230 2915 567 --11333
NM_004330chr152773 284 --11164 --
NM_004331chr842618 2386 2214 314 11708 ----
NM_004337chr871902 1836 436 370 288 242 133 ------
NM_004338chr18126919 6647 6612 6315 6241 5955 5605 5595 5376 2643 2431 197 16094 24591 1711 --
NM_004341chr21231 ------
NM_004342chr742139 1680 442 110 2303 280 11624 --
NM_004346chr431422 427 83 --1509 --
NM_004349chr821244 970 ------
NM_004356chr111504 ------
NM_004364chr192964 354 ------
NM_004370chr672098 1824 1722 1413 817 561 524 --1598 --
NM_004378chr151208 ------
NM_004379chr221392 1307 --21505 149 --
NM_004380chr1642215 2093 859 188 ------
NM_004382chr1721052 398 ------
NM_004384chr572124 1942 1765 1731 500 140 69 --146 --
NM_004385chr52125 34 ------
NM_004392chr1352466 2430 2392 1702 1001 2642 368 ----
NM_004393chr331495 840 264 ------
NM_004396chr17------164
NM_004397chr11104316 3774 3593 2918 2608 1702 1555 1257 490 92 --12865 --
NM_004404chr241534 1421 467 375 --2586 574 --
NM_004407chr42748 169 1982 ----
NM_004414chr2131303 1218 251 ------
NM_004417chr51175 1229 ----
NM_004419chr102387 299 ------
NM_004429chrX31380 408 389 --1415 --
NM_004432chr942336 1885 1599 889 1914 ----
NM_004436chr11560 ------
NM_004437chr133327 3176 1243 1701 ----
NM_004438chr263239 2543 1057 361 133 89 13310 1409 1199
NM_004439chr41124 ------
NM_004440chr621963 1869 --1426 --
NM_004447chr1231075 1062 91 --1857 --
NM_004448chr171594 ------
NM_004449chr2111397 --1229 --
NM_004454chr311666 --1120 --
NM_004457chr231298 1271 195 1533 ----
NM_004458chrX51866 1057 984 935 482 ------
NM_004459chr1761943 1642 1485 779 338 207 --2492 438 --
NM_004464chr494279 4204 3015 2827 1398 1367 900 888 501 --2542 131 --
NM_004469chrX133 1486 ----
NM_004482chr23938 844 736 ------
NM_004496chr141133 --11344 --
NM_004500chr1432047 1583 390 --11402 --
NM_004501chr143503 1336 1060 725 23574 3535 33011 2801 262 --
NM_004504chr252685 2667 1857 1085 431 12142 ----
NM_004505chr1741487 1475 1422 1337 11437 11971 --
NM_004506chr61518 --2491 72 --
NM_004520chr51228 178 ----
NM_004523chr1021482 220 21396 1056 1494 --
NM_004525chr231362 553 423 ------
NM_004529chr941451 1057 937 183 ------
NM_004535chr202487 203 ------
NM_004537chr1221350 390 ----182
NM_004538chrX2696 247 1577 --1785
NM_004540chr212862 568 1645 ----
NM_004561chr1131264 645 190 --11747 --
NM_004565chr1----1695 --
NM_004571chr2132142 908 836 --22098 545 --
NM_004575chr421388 1143 ------
NM_004576chr5--1397 --183
NM_004586chrX44979 1909 1146 679 177 31310 919 700 --
NM_004588chr1173998 3378 3236 2687 2615 1197 1062 ------
NM_004593chr33871 289 173 ------
NM_004598chr572914 2230 998 922 604 548 65 --13258 12684
NM_004600chr131323 1260 1023 1509 1463 --
NM_004606chrX1254 193 ----
NM_004612chr964636 3494 1791 1235 515 326 --44034 1096 801 744 --
NM_004615chrX2951 306 ------
NM_004630chr112932 795 --11118 --
NM_004634chr3198 --2519 485 --
NM_004637chr33983 860 544 ----1401
NM_004642chr124656 493 265 61 ------
NM_004643chr141816 ------
NM_004654chrY11220 ------
NM_004655chr1731338 1079 1008 ------
NM_004663chr1521506 1445 ------
NM_004666chr631390 1282 1110 --1168 --
NM_004673chr141460 1111 1066 606 --31367 1326 168 --
NM_004681chrY2675 92 ------
NM_004684chr41326 ------
NM_004685chr1362919 2609 2213 1193 1084 170 2801 743 ----
NM_004686chr841604 536 360 187 21308 423 ----
NM_004687chr1771892 1877 1661 1578 1453 821 739 ------
NM_004703chr1732522 542 49 --1398 --
NM_004709chrX31306 446 362 --1459 --
NM_004713chr144585 532 294 241 ------
NM_004717chr741370 427 102 46 ------
NM_004719chr1221904 38 22152 531 ----
NM_004725chr103938 518 389 11454 ----
NM_004726chrX114940 4613 4063 3990 3881 2309 2259 2212 1684 915 842 14776 15583 --
NM_004730chr541418 716 700 673 ------
NM_004731chr1271852 1844 1453 504 394 60 41 21771 672 ----
NM_004734chr1353237 3139 3077 3012 2275 ----1195
NM_004736chr132053 1510 1412 --1232 --
NM_004742chr311397 1497 --11289
NM_004745chr886447 6042 5884 4842 4314 4279 2240 1093 16757 ----
NM_004748chr1594080 4058 2852 1439 1150 605 554 465 199 34028 3819 1487 1963 --
NM_004757chr43196 130 95 1525 ----
NM_004760chr752191 1791 796 736 387 --11896 --
NM_004764chr122201 89 ------
NM_004772chr521468 397 11018 ----
NM_004774chr1763090 2837 892 513 439 376 12252 1612 --
NM_004775chr1882391 2167 2119 2077 2018 1785 1753 963 --12003 1699
NM_004779chr541097 522 116 69 --1872 1282
NM_004781chr131728 1501 94 --1327 --
NM_004781chr131728 1501 94 --1327 --
NM_004787chr41156 ------
NM_004788chr1142109 1723 1691 797 12764 ----
NM_004789chr93355 329 48 ------
NM_004796chr1432238 2211 2013 --1552 --
NM_004798chr2063614 2895 1321 1289 526 38 23261 2754 22531 806 --
NM_004799chr1----165 --
NM_004800chr132264 193 ------
NM_004801chr22243 45 1532 --152
NM_004805chr241096 1000 967 316 ----11157
NM_004808chr1083334 3278 2851 2392 2254 443 414 156 --140 --
NM_004815chr1114086 3175 3168 1976 1810 1133 1074 918 495 210 191 2729 302 14642 --
NM_004817chr92598 584 ------
NM_004824chr631366 1335 388 ------
NM_004831chr1921112 423 ------
NM_004834chr223219 697 --12071 --
NM_004840chrX52119 2001 556 226 194 ----11576
NM_004842chr621682 1452 21535 366 1447 1379
NM_004844chr3176 --11120 --
NM_004849chr631667 1166 619 11211 ----
NM_004850chr211094 --11505 --
NM_004857chr1484691 4119 4094 3242 2930 1183 102 61 11863 11072 14057
NM_004863chr1445116 5103 4767 1176 22007 815 ----
NM_004867chrX4608 572 469 227 ------
NM_004871chr17104364 3953 3702 3133 1481 1330 1095 979 939 783 22946 1017 --1903
NM_004879chr112915 261 ------
NM_004883chr51152 ------
NM_004888chr94687 408 197 184 ------
NM_004893chr52119 103 ------
NM_004896chr1041385 1021 517 134 --21486 1059 --
NM_004898chr452846 2620 2337 879 622 12323 ----
NM_004902chr203551 65 55 --1109 --
NM_004904chr7136559 6323 6025 4807 4436 4355 4334 4177 2271 2054 1823 652 127 45115 4568 4100 1831 14211 --
NM_004906chr62549 34 ------
NM_004912chr731490 1220 1120 ------
NM_004921chr172554 2179 1967 702 631 538 69 1263 12285 --
NM_004922chr1021000 898 ------
NM_004926chr141522 ------
NM_004929chr841115 1053 352 93 11091 ----
NM_004932chr541720 1713 1145 1109 ------
NM_004938chr92852 457 --1928 --
NM_004947chr352562 1860 785 713 702 --22045 1835 --
NM_004949chr1892107 1741 1651 1432 756 595 475 421 22 ------
NM_004956chr7114029 3808 2941 1835 1518 1428 870 829 726 563 450 --23952 3721 --
NM_004964chr11544 ------
NM_004965chr21----1189 --
NM_004966chr104930 675 254 35 ------
NM_004969chr103510 486 70 ------
NM_004979chrX41109 763 474 37 1354 ----
NM_004982chr122656 486 ------
NM_004985chr1263772 3656 1817 1604 371 79 13759 44367 4074 3662 3008 13479
NM_004992chrX118034 6941 6264 6226 6197 5516 5490 5147 3093 2014 1248 --12834 --
NM_004992chrX118034 6941 6264 6226 6197 5516 5490 5147 3093 2014 1248 --12834 --
NM_004993chr1421297 415 ------
NM_004996chr1651747 589 537 490 21 ------
NM_004999chr664441 4410 1537 1490 1130 845 ------
NM_005010chr731898 749 691 --22063 1459 --
NM_005020chr73548 452 104 ------
NM_005026chr152045 1767 1603 754 545 ------
NM_005028chr1062163 2133 2111 1860 1794 96 ------
NM_005032chrX2316 118 ------
NM_005044chrX64152 3891 2782 902 565 247 1532 13291 23342 788
NM_005052chr171349 ------
NM_005056chr1275438 5137 4645 1533 910 888 135 --14779 --
NM_005057chr191809 1708 1212 467 375 360 347 322 266 ----2418 73
NM_005063chr1021449 466 13145 --1513
NM_005065chr1494351 4264 4187 4180 3707 1995 1712 1330 913 21390 68 35261 1465 48 --
NM_005066chr11751 1835 ----
NM_005077chr91462 ------
NM_005079chr822986 1046 --12802 --
NM_005080chr222733 633 ------
NM_005087chr33865 537 122 --1552 --
NM_005093chr20105252 4903 4769 4391 4126 975 937 918 898 848 ----31179 1062 717
NM_005095chr161679 1667 1603 1468 887 646 12078 11970 --
NM_005096chrX1164 ----1477
NM_005099chr111024 --11316 --
NM_005103chr111337 ------
NM_005109chr312569 2677 256 ----
NM_005114chr42534 512 156 ----
NM_005116chr2084027 3671 3583 2934 1029 739 617 45 1665 1425 24260 415
NM_005119chr12863 355 --2361 260 --
NM_005121chr1753001 2674 983 569 78 --197 --
NM_005124chr61816 1387 --188
NM_005126chr331905 1482 702 --1282 --
NM_005135chr1543394 3162 1191 430 2249 174 ----
NM_005140chrX41021 811 767 652 ------
NM_005149chr131414 1270 972 11191 1186 1914
NM_005151chr1872430 2303 895 435 310 186 57 --21895 115 --
NM_005153chr16----1201 --
NM_005154chr152655 28 ------
NM_005155chr61559 --1230 --
NM_005156chr985403 4983 3933 3332 1881 1721 1673 1373 --25144 363 --
NM_005168chr221519 139 ------
NM_005171chr1231195 1130 361 11338 ----
NM_005180chr1031711 1137 423 --11675 --
NM_005188chr11178278 8199 8193 7856 7078 6038 5948 3091 3015 2629 2447 2421 2271 2060 1796 1767 1028 1216 37418 2171 1127 37695 6113 1182
NM_005197chr1466136 5240 4480 2375 1185 39 35587 3876 553 25354 4932 25834 267
NM_005202chr112152 ----11827
NM_005204chr103800 383 208 ------
NM_005208chr171133 ------
NM_005220chr1741478 1455 572 312 ------
NM_005231chr1121130 1101 11342 ----
NM_005233chr332168 475 180 12130 21723 518 --
NM_005235chr2207380 7249 7011 6918 6893 6811 6461 6406 5925 5623 2725 1962 1768 1632 1289 854 654 414 404 220 --12174 --
NM_005238chr1163509 1054 837 617 306 111 ------
NM_005239chr2161915 1794 1630 804 592 439 1577 ----
NM_005242chr531331 1267 359 1999 ----
NM_005245chr42542 232 ------
NM_005249chr14144 ------
NM_005257chr1831014 995 443 ------
NM_005259chr211170 ----11340
NM_005264chr102909 661 --155 --
NM_005276chr124681 599 207 115 ------
NM_005276chr124681 599 207 115 ------
NM_005277chr461623 1593 1542 1193 617 250 130 ----
NM_005281chr11789 ------
NM_005292chr132128 122 ------
NM_005296chrX4886 806 800 121 1270 ----
NM_005313chr1541344 1266 1003 291 1453 ----
NM_005318chr221165 ------
NM_005327chr42289 218 ------
NM_005339chr493647 3304 2973 2903 1445 716 185 121 59 1506 --11512
NM_005342chrX12821 ------
NM_005358chr1361813 1667 1510 748 709 412 ------
NM_005359chr18105352 5227 5052 4794 4386 4014 1834 1613 1552 104 14522 55257 4024 2423 1847 325 --
NM_005369chrX2246 162 --158 --
NM_005373chr131563 1502 210 --11252 --
NM_005375chr6--31105 986 820 1296 --
NM_005376chr111105 1996 ----
NM_005381chr2--133 ----
NM_005384chr91102 --144 --
NM_005385chr362413 2270 267 237 141 41 ------
NM_005386chr201568 ------
NM_005387chr112218 151 --1244 --
NM_005389chr62591 98 ------
NM_005397chr763608 2895 2516 1255 718 395 ----11566
NM_005398chr1021144 1027 ------
NM_005399chr173573 2775 1372 1308 1213 1178 566 1155 --11189
NM_005400chr272589 2583 2185 2104 1919 1153 1101 1699 12004 --
NM_005401chr1175 --1254 --
NM_005402chr741592 623 369 26 --1521 --
NM_005407chr1421280 347 --11439 --
NM_005409chr411069 2880 40 1432 --
NM_005414chr31122 --291 23 --
NM_005415chr2----1757 --
NM_005418chr111536 ------
NM_005426chr11312 ------
NM_005433chr1832507 2429 304 ------
NM_005436chr1093949 3809 3713 2663 1344 1129 1064 971 117 --21148 880 --
NM_005437chr1031478 1350 1292 ------
NM_005438chr111253 ------
NM_005455chr141790 406 345 337 --21763 61 --
NM_005460chr51518 ------
NM_005461chr201338 11669 ----
NM_005465chr151628 1321 568 335 32 --1318 --
NM_005475chr1253178 2888 2259 2225 187 13120 12861 12762
NM_005487chr2251957 1859 1770 1548 405 ------
NM_005491chrX42162 2017 1969 1352 32149 579 42 ----
NM_005494chr7--151 1610 --
NM_005497chr17144559 4057 3757 2459 2406 2287 2279 1949 1934 1284 953 234 99 86 ------
NM_005499chr192659 140 --146 --
NM_005502chr973181 2906 2787 2183 2146 1251 904 13128 12705 1954
NM_005504chr12106498 5600 5023 4246 2429 2365 2244 1589 947 539 26189 73 24352 1049 14041
NM_005509chr531471 1393 734 ------
NM_005513chr341547 1494 614 59 ----1527
NM_005517chr151265 1187 1181 548 403 ------
NM_005520chr52570 299 ------
NM_005521chr102267 148 1764 ----
NM_005522chr76541 489 358 351 124 80 ------
NM_005523chr731531 1400 1174 --11459 --
NM_005525chr12158 73 ----163
NM_005530chr15----1271 --
NM_005542chr751938 1737 1243 763 78 ------
NM_005566chr11123 ----184
NM_005578chr374337 4050 3974 3947 1957 892 420 --45092 1858 314 108 --
NM_005584chr132556 149 1740 1588 --
NM_005593chr121563 ------
NM_005595chr1--1215 ----
NM_005596chr975254 4661 2538 1797 1681 1586 507 ------
NM_005599chr121422 422 11526 11166 --
NM_005602chr31941 11260 1914 --
NM_005604chr682562 2491 2334 2245 1963 1899 1007 930 ------
NM_005607chr83875 184 131 ------
NM_005610chr11320 ------
NM_005613chr121855 1485 21959 671 ----
NM_005614chr7----2952 120 --
NM_005629chrX11368 ------
NM_005637chr183813 733 634 ------
NM_005638chrX121766 1592 1575 1488 1441 1183 1177 406 270 170 159 98 11209 ----
NM_005639chr12388 56 27 --1448 1544
NM_005644chr1----1411 --
NM_005647chrX42726 2368 2354 129 1605 13429 --
NM_005650chr2241382 1103 500 425 11206 ----
NM_005655chr83484 468 203 ------
NM_005659chr221377 --144 --
NM_005662chr81427 ------
NM_005665chr174864 4462 3281 1619 1497 1084 172 2468 451 31941 931 161 13043
NM_005668chr544358 3827 3031 2925 13501 14610 11276
NM_005669chr532399 922 525 --22255 857 --
NM_005681chr11227 ------
NM_005688chr32412 110 --1958 --
NM_005707chr1541328 1255 809 489 ------
NM_005708chr131341 143 ----
NM_005715chr632157 741 30 11056 32316 1833 328 --
NM_005716chr191649 2617 499 ----
NM_005717chr131278 133 96 --123 --
NM_005721chr231091 966 713 1988 21013 1000 --
NM_005722chr222482 2419 12293 ----
NM_005724chr152555 90 ------
NM_005725chr172186 1888 1823 810 591 129 74 11924 ----
NM_005730chr1253476 3119 2289 1214 952 ------
NM_005734chr114664 309 200 172 141 ----
NM_005737chr232805 2588 2046 --1593 12212
NM_005738chr762007 1814 1303 1292 233 22 ------
NM_005739chr1542283 1513 281 49 11550 12232 --
NM_005746chr731760 1052 131 --11702 --
NM_005748chr1263374 2773 1266 797 654 608 11367 --12122
NM_005749chr171147 --1155 --
NM_005754chr531031 812 355 ------
NM_005756chrX61300 324 220 213 114 96 ------
NM_005766chr1331112 490 477 1173 11356 --
NM_005778chr31433 --1378 --
NM_005786chr1821013 225 ------
NM_005788chr117805 734 585 563 288 272 214 ------
NM_005789chr1762170 2040 1374 762 524 149 --11860 --
NM_005795chr262580 2034 1920 1864 1043 851 11032 22782 624 --
NM_005797chr1121435 1203 11510 11336 --
NM_005798chr13105131 4808 4656 4620 4208 3987 3981 3920 3690 2116 --12102 --
NM_005801chr173533 201 114 ------
NM_005802chr9292 64 --1546 --
NM_005808chr362947 2884 2463 851 706 682 23471 3083 ----
NM_005813chr252658 1749 1025 891 36 12350 186 --
NM_005822chr622396 434 11976 22353 1854 11866
NM_005826chr13261 117 92 ------
NM_005828chr1744248 1862 540 492 11005 --11557
NM_005832chr321276 1230 --21346 291 --
NM_005839chr1197 ----1395
NM_005840chrX167678 7259 6453 6300 5950 5766 5696 5654 5145 2820 2484 2379 2116 1943 879 68 17500 16903 1644
NM_005843chr221907 1558 ------
NM_005845chr1331737 1311 294 --11079 1127
NM_005857chr151291 979 225 169 144 11261 21409 1000 --
NM_005859chr51527 1465 ----
NM_005862chr31749 --1225 --
NM_005863chr1021281 576 ------
NM_005870chr1321061 123 --11193 --
NM_005871chr105945 900 429 175 25 1159 ----
NM_005875chr32134 103 ------
NM_005880chr165448 283 194 109 44 --11240 --
NM_005882chr41190 1225 ----
NM_005884chr191655 ------
NM_005896chr23805 531 130 --1261 --
NM_005898chr1193153 2976 2904 2560 2022 1263 1227 222 81 --1586 --
NM_005899chr1721282 363 ------
NM_005900chr421074 795 ------
NM_005901chr18137731 6339 6256 5393 5382 2843 2779 2727 1865 1649 1630 1547 1218 28716 6819 38613 7536 2253 --
NM_005903chr564299 1631 982 717 165 141 23629 3364 ----
NM_005904chr1821049 322 ------
NM_005906chr621498 1246 --1353 --
NM_005909chr593726 3523 3475 1424 822 310 259 245 90 13704 13495 --
NM_005910chr1764048 3784 3609 3479 2621 205 1675 ----
NM_005920chr143128 3104 751 138 ------
NM_005927chr541076 452 337 196 --1865 --
NM_005930chr143798 632 45 ------
NM_005933chr1172972 2566 1976 1925 1860 658 474 12964 ----
NM_005935chr4125264 4159 3410 3348 2019 1900 1720 1512 520 383 133 76 11857 13762 --
NM_005938chrX31344 1249 171 ----1394
NM_005941chr893820 3618 3603 3389 3277 2880 1603 674 204 11527 ----
NM_005955chr165480 5446 4369 3600 1234 452 --21240 554 --
NM_005962chr1022207 568 ------
NM_005962chr1022207 568 ------
NM_005964chr1731036 590 491 ------
NM_005966chr242236 1583 626 250 ------
NM_005968chr19--1160 ----
NM_005977chr132388 289 ------
NM_005986chr1332664 1935 440 1602 1888 --
NM_005989chr711524 ------
NM_005999chr13256 173 79 ------
NM_006007chr963093 2901 1644 1090 570 331 2850 826 11257 --
NM_006011chr1553758 3663 3524 1263 201 --24267 3577 --
NM_006015chr111280 ------
NM_006016chr641876 1629 1523 432 --139 12161
NM_006017chr4--1698 1990 11143
NM_006036chr252200 2095 1922 925 702 32447 569 502 ----
NM_006037chr2114892 4102 3948 3923 3781 3226 3049 1433 1027 854 470 ------
NM_006038chr2041811 1723 615 238 12158 ----
NM_006040chr1661389 1102 412 262 220 206 ----11278
NM_006047chr2092778 2632 2439 2267 1018 754 467 254 207 12398 22579 598 --
NM_006055chr2123149 3015 2721 2556 2492 2485 2052 561 476 323 168 140 --12977 1982
NM_006076chr722065 780 1993 ----
NM_006080chr732625 1204 943 --1316 --
NM_006095chr4124372 4161 4135 3655 3356 3170 1651 895 846 679 500 122 11313 --11407
NM_006106chr1152820 1337 870 339 262 23167 477 1911 11202
NM_006107chr171407 ------
NM_006108chr1152094 1593 597 419 106 ------
NM_006122chr1542786 1064 979 135 --12708 --
NM_006135chr121180 517 ------
NM_006136chr731195 174 27 ------
NM_006139chr262170 2145 929 616 164 45 --12771 --
NM_006141chr1632361 2281 258 --12640 11966
NM_006143chr12----1131 --
NM_006148chr1742849 2823 2473 2360 12929 ----
NM_006152chr121266 151 ----
NM_006154chr1592922 2817 2617 2503 2397 2221 2192 2103 346 1140 22412 1925 --
NM_006155chr241534 1421 467 375 --2586 574 --
NM_006157chr11----1288 --
NM_006158chr821389 188 11357 ----
NM_006162chr1841191 653 578 265 ------
NM_006166chr1271715 1670 1059 887 561 500 417 --1794 --
NM_006186chr2------1804
NM_006192chr201884 11173 1928 --
NM_006194chr1421323 252 1996 ----
NM_006195chr921149 958 --1166 --
NM_006197chr85698 305 239 134 21 178 1662 --
NM_006203chr595261 5224 4633 3904 3698 2001 1404 1227 1157 45148 3732 3508 2054 35430 655 101 --
NM_006206chr432384 635 615 ------
NM_006207chr82283 42 ------
NM_006223chrX1428 ------
NM_006224chr1731838 1661 187 --1393 11695
NM_006226chr24884 365 342 165 ------
NM_006237chr1331453 543 116 11864 ----
NM_006241chr321994 1522 --22292 921 --
NM_006245chr6------1358
NM_006246chr141442 1864 ----
NM_006251chr563191 2684 2442 861 190 72 --23396 1276 --
NM_006252chr1197107 6941 6584 6417 6294 5408 5257 4971 4839 3006 2749 1360 1167 898 763 720 681 652 65 25464 163 11380 37616 5214 4710
NM_006256chr131700 1089 870 --168 --
NM_006264chr41565 --2549 530 --
NM_006265chr83326 169 136 1499 ----
NM_006267chr231213 1185 451 1372 2693 31 --
NM_006275chr2041736 550 543 267 --1670 --
NM_006279chr11327 ------
NM_006281chr871107 1061 994 938 885 434 177 ------
NM_006281chr871107 1061 994 938 885 434 177 ------
NM_006282chr2064129 2919 1896 1815 209 100 ----23546 1120
NM_006283chr8134861 4748 3898 3855 3408 939 905 884 706 312 290 64 36 14441 24801 1757 31788 1765 1377
NM_006287chr272089 1035 352 321 310 255 244 ------
NM_006298chr662751 1279 1207 1107 965 676 1210 --12702
NM_006301chr122503 483 ------
NM_006306chrX105340 4792 4357 4135 2304 2051 2029 1292 550 242 --2914 535 1887
NM_006313chr1241085 686 633 352 31694 1501 1197 ----
NM_006315chr484329 4311 4279 2847 1721 1644 1538 981 23603 1575 14053 --
NM_006322chr133978 235 192 ------
NM_006323chr42562 94 ------
NM_006327chr103343 257 44 ------
NM_006330chr841528 1516 1201 1023 --11116 1315
NM_006333chr22446 168 ------
NM_006335chr161001 951 941 878 314 214 ------
NM_006345chr41323 1890 ----
NM_006346chr13----1375 --
NM_006357chr21508 --1372 --
NM_006359chrX52465 2013 1898 1636 1549 1535 1914 --
NM_006364chr142154 56 --2308 77 --
NM_006366chr621289 1043 --1957 --
NM_006371chr375141 5070 3906 3773 2037 546 453 22078 966 14613 --
NM_006377chr911295 --2966 885 --
NM_006379chr732156 1669 604 ------
NM_006380chr1793960 3631 3373 3139 1159 972 817 694 288 11381 --21166 590
NM_006386chr2272453 2272 1925 812 765 443 329 1580 ----
NM_006390chr123673 146 124 ------
NM_006393chr1053621 3095 1755 1611 1268 --1612 --
NM_006400chr12--1110 ----
NM_006403chr631336 1218 83 1223 ----
NM_006411chr63897 276 29 --11025 --
NM_006413chr101312 --1100 --
NM_006416chr6142 1159 1633 --
NM_006420chr2053115 2750 2336 889 234 12201 13198 --
NM_006421chr821213 920 1501 ----
NM_006431chr122208 173 ------
NM_006434chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_006449chr222166 1633 1498 22179 798 --
NM_006451chr541007 998 411 154 --1805 --
NM_006457chr4144040 3945 3933 3836 3825 3636 3268 2797 2650 2631 2579 927 446 275 --14001 --
NM_006459chr1031598 1588 1561 --1107 --
NM_006460chr1731321 598 348 ------
NM_006465chr1561892 1824 657 140 107 77 11874 ----
NM_006467chr542071 1599 917 50 --11708 --
NM_006469chr12300 273 11261 21448 992 --
NM_006482chr1273891 3412 3185 2974 2921 825 157 --32682 1299 113 --
NM_006489chr1472038 1831 1791 1763 1672 1311 725 21300 613 21440 668 --
NM_006496chr172030 1874 1605 1399 1368 475 358 ------
NM_006497chr171526 ------
NM_006504chr1062683 2380 1917 753 521 272 ------
NM_006516chr131452 1404 1083 --21507 1410 --
NM_006519chr61234 ------
NM_006520chrX41727 1692 1180 1092 ------
NM_006526chr2031686 1396 514 --1349 11527
NM_006532chr1931982 832 143 ----1101
NM_006534chr2073350 2874 2647 2565 2327 1042 402 22933 2277 32676 2491 580 1150
NM_006536chr13959 952 367 --21017 403 --
NM_006538chr2114063 3580 3226 1666 1413 1291 1154 885 835 695 657 ------
NM_006540chr811474 --1443 --
NM_006544chr14105315 5135 5054 4814 4632 4275 4193 2138 1463 424 --11618 --
NM_006546chr1796655 6208 5569 2639 2416 2392 576 493 390 11204 11159 --
NM_006547chr772146 2107 2013 1997 1920 857 826 --11407 --
NM_006549chr1221055 122 22229 426 12356 --
NM_006557chr941557 1442 1287 307 --11476 --
NM_006558chr82360 327 ------
NM_006559chr1--1916 ----
NM_006561chr10145959 5884 5351 4913 4672 4516 4032 4007 2048 1673 1457 996 218 31 14090 ----
NM_006565chr161108 1795 ----
NM_006572chr1773509 3136 2846 2621 2175 1136 1006 13384 12861 --
NM_006574chr3297 62 ------
NM_006575chr1461346 1131 1018 578 357 330 ------
NM_006582chr1181 ------
NM_006595chr1112018 21678 1315 ----
NM_006597chr11--149 ----
NM_006599chr16168241 8190 7128 6461 6031 5880 5320 5267 5060 5048 3220 2819 1948 1883 1532 1431 36854 5558 2133 48168 7588 2213 724 15295
NM_006602chr202213 171 ------
NM_006603chrX51368 1286 585 328 36 ------
NM_006608chr11432 ------
NM_006609chr242363 2289 1160 520 --2448 310 --
NM_006614chr332785 2583 821 12887 23402 55 --
NM_006618chr121326 142 ----2552 418
NM_006620chr6124469 4336 4292 3794 3372 3211 3145 1503 1197 881 812 803 1290 23765 3389 13821
NM_006621chr141976 1733 625 134 ------
NM_006624chr1022125 737 --1487 --
NM_006625chr11474 --2842 459 --
NM_006625chr11474 --2842 459 --
NM_006625chr11474 --2842 459 --
NM_006626chr982607 2533 2078 1851 768 518 203 75 12060 --11841
NM_006628chr1574229 4004 1814 1682 1026 328 64 22874 2829 23200 938 198
NM_006629chr1822844 2138 --11802 1132
NM_006636chr231031 645 366 --1848 --
NM_006644chr133688 675 254 ------
NM_006646chr1382944 2938 2766 2558 2477 2420 658 256 --13018 --
NM_006650chr531058 1045 1009 11509 23064 670 --
NM_006654chr12104430 3677 3557 3029 2923 843 820 654 75 69 1745 11002 1669
NM_006658chr72718 90 ----1104
NM_006667chrX2443 251 --148 1802
NM_006690chr2032367 1914 1667 --12214 --
NM_006699chr121682 1079 1562 ----
NM_006706chr52333 128 1106 ----
NM_006710chr25962 922 910 207 28 1421 1384 --
NM_006714chr62307 282 ------
NM_006717chr993256 3237 2915 2538 2376 2229 800 392 275 22859 2428 ----
NM_006721chr102276 174 --191 --
NM_006722chr343076 2656 2504 236 --1602 1920
NM_006727chr54500 484 471 120 ------
NM_006729chrX145578 4729 4617 4518 4466 4361 4260 3784 3531 3441 2229 1034 567 147 35014 1680 1511 2593 248 --
NM_006731chr9145739 4796 4741 4733 4510 3696 2264 1916 1839 1437 999 993 829 535 ----1142
NM_006734chr651534 1442 1267 320 26 ------
NM_006738chr15144599 4437 4020 3424 3204 3097 2977 2918 1604 1555 1310 657 633 491 --14498 --
NM_006750chr16207740 7337 7052 6947 6665 6273 6159 6011 5444 5299 5210 2964 2953 2582 2427 2260 1376 565 326 239 25582 1946 26696 6346 11848
NM_006751chr22831 299 ----1165
NM_006756chr851328 603 581 492 25 ------
NM_006761chr172283 109 2809 333 ----
NM_006763chr121527 510 ------
NM_006766chr892357 2331 2208 1873 465 402 347 236 180 ------
NM_006769chr12738 35 ------
NM_006771chr172800 241 ------
NM_006775chr642685 2327 287 134 1700 ----
NM_006777chrX42405 1108 232 205 ----2584 113
NM_006788chr1832157 2027 1659 1143 ----
NM_006790chr5------1413
NM_006791chr153496 413 194 ------
NM_006802chr111156 --1178 11111
NM_006803chr861559 1382 757 327 301 44 ------
NM_006805chr531404 1216 493 ------
NM_006807chr172494 481 132 ----
NM_006815chr122853 423 ------
NM_006818chr13833 624 156 ------
NM_006823chr861037 463 323 236 69 58 --11365 --
NM_006826chr231269 284 229 ------
NM_006827chr1473117 2398 2314 1219 847 606 296 --1422 --
NM_006828chr62211 59 123 ----
NM_006831chr112404 341 --144 --
NM_006832chr141103 ------
NM_006836chr12272 57 ------
NM_006851chr1242593 2037 373 175 --1862 --
NM_006854chr741547 511 192 26 1763 21468 796 --
NM_006856chr1281017 1007 796 728 699 308 83 67 ------
NM_006868chr1843173 3059 2761 2462 ------
NM_006874chr431124 863 58 11045 ----
NM_006875chrX2265 79 ------
NM_006884chr331895 1548 1538 --12015 --
NM_006885chr1643325 2585 1427 1150 ----1976
NM_006888chr1453547 2718 1270 274 98 13096 ----
NM_006898chr21733 ------
NM_006901chr151363 1374 ----
NM_006910chr16--1291 142 --
NM_006912chr132285 722 634 11658 125 --
NM_006915chrX52543 2374 2191 179 153 2909 582 12274 --
NM_006918chr11145891 5131 4560 4515 4346 4210 4135 3836 3817 2035 1443 1397 588 340 14967 1119 --
NM_006920chr261811 1620 1492 1258 412 377 ------
NM_006922chr252332 2109 2001 1645 351 1634 ----
NM_006924chr17104084 3190 2704 1303 901 430 340 313 267 73 1374 13390 11250
NM_006930chr541976 1711 1402 552 21245 269 11989 --
NM_006937chr172438 131 ------
NM_006939chr1411047 ------
NM_006940chr1251850 1752 752 685 493 ------
NM_006947chr471153 1131 697 450 310 251 104 --1267 --
NM_006948chr2132176 1955 1817 1777 ----
NM_006951chr10--2559 180 ----
NM_006981chr932677 2181 86 ------
NM_006996chr161532 1437 1272 712 577 451 --11385 --
NM_006997chr101400 ------
NM_006999chr51346 21501 1388 1191 --
NM_007005chr921141 278 --1617 --
NM_007006chr1693555 3416 3097 2570 2300 2191 658 307 102 ----1473
NM_007007chr1274818 4446 1798 1652 1555 1405 276 --13220 --
NM_007008chr23696 191 32 1255 --153
NM_007010chr1741490 1433 1293 510 21192 109 ----
NM_007011chr15166801 6291 6012 5992 5843 5806 4370 2693 2643 2064 1807 1567 1501 922 385 271 16065 ----
NM_007013chr81377 1953 ----
NM_007017chr54876 854 829 618 ------
NM_007034chr12742 216 ------
NM_007035chr121329 1713 1123 --
NM_007036chr51819 2922 653 ----
NM_007038chr21105485 4384 4165 4125 3861 2012 1727 1037 707 349 35616 5111 279 14216 1928
NM_007039chr1441647 1470 686 506 ------
NM_007042chr332657 1651 394 21705 322 1836 --
NM_007043chr1241985 1965 1372 569 1287 11770 1671
NM_007045chr62549 156 ------
NM_007054chr563715 3429 3118 2995 782 518 13414 --1632
NM_007067chr1731368 537 71 --11349 --
NM_007078chr1062878 2865 2415 1970 1222 171 ------
NM_007084chr1351549 1516 1402 1180 220 --11276 --
NM_007106chr1382739 2545 2456 1874 1746 1724 281 144 --12842 --
NM_007111chr132828 281 --1252 --
NM_007114chr383169 3105 2745 2416 1191 1002 712 240 22213 389 12281 --
NM_007124chr641984 1839 445 277 ------
NM_007125chrY2501 377 --1321 21450 443
NM_007126chr91346 --1209 --
NM_007129chr1331025 888 422 ------
NM_007137chrX64267 3545 2202 2171 1860 638 ------
NM_007144chr1721289 263 ------
NM_007145chr1931324 1296 377 ------
NM_007146chr1722137 2065 ------
NM_007150chrX31523 691 249 --1558 --
NM_007152chr112271 46 ------
NM_007153chr1924069 3028 24042 3200 ----
NM_007157chrX82764 1950 1094 991 838 780 548 91 32223 542 209 ----
NM_007158chr141161 1110 496 333 ------
NM_007159chr341529 1521 365 162 ------
NM_007166chr1141436 1402 1194 435 ------
NM_007172chr2252907 2485 2400 856 780 31035 1028 223 --11231
NM_007173chr114550 517 424 210 --1938 1333
NM_007174chr1261956 1538 803 495 233 30 --12017 --
NM_007175chr863391 3281 3106 2442 1361 833 22624 499 12507 1350
NM_007185chr12884 283 ------
NM_007187chr131269 --167 --
NM_007192chr145990 808 461 138 112 ----198
NM_007198chr861625 1125 425 364 137 50 ------
NM_007200chr15144599 4437 4020 3424 3204 3097 2977 2918 1604 1555 1310 657 633 491 --14498 --
NM_007212chr12804 556 1231 21839 1408 --
NM_007214chr62899 528 --1233 1295
NM_007220chrX14020 194 11953 --
NM_007222chr821735 1337 ------
NM_007231chrX2574 216 1439 ----
NM_007235chr121442 ------
NM_007236chr1532087 250 237 ------
NM_007249chr13259344 8955 8577 8326 8268 8128 7768 7637 7403 7356 5817 5791 5779 5732 5700 3670 3635 3413 2895 2668 1881 1819 1454 1412 844 28754 7020 38903 695 646 19357
NM_007257chr862895 2784 2596 2434 2104 2065 12358 ----
NM_007269chr11166 ------
NM_007271chr61634 1168 11379 --
NM_007276chr71257 1239 ----
NM_007285chr161110 ------
NM_007287chr363138 2112 1272 573 538 214 ------
NM_007288chr363138 2112 1272 573 538 214 ------
NM_007289chr363138 2112 1272 573 538 214 ------
NM_007308chr42562 149 1684 ----
NM_007315chr241385 1092 1032 1020 --149 --
NM_007324chr1----165 --
NM_007331chr452693 2498 2270 1983 611 ------
NM_007345chr1872350 1913 851 797 631 132 120 ------
NM_007346chr20------1345
NM_007347chr1553012 2929 2596 1244 961 ----13195
NM_007351chr43276 75 56 11139 ----
NM_007358chr141815 1564 1318 565 ------
NM_007359chr1741718 1304 623 395 ------
NM_007362chr341465 1225 1082 973 11211 ----
NM_007363chrX1768 --1344 --
NM_007373chr1051786 1214 262 67 60 ------
NM_007375chr172282 2194 1947 1726 998 545 527 22441 2408 ----
NM_012062chr122741 639 ----1256
NM_012064chr1221125 1102 ------
NM_012069chrX51791 913 473 126 45 1296 ----
NM_012081chr563594 2825 2734 2638 1228 740 --11243 --
NM_012082chr82791 92 --1272 --
NM_012089chr141551 1384 1372 291 ------
NM_012092chr241608 1502 399 287 11961 ----
NM_012093chr111248 --1358 --
NM_012095chr1073527 2464 1317 818 429 266 107 --1733 --
NM_012096chr373679 2660 2618 1504 344 268 236 12801 ----
NM_012097chr222251 1808 ------
NM_012098chr941175 1083 1067 578 ----11040
NM_012102chr152151 1866 1062 858 533 12624 ----
NM_012104chr1162962 2895 2530 1420 784 686 1886 ----
NM_012104chr1162962 2895 2530 1420 784 686 1886 ----
NM_012110chr4--1292 ----
NM_012115chr6----2554 205 --
NM_012117chr12124 ------
NM_012129chr721866 978 ------
NM_012137chr152654 1023 947 605 284 --12383 --
NM_012141chr1392789 2720 2713 2568 1090 569 172 150 84 24057 3387 --13833
NM_012156chr2053142 2578 2323 704 454 33179 2162 256 --11025
NM_012161chr431063 293 32 ------
NM_012164chr9106736 6410 6155 5263 5256 2351 1217 1208 279 131 16717 22622 231 15780
NM_012183chr11426 ----1460
NM_012193chr1144513 3421 733 30 12096 ----
NM_012199chr174514 4283 3851 3763 1814 998 242 1923 ----
NM_012202chr11--1371 --1134
NM_012210chr951135 1049 556 531 357 --1410 --
NM_012214chr2146049 5980 5500 5423 4937 4290 2536 2484 1778 1734 962 953 692 131 15550 1932 --
NM_012215chr1071776 1678 1326 1272 622 371 365 ------
NM_012218chr1922946 1011 21083 496 1346 --
NM_012223chr231332 1270 1094 ------
NM_012224chr431230 1110 187 144 ----
NM_012234chr373706 3398 2891 2576 768 237 151 --33443 891 680 --
NM_012238chr1021544 1192 --1281 11779
NM_012243chr14908 870 768 373 ------
NM_012247chr104779 364 278 257 ------
NM_012249chr253378 2986 2900 2682 1162 33015 2407 193 ----
NM_012250chr112170 46 11233 --1218
NM_012257chr721094 88 ------
NM_012259chr621291 947 11087 ----
NM_012262chr1155263 4375 4332 4106 3966 3597 3585 3199 1924 1712 1546 1448 1290 1078 380 --14658 --
NM_012281chr732407 2291 1821 --1955 11993
NM_012286chrX3399 181 38 ------
NM_012287chr334487 3546 166 --12899 --
NM_012288chr695671 5430 5135 4458 3665 1741 1018 632 371 15460 21726 1108 --
NM_012290chr22467 346 171 2579 167 --
NM_012294chr784042 3850 3050 2915 1446 1395 798 29 --22963 2648 --
NM_012297chr452380 663 543 511 108 --1592 --
NM_012300chr52641 459 --12326 --
NM_012302chr11788 ------
NM_012304chr562023 1880 1747 1574 968 150 --32455 1609 221 --
NM_012309chr1143523 3289 1508 536 21883 70 ----
NM_012311chr101456 ------
NM_012316chr174609 3745 3720 1575 1231 435 387 1191 35435 4177 884 --
NM_012317chrX5724 683 249 146 130 ------
NM_012319chr18------1907
NM_012322chr71328 1342 ----
NM_012323chr2251573 1240 1173 1152 329 ------
NM_012325chr2011091 --11266 --
NM_012327chr1851577 642 250 214 27 --1154 --
NM_012329chr1751626 1565 1547 1134 450 ------
NM_012330chr1041755 632 218 115 --31601 1153 343 --
NM_012334chr594228 3681 3526 3492 3163 2901 949 840 570 ------
NM_012341chr101475 ------
NM_012342chr103441 100 92 ----178
NM_012343chr541056 848 278 93 31016 801 389 ----
NM_012382chr5103935 3711 3626 3198 3009 2871 1603 1280 741 483 1901 1503 --
NM_012384chr2052447 1857 1808 1639 253 ------
NM_012388chr1523004 2013 --11943 13135
NM_012397chr1861752 1719 1675 1395 1310 560 --21712 1208 --
NM_012398chr1942655 2102 1858 558 1248 ----
NM_012406chr122904 65 ------
NM_012416chr941001 180 166 29 ------
NM_012417chr171594 --140 --
NM_012419chr62574 23 ------
NM_012421chr1157 ------
NM_012433chr23314 249 238 ------
NM_012454chr62453 37 ------
NM_012465chr1053218 2169 909 717 468 ------
NM_012471chrX11771 21811 760 ----
NM_012482chr14572 530 507 469 ------
NM_013227chr151146 ------
NM_013230chrY21382 66 --1380 --
NM_013231chr1484117 3413 3378 3052 2792 1151 751 113 2122 90 13269 --
NM_013233chr221372 266 1442 ----
NM_013236chr224928 919 501 56 --1904 --
NM_013242chr162362 92 ------
NM_013253chr111153 ------
NM_013254chr123653 602 193 ------
NM_013255chr7288875 8684 7815 7744 7246 6536 6360 6051 5698 5554 5528 3486 3363 3096 2901 2731 2606 2588 2213 2155 2115 1264 1247 1011 981 915 558 271 36089 738 677 46312 5492 2580 417 1944
NM_013257chr831859 580 104 ------
NM_013261chr423020 2357 ------
NM_013262chr631305 502 104 ------
NM_013269chr1283347 3331 3190 1424 1405 926 637 464 13367 24035 475 --
NM_013272chr15147 ------
NM_013277chr124897 672 359 57 1404 21048 707 --
NM_013281chr201128 ------
NM_013283chr51209 ------
NM_013286chr33496 490 98 --1121 --
NM_013293chr72546 203 ------
NM_013302chr1674486 3987 3743 3486 1376 607 138 ----11520
NM_013309chr1592640 2596 2526 2409 2119 1926 1756 1742 1716 --1974 --
NM_013313chr2293195 3118 3031 2935 2508 1362 1160 636 78 --23551 3351 --
NM_013316chr73784 417 89 2879 214 ----
NM_013322chr721731 1251 ------
NM_013341chr252920 2514 2240 2084 1949 3411 319 48 ----
NM_013372chr1553229 2356 1064 586 245 --12877 --
NM_013374chr363101 2913 2213 1248 659 551 32634 289 169 ----
NM_013377chr12----1158 --
NM_013381chr1262175 874 816 767 619 346 ------
NM_013391chr52383 102 ------
NM_013410chr121311 977 ------
NM_013411chr152556 1991 1768 358 299 1496 1706 --
NM_013423chrX1990 ------
NM_013427chrX1990 ------
NM_013433chr1931974 1589 277 ------
NM_013436chr22565 239 ------
NM_013437chr851312 1262 488 322 316 --2477 241 1307
NM_013438chr961394 1271 704 498 288 81 --1370 --
NM_013444chrX2898 96 ------
NM_013449chr1242713 2558 2266 1918 12682 ----
NM_013450chr231108 1056 381 --1980 1803
NM_013943chr1103262 2997 2753 2503 2130 2108 1108 881 729 155 1660 1809 --
NM_013951chr221635 562 12336 ----
NM_013952chr231712 639 74 12413 ----
NM_013953chr231712 639 74 12413 ----
NM_013975chr171433 ------
NM_013981chr51152 ------
NM_013982chr51152 ------
NM_013983chr51152 ------
NM_013989chr1483690 3430 3300 2017 1375 777 520 118 21433 308 1637 --
NM_013992chr231712 639 74 12413 ----
NM_013995chrX42500 2469 604 290 ------
NM_013996chr71495 --135 --
NM_013996chr71495 --135 --
NM_013997chr71495 --135 --
NM_013997chr71495 --135 --
NM_013998chr71495 --135 --
NM_013998chr71495 --135 --
NM_014000chr1021982 599 ------
NM_014011chr251812 1678 948 295 127 ------
NM_014021chr193371 3201 2474 2318 1083 947 656 216 87 12766 12386 --
NM_014023chr1062484 2272 646 596 393 315 --12655 12423
NM_014028chr673344 3159 1217 841 592 526 220 22938 291 ----
NM_014030chr1711201 ------
NM_014034chr631295 588 428 --11489 --
NM_014038chr71375 169 ----
NM_014044chr2157 ------
NM_014048chr1695062 4021 3990 3829 1270 1144 1037 783 248 ----11834
NM_014055chr121521 ----1419
NM_014057chr951520 1360 1351 1306 109 31606 1403 1053 ----
NM_014089chr1341931 1726 1506 345 --11855 --
NM_014106chr1582845 2557 2517 2352 1159 1099 314 118 --11984 --
NM_014109chr871235 1176 969 478 459 428 52 1380 11036 --
NM_014110chr141136 1000 300 106 --11086 --
NM_014112chr8115418 5005 4124 3965 2196 2190 2008 1627 795 733 408 ------
NM_014117chr1672685 2514 2172 1734 1688 990 912 ------
NM_014141chr745315 4845 593 285 11201 --1832
NM_014154chr321428 1098 ----1461
NM_014155chr11157203 7097 6943 5967 5901 5653 4881 4714 2866 2259 2084 1699 1417 818 102 15140 11856 --
NM_014157chr1693907 3307 3266 1491 1235 852 760 149 134 ------
NM_014175chr82144 138 ------
NM_014176chr13170 119 21 ------
NM_014181chr232721 1975 277 148 12727 --
NM_014182chr121262 ------
NM_014217chr131319 483 138 21640 585 ----
NM_014223chr11768 ------
NM_014231chr121804 --1153 --
NM_014232chr171324 --1318 --
NM_014232chr171324 --1318 --
NM_014233chr1741859 1426 1340 676 ------
NM_014250chr2251957 1859 1770 1548 405 ------
NM_014251chr73858 815 150 1236 ----
NM_014252chr132409 54 ------
NM_014253chrX62427 2291 1920 1850 1613 816 1414 ----
NM_014258chr20129 1687 ----
NM_014263chr1031508 1255 508 --1138 --
NM_014264chr42550 538 ------
NM_014267chr115875 819 684 579 320 ------
NM_014268chr1841350 559 424 283 ------
NM_014278chr42168 67 --1114 --
NM_014280chr12805 648 ------
NM_014289chrX61381 1366 1126 1031 243 167 --11013 --
NM_014294chr821169 398 21110 153 11036 --
NM_014309chr2294665 4609 3813 3614 1458 1207 773 630 407 21822 370 ----
NM_014317chr101104 ------
NM_014319chr12----1486 21674 1551
NM_014322chr141020 971 280 255 1447 ----
NM_014323chr222111 35 ----1192
NM_014325chr1241656 695 631 107 11787 --1571
NM_014331chr4147642 7402 6828 6717 6608 6432 6385 6342 4788 2471 1366 945 727 68 47847 6759 5339 1872 37438 2163 721 --
NM_014333chr1142813 2241 2128 787 --21052 732 --
NM_014342chr1131442 1436 106 ------
NM_014344chr112798 635 ------
NM_014345chr64851 691 230 85 --191 --
NM_014351chr2251396 1171 462 380 74 11047 ----
NM_014352chr1141392 960 542 377 ------
NM_014361chr112442 348 1321 ----
NM_014363chr132965 436 ------
NM_014368chr94535 528 356 23 ------
NM_014372chr131937 778 419 ------
NM_014379chr82142 110 1196 ----
NM_014381chr1452300 2030 1316 1209 372 --1220 --
NM_014382chr341360 530 419 54 --21762 1240 --
NM_014388chr1155724 5523 5329 4865 4707 4618 4473 4383 3702 2268 1480 986 722 443 62 1833 25274 4527 1136
NM_014392chr431573 242 104 11482 ----
NM_014393chr841489 843 343 169 --155 --
NM_014397chr95899 538 500 297 58 ----11166
NM_014399chr73831 102 75 ------
NM_014405chr172915 334 ----11733
NM_014415chr341554 1459 638 61 --1332 --
NM_014421chr441682 1611 1410 242 ------
NM_014423chr555421 4018 1539 969 490 15242 --1880
NM_014429chr31205 --1721 --
NM_014445chr332341 2234 1796 ----11988
NM_014447chr451626 1380 1082 632 436 11061 ----
NM_014456chr1031343 511 277 147 ----
NM_014458chr141385 1072 543 323 --11330 --
NM_014462chr81303 184 ----
NM_014470chr122732 540 ------
NM_014491chr73969 738 730 --1707 --
NM_014494chr1641919 1906 887 805 ----11785
NM_014497chr2172 ------
NM_014504chr731625 1334 213 ------
NM_014515chr122797 246 1157 ----
NM_014516chr191240 ------
NM_014520chr172407 39 ------
NM_014547chr151711 --3573 528 289 --
NM_014547chr151711 --3573 528 289 --
NM_014548chr1581655 1647 1555 1521 1063 575 162 102 ------
NM_014554chr1242283 2004 595 156 --1623 --
NM_014572chr1331617 637 349 ------
NM_014573chr1711864 21540 104 ----
NM_014574chr1441551 440 258 119 ------
NM_014584chr1431415 1351 1325 --1601 --
NM_014585chr211206 --1343 1329
NM_014586chr21114848 4739 4601 4584 4512 4184 1472 1020 682 615 64 34709 3884 3233 13379 --
NM_014592chr52638 259 --1595 --
NM_014600chr261648 1165 1141 622 434 394 ------
NM_014607chr241763 1744 1472 557 ------
NM_014612chr941260 1029 380 57 21515 239 ----
NM_014614chr271295 1108 384 375 355 116 65 2240 177 ----
NM_014615chr1652765 1164 1077 518 47 --12805 --
NM_014616chr373348 3209 2897 2245 1129 576 236 12135 22450 1359 22932 2530
NM_014618chr9----1140 --
NM_014620chr122599 502 ------
NM_014630chr1573482 3145 2852 2735 2670 1555 1213 22840 812 23013 2973 11466
NM_014636chr9104197 3684 3326 3235 3102 3002 1697 1662 1010 281 --33875 1261 741 --
NM_014637chr83456 433 303 --21009 347 --
NM_014647chr163791 238 122 --12114 --
NM_014655chr15681 499 430 312 130 ------
NM_014666chr52835 213 ------
NM_014667chr362200 2015 1918 744 591 227 ------
NM_014670chr261424 1412 1212 1206 508 249 ------
NM_014671chr711177 11496 ----
NM_014676chr121222 454 --1408 --
NM_014677chr81353 ------
NM_014682chr842329 1700 437 340 ----11720
NM_014683chr1721860 789 --21487 1399 --
NM_014690chr762824 2695 2500 2108 1936 373 --1586 --
NM_014700chr1611272 ------
NM_014701chr1563186 3172 3007 2099 1201 69 --1644 --
NM_014702chr693112 3079 2989 2931 2853 2787 978 495 158 --22816 2126 --
NM_014705chr722031 1307 --1228 --
NM_014706chr1231116 931 492 --11121 --
NM_014707chr721874 650 1227 --22035 812
NM_014709chr2----1643 --
NM_014710chrX1193 1955 ----
NM_014711chr1662128 645 435 369 295 211 --2119 110 --
NM_014715chr112615 201 ------
NM_014717chr193857 810 27 --167 --
NM_014720chr1031306 249 60 ------
NM_014721chr6126777 6162 5345 5055 4970 4926 2046 1802 1657 1560 1184 39 --16843 --
NM_014729chr82764 552 1130 ----
NM_014730chr1274369 4294 4226 3383 1325 1177 723 25210 1168 2557 295 1801
NM_014730chr1274369 4294 4226 3383 1325 1177 723 25210 1168 2557 295 1801
NM_014733chr541968 1417 382 302 ------
NM_014735chrX32067 743 379 ------
NM_014743chr473123 2862 2526 2507 1157 984 135 23101 889 ----
NM_014746chr283685 3586 3088 2843 1449 1057 907 751 11517 13562 --
NM_014747chr1115640 5447 5290 5186 1764 1534 1268 1054 794 784 211 11048 65059 4892 1177 1083 882 219 --
NM_014749chr14152 --1295 --
NM_014751chr81494 11348 ----
NM_014752chr1131542 1452 771 1481 ----
NM_014755chr243238 3113 1561 1441 1250 ----
NM_014757chr542098 1816 1589 214 ------
NM_014761chr16----1108 1906
NM_014766chr763325 3319 2578 1007 981 436 ----13556
NM_014773chr531391 1336 214 ------
NM_014774chr173052 2731 2468 2132 964 778 307 1932 ----
NM_014776chr1272520 2134 999 845 656 622 571 12087 22744 412 32513 2462 1046
NM_014779chr33426 407 371 --1780 --
NM_014781chr85827 501 381 270 160 ------
NM_014787chr132057 1811 1074 12686 ----
NM_014790chr52416 363 ----1517
NM_014791chr91337 ------
NM_014795chr231281 990 950 --11094 --
NM_014802chr1221097 70 1864 ----
NM_014803chr1062761 1948 1086 818 493 446 ------
NM_014804chr1721223 25 --11142 --
NM_014810chr173361 3268 2957 1170 1069 856 518 22327 1307 12395 --
NM_014812chr131888 1219 787 11717 1410 --
NM_014813chr1194 1123 ----
NM_014819chr562516 2469 2202 1933 904 822 --21843 291 --
NM_014822chr41105 --1503 --
NM_014824chr116813 655 643 401 208 196 ----1428
NM_014826chr1134123 4059 3619 3489 3114 3074 1715 1686 1488 961 893 701 65 32965 1017 855 ----
NM_014827chr151667 1040 222 89 60 1204 1139 --
NM_014828chr1432307 1705 1672 --22495 36 21963 569
NM_014829chr542210 2093 928 382 ------
NM_014830chr1253528 2746 920 740 554 23876 890 22918 833 12787
NM_014836chr102149 84 21848 1549 11956 --
NM_014838chr2262490 2474 2451 1087 1079 577 --11129 --
NM_014839chr132376 2291 419 ------
NM_014840chr1273404 2781 2411 1344 712 628 230 ----13308
NM_014841chr64922 866 413 346 11265 ----
NM_014844chr1453803 1406 1102 143 40 ------
NM_014850chr343352 1160 1059 117 ------
NM_014853chr1741528 977 926 275 11260 ----
NM_014859chr1731410 1006 984 ------
NM_014860chr292546 1644 1638 957 809 521 451 437 308 --1800 --
NM_014862chr1523987 3796 --24120 246 --
NM_014864chr174225 4046 3601 2804 1755 1114 305 ----13587
NM_014870chr1104412 4152 3579 3233 1712 1469 1168 1058 794 619 1184 ----
NM_014871chr123671 565 537 ------
NM_014872chr932073 2014 1940 ------
NM_014873chr194781 4625 4572 4191 4032 1895 952 683 260 24318 301 14678 1673
NM_014874chr121373 531 --11816 1296
NM_014877chr1797617 7501 7407 7294 5710 5529 4716 466 78 27091 2495 26586 1728 17111
NM_014883chr451984 631 604 332 132 12126 1701 --
NM_014884chr192227 36 ------
NM_014890chr31262 ------
NM_014893chrY32240 2092 1605 --1825 --
NM_014897chr1762927 2884 1157 1087 1070 194 1797 ----
NM_014899chr573059 2718 2540 758 588 485 411 12105 1562 --
NM_014900chr251136 995 401 259 106 1800 ----
NM_014901chr522022 178 --1803 --
NM_014903chr1272448 2220 1896 1666 939 901 220 --11535 12300
NM_014904chr1083909 3709 3540 2989 2845 2694 1487 194 2961 855 ----
NM_014905chr281965 1738 1536 817 706 111 105 81 ------
NM_014906chr1764121 3745 1196 998 814 435 --1407 --
NM_014912chr1073381 3295 3221 3075 2564 1382 977 ------
NM_014917chr1165 ------
NM_014918chr1551638 1460 1168 525 37 11142 11543 --
NM_014923chr1342158 1924 1771 124 11945 1479 --
NM_014926chr32942 435 --1442 --
NM_014929chr23273 91 40 ------
NM_014935chr123882 3648 ------
NM_014938chr1242409 2214 1959 930 12345 1712 --
NM_014939chr1831348 621 136 1107 ----
NM_014943chr831102 924 889 11167 11235 --
NM_014945chr522025 261 11737 ----
NM_014946chr232159 1167 374 ------
NM_014947chr142743 2412 2402 823 ----1176
NM_014949chr13964 227 100 3976 304 62 ----
NM_014950chr1431207 640 319 ------
NM_014953chr13103944 3770 3460 2848 1088 1010 368 298 281 130 1160 14169 --
NM_014961chr452215 1654 1397 745 394 ------
NM_014962chr2062553 1044 633 529 193 44 12290 175 --
NM_014964chr1731966 759 650 --32453 1992 65 --
NM_014974chr1061613 1372 1238 1223 659 107 ------
NM_014977chr141215 ------
NM_014982chr14135444 4973 4823 4562 4331 3867 3642 1992 1984 706 516 408 328 13353 24634 4535 --
NM_014988chr462743 2626 774 571 208 139 12488 12282 --
NM_014989chr651268 779 730 678 495 --11857 --
NM_014990chr143888 464 366 ------
NM_014991chr483294 3125 2842 2756 1142 963 635 322 13189 22662 588 --
NM_014992chr142701 283 --1112 --
NM_014996chr31355 ------
NM_014999chr1241459 1265 1141 628 ----11121
NM_015000chr1243014 2858 502 367 ------
NM_015001chr1----1813 --
NM_015004chr31101 ------
NM_015008chr343194 2613 1363 218 ----12770
NM_015017chr12113 37 ------
NM_015020chr1643156 2742 739 621 --13647 --
NM_015025chr272735 2652 2505 2481 2336 461 268 11071 12372 --
NM_015026chr12104203 3852 3478 3078 2989 2923 1058 968 848 457 1725 11587 14027
NM_015027chr1621801 741 1756 --21632 1618
NM_015032chr1372601 2511 2383 2152 1841 474 155 --1316 --
NM_015033chr952705 2599 2324 609 52 1923 ----
NM_015039chr173425 2794 968 961 947 179 92 --12975 --
NM_015042chr1552809 1726 1062 784 671 11072 --11088
NM_015044chr1642801 786 280 26 13118 43214 2955 2927 2795 --
NM_015045chr1031986 1786 168 --1474 11840
NM_015049chr262994 2468 1150 689 571 509 12311 12564 1822
NM_015051chr962619 2217 1158 600 409 167 --13150 12862
NM_015052chr7--11392 ----
NM_015057chr133649 582 201 ------
NM_015059chr1553966 2838 1090 879 821 --12469 --
NM_015064chr1243260 2707 1440 524 13346 12806 --
NM_015068chr773338 2505 1582 1516 1093 1081 240 13359 ----
NM_015069chr16--167 195 --
NM_015071chr5106555 5771 4998 4886 4879 4317 2226 297 174 162 35758 1059 233 ----
NM_015073chr1911847 --12021 --
NM_015074chr194804 4616 4542 4398 3476 1962 1684 517 61 --11764 14833
NM_015076chr694302 4075 2893 1578 1335 985 724 559 346 1254 ----
NM_015085chr1793966 3934 3390 2843 1284 1191 1012 618 590 11256 ----
NM_015087chr1382499 2480 2324 2262 1902 780 328 188 ------
NM_015090chr135116 1812 1149 36090 4136 4025 11974 --
NM_015091chr142561 149 --1277 --
NM_015092chr1634342 3771 853 1927 13347 11171
NM_015093chr61450 --11734 --
NM_015094chr2234371 1782 1644 --11027 --
NM_015097chr332338 1906 269 --21831 723 11751
NM_015107chrX42472 1949 1550 84 ------
NM_015110chr951825 1619 1003 519 491 ------
NM_015115chr421973 621 --22535 538 --
NM_015129chrX--11207 11759 --
NM_015130chr411226 --1372 --
NM_015132chr74797 771 163 30 ------
NM_015137chr8102594 2482 2162 2013 1814 1000 914 581 558 362 --11895 --
NM_015138chr1552701 632 556 486 151 1716 22235 135 --
NM_015143chr41320 1136 1243 --
NM_015144chr1653240 2979 2561 1050 954 12485 12973 12520
NM_015149chr132070 760 648 --22171 887 1227
NM_015153chr64617 611 567 488 --1121 --
NM_015156chr1483995 3947 3143 1320 661 414 152 83 --11458 --
NM_015161chr1641466 1312 347 71 ------
NM_015170chr811648 1344 1472 2413 311
NM_015172chr131617 1575 455 ------
NM_015176chr131115 658 444 ------
NM_015184chr3168 ------
NM_015186chr91454 ------
NM_015192chr20112761 2675 2397 2311 2261 2243 1001 960 924 697 469 ------
NM_015199chr322924 2545 32834 2825 608 --12344
NM_015200chr452075 1031 852 716 314 ------
NM_015206chr1583321 3233 3185 2990 2969 1150 985 952 11355 21135 51 --
NM_015208chr1832576 921 148 --1461 13198
NM_015209chr162159 2091 1561 795 505 255 ------
NM_015215chr162228 926 773 546 199 57 ------
NM_015216chr5--1979 11049 --
NM_015225chr982956 2437 2423 2360 2334 2292 1948 657 --1814 --
NM_015229chr1721172 1030 --1422 --
NM_015230chr421867 375 --11458 11755
NM_015233chr1342523 2414 798 403 ----12306
NM_015235chr1092109 2087 1872 1580 1504 1410 1382 644 203 1694 ----
NM_015247chr16105182 4876 4636 4173 3299 2033 1754 1422 1406 394 35129 4811 4350 13279 --
NM_015250chr9--11740 11754 --
NM_015251chr1632155 1455 231 11849 ----
NM_015252chr23903 342 197 ------
NM_015263chr151143 1273 ----
NM_015265chr262430 2247 2227 1998 671 57 ------
NM_015268chr32265 251 ------
NM_015271chr453497 3239 1043 416 240 --24120 1523 --
NM_015272chr1671782 1710 1485 1453 1433 863 697 --1168 --
NM_015275chr1241925 1806 1614 1558 11538 ----
NM_015277chr18161 ------
NM_015278chr6113447 3381 3145 2741 2374 2239 726 621 496 389 80 1828 1476 --
NM_015282chr242942 886 827 768 ------
NM_015286chr1562448 1793 740 574 534 317 --12124 --
NM_015288chr543511 2977 2732 432 --22464 1427 1608
NM_015294chr174945 719 414 116 --11049 --
NM_015299chr1443922 3769 3753 3559 --33665 3371 1195 --
NM_015310chr8127801 7134 6638 5972 5807 5229 3097 2391 2076 1249 861 700 46048 5991 5924 1102 11979 18201
NM_015313chr11134768 4585 4502 3881 3711 3413 3377 1791 1715 1049 886 801 250 ------
NM_015314chr722426 636 --21877 656 --
NM_015315chr563384 3288 2552 2389 1301 154 --43244 3090 522 321 --
NM_015317chr252491 2405 2192 1136 141 ------
NM_015326chr122853 443 12836 ----
NM_015328chr783012 2999 2648 2385 1947 1923 731 699 21228 900 22357 271 1788
NM_015332chr763614 2564 2445 2327 1255 96 13437 ----
NM_015335chr1242523 1780 1646 594 --12017 --
NM_015338chr2041800 1691 1666 706 --2634 538 21719 1673
NM_015339chr2041022 948 917 686 --1279 --
NM_015344chr81226 --2343 44 --
NM_015346chr1441619 1543 1477 1170 1676 ----
NM_015347chr1262489 2096 1076 777 241 228 12679 12103 --
NM_015349chr652622 2240 989 450 254 22680 1231 12879 21049 379
NM_015353chr17----1233 --
NM_015355chr1751968 1694 1595 700 618 11923 1537 --
NM_015358chr2121125 169 ------
NM_015359chr832492 2413 945 1887 --12312
NM_015361chr2--1786 ----
NM_015365chrX74311 3355 1488 1055 700 452 183 --23393 1372 12939
NM_015367chr2241531 1520 552 89 ----1184
NM_015381chr2221787 1565 1499 ----
NM_015385chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_015387chr261916 1381 732 717 318 62 --1225 --
NM_015393chr483808 3752 3505 2992 2981 2585 1240 1067 23444 2717 33491 503 366 --
NM_015396chr33994 264 158 ----173
NM_015409chr1292711 2211 1859 1751 733 366 252 142 27 --11833 --
NM_015415chr12225 194 ------
NM_015419chrX31007 994 456 21126 330 ----
NM_015429chr36975 756 462 446 187 73 1719 1271 --
NM_015435chr82554 494 --1544 --
NM_015436chr472923 2224 1143 913 771 343 86 --12741 --
NM_015446chr151380 1107 524 339 305 ------
NM_015447chr93783 191 104 ----1534
NM_015453chr331805 1737 832 --11451 --
NM_015455chr563763 2685 1517 1398 1378 1033 --33537 507 239 --
NM_015457chr113299 264 214 ------
NM_015458chr8124706 4680 4595 4424 4209 3886 1500 1334 1255 817 280 240 13674 14318 --
NM_015460chr322144 1568 31850 691 345 ----
NM_015461chr18--1624 --1222
NM_015475chr221106 133 ------
NM_015483chr74785 308 265 47 ------
NM_015484chr15845 780 634 620 606 ------
NM_015492chr1531039 987 409 ------
NM_015497chr1541013 462 312 57 ----11069
NM_015508chr331317 1268 50 ------
NM_015509chr126365 333 316 288 206 200 --11042 --
NM_015516chr1131426 1279 1167 --21254 987 --
NM_015520chr332545 2479 1058 3841 796 698 ----
NM_015523chr111236 --135 --
NM_015534chr111022 --21085 1051 --
NM_015535chr272889 2823 1646 1193 708 429 133 1499 12766 --
NM_015541chr331456 1118 415 --195 --
NM_015542chr1021079 452 139 ----
NM_015548chr61708 --1156 1885
NM_015550chr763374 3339 2975 2893 1231 1054 22419 631 43286 2946 2342 538 --
NM_015553chr695164 5048 4648 4015 1656 1412 1322 1234 178 23566 883 ----
NM_015554chr1542440 2182 1813 546 ------
NM_015557chr142617 2371 309 37 ------
NM_015559chr18----1357 --
NM_015564chr583386 3279 3037 2715 2704 2648 2348 2251 13553 12762 --
NM_015567chr1341256 1137 304 194 175 --11087
NM_015568chr2033127 2975 2917 2855 213 1205 --
NM_015569chr173965 3679 3505 3448 3394 1670 146 34872 3512 3171 23833 271 --
NM_015570chr711442 11471 ----
NM_015571chr642256 2187 902 22 ------
NM_015575chr253238 2944 926 300 125 --22314 976 --
NM_015576chr372656 2155 1031 809 451 331 229 12500 1416 12583
NM_015577chr541843 1718 556 489 --2724 38 --
NM_015578chr1941461 1341 196 106 ------
NM_015602chr151488 1168 1129 495 187 --21367 168 11610
NM_015605chr1021479 978 1526 1197 --
NM_015608chr101604 ------
NM_015609chr142711 2662 2632 760 2509 453 12423 --
NM_015610chr742510 1017 370 178 1882 ----
NM_015622chr72218 51 ------
NM_015626chr1721168 1145 --181 --
NM_015630chr2------1787
NM_015635chr941840 551 468 178 ------
NM_015640chr1125314 5147 4843 4657 3504 1982 1854 1434 1242 951 657 553 24950 2043 33408 360 145 --
NM_015642chr31105 ------
NM_015652chr102538 437 ----1653
NM_015660chr73267 225 36 ------
NM_015676chr14------1151
NM_015678chr1351602 1586 1323 1113 88 ------
NM_015686chrX11780 ----12188
NM_015687chr62164 142 --2446 65 --
NM_015691chrX32879 2793 659 11963 12921 --
NM_015695chr631978 1901 1493 ------
NM_015713chr893557 3337 2849 2744 2407 1164 989 502 340 --12907 --
NM_015716chr172663 486 1296 ----
NM_015723chr71496 1547 ----
NM_015840chr162379 2282 2214 944 550 247 --21690 425 --
NM_015841chr162379 2282 2214 944 550 247 --21690 425 --
NM_015850chr832236 2033 901 --12191 --
NM_015866chr131099 427 174 ------
NM_015878chr841900 1360 705 163 12234 ----
NM_015879chr18258533 8220 7737 7678 6604 6357 6230 5751 5351 5261 3217 3110 2444 2364 2236 2124 1557 1443 1348 1179 870 592 454 304 232 11522 26857 2040 --
NM_015881chr111153 ------
NM_015885chr11----1135 --
NM_015888chr1122927 2638 2585 2561 2505 2325 2144 1080 996 730 565 256 1212 ----
NM_015891chr631979 172 33 2691 77 1161 --
NM_015902chr84757 276 187 64 ----1619
NM_015906chr1114023 3414 3091 1619 1595 1408 1254 1017 927 652 546 --21424 1234 --
NM_015912chr832092 1848 387 1896 --22317 1768
NM_015939chr201175 ------
NM_015948chr62169 112 ------
NM_015975chrX71834 1662 1411 742 672 565 334 ------
NM_015980chr511114 --11514 11456
NM_015984chr11509 --1464 --
NM_015986chr1741280 355 135 96 ------
NM_015994chr142265 47 ------
NM_016003chr742510 1017 370 178 1882 ----
NM_016009chr164203 3930 3767 1416 1095 368 ----13418
NM_016018chr842788 2385 2217 1027 ------
NM_016021chr642806 2717 2302 270 22141 2059 --12817
NM_016022chr121044 760 ------
NM_016023chr851918 1726 795 745 268 ------
NM_016025chr1611276 ------
NM_016032chrX21401 881 ------
NM_016038chr71416 ----1494
NM_016040chr142494 2366 844 829 --12276 22703 2658
NM_016045chr2031696 1449 1237 1217 --1188
NM_016047chr2----122 --
NM_016059chr63326 211 91 ------
NM_016061chr241660 1592 1582 388 11517 ----
NM_016072chr1292390 1866 1847 1603 1513 729 468 375 26 11588 --157
NM_016075chr1372698 2639 2213 2003 1064 623 296 --13047 --
NM_016076chr162687 2082 2054 1982 1050 803 --12073 --
NM_016078chr173959 886 314 ------
NM_016081chr421810 524 ------
NM_016083chr6123591 3072 3016 2875 2688 2628 2578 2542 2416 2401 1018 769 --12922 --
NM_016087chr731596 454 403 ----1170
NM_016090chr1151068 999 313 251 37 --11030 --
NM_016094chr31732 ----129
NM_016096chr852046 1542 586 289 131 --1537 --
NM_016097chr1811109 1237 1151 --
NM_016100chr201101 ------
NM_016101chr1621348 563 1944 1314 --
NM_016107chr531270 1127 46 ------
NM_016125chr17----142 --
NM_016129chr42256 77 ------
NM_016131chr261739 1625 471 311 227 111 --21983 151 --
NM_016132chr1563256 2803 2679 2099 63 33 ------
NM_016133chr221566 1026 --1190 --
NM_016152chr311145 ------
NM_016156chr1152211 1605 1590 1575 316 ----22233 450
NM_016162chr121660 ------
NM_016192chr21108 ------
NM_016201chr341533 1468 1462 136 --1487 --
NM_016206chr3228742 8259 8036 7892 7877 7805 7349 7323 7074 6720 6417 6356 6158 3146 3050 2010 1770 1501 1071 543 293 255 38185 5806 1057 --1217
NM_016217chr6103617 3432 3135 3086 2798 2476 1334 716 578 223 12941 21385 823 --
NM_016218chr52439 313 --1515 --
NM_016221chr551662 1570 918 561 469 --1615 --
NM_016226chr121380 ------
NM_016230chr62427 39 ------
NM_016231chr1721302 1269 11741 11375 --
NM_016248chr13103967 3567 3482 3450 2873 1478 1341 905 510 205 ----13111
NM_016252chr23928 714 696 ------
NM_016258chr12548 39 ------
NM_016260chr2167038 6880 5589 5091 4994 2938 2862 2527 2477 2338 2280 2082 1872 1708 1620 1542 1657 1159 11698
NM_016269chr461213 1019 941 404 332 212 ------
NM_016271chr1861967 1648 856 268 167 118 1677 --12079
NM_016272chr2252485 2270 1808 684 665 ------
NM_016275chr362082 2017 1856 1750 912 883 ----11785
NM_016277chr651554 1538 1487 1259 511 ------
NM_016284chr162233 123 ------
NM_016287chr151794 333 205 157 68 ------
NM_016289chr2102325 2260 2134 1449 1442 795 745 222 127 41 22120 637 --1467
NM_016299chr10148 ------
NM_016303chrX1298 --1136 --
NM_016306chr31124 --157 --
NM_016308chr151941 1566 1530 1410 528 11798 11295 --
NM_016312chr122470 382 ------
NM_016315chr241329 473 325 57 --11472 --
NM_016322chr942337 1118 606 575 ----22041 29
NM_016329chr31516 ------
NM_016338chr521117 302 1257 ----
NM_016357chr1221087 219 ------
NM_016374chr121200 1161 1383 1429 --
NM_016374chr121200 1161 1383 1429 --
NM_016376chr1763904 3689 2926 2783 2734 715 --13137 --
NM_016377chr621682 1452 21535 366 1447 1379
NM_016395chr151162 31707 566 201 ----
NM_016396chr15102431 2257 1944 1932 1903 676 423 263 168 123 1591 22977 2541 --
NM_016410chr92411 65 ------
NM_016422chr1143158 3119 850 178 1400 2230 139 11008
NM_016424chr1741912 1516 331 273 ------
NM_016436chr2052709 2548 2168 1804 449 11788 ----
NM_016441chr231996 1697 752 --22390 1512 --
NM_016442chr5102134 2073 1947 1864 1729 1548 804 651 643 97 --1748 --
NM_016447chr71200 --1100 --
NM_016448chr171743 1616 1597 602 380 291 129 --11285 --
NM_016472chr1431528 1229 256 --11256 --
NM_016485chr672158 1570 1554 1393 912 856 206 --1660 --
NM_016486chr16457 427 357 337 96 56 ------
NM_016507chr1752771 2560 2171 873 109 --2103 82 12037
NM_016516chr22772 185 ----132
NM_016519chr42488 406 ------
NM_016525chr91239 ------
NM_016530chr15104127 3692 3568 3367 3096 2920 1253 714 693 277 --21291 799 --
NM_016531chr443031 2610 1184 72 --11155 1566
NM_016538chr171135 ------
NM_016542chrX21277 166 1582 11551 --
NM_016544chr252798 1212 1203 224 186 12735 1126 --
NM_016548chr931615 639 363 1112 ----
NM_016562chrX61502 1275 1142 573 202 146 --11050 --
NM_016575chr1295352 5262 4366 4331 1793 1632 1559 1244 773 --34115 832 523 --
NM_016577chr384440 3465 3451 1729 1711 1541 507 323 ------
NM_016578chr111538 ----1682
NM_016587chr71257 1239 ----
NM_016603chr531975 1730 115 ------
NM_016604chr511232 ------
NM_016605chr562453 2286 2220 2163 1686 651 ------
NM_016607chrX71682 1350 1332 1281 305 218 50 1456 ----
NM_016620chr12970 961 --182 --
NM_016621chr1143877 3376 1235 1038 ------
NM_016623chr82666 94 ------
NM_016625chr33389 318 126 --1132 --
NM_016628chr104907 757 633 567 ------
NM_016631chr211249 1772 ----
NM_016645chr151336 ------
NM_016651chr1431130 149 82 ------
NM_016819chr32555 514 ------
NM_016820chr3170 ------
NM_016821chr32508 57 ------
NM_016824chr1051661 308 274 175 168 --1536 11885
NM_016834chr1764048 3784 3609 3479 2621 205 1675 ----
NM_016835chr1764048 3784 3609 3479 2621 205 1675 ----
NM_016841chr1764048 3784 3609 3479 2621 205 1675 ----
NM_016929chr6114411 4078 3243 3074 2846 1822 1582 1485 1376 1273 121 ----14224
NM_016936chr1631865 887 367 ------
NM_016950chr4173 --1180 --
NM_016952chr1194093 3057 3003 2882 2615 2597 1472 860 719 --12686 --
NM_016953chr2105735 5726 5635 5433 5041 4858 4822 4195 2233 1402 13741 25608 5247 14663
NM_017412chr831183 283 223 ----11218
NM_017420chr1453333 3009 955 541 274 ------
NM_017423chr441702 861 668 553 --1177 --
NM_017425chr11171 1271 ----
NM_017437chr1451789 872 586 58 25 ----1676
NM_017440chr12123 1603 ----
NM_017451chr1711012 ------
NM_017510chr51644 ------
NM_017519chr621305 1216 ------
NM_017544chrX3400 297 112 ------
NM_017548chr362138 1714 1459 1375 479 286 11732 1633 21500 74
NM_017549chr731409 1337 1090 --11326 --
NM_017551chr1052698 2181 1662 761 126 ------
NM_017553chr1521132 189 --1169 --
NM_017554chr342208 1500 181 38 22020 1510 ----
NM_017563chr3126209 6070 5070 4512 4272 4100 2523 2240 1622 493 458 65 45537 5347 2562 1124 25666 1523 --
NM_017580chr1031739 1681 1542 ------
NM_017582chr131827 476 104 ------
NM_017588chr941731 1587 727 520 11911 --11579
NM_017593chr4--177 ----
NM_017595chr1711701 --11056 --
NM_017599chr1241912 1510 1340 301 ------
NM_017610chr1541620 732 716 228 ------
NM_017617chr931585 237 52 1589 1214 --
NM_017628chr4155282 4788 4751 4420 3892 3768 3640 3233 1070 516 488 464 382 228 187 13675 35190 1237 751 --
NM_017633chr643193 2539 983 330 --12988 --
NM_017634chr831651 571 211 1356 ----
NM_017635chr1111360 ------
NM_017637chr9138456 8322 8001 7210 6653 6339 3696 3645 3411 2807 2258 1306 662 --49083 7865 3432 2308 15775
NM_017638chr13929 896 23 ------
NM_017640chr61220 1250 --1324
NM_017641chr122837 313 21103 123 1920 --
NM_017643chr1783030 2904 2872 2809 2789 2150 982 857 ------
NM_017644chr374855 4346 3386 1923 1675 768 409 14271 45020 4768 1277 348 11231
NM_017645chr982964 2914 2827 2522 2357 2345 1218 417 ------
NM_017650chr785272 4301 2355 2140 2066 1657 1362 237 35862 4384 3718 25833 4002 11634
NM_017651chr641649 1137 437 376 ------
NM_017658chr1464669 4575 3796 3502 1808 1666 14062 31691 1040 475 21527 555
NM_017660chr1942337 1217 951 430 ------
NM_017661chr1551185 1097 1053 264 45 ------
NM_017672chr1511105 1948 --1280
NM_017684chr1522044 74 11845 ----
NM_017693chr1341541 1460 420 374 --21041 541 --
NM_017694chr241984 1618 1474 436 ------
NM_017709chr144338 4038 812 88 ------
NM_017714chr204955 852 311 86 ------
NM_017719chr362346 1782 967 270 130 75 ------
NM_017736chr1642343 1166 940 509 22902 1264 ----
NM_017737chr162181 2055 1353 537 405 387 ------
NM_017738chr941002 851 774 89 1210 ----
NM_017740chr161380 --31676 1418 81 --
NM_017742chr1831445 1361 133 --11265 --
NM_017745chrX1270 ------
NM_017753chr93916 108 39 ------
NM_017754chr653822 913 709 345 21 14959 13596 11484
NM_017762chr1562463 2333 1735 623 456 381 2395 310 ----
NM_017768chr16779 302 259 225 85 71 ------
NM_017769chr1483133 2736 2260 1067 1044 931 408 219 1977 13066 12054
NM_017770chr632986 2118 463 22806 2720 2733 123 --
NM_017778chr82452 329 ------
NM_017790chr92629 416 ----1128
NM_017798chr203476 398 390 --1485 1319
NM_017799chr1431731 1273 111 11940 ----
NM_017801chr362593 2550 1822 1604 385 221 1853 31967 1597 1011 --
NM_017811chr943115 942 509 293 ----13058
NM_017812chr71151 185 ----
NM_017813chr8114888 4740 4232 4126 3860 3766 1815 1723 951 844 731 ------
NM_017824chr1042564 2240 240 157 ----1533
NM_017830chr42339 48 ----1214
NM_017845chr42813 257 ------
NM_017847chr12258 82 ----12160
NM_017848chrX84150 3943 3928 3879 3745 3258 984 276 23334 1443 33051 1653 1617 12865
NM_017849chr222189 1943 13111 ----
NM_017902chr1055141 4624 3520 479 363 11657 ----
NM_017915chr1221188 216 1407 ----
NM_017918chr4183 ------
NM_017919chr9105800 5193 5090 4527 2216 2019 1373 1102 1000 838 35477 5219 1019 15794 --
NM_017922chr143658 637 272 ------
NM_017925chr911368 1182 154 --
NM_017933chr251458 1444 1085 642 266 ------
NM_017935chr41244 ------
NM_017938chrX31990 1836 778 11730 ----
NM_017944chr1162699 2383 830 788 728 580 --12983 --
NM_017945chr32460 70 --11352 --
NM_017952chr284477 4336 2799 1814 1439 1010 947 410 --13918 --
NM_017958chr243030 2797 1975 1968 --12740 --
NM_017964chr221022 90 ------
NM_017975chr153831 329 261 ------
NM_017987chr1042088 445 267 123 ------
NM_017988chr124825 597 374 280 ------
NM_017990chr1694035 3988 3746 2986 1373 699 555 121 36 33875 3481 3199 ----
NM_017993chr131138 1288 ----
NM_017994chr732524 718 97 23024 409 ----
NM_017996chr15156 2358 285 126 --
NM_018004chr32380 259 ------
NM_018011chr131582 ------
NM_018015chrX7876 853 826 297 262 175 64 --11011 --
NM_018018chr1261855 1820 1645 760 378 73 ------
NM_018019chr1731066 473 320 ------
NM_018027chr1031232 1162 960 --1169 --
NM_018030chr182969 89 1700 ----
NM_018034chr5192 ------
NM_018036chr1494295 4038 4008 3689 3474 3024 1636 237 103 13248 ----
NM_018043chr1121504 1198 ------
NM_018045chr142224 1180 664 454 1741 ----
NM_018050chr122259 30 ------
NM_018061chr141625 1193 531 125 ----11404
NM_018064chr61232 ------
NM_018084chr283268 2393 1071 1054 971 952 817 117 --22428 369 --
NM_018086chr231548 1368 596 ------
NM_018092chr1661497 582 514 461 239 220 ------
NM_018094chrX1308 1415 ----
NM_018098chr31225 --1951 --
NM_018105chr841169 843 499 75 192 ----
NM_018112chr941036 822 778 46 ------
NM_018117chr101674 ------
NM_018121chr1043053 2598 2131 326 --13045 --
NM_018126chr441382 1374 361 148 ------
NM_018131chr101600 --1653 1746
NM_018133chr321490 652 ------
NM_018142chr81196 ------
NM_018151chr22679 248 --1610 --
NM_018155chr353430 1392 1351 829 766 --32760 2499 1162 --
NM_018157chr1262376 2334 2228 1281 881 726 12829 12308 --
NM_018159chrX21516 1088 1323 1117 11587
NM_018167chr14--136 ----
NM_018179chr122420 135 ------
NM_018181chr1821981 1478 31780 550 271 ----
NM_018184chr332123 725 520 ------
NM_018191chr1332017 294 125 11921 11871 --
NM_018195chr1142007 1904 850 120 ------
NM_018198chr121316 584 11244 11455 1555
NM_018200chr1562614 2140 2088 1737 807 333 --21967 1801 --
NM_018202chr14770 758 124 115 ------
NM_018208chr131199 961 113 --11158 --
NM_018214chr62904 516 ------
NM_018221chr24322 310 67 39 ------
NM_018222chr1141795 1688 1262 1191 1698 ----
NM_018224chr72201 49 ------
NM_018229chr1441011 910 779 262 ------
NM_018241chr41786 ------
NM_018243chr484010 3958 3912 3809 3583 3363 557 426 2634 341 11348 --
NM_018244chr2041057 977 138 117 ------
NM_018246chr832358 1900 1779 --3785 536 73 --
NM_018247chr672683 1958 814 739 482 95 80 --43144 1970 1928 27 12716
NM_018254chr172393 1950 1695 885 858 513 92 12025 1736 162
NM_018257chr2041848 1766 1659 830 --12142 --
NM_018263chr262624 2431 2378 1884 1707 593 ------
NM_018269chr24315 284 201 115 ------
NM_018286chr171351 --1826 --
NM_018287chr1021143 222 ------
NM_018293chr392952 2579 2260 2232 2221 2035 1150 1024 955 --11866 --
NM_018299chr853010 2985 2776 1083 940 ----12489
NM_018312chr1142097 1993 1510 446 --31347 846 834 --
NM_018313chr372655 1879 931 746 672 618 284 ----12598
NM_018315chr43474 458 210 --11038 --
NM_018325chr921470 1134 ------
NM_018327chr2051756 1202 534 525 396 --1472 --
NM_018328chr22412 58 ------
NM_018332chr1621389 906 ------
NM_018348chr1651220 1128 1042 329 112 11027 ----
NM_018351chr1294421 4401 3610 3525 1264 995 787 572 181 13731 --24259 1808
NM_018361chr863242 2639 1618 1177 590 442 --23539 2469 --
NM_018362chr11124021 2886 1296 1270 836 806 630 476 361 156 130 27 --23089 1180 --
NM_018364chr153861 3496 613 475 341 --13362 --
NM_018367chr1162223 2053 1013 691 568 194 11668 32466 2360 1780 --
NM_018372chr11566 1624 ----
NM_018373chr1485870 4649 4362 1938 1847 1305 828 702 --26090 4065 --
NM_018374chr7134869 4755 4221 4016 3923 2111 1901 1808 1727 1721 1263 1256 715 --2544 525 11818
NM_018383chr252061 2007 522 465 319 ------
NM_018387chr92500 218 ------
NM_018401chr461527 1193 649 331 227 39 ------
NM_018403chr3114085 4030 3738 3266 3134 1576 1399 1250 760 564 128 1659 13808 --
NM_018409chr483220 2574 2552 1288 901 855 484 461 13139 22414 1034 1385
NM_018424chr981525 1448 1361 748 532 445 425 277 1456 31870 1715 1566 --
NM_018425chr1042459 1853 403 269 12509 1898 --
NM_018429chr562938 2862 2658 2384 1861 301 --1449 --
NM_018431chr20--1666 1526 --
NM_018434chr5170 ------
NM_018439chr1872293 2148 952 563 508 446 243 --1158 --
NM_018440chr8197737 7689 7544 7496 7113 6129 5980 5626 3004 2851 2427 2320 2245 1793 1680 1631 1353 1222 293 --26758 3428 --
NM_018442chr11356 ------
NM_018444chr842386 2051 1866 683 --1809 --
NM_018448chr1231232 887 380 1247 ----
NM_018452chr6_random83348 3330 2560 2475 2440 2356 1265 743 11123 11367 --
NM_018460chr22116 35 1162 ----
NM_018462chr32806 159 --1819 1629
NM_018464chr102175 146 ------
NM_018469chr1741025 556 500 69 11276 ----
NM_018482chr832521 2262 1895 11867 22486 479 --
NM_018489chr151950 837 304 101 30 ------
NM_018490chr1171800 1791 1455 1403 651 157 71 11709 179 --
NM_018534chr22629 174 ------
NM_018557chr251680 1660 1224 182 111 ------
NM_018566chr195041 4526 4066 3912 3488 3232 1565 1445 1310 11648 21153 936 11914
NM_018569chr441405 1324 1313 498 --1194 --
NM_018590chr10--1517 --11356
NM_018602chr1541698 622 403 242 ------
NM_018638chr12135325 4565 4538 4442 4216 3816 3789 3596 1655 1557 475 446 110 --14900 --
NM_018640chr12122816 2785 2768 2587 2402 2196 698 682 361 350 153 50 ------
NM_018649chr103535 486 175 ------
NM_018650chr152118 913 563 246 188 --1807 --
NM_018652chr153159 143 82 1170 1761 --
NM_018657chr33718 612 308 ----2669 92
NM_018660chr862980 2680 2649 2538 2041 818 --12864 --
NM_018682chr73459 295 143 ----1584
NM_018684chrX21401 500 --1554 --
NM_018685chr751092 1059 418 248 43 ------
NM_018689chr1532328 1862 272 ------
NM_018691chr541227 1174 1076 914 ------
NM_018695chr531841 1540 743 ------
NM_018703chr16--1291 142 --
NM_018704chr181787 1722 1662 1575 1561 448 327 112 ------
NM_018712chr1131372 184 134 --1987 --
NM_018715chr12759 50 12151 ----
NM_018717chr452845 2256 2080 1094 178 11154 12889 12565
NM_018718chr72380 77 ------
NM_018723chr16189 ------
NM_018834chr53960 678 303 1763 --1404
NM_018847chr931660 315 120 21766 1756 11918 --
NM_018898chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018899chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018900chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018901chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018902chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018903chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018904chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018905chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018906chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018907chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018908chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018909chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018910chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018911chr552349 2274 2254 2161 1961 22187 1858 ----
NM_018931chr52317 21 ------
NM_018945chr663594 1388 1349 985 912 184 1380 22668 1050 --
NM_018951chr72812 143 ------
NM_018970chr7143186 3087 2874 2852 2634 2557 2501 2111 2011 933 847 833 718 643 12791 22895 2866 --
NM_018976chr1232265 1859 934 31022 368 35 1186 --
NM_018977chrX1944 ------
NM_018983chr41113 ----1264
NM_018992chr161108 ------
NM_018999chr10104824 3865 3811 3480 1705 1333 926 884 702 400 34492 1676 914 21532 199 --
NM_019000chr531554 1409 1313 11251 ----
NM_019001chr3124850 4661 4514 4454 3988 3656 3158 1833 1479 654 579 130 11290 33650 1569 1473 --
NM_019004chr721864 159 ------
NM_019006chr152229 34 --1532 --
NM_019008chr22103523 3133 2926 2544 2465 1388 1108 433 333 162 --21447 806 --
NM_019022chr1852785 2721 2626 1247 1136 22753 279 ----
NM_019027chr432356 1803 275 --12367 --
NM_019030chr5------164
NM_019035chr431561 747 204 ------
NM_019041chr632555 2244 439 ------
NM_019049chr13559 139 114 ------
NM_019050chr462102 1924 1559 851 650 568 --1351 --
NM_019053chr10--1295 1158 --
NM_019063chr231851 1700 392 --11520 1340
NM_019066chr152320 137 ------
NM_019071chr71268 ------
NM_019072chr5114267 4155 4141 4031 3861 3519 3464 3399 3321 548 487 1109 ----
NM_019083chr131452 1019 347 --126 --
NM_019084chr1052521 597 576 380 338 ------
NM_019087chr571750 471 375 240 134 121 61 1635 ----
NM_019091chr221058 168 ------
NM_019094chr1273811 3555 3186 1538 1016 584 409 2307 78 23786 2540 22831 1159
NM_019106chr2243256 2468 1281 348 --32574 2444 280 --
NM_019114chr962155 1719 1560 444 405 291 1351 1490 --
NM_019116chr1663502 3406 3307 1317 1264 419 11144 ----
NM_019555chr321383 137 --1442 --
NM_019556chrX31132 279 68 ------
NM_019590chr10--1557 ----
NM_019593chr2093062 2879 2764 2357 2161 809 442 57 23 --12311 1350
NM_019596chr2192850 2568 2336 1993 1129 1123 977 344 44 ------
NM_019597chrX4547 299 158 51 ------
NM_019610chr151708 1454 1362 808 301 --11749 --
NM_019842chr61296 ------
NM_019843chr223463 136 67 ------
NM_019852chr141106 ------
NM_019859chr101233 --165 --
NM_019860chr101281 --1113 --
NM_019862chr1651747 589 537 490 21 ------
NM_019891chr121268 1178 ------
NM_019898chr1651747 589 537 490 21 ------
NM_019899chr1651747 589 537 490 21 ------
NM_019900chr1651747 589 537 490 21 ------
NM_019903chr1051661 308 274 175 168 --1536 11885
NM_020116chr42339 288 ------
NM_020120chr221327 1185 2138 34 ----
NM_020122chr2105458 5422 4426 3974 2047 1793 1726 852 647 162 15102 46031 3864 1737 686 --
NM_020123chr104979 617 608 335 ------
NM_020130chr821406 1125 1501 ----
NM_020132chr2184687 4462 4031 1447 1410 1370 684 353 34157 1808 659 15129 --
NM_020135chr61303 ------
NM_020137chrX2452 353 ------
NM_020141chr192150 2142 2035 1754 1695 1675 960 521 129 --1664 --
NM_020144chr762075 1902 1841 1364 522 264 --1353 --
NM_020147chr153839 354 63 1805 ----
NM_020150chr1012219 --1500 --
NM_020154chr15125 ------
NM_020159chr441682 700 492 237 ----1436
NM_020177chr583199 2824 2763 2742 836 524 501 91 1738 ----
NM_020178chr173967 906 819 --1924 --
NM_020184chr24922 783 683 296 --1519 1606
NM_020185chr61409 ----1119
NM_020186chr7----1524 --
NM_020193chr1131349 1166 993 ------
NM_020198chr1741550 1511 1065 136 ------
NM_020199chr521012 336 11289 1169 --
NM_020204chr11151 1701 ----
NM_020205chr143224 2291 736 474 --1687 --
NM_020210chr151987 ------
NM_020228chr1141856 563 458 168 ------
NM_020240chr562247 815 568 440 397 351 1767 12222 --
NM_020245chr6114618 4351 3731 3617 2033 1824 1570 540 235 223 168 1485 14239 --
NM_020311chr21590 --1178 --
NM_020336chr20103889 3764 3525 3006 2952 2795 2481 1494 1391 1236 1155 ----
NM_020337chr463125 2559 760 675 546 206 ------
NM_020338chr1083601 3509 3479 3189 3172 3065 1415 1006 --13730 --
NM_020341chr2022046 1431 ------
NM_020342chr272599 2528 2075 1944 1761 356 56 ------
NM_020346chr1171710 1364 1307 1274 1118 220 192 ------
NM_020347chr372269 2260 2027 1925 734 629 485 ------
NM_020353chr341562 1517 816 463 ------
NM_020357chr33510 200 114 ------
NM_020403chr1321492 306 ------
NM_020416chr42908 724 ----1709
NM_020420chrY51322 706 699 538 235 --1346 11338
NM_020423chr1--2493 239 ----
NM_020432chr721593 818 ------
NM_020438chr9----11227 --
NM_020440chr163353 3006 1198 727 379 268 22884 561 ----
NM_020443chr187026 7007 6964 6859 1710 1692 862 848 26058 2070 16993 11524
NM_020449chrX2513 107 --2736 691 --
NM_020452chr132139 1337 159 ------
NM_020455chr652729 2282 624 509 485 ------
NM_020463chr221466 1152 ------
NM_020466chr645033 3959 1958 407 ------
NM_020473chrX31695 1676 34 ------
NM_020474chr181642 --1654 --
NM_020532chr23696 191 32 1255 --153
NM_020546chr552885 2796 619 375 324 ----2602 384
NM_020548chr2------1194
NM_020640chr32255 247 1572 1832 --
NM_020644chr115850 748 694 271 81 ------
NM_020645chr111542 --1655 --
NM_020647chr882320 1954 1769 833 800 682 648 335 1432 ----
NM_020651chr221764 418 --21581 102 --
NM_020654chr331597 647 65 ------
NM_020661chr1221779 515 ----1398
NM_020673chr20187145 6468 6351 5573 4894 2605 2407 2203 2185 1719 1704 1403 1316 1228 1135 529 436 326 --25725 2950 1962
NM_020698chr1252937 2354 2226 1257 1028 --13069 --
NM_020699chr155310 4243 3623 1456 923 --24470 4446 24926 4719
NM_020704chr752518 2162 1625 818 809 1326 ----
NM_020711chr231791 966 219 12230 ----
NM_020713chr2013072 ----11090
NM_020715chr1432290 1899 803 ----11591
NM_020718chr16196341 5991 5377 4797 4051 2543 2303 2135 2097 2064 1961 1432 1239 1195 1163 1023 941 718 654 35237 5140 2175 21948 28 12161
NM_020727chr2173892 3452 2882 2449 1607 840 307 1819 13719 --
NM_020728chr732427 468 462 12047 ----
NM_020732chr621305 1216 ------
NM_020734chr1273089 2927 2520 2272 2078 424 181 ------
NM_020739chr1594080 4058 2852 1439 1150 605 554 465 199 34028 3819 1487 1963 --
NM_020742chrX42085 2030 1680 1668 12375 22284 889 --
NM_020747chr55761 707 687 208 118 ------
NM_020748chr1721579 770 ------
NM_020749chr861603 1479 1289 804 597 500 ------
NM_020752chr1052493 2177 2079 1986 501 ----12850
NM_020754chr331224 321 163 --145 --
NM_020755chr621142 146 ------
NM_020760chr261510 482 452 379 261 152 ------
NM_020762chr122214 174 ------
NM_020766chrX113583 3563 3388 3144 3040 1638 1475 1301 1016 866 445 --34545 4523 1630 --
NM_020768chr543213 1240 319 40 ------
NM_020769chrX21002 974 132 ----
NM_020772chr17148519 8212 8182 7852 7752 6349 6244 6068 5576 3478 3242 1875 1008 786 ------
NM_020774chr18146048 5909 5038 5024 4743 3827 2390 2280 1719 1661 1292 1275 1064 367 36102 6079 1783 24012 867 --
NM_020777chr442343 1690 1555 1015 22414 2319 22526 2232 --
NM_020782chr1244646 4571 4398 4018 ----24778 1270
NM_020783chr1872133 1784 949 584 526 519 403 ------
NM_020791chr1731362 1132 134 --1565 --
NM_020794chr121393 1312 ------
NM_020796chr5--12939 12014 --
NM_020801chr522090 2035 ------
NM_020805chr1831599 680 567 ----1702
NM_020810chr1453397 3252 2409 2309 186 --31247 658 643 --
NM_020821chr1522044 74 11845 ----
NM_020824chr101124 --1107 --
NM_020825chr16103074 2908 2672 2645 2521 2341 1341 1076 1047 832 12555 12373 --
NM_020839chr341586 322 132 31 --21141 1057 --
NM_020841chr1293641 3426 3111 2876 2813 2768 1396 535 157 33786 3720 864 1512 --
NM_020843chr152267 89 ------
NM_020854chr1851445 1351 1326 625 328 ------
NM_020858chr1532235 1826 1595 ------
NM_020860chr43395 252 39 ------
NM_020861chr62935 32 ------
NM_020866chr131367 1437 --1427
NM_020868chr231991 347 323 1152 1375 --
NM_020870chr441593 892 422 80 --22065 1869 --
NM_020871chrX82430 2416 2206 2064 851 735 361 37 ------
NM_020872chr341757 1662 599 354 1650 11791 --
NM_020873chr33850 716 702 ------
NM_020888chr142054 774 349 255 ------
NM_020897chr13858 836 465 ------
NM_020918chr1023397 1341 13434 2484 418 --
NM_020919chr251295 1103 266 57 31 ------
NM_020920chr14148 ------
NM_020921chr1483579 3504 3323 3296 2591 2344 2271 984 --1711 --
NM_020922chrX21699 386 ----1109
NM_020935chr221221 273 34098 3852 739 34562 3419 3371 --
NM_020937chr142605 188 ------
NM_020940chr1022499 2335 --12061 --
NM_020948chr163712 2521 1369 1016 813 320 23530 3522 22528 630 2335 257
NM_020951chr1921696 448 ----12084
NM_020952chr92640 357 1180 ----
NM_020960chr974857 4765 1983 1636 1578 308 276 14335 15037 11227
NM_020962chr1572490 2374 2124 1992 1886 1659 795 ------
NM_020975chr102743 632 ------
NM_020977chr421766 1434 --21686 1597 --
NM_020987chr1051032 929 314 294 225 --21224 908 --
NM_020993chr1222854 289 ------
NM_021005chr1531190 894 252 ------
NM_021007chr222345 1566 12302 ----
NM_021032chr331884 1790 470 ------
NM_021033chr1393269 2816 2529 2441 2298 946 223 199 170 12849 11318 1269
NM_021069chr442132 1937 1632 1420 11986 --1854
NM_021072chr5--22142 996 ----
NM_021090chr2284860 4696 4002 3875 3445 1978 1714 528 24420 1633 14240 --
NM_021097chr2153067 3058 2691 2505 2399 2254 2073 2061 1163 1125 1033 920 757 570 85 ------
NM_021101chr382120 1989 1678 1659 480 448 227 190 --11705 --
NM_021110chr83720 557 109 ------
NM_021111chr93970 411 370 ------
NM_021120chrX83146 2879 2701 2542 2354 744 590 430 --12814 --
NM_021129chr101107 --2232 49 --
NM_021132chr102989 844 1183 ----
NM_021140chrX2902 393 1246 1336 --
NM_021144chr92372 351 ------
NM_021145chr71869 ----1178
NM_021148chr722166 166 ------
NM_021149chr1631150 1037 268 11117 140 --
NM_021155chr1952169 531 404 337 314 ------
NM_021156chr202963 254 --1132 --
NM_021159chr431704 1688 674 ------
NM_021163chr743582 2617 1549 129 1773 13439 180
NM_021167chr732301 2178 1878 --12808 --
NM_021174chr81251 ------
NM_021176chr241582 1411 1292 395 1418 ----
NM_021180chr11714 --1641 --
NM_021183chrX52588 2531 1911 893 754 11739 ----
NM_021189chr11243 ------
NM_021194chr1--1293 ----
NM_021202chr2022075 963 12208 ----
NM_021219chr21185 ------
NM_021229chr1241082 216 147 138 --1886 --
NM_021238chr1221907 1566 144 ----
NM_021239chr1421123 904 21430 268 --1186
NM_021245chr10129 ------
NM_021253chr621084 113 --21274 1069 --
NM_021255chr1441231 1125 1016 743 ------
NM_021619chr951328 1320 1271 1203 1072 ------
NM_021622chr1082354 2150 1890 1632 1519 909 661 362 22229 1831 1231 --
NM_021627chr32851 393 ------
NM_021629chr3114348 4081 4066 3691 3525 1051 946 840 804 118 37 24772 881 1574 --
NM_021637chrX31200 186 94 ----183
NM_021643chr22583 299 ------
NM_021647chr494281 4122 3685 3457 3360 3168 1533 1413 609 11730 43903 3436 1786 1289 --
NM_021648chr672706 1818 1705 812 322 115 89 ----1588
NM_021728chr14----1840 1115
NM_021738chr103844 767 241 ------
NM_021803chr4160 ------
NM_021813chr6135751 5578 5198 4928 4558 4528 3577 1498 1420 1298 614 538 107 --178 1752
NM_021814chr621519 1284 11243 --138
NM_021815chr252588 2107 917 802 525 21981 1225 ----
NM_021911chr585164 3900 2143 2051 827 631 366 154 15088 2423 342 --
NM_021912chr1584086 3513 3441 3326 1589 1124 347 33 11209 ----
NM_021914chr1452292 2276 2178 146 22 12265 --1953
NM_021931chr2021089 170 ------
NM_021940chr62193 109 --21546 614 --
NM_021942chr41609 1202 --1259
NM_021945chr673533 3308 3094 2775 2717 627 249 ------
NM_021947chr1741386 1345 1012 413 ------
NM_021949chrX32390 2331 447 1691 22783 1045 --
NM_021954chr1343601 2965 2817 1403 12707 1487 1547
NM_021959chr64985 918 299 192 ------
NM_021960chr112141 ----32013 1115 943
NM_021961chr11117194 7128 5272 4767 4717 2920 1919 507 363 169 29 17083 47528 6917 5434 1443 --
NM_021964chr3115826 5816 4778 4524 2654 2560 1779 1513 1173 1009 554 --24703 4016 --
NM_021967chr541019 986 112 50 --131 --
NM_021988chr202144 62 1183 11129 --
NM_021998chrX21365 237 ------
NM_021999chr136812 612 538 330 282 133 --1287 --
NM_022037chr25944 747 682 638 133 1816 ----
NM_022041chr1652631 2582 2307 1807 629 ------
NM_022048chr15105405 4454 2151 2101 1842 1816 1568 1397 1371 1004 14424 36258 5688 2069 11752
NM_022049chr151801 1480 1224 384 202 11733 11858 --
NM_022054chr143844 770 610 ------
NM_022062chr1111673 --11420 --
NM_022067chr143750 658 33 ----1182
NM_022068chr181608 139 ----
NM_022073chr14133 --11059 1455
NM_022093chr12697 259 --1645 --
NM_022095chr20186 ------
NM_022100chr13493 188 163 ------
NM_022104chr20----1238 --
NM_022114chr143525 1685 1524 1439 14496 1579 --
NM_022116chr751062 1025 404 334 250 1142 1986 --
NM_022130chr541020 1004 915 430 ----11460
NM_022133chr861891 1648 1170 722 697 389 ------
NM_022137chr1431788 1614 173 ------
NM_022140chr5102279 2255 2234 1983 1916 1644 1571 544 517 133 1590 ----
NM_022143chr72474 389 ------
NM_022153chr1032787 2308 1336 154 ----
NM_022166chr1685765 5521 5346 5287 5024 4383 1405 583 16037 --16070
NM_022170chr731522 583 355 ------
NM_022171chr341440 1373 1161 1153 --1215 --
NM_022173chr25944 747 682 638 133 1816 ----
NM_022343chr951260 1206 445 381 84 ------
NM_022346chr43982 570 248 1348 ----
NM_022351chr863712 3365 1005 951 673 54 12945 33483 3457 79 --
NM_022353chr21194 ------
NM_022365chr10131 ------
NM_022366chr12132 36 ------
NM_022368chrX2370 285 145 1341 --
NM_022373chr74711 694 346 254 1179 ----
NM_022442chr202144 62 1183 11129 --
NM_022444chr791746 1712 1597 731 537 436 319 311 251 --21831 488 --
NM_022455chr5299 50 ------
NM_022459chr1396055 5351 5171 5120 5010 4346 4261 3885 1950 11606 35534 4470 96 15542
NM_022461chr331288 363 41 ------
NM_022465chr1232105 459 224 --1626 --
NM_022474chr1462783 2747 2626 754 578 225 1922 ----
NM_022475chr42600 527 ------
NM_022476chr163800 301 215 ----1441
NM_022482chr2062211 1720 956 844 590 490 12269 ----
NM_022484chr711168 1466 ----
NM_022490chr9163 ------
NM_022496chr121197 ------
NM_022497chr343206 2668 1117 249 23778 2856 12543 11336
NM_022550chr52362 51 ------
NM_022557chr171245 ------
NM_022640chr171243 ------
NM_022652chr121365 21075 1057 ----
NM_022658chr12----21274 92 --
NM_022716chr1102986 2820 2766 2332 2194 2072 1072 769 655 615 11283 180 12570
NM_022726chr61399 1480 1489 --
NM_022739chr1741202 916 796 417 ------
NM_022748chr752887 2864 2132 1839 1134 ----1204
NM_022749chr831399 1322 318 ------
NM_022753chr132474 1871 1788 --32425 1113 985 --
NM_022756chr15540 469 415 205 172 1534 21410 327 --
NM_022758chr662641 2267 906 660 574 536 ------
NM_022763chr393171 2441 2202 1980 1087 968 560 398 392 ------
NM_022778chr131470 1090 130 ------
NM_022780chr231154 362 213 ------
NM_022781chr993180 3115 3054 3042 2990 2752 2202 2167 441 12893 13104 13196
NM_022783chr83705 288 213 ------
NM_022817chr272026 1957 1868 895 798 646 458 ----1448
NM_022824chr541812 1375 602 62 11554 1172 --
NM_022826chr21466 --1479 --
NM_022828chr531674 1124 290 1379 ----
NM_022831chr141807 1445 381 335 ------
NM_022836chr121316 342 --11404 --
NM_022841chr1552644 2264 764 386 311 ------
NM_022843chr1341331 1308 1042 331 --11455 --
NM_022845chr1662174 2159 1998 433 381 329 ------
NM_022875chr52210 82 ------
NM_022877chr52210 82 ------
NM_022893chr242936 2267 1092 903 --1709 --
NM_022894chr22261 39 --1538 --
NM_022898chr1454674 4483 3584 1169 1120 11362 14789 --
NM_022900chr74860 276 137 75 --11065 --
NM_022912chr232464 833 404 22449 1134 1415 --
NM_022913chr51302 ------
NM_022918chr1191912 1893 1704 1574 837 640 592 466 40 --21501 126 --
NM_022977chrX51866 1057 984 935 482 ------
NM_022978chr541019 986 112 50 --131 --
NM_023000chr1421570 1082 ------
NM_023001chr1421570 1082 ------
NM_023003chr15----1226 --
NM_023009chr12732 181 ------
NM_023012chr121537 ------
NM_023016chr242791 2378 2298 487 1372 12141 --
NM_023034chr81403 ------
NM_023037chr1321068 877 1249 ----
NM_023071chr121237 ------
NM_023072chr1921028 836 ------
NM_023073chr541247 1069 1053 117 ------
NM_023074chr192416 177 ----1893
NM_023079chr1731560 1168 202 11851 ----
NM_023105chr832236 2033 901 --12191 --
NM_023106chr832236 2033 901 --12191 --
NM_023110chr832236 2033 901 --12191 --
NM_023111chr832236 2033 901 --12191 --
NM_023927chr541329 1130 1065 1044 11056 ----
NM_023929chr862790 2185 2174 1714 854 35 ------
NM_023934chrX62155 1968 1623 1407 422 144 --11930 --
NM_023948chr71159 ------
NM_024007chr573004 2682 2294 2124 1085 953 629 --32595 1225 312 12537
NM_024016chr171521 ------
NM_024050chr191575 ------
NM_024052chr1752413 2290 2123 1046 734 ------
NM_024076chr1932388 2002 1472 --11633 141
NM_024094chr82298 127 ------
NM_024099chr111290 ------
NM_024106chr19----143 --
NM_024293chr23821 292 224 ------
NM_024294chr662641 2267 906 660 574 536 ------
NM_024295chr841803 1530 414 365 1283 11627 11340
NM_024321chr191128 ------
NM_024332chrX194 21750 600 ----
NM_024345chr9115851 4976 4409 2377 1859 991 852 536 385 269 207 --34935 1962 902 --
NM_024416chr951520 1360 1351 1306 109 31606 1403 1053 ----
NM_024421chr1841000 915 318 76 --1885 --
NM_024422chr1881899 1533 1443 1224 548 387 267 213 ------
NM_024424chr112807 264 ------
NM_024425chr112807 264 ------
NM_024426chr112807 264 ------
NM_024482chr1181 ------
NM_024491chr33585 524 226 --1146 --
NM_024496chr14----1261 1212
NM_024501chr21490 ------
NM_024511chr442663 2472 833 283 --11094 --
NM_024522chr14617 575 137 131 --11414 --
NM_024523chr721313 95 ------
NM_024524chr332098 823 796 ----1492
NM_024529chr131109 947 896 ------
NM_024539chrX1282 ------
NM_024546chr132195 170 --122 --
NM_024548chr351508 1387 1165 296 174 11343 ----
NM_024551chr1222528 1941 ----1858
NM_024551chr1222528 1941 ----1858
NM_024554chr121387 493 --1181 --
NM_024556chr111512 ------
NM_024563chr511823 ----11843
NM_024582chr441091 937 925 253 188 ----
NM_024598chr1611046 ------
NM_024607chr8114360 4354 4121 3729 3512 3470 3121 2798 1277 423 263 23600 1302 11692 --
NM_024612chr1721081 359 ------
NM_024613chr821191 321 31737 1577 40 11646 1629
NM_024617chr94915 786 185 70 ------
NM_024624chr22334 316 ------
NM_024631chr112540 197 ------
NM_024635chr91274 ------
NM_024638chr321801 267 12370 1597 1622
NM_024639chr632947 2433 2125 1235 --1981
NM_024646chr174010 3275 1266 903 499 443 58 11187 13892 --
NM_024659chr22700 149 ------
NM_024665chr374404 4252 3618 3433 1853 1585 1333 ------
NM_024670chr102591 134 ------
NM_024674chr133181 915 769 ------
NM_024675chr161232 187 ----
NM_024686chr1147 ------
NM_024692chr261864 1503 1281 540 415 112 --11840 --
NM_024700chr131166 813 229 21149 164 ----
NM_024713chr1551619 1547 591 264 27 11285 --183
NM_024715chr5----1128 --
NM_024721chr821797 985 --2841 444 --
NM_024725chr114812 207 139 97 ----1187
NM_024740chr11133995 3676 3651 3573 3560 3386 1665 1622 1285 827 667 178 90 2620 399 13565 23425 3326
NM_024744chr242583 653 567 226 21893 1048 ----
NM_024761chr994911 4822 4665 4545 4535 3891 3842 3609 1633 35254 4237 1780 24877 385 --
NM_024769chr112860 107 --1199 --
NM_024770chr2136659 6295 6014 5213 4823 4698 4480 4336 4285 4219 2663 1803 1003 1542 --1411
NM_024786chr54934 845 213 143 ------
NM_024811chr1111814 11396 ----
NM_024814chr71274 ------
NM_024817chr15175904 5469 5438 5416 5213 5115 4860 4666 4429 4127 4092 1824 1646 803 750 317 251 ----12060
NM_024824chr1451647 1625 1557 1396 695 1142 ----
NM_024828chr931546 123 53 ------
NM_024834chr1041441 566 523 69 ------
NM_024837chr1541891 599 427 31 ------
NM_024841chr1162329 1720 960 874 787 278 32369 2200 1931 ----
NM_024847chr161939 ------
NM_024852chr12687 265 ------
NM_024874chr141230 1118 105 95 1979 11291 --
NM_024893chr201945 ------
NM_024911chr13807 277 146 ------
NM_024913chr751718 1547 1266 1097 93 11694 1694 --
NM_024920chr431453 346 221 ----11036
NM_024921chrX21340 587 ------
NM_024939chr1621558 515 21198 419 ----
NM_024944chr2141217 465 350 169 ------
NM_024947chr3219617 9563 9285 9067 8852 8447 7887 7662 6802 6624 6532 6043 3455 2595 2034 1728 1644 1532 1121 702 520 29646 9262 ----
NM_024949chr4104936 4370 3855 3467 3095 1920 1055 461 428 282 14231 2938 32 --
NM_024953chr1272832 2660 2489 2476 1983 786 75 --1207 12495
NM_024954chr102650 81 ------
NM_024971chr92640 357 1180 ----
NM_024989chr2157286 6972 6416 5875 5616 5252 5133 2943 2589 2163 1599 1453 1155 371 214 25435 968 47770 6759 2148 1441 --
NM_024991chr1083243 3184 2656 2367 2341 2244 1151 940 --13021 --
NM_024993chr221528 251 11291 ----
NM_025027chr191136 134 ----
NM_025054chr863285 3133 2910 1610 1448 835 23828 1549 --1450
NM_025073chr1144704 4470 4222 3806 3716 3572 3566 1629 1565 1527 1441 1404 972 242 21376 435 ----
NM_025074chr443004 2237 2163 38 --12591 1986
NM_025106chr111417 ------
NM_025112chr3----190 --
NM_025114chr12127 ------
NM_025126chr12--1488 ----
NM_025133chr211170 ------
NM_025134chr1622442 1882 --12518 --
NM_025145chr10251 39 --157 --
NM_025146chr342339 1787 1097 1002 22742 1040 12528 --
NM_025147chr2197 ------
NM_025152chr1462012 1432 1277 797 665 644 --1478 --
NM_025154chr721486 282 --1404 --
NM_025160chr153930 2759 1731 1165 727 23627 607 1717 --
NM_025164chr1142189 1518 1447 136 --11900 --
NM_025179chr174561 4242 3030 1841 1302 794 769 23858 1070 13400 1328
NM_025181chr22582 165 ----1296
NM_025187chr1621230 461 ------
NM_025191chr193105 2534 2362 2322 1392 881 870 561 338 ------
NM_025212chr42115 32 ------
NM_025216chr21480 ------
NM_025221chr431166 405 226 --2568 354 --
NM_025222chr342140 1106 1095 149 --11159 194
NM_025230chr14--3766 352 104 1251 --
NM_025235chr1092250 1959 1847 1782 1729 656 522 511 94 1556 2634 393 --
NM_025236chr62812 78 ------
NM_025238chr1551372 1240 1036 533 258 --11521 --
NM_025244chr22277 85 ------
NM_025250chr772558 2273 2095 814 808 475 124 12801 ----
NM_030621chr1473570 3060 2927 1313 1228 738 227 33636 3541 1664 44266 3579 2790 1688 --
NM_030623chr231714 1669 583 ------
NM_030625chr1082228 2081 1681 1667 866 714 327 96 ------
NM_030627chr583972 3956 3477 2905 1269 1038 487 22 1426 34049 3604 818 --
NM_030629chr1621621 1571 ------
NM_030634chr13991 510 179 1147 --136
NM_030637chr142200 184 ------
NM_030647chr7206273 5898 5618 5364 5039 4704 4173 2529 2352 1941 1689 1368 1345 998 897 881 821 814 729 604 --34869 1833 1412 --
NM_030648chr484679 3898 3680 3609 1648 669 554 341 1234 14443 24186 66
NM_030650chr2143893 3533 3369 3278 3239 3175 3130 2967 2907 1690 1396 1254 1088 856 --34070 1594 1235 1117
NM_030660chr1421297 415 ------
NM_030664chr1032192 1979 113 1908 --12337
NM_030670chr1242133 1822 1576 108 ------
NM_030671chr1242133 1822 1576 108 ------
NM_030674chr1295519 4880 4850 4614 2157 1132 732 403 267 --14955 25673 525
NM_030751chr1071884 1855 1737 1623 629 365 351 ------
NM_030751chr1071884 1855 1737 1623 629 365 351 ------
NM_030755chr1423060 59 11926 --1370
NM_030759chr101313 --1116 1701
NM_030762chr1241368 1341 771 335 ------
NM_030774chr1141480 1249 1093 27 ------
NM_030777chr2072387 2059 2035 887 463 390 183 --11676 1740
NM_030780chr82306 29 ------
NM_030786chr12766 333 1608 31792 753 223 --
NM_030791chr1421814 1465 1316 ----
NM_030795chr81514 ------
NM_030799chr531886 845 155 22119 113 21788 1628 --
NM_030805chr21861 1444 11102 --
NM_030806chr1179167 8966 8653 8198 6554 6484 6261 6237 6219 3418 2637 2445 2345 2332 2139 991 711 22559 2057 16274 13182
NM_030809chr1241735 898 401 56 ------
NM_030816chr173267 2564 2337 2288 1332 1161 433 ------
NM_030817chr1293753 3540 2725 2715 2685 2324 735 673 181 13036 --13397
NM_030820chr61787 --1187 --
NM_030881chr2272453 2272 1925 812 765 443 329 1580 ----
NM_030915chr262309 2187 572 532 396 41 --11937 1304
NM_030918chr133395 1523 1168 --1482 --
NM_030920chr121862 282 ------
NM_030925chr1351828 397 187 64 34 1151 140 --
NM_030937chr121458 1041 ------
NM_030938chr1731138 997 421 ------
NM_030939chr661015 374 347 329 166 160 1307 ----
NM_030945chr5--32273 768 403 1314 --
NM_030949chr6--1402 ----
NM_030953chr521430 1387 ----11658
NM_030964chr533559 1493 876 ------
NM_030972chr192653 32 ------
NM_031203chr19--1160 ----
NM_031208chr161716 ------
NM_031216chr1892214 1992 1975 1884 1860 747 660 646 541 --1368 1330
NM_031243chr732008 1491 113 11981 ----
NM_031262chr941122 457 364 311 199 147 --
NM_031263chr931179 421 368 1156 1104 --
NM_031267chr72523 29 --136 --
NM_031268chr16104682 4126 3918 3847 3745 3590 3402 2028 1348 1130 --24614 1174 --
NM_031271chr8--31467 326 189 21490 1078 --
NM_031284chr151851 ------
NM_031291chr44611 534 224 69 --1598 --
NM_031292chr1251510 1363 649 630 105 ------
NM_031296chr44846 551 102 24 --12338 --
NM_031314chr1432047 1583 390 --11402 --
NM_031362chr252838 2195 878 624 278 12616 11938 --
NM_031365chr252974 2331 1014 760 414 12752 12074 --
NM_031366chr252974 2331 1014 760 414 12752 12074 --
NM_031371chr121200 1161 1383 1429 --
NM_031371chr121200 1161 1383 1429 --
NM_031372chr441563 467 243 193 ----1531
NM_031411chr552349 2274 2254 2161 1961 22187 1858 ----
NM_031412chr1221150 405 ------
NM_031419chr351468 1049 218 78 63 1234 1421 --
NM_031426chr932791 2481 1066 --3935 157 96 --
NM_031427chr14105497 5057 3775 3673 1435 1380 721 348 306 136 1384 14945 21721 1586
NM_031431chr132631 492 11535 11309 --
NM_031435chr1263391 3327 3037 2265 1025 1001 12751 12434 12906
NM_031442chrX73201 3170 2451 1208 1145 873 57 --43106 2963 1279 759 --
NM_031445chr263299 3155 2490 1180 1123 209 --11294 --
NM_031453chr1031884 1631 881 22293 1008 1422 --
NM_031457chr111373 ------
NM_031461chr832184 2175 372 --12207 --
NM_031468chr7128144 6390 5739 5352 5013 2645 2100 1198 986 312 306 178 17005 15772 --
NM_031469chr634102 3217 2852 33850 3811 806 11029 1795
NM_031475chr11498 --2782 533 --
NM_031483chr2092909 2881 1247 1220 936 490 419 148 138 --33183 1291 641 21120 112
NM_031844chr143503 1336 1060 725 23574 3535 33011 2801 262 --
NM_031845chr2112897 1317 1301 1247 1151 857 806 753 533 360 193 1611 ----
NM_031847chr2112897 1317 1301 1247 1151 857 806 753 533 360 193 1611 ----
NM_031849chr552349 2274 2254 2161 1961 22187 1858 ----
NM_031857chr552349 2274 2254 2161 1961 22187 1858 ----
NM_031858chr1721282 363 ------
NM_031860chr552349 2274 2254 2161 1961 22187 1858 ----
NM_031862chr1721282 363 ------
NM_031908chr531226 869 272 1989 --11179
NM_031911chr452762 2657 2635 2296 993 ------
NM_031934chr17185 ------
NM_031940chr862384 2257 2050 1641 126 59 ----22229 602
NM_031954chr121956 32609 858 443 ----
NM_031966chr52571 60 ------
NM_031992chr731522 583 355 ------
NM_032012chr9114939 4847 3751 3378 3349 2057 1879 1440 1269 307 262 ------
NM_032021chr112464 322 --11096 --
NM_032027chr11289 ------
NM_032047chr342132 194 172 74 ------
NM_032050chr222111 35 ----1192
NM_032052chr224496 420 334 326 ----1577
NM_032102chr1152948 2292 1935 1013 946 ------
NM_032105chr1147340 7147 6810 6487 5568 4998 2567 2012 1692 1045 1034 811 385 175 11272 16640 --
NM_032121chrX32717 456 136 --12748 1347
NM_032124chr1831070 989 874 ------
NM_032138chr131590 ------
NM_032144chr221433 227 ------
NM_032145chr671942 1878 1503 1320 1248 779 596 ------
NM_032147chr123807 315 80 --1408 --
NM_032149chr41187 ------
NM_032151chr51480 ------
NM_032153chr352763 2175 674 295 289 --12577 --
NM_032154chr104704 386 353 179 ------
NM_032160chr1894281 4044 4018 3775 1462 1116 1100 1019 467 33995 3220 2800 33527 2837 328 --
NM_032182chr101464 31654 1464 1103 11492 --
NM_032186chr12970 961 --182 --
NM_032189chr1365029 4430 1982 1933 1141 1057 11478 1493 --
NM_032195chr212493 467 ------
NM_032199chr10103910 3455 3370 3345 2510 2407 2367 1004 622 483 1317 ----
NM_032208chr233119 1372 320 ----23426 326
NM_032217chr431201 225 166 --140 --
NM_032221chr2031530 1483 569 ------
NM_032226chr94683 281 243 83 1874 142 --
NM_032228chr11113497 3068 2514 2389 2345 2213 1394 597 561 445 77 21316 585 --12321
NM_032229chr133749 378 183 ------
NM_032233chr141348 1762 ----
NM_032236chr11852 ------
NM_032239chr41432 ----1520
NM_032246chr1551340 1100 1022 219 176 ------
NM_032268chr1622590 267 --13017 12015
NM_032287chr2253180 1338 1217 1050 27 --24046 561 --
NM_032288chr342357 2024 1990 1883 11597 1246 1680
NM_032289chr541597 1247 355 249 11500 11209 --
NM_032291chr141942 1771 1486 99 11359 1141 --
NM_032303chr941259 1252 669 528 ------
NM_032312chr21741 1721 1183 --
NM_032320chr113755 584 523 ----1536
NM_032325chr1131975 1935 592 --11921 --
NM_032329chr264312 3563 3220 1314 1277 825 ----13389
NM_032352chr142964 310 --1337 --
NM_032354chr1731177 1042 774 ------
NM_032364chr122969 818 ------
NM_032373chr1054359 2066 1301 615 208 15423 11640 --
NM_032383chr361187 981 857 510 430 352 135 ----
NM_032410chr871254 1142 1074 932 867 811 131 ------
NM_032411chr21194 ------
NM_032420chr53887 607 188 1242 ----
NM_032434chr241131 431 376 233 --11087 --
NM_032435chr152203 2052 458 323 306 21799 758 11718 --
NM_032438chr651559 1542 1508 242 211 11658 1473 --
NM_032439chr1041333 1207 1092 365 ------
NM_032440chr1082569 2456 874 799 581 474 405 89 --12080 1744
NM_032444chr162204 58 --11099 --
NM_032445chr153904 524 445 ----1312
NM_032446chr593853 3692 3357 3265 3119 2530 2434 1485 1228 --1370 --
NM_032457chr493912 3611 3228 3178 3044 2968 2393 1206 965 --23627 424 --
NM_032458chrX103001 2714 2573 2163 2140 2088 1322 1055 321 207 --1879 --
NM_032466chr831443 1130 661 11619 ----
NM_032468chr831443 1130 661 11619 ----
NM_032482chr191213 --12503 --
NM_032486chr1672709 2544 794 490 463 231 193 --2278 259 12220
NM_032499chr1531333 712 90 --11686 --
NM_032505chr351779 956 892 244 177 12449 ----
NM_032509chr842333 1955 1598 64 ------
NM_032510chr1841921 1529 508 81 ------
NM_032521chr2052687 2523 643 307 54 ------
NM_032523chr24585 534 130 115 ------
NM_032547chr481185 1086 1069 931 495 467 414 44 --1570 --
NM_032552chr931948 1666 1259 --1270 --
NM_032557chr42931 208 ------
NM_032560chr14--11109 ----
NM_032569chr1641924 1586 1286 374 ------
NM_032582chr1761510 1498 1356 1226 176 65 11460 ----
NM_032590chr123969 409 82 ------
NM_032595chr1741246 1204 1055 380 ------
NM_032603chr24743 534 302 182 ------
NM_032626chr162283 23 ----