TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1247-3p
miRNA Sequence: CCCCGGGAACGUCGAGACUGGAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX56247 5876 4436 4351 1522 --14911 --
NM_000259chr1575803 4240 3988 2260 1293 1040 910 21249 1217 ----
NM_000266chrX1968 ----2404 117
NM_000278chr10101814 1778 754 734 454 433 358 308 220 111 1547 21451 594 --
NM_000362chr2272772 2714 2333 1336 1294 848 178 1230 22946 1397 --
NM_000430chr1743309 3098 2897 234 12563 22976 1186 --
NM_000451chrX3392 244 115 1125 31356 676 37 2274 162
NM_000719chr1276041 5753 5675 2249 612 269 147 1168 1225 14923
NM_000723chr1751233 1050 505 407 326 11455 --1170
NM_000738chr115788 410 276 201 123 2264 40 1136 1709
NM_000831chr1135913 5901 5547 4433 3932 1307 1263 1158 995 956 911 502 31 ------
NM_000875chr1566485 5394 5224 4802 4420 1407 12017 24925 2773 --
NM_001001331chr342061 915 904 270 11956 21081 61 --
NM_001001890chr213314 103 53 --33066 121 96 14178
NM_001003406chr22123261 3153 3093 3082 2519 2047 1171 1164 1059 986 954 743 22164 98 ----
NM_001003652chr1866862 5298 2712 2030 1541 1374 27371 5613 ----
NM_001003760chr643518 3161 2380 160 1846 ----
NM_001003800chr943739 3350 2847 339 --11405 --
NM_001003940chr1573722 3425 3371 3225 3157 3121 601 32783 2768 779 ----
NM_001003942chr1573722 3425 3371 3225 3157 3121 601 32783 2768 779 ----
NM_001004304chr1263041 2436 2407 1127 453 110 22817 2631 42838 2687 227 204 --
NM_001005404chr1783639 1587 687 668 458 405 216 119 22911 2904 1647 --
NM_001005609chrX53646 1472 921 780 40 21515 878 11104 --
NM_001006115chr372640 2254 1976 1022 966 620 374 22563 2003 22589 1072 --
NM_001008220chr553841 3734 3715 3207 943 23161 2895 22667 731 1480
NM_001008701chr1972287 1184 1012 1002 820 165 53 --32030 834 369 12388
NM_001009993chr264329 4061 3710 1561 986 139 ----2887 588
NM_001010867chr1116411 6184 6119 5961 5719 4620 2670 1712 1115 436 47 24539 951 32104 1199 339 14303
NM_001012393chr1123614 3596 11854 --11821
NM_001012426chr693222 2607 2442 1342 1264 1210 819 524 129 --11354 --
NM_001012427chr693222 2607 2442 1342 1264 1210 819 524 129 --11354 --
NM_001012761chr51460 --12480 1130
NM_001013693chr182691 2495 2396 1138 865 406 344 309 11077 12387 --
NM_001013693chr182691 2495 2396 1138 865 406 344 309 11077 12387 --
NM_001017395chr342890 2862 2835 561 23382 2400 ----
NM_001018050chr22153377 3371 3177 3111 2650 2618 2309 2109 2092 1252 1190 1078 1040 895 254 --2989 770 22357 1176
NM_001018052chr22153377 3371 3177 3111 2650 2618 2309 2109 2092 1252 1190 1078 1040 895 254 --2989 770 22357 1176
NM_001025266chr344471 3779 1429 360 --11671 13565
NM_001031680chr182236 2121 1017 950 460 239 117 83 2413 215 --2989 348
NM_001031690chr763078 2610 2206 259 212 137 32443 849 199 ----
NM_001033045chr233312 1470 1281 23231 1421 ----
NM_001033117chr364608 4577 4027 3381 1088 150 --23395 1448 --
NM_001035534chr94924 448 345 49 11148 --11114
NM_001039570chr22124219 4132 3889 3829 3778 3755 3747 1607 1439 1015 518 235 53178 2876 1558 1526 612 ----
NM_001039571chr22124219 4132 3889 3829 3778 3755 3747 1607 1439 1015 518 235 53178 2876 1558 1526 612 ----
NM_001039690chr1662068 2024 949 727 613 258 189 1963 22171 494
NM_001040144chr1662068 2024 949 727 613 258 189 1963 22171 494
NM_001040146chr1662068 2024 949 727 613 258 189 1963 22171 494
NM_001040450chr1522901 2509 ----12130
NM_001040453chr1522901 2509 ----12130
NM_001043318chr1463171 1340 1303 722 706 252 31493 733 633 21365 488 --
NM_001106chr393838 3619 3416 3083 2254 2192 2144 1813 688 --27995 1082 13648
NM_001148chr4--1419 --11801
NM_001365chr172214 47 1729 --1637
NM_001399chrX53646 1472 921 780 40 21515 878 11104 --
NM_001419chr1963800 3669 3220 3168 3149 3102 --23038 530 1551
NM_001497chr952306 1711 1055 1029 310 11069 11792 12431
NM_001543chr5104546 4488 4379 4041 3965 1781 1179 984 682 268 1713 1253 14658
NM_001683chr342061 915 904 270 11956 21081 61 --
NM_001754chr213314 103 53 --33066 121 96 14178
NM_001859chr963937 3818 2662 2572 766 398 13737 ----
NM_002025chrX88663 8049 6589 6357 6070 3451 3058 770 ------
NM_002061chr141954 1706 1479 1229 21905 1430 ----
NM_002149chr24763 276 115 109 --1102 --
NM_002309chr2262935 2860 2671 2626 2348 2122 3916 739 654 ----
NM_002319chr76966 960 919 781 673 168 3901 893 801 ----
NM_002359chr1784252 3942 3895 3169 2763 1376 1310 538 14038 13630 --
NM_002373chr151437 --1539 1405
NM_002375chr351808 1615 358 312 200 11497 52016 1687 229 208 121 --
NM_002390chr1762018 1983 473 304 127 42 11529 12070 --
NM_002403chr14262 131 52 26 ----137
NM_002486chr931906 1738 387 21857 626 ----
NM_002501chr19113705 3674 3264 3210 3025 2990 2976 1567 255 196 26 21463 854 1783 13732
NM_002522chr1742888 2857 2849 2510 43196 1468 952 772 --1654
NM_002545chr1123614 3596 11854 --11821
NM_002613chr1684303 1872 1834 1814 1789 1710 1388 454 21664 71 12142 --
NM_002698chr1972690 2517 1041 844 818 180 45 22614 354 ----
NM_002699chr16974 582 540 333 312 247 2389 207 21243 590 --
NM_002957chr993697 3294 2844 2727 1389 1200 1194 884 552 --12673 --
NM_003012chr82698 35 168 --12560
NM_003029chr141423 1347 246 177 ----168
NM_003042chr341975 393 335 165 ----1474
NM_003045chr1341333 773 644 186 --54306 4279 4055 3594 369 --
NM_003108chr2146667 2817 2757 2724 2691 2562 2520 2455 2276 2063 1949 1889 1101 30 42862 2533 2465 1915 32872 2663 2607 --
NM_003131chr641770 888 863 825 12211 2623 573 1258
NM_003156chr1131284 1269 44 ----11251
NM_003200chr19102095 2025 1915 1874 1788 1523 956 309 194 78 22047 1662 --12211
NM_003216chr2282891 2679 1076 1055 922 638 357 54 33142 2899 588 22351 316 --
NM_003468chr221250 1135 --13164 24142 3537
NM_003644chr1775597 5489 4993 4818 4796 1765 754 12039 35863 960 99 26056 5719
NM_003987chr10101814 1778 754 734 454 433 358 308 220 111 1547 21451 594 --
NM_003988chr10111891 1855 831 811 531 510 435 385 297 188 33 1624 21528 671 --
NM_003989chr10101750 1714 690 670 390 369 294 244 156 47 1483 21387 530 1879
NM_003990chr10101750 1714 690 670 390 369 294 244 156 47 1483 21387 530 1879
NM_004055chr1162036 1944 1574 1568 1484 824 32150 1893 77 11471 --
NM_004090chr1753265 2662 2315 936 166 22683 2173 1147 --
NM_004200chr1182877 2661 2573 2278 2174 530 409 199 11226 1524 --
NM_004227chr772484 2129 1239 749 625 429 316 22248 770 --1180
NM_004302chr1272792 2248 2064 1883 1121 969 30 2489 145 --11076
NM_004321chr263357 3191 1181 769 592 146 12431 32560 857 626 --
NM_004350chr182236 2121 1017 950 460 239 117 83 2413 215 --2989 348
NM_004405chr26421 328 297 253 247 83 --3383 183 157 1348
NM_004437chr143074 2301 1366 1280 12864 21391 977 --
NM_004586chrX45397 3664 1738 196 23553 1689 ----
NM_004588chr1162785 1376 860 262 224 121 11321 ----
NM_004854chr281276 1140 1056 880 851 374 114 42 ----11235
NM_004976chr11124521 4284 4029 4020 3876 3224 1796 1475 791 736 184 110 35064 4746 3234 --24384 1512
NM_004992chrX107662 6484 6061 6025 5321 2841 2825 2666 1784 821 16549 15389 --
NM_004992chrX107662 6484 6061 6025 5321 2841 2825 2666 1784 821 16549 15389 --
NM_005027chr198891 440 411 391 345 338 274 37 ------
NM_005063chr1053397 1554 1508 688 682 ------
NM_005188chr1132836 2493 278 27960 7411 46763 6458 5540 348 --
NM_005219chr521616 498 ----21581 588
NM_005338chr773698 3648 2776 904 763 700 552 --13284 --
NM_005417chr2051935 1907 1434 265 29 11373 263 42 --
NM_005477chr1552346 1824 447 435 294 ----22173 2087
NM_005477chr1552346 1824 447 435 294 ----22173 2087
NM_005596chr942284 2209 2134 501 ----15887
NM_005665chr124123 3863 1627 13881 14170
NM_005828chr1774073 3916 3792 3671 3518 3210 151 13161 33807 3532 1179 --
NM_005901chr1866862 5298 2712 2030 1541 1374 27371 5613 ----
NM_005920chr163420 2914 2360 1060 982 76 33477 3017 697 43717 3710 3698 2992 --
NM_005934chr1972580 2522 2057 1729 912 228 194 21698 834 41662 1640 854 785 142
NM_006034chr1161985 1753 765 477 77 36 1842 2181 155 1790
NM_006095chr413314 ----13187
NM_006133chr11102285 1629 1574 1002 991 842 755 484 444 251 1937 22081 719 21957 1692
NM_006141chr1632730 1883 1090 11848 --12773
NM_006148chr1732958 2016 532 12891 157 1446
NM_006212chr163350 2159 1789 1766 859 25 1794 ----
NM_006336chr981496 1489 1354 1338 1182 554 478 391 11362 1486 --
NM_006371chr363712 3487 3338 1671 1335 1258 31089 785 343 ----
NM_006454chr4142755 2566 2517 2313 2245 1946 1130 1010 929 875 786 721 528 481 12877 1592 --
NM_006521chrX3487 447 269 124 1115 21069 384
NM_006546chr1796241 6071 5430 5296 5249 4047 973 219 105 24868 97 ----
NM_006650chr553841 3734 3715 3207 943 23161 2895 22667 731 1480
NM_006690chr2092294 2083 1996 1974 1876 1471 533 427 353 41814 1691 1582 410 1230 --
NM_006927chr1682080 2027 1372 872 773 385 228 26 160 1639 --
NM_006943chr2062592 1027 764 602 462 122 1653 13131 2992 636
NM_006990chr162500 2400 2098 2032 1797 1017 1562 ----
NM_007011chr1576478 6173 5636 2306 1644 686 147 25555 1101 --25019 168
NM_007232chr203920 738 344 --2169 54 1644
NM_007238chr2074261 3995 1740 769 620 533 319 11691 --14110
NM_007249chr1346807 1852 729 205 1212 ----
NM_012199chr164084 3530 3311 3153 1641 1023 --13362 --
NM_012232chr1782200 2041 1973 1431 403 307 248 68 1628 ----
NM_012264chr22101546 1486 1394 1368 806 668 629 499 435 225 11650 ----
NM_012264chr22101546 1486 1394 1368 806 668 629 499 435 225 11650 ----
NM_012296chr1153392 2997 2717 758 204 43542 1200 1023 164 12920 --
NM_012316chr165491 5179 4522 3890 624 404 21345 658 ----
NM_012402chr1161393 1215 928 381 370 209 21343 1311 ----
NM_013279chr1152286 2024 1832 668 520 1617 11690 1862
NM_013286chr353686 2400 809 444 343 1893 2784 104 --
NM_013399chr1661624 1493 1254 1153 669 493 31453 1390 358 ----
NM_013443chr921035 161 ----21008 365
NM_014240chr353928 2700 1372 75 64 13879 23487 2943 --
NM_014293chr2273883 3623 2861 1358 1153 806 114 23547 1593 23376 895 --
NM_014634chr22103504 3461 2650 2291 1167 504 402 364 273 164 --32877 1196 629 --
NM_014646chr1832089 219 192 1234 12927 1844
NM_014665chr8123585 3300 3202 2681 2332 2239 1374 1044 879 504 292 226 --11063 --
NM_014686chr1942357 1694 853 634 31645 1613 680 ----
NM_014690chr763078 2610 2206 259 212 137 32443 849 199 ----
NM_014747chr1134702 3694 1662 1220 946 854 762 652 487 433 395 389 240 --15695 --
NM_014762chr162083 835 737 681 280 148 2782 559 ----
NM_014767chr1093230 3199 2833 2294 2255 1133 885 264 114 12986 --12357
NM_014807chr113130 86 70 1564 --1112
NM_014850chr364608 4577 4027 3381 1088 150 --23395 1448 --
NM_014877chr1777024 6953 6831 6152 5993 5969 5764 ------
NM_014891chr751492 465 419 129 35 1300 ----
NM_014921chr1972287 1184 1012 1002 820 165 53 --32030 834 369 12388
NM_014935chr163262 3170 3139 2796 2449 90 32956 1309 1022 21070 249 --
NM_015008chr342890 2862 2835 561 23382 2400 ----
NM_015033chr992501 1022 714 339 329 230 181 37 24 22275 602 32514 1047 312 --
NM_015035chr2056457 6138 5880 5521 2175 25472 121 11536 --
NM_015042chr1553918 3896 3683 3611 3357 34005 1028 509 --13247
NM_015063chr194986 449 272 38 --1327 2200 112
NM_015074chr154096 3735 3542 1644 1326 24047 737 --13231
NM_015092chr1641769 1599 838 140 11688 13531 --
NM_015149chr112109 1371 --1455
NM_015229chr1741036 887 468 256 ----2835 146
NM_015254chr8152935 2548 2496 2317 2158 2074 1257 1092 591 572 450 319 277 186 154 1988 42603 1956 1239 896 --
NM_015270chr1212226 --1504 21442 409
NM_015288chr553723 2631 1550 876 284 --21284 1017 --
NM_015299chr1463672 3274 1523 1482 988 283 --13598 1430
NM_015310chr867821 7446 7205 6608 3348 963 ------
NM_015315chr573069 2948 2852 2157 1067 1010 176 ------
NM_015374chr2251285 1272 1253 414 388 1338 1597 1244
NM_015375chr184526 4371 4124 3852 3433 1989 946 158 21940 897 ----
NM_015457chr1111041 ----1437
NM_015557chr1103470 2911 2792 2599 2460 2268 2212 1374 1046 447 22276 1000 11093 11457
NM_015726chr1153 --11397 21612 532
NM_015872chr181799 1666 1395 1366 665 602 473 453 --21612 281 --
NM_015995chr15125382 4324 3881 3662 3527 3509 3462 2171 1404 1352 911 862 23894 1685 45177 4664 1715 1385 --
NM_016169chr1063055 1190 1012 966 753 647 23202 912 23184 1294 --
NM_016173chr3144054 3820 3782 3610 3267 3055 2926 1755 1729 1513 736 500 451 429 --1629 --
NM_016206chr347452 7149 2620 2357 22689 2532 17477 11948
NM_016287chr12398 226 --21386 806 11920
NM_016436chr2032533 2403 421 12354 22058 38 --
NM_017459chr14262 131 52 26 ----137
NM_017592chr1941812 803 551 277 31763 1731 904 2870 71 --
NM_017596chr184174 4098 3802 1632 1261 1144 846 315 23074 1596 34206 3392 1500 --
NM_017741chr432322 1923 426 22273 345 ----
NM_017758chr1761323 1250 1181 574 465 216 ----123
NM_017902chr1044895 4743 1209 399 35015 1514 1049 --11416
NM_017919chr944171 3834 1222 201 --1968 --
NM_017921chr1742201 1855 924 426 12038 1133 12256
NM_017994chr752658 2448 297 211 70 --12860 12499
NM_018201chr952142 1995 1881 1725 27 32075 791 242 2355 258 164
NM_018208chr161203 1132 1034 774 445 439 1368 21122 296 --
NM_018403chr353463 3146 3003 1554 1059 12954 --12656
NM_018440chr887398 7348 7000 6395 5597 5556 604 22 16346 ----
NM_018667chr1672055 1798 1077 1022 780 453 56 31781 792 135 42334 2225 2112 512 --
NM_019596chr2132857 724 684 1628 11900 --
NM_020122chr245025 4950 3748 1946 44901 4870 3696 3664 15589 --
NM_020168chr1531266 1057 284 ----1886
NM_020184chr232363 1672 735 --22248 632 22078 389
NM_020208chr332924 2889 2663 32852 2728 2355 12137 --
NM_020405chr1763960 1553 1214 862 101 80 11165 ----
NM_020438chr96528 513 458 291 213 197 11136 1331 --
NM_020443chr166260 5800 5625 4984 2110 1629 --1313 24607 2710
NM_020673chr2056629 6029 2150 1937 1447 --35127 2392 624 --
NM_020699chr164992 4379 4306 3844 1874 720 --33977 2023 297 --
NM_020713chr2072846 2440 2284 897 788 459 198 22788 73 --12235
NM_020717chrX54769 4680 4250 4223 180 14856 24937 1783 --
NM_020825chr1683693 3375 2774 2749 593 509 323 250 12626 1844 --
NM_020845chr1241939 313 174 76 31758 267 101 11796 --
NM_020977chr4--1419 --11801
NM_020983chr1212226 --1504 21442 409
NM_021020chr873287 3149 2617 2495 794 679 390 22988 112 ----
NM_021096chr22123261 3153 3093 3082 2519 2047 1171 1164 1059 986 954 743 22164 98 ----
NM_021638chr4104964 4435 4200 3165 3035 1799 1274 1241 966 417 ------
NM_021643chr23611 520 362 1250 169 --
NM_021964chr3--15338 --14946
NM_022153chr1073394 3328 3115 2886 2591 1378 1330 22467 884 --13604
NM_022166chr1664389 4299 2369 1733 121 91 24661 2216 ----
NM_022405chr332924 2889 2663 32852 2728 2355 12137 --
NM_022648chr2144564 4545 4193 4115 3776 3727 3689 3490 3417 1214 974 805 775 235 --11334 --
NM_022719chr2252949 2905 2395 315 98 --23541 85 --
NM_022833chr94924 448 345 49 11148 --11114
NM_024345chr91113 11746 --11487
NM_024541chr1031831 620 448 21692 1303 1646 --
NM_024698chr1171258 1068 1033 384 326 320 173 1887 --11299
NM_024742chr1661507 1418 1333 485 415 151 31846 1708 1463 11206 --
NM_024798chr1552157 2016 1790 832 526 1428 31183 1172 551 12407
NM_024817chr1575250 1881 1749 1190 1141 868 768 --146 --
NM_024884chr144799 630 417 296 1750 24193 1013 --
NM_024963chr7195745 5565 5100 4966 4847 4679 4494 3742 2364 2075 1985 1458 1377 1300 947 314 228 142 107 65395 4798 2355 1122 763 58 55479 2228 1565 784 134 35414 3602 2308
NM_025179chr174014 3927 3894 3835 1021 678 238 --24007 127 125
NM_025248chr1763272 3011 2263 1303 714 469 11042 32866 1266 733 --
NM_030806chr1128881 7992 7226 6314 5923 5791 3313 3189 2764 2274 1415 596 11655 26978 820 12003
NM_030884chr351808 1615 358 312 200 11497 52016 1687 229 208 121 --
NM_030918chr194256 2053 1665 1608 1473 1102 608 495 256 14197 ----
NM_030949chr621147 980 ----149
NM_031268chr1684303 1872 1834 1814 1789 1710 1388 454 21664 71 12142 --
NM_031483chr2033000 828 549 22958 2354 ----
NM_032012chr945131 1684 395 129 1604 ----
NM_032510chr182742 134 1693 21004 915 1768
NM_032595chr1771541 518 458 429 418 193 97 --11394 1570
NM_032711chr1784252 3942 3895 3169 2763 1376 1310 538 14038 13630 --
NM_032737chr1972294 1835 709 623 579 454 155 12152 12514 --
NM_032932chr17105897 5809 5141 4970 2040 1964 1842 1012 985 326 22120 40 26432 5554 --
NM_033290chrX32854 2754 954 11456 ----
NM_033315chr1761955 778 601 506 139 108 ----1212
NM_033387chr962197 2157 1870 1034 646 163 21657 144 --11900
NM_033420chr1991143 1107 1037 466 360 289 197 181 133 21016 93 1215 --
NM_033426chr142541 524 --12105 1892
NM_033429chr1572225 2219 2104 825 286 274 29 ----1854
NM_033503chr1573722 3425 3371 3225 3157 3121 601 32783 2768 779 ----
NM_033551chr573069 2948 2852 2157 1067 1010 176 ------
NM_052828chr651574 1423 618 578 34 21437 1220 --11053
NM_052845chr1262969 2124 2088 1152 611 80 22181 1136 22861 223 --
NM_052906chr22154868 4543 4344 4283 3860 3605 3543 3345 1930 1863 1149 1124 965 611 93 33765 906 817 32027 1491 786 13422
NM_053016chr967774 7454 6845 5225 3014 1700 23196 3164 ----
NM_053279chr872720 2544 859 316 270 175 97 2774 115 11960 --
NM_058167chr1101070 1028 1022 928 864 420 395 386 374 197 ------
NM_080491chr1153392 2997 2717 758 204 43542 1200 1023 164 12920 --
NM_080743chr652504 2050 1874 1018 471 ------
NM_130830chr382585 1273 882 654 341 258 235 79 33589 1110 51 23769 1063 --
NM_134421chr24763 276 115 109 --1102 --
NM_138338chr22153377 3371 3177 3111 2650 2618 2309 2109 2092 1252 1190 1078 1040 895 254 --2989 770 22357 1176
NM_138415chr2271195 584 553 534 282 272 62 31767 1500 1187 ----
NM_138457chr693222 2607 2442 1342 1264 1210 819 524 129 --11354 --
NM_138967chr1542388 2324 2193 831 12223 12258 1475
NM_144579chr232493 2247 509 22776 124 1114 --
NM_144588chr1031450 1026 971 31273 376 264 --11184
NM_144671chr1291821 1780 1548 699 640 634 626 473 66 1491 11927 11868
NM_144973chr1243374 1874 1718 1501 1972 ----
NM_145176chr61519 --12873 1738
NM_145245chr19101148 1037 1013 998 903 364 242 188 171 55 1484 11086 --
NM_145313chr1071298 1281 1245 1208 1063 505 483 --11325 --
NM_145349chr1771816 1642 1578 1557 846 654 381 --51841 1465 863 765 211 --
NM_145912chr2293691 3592 3065 1797 1742 1270 1261 295 34 33257 3016 1878 --13880
NM_148960chr161970 1518 753 484 341 167 21922 1890 ----
NM_152237chr22101657 1488 1402 1342 1224 1191 1096 694 508 294 31306 468 102 11169 1238
NM_152253chr22113755 3673 3157 3130 2771 2745 1706 1508 1419 289 81 1115 23381 3109 13431
NM_152263chr184919 4263 4095 3813 1866 1669 1215 49 34214 1166 1134 55650 4778 4390 3735 2226 11539
NM_152267chr2282164 1492 713 697 689 97 80 65 --11775 --
NM_152529chr233312 1470 1281 23231 1421 ----
NM_152722chr116667 610 595 220 79 53 --2131 112 --
NM_152733chr6146304 5728 5632 5476 4905 4837 4610 4421 4111 1793 1159 664 513 38 22106 1236 --11683
NM_152734chr645178 1425 889 870 14358 1268 15304
NM_152924chr1576478 6173 5636 2306 1644 686 147 25555 1101 --25019 168
NM_153273chr372640 2254 1976 1022 966 620 374 22563 2003 22589 1072 --
NM_153367chr10113947 3721 1465 1420 1385 1042 684 600 432 296 243 13505 ----
NM_153810chr1054301 4159 3646 1637 653 15018 ----
NM_173476chr16121982 1924 1655 1588 1554 1548 911 837 515 479 455 278 21793 712 31768 1441 887 --
NM_173595chr12105148 4682 4606 4366 4153 1802 1410 640 339 133 24511 1146 13703 --
NM_173642chr158119 6298 6217 5641 2939 --27914 6537 18097
NM_173832chr8143401 3282 2856 2704 2664 2447 2331 2320 1086 806 549 376 125 24 22610 513 ----
NM_174911chr83636 538 407 1574 2391 119 --
NM_174934chr1172892 1148 1043 740 670 477 285 1586 2822 128 13293
NM_176871chr873255 3138 850 634 334 196 52 1255 12766 193
NM_177999chr963464 3150 3009 962 288 141 --13052 --
NM_178539chr1221835 395 --21558 408 11625
NM_178554chr373386 2216 1404 1373 1118 972 880 --22755 2518 --
NM_178565chr821368 1138 ----11725
NM_181491chr9132865 2624 2514 2406 969 948 871 852 311 185 134 114 41 --11109 --
NM_181701chr961743 749 641 427 217 150 11900 ----
NM_181712chr111642 21956 1593 --22022 1334
NM_181809chr192896 1479 1463 1352 880 611 178 155 119 1903 21616 940 --
NM_181844chr1761965 1810 1710 1223 276 168 ------
NM_182526chr1472861 2779 1908 867 850 326 25 12883 32806 2584 2269 --
NM_182527chr2242250 1562 125 95 --2501 473 1288
NM_182970chr20164143 4115 3527 3364 3285 3187 3131 3116 2823 1726 1720 1464 1360 1184 1153 773 21268 60 13755 13587
NM_194278chr1463171 1340 1303 722 706 252 31493 733 633 21365 488 --
NM_194286chr1275815 2355 2057 1861 1722 1418 222 11842 36182 5525 204 16103
NM_194315chr1101070 1028 1022 928 864 420 395 386 374 197 ------
NM_194457chr1101070 1028 1022 928 864 420 395 386 374 197 ------
NM_194458chr1101070 1028 1022 928 864 420 395 386 374 197 ------
NM_197939chr172469 326 ----3834 227 202
NM_198291chr2051935 1907 1434 265 29 11373 263 42 --
NM_198490chr3113044 3035 2941 2882 2796 2724 2510 1318 565 408 398 12382 2418 90 --
NM_198560chr3103096 2863 2535 1503 1438 1361 1132 737 561 171 1541 22941 1420 --
NM_198595chr4104964 4435 4200 3165 3035 1799 1274 1241 966 417 ------
NM_198993chr1751435 1070 624 552 313 11316 21513 326 --
NM_199129chr2021235 917 2951 457 1115 11254
NM_199262chr1761856 1637 535 502 373 265 1415 135 11688
NM_199462chr184526 4371 4124 3852 3433 1989 946 158 21940 897 ----
NM_201432chr1775597 5489 4993 4818 4796 1765 754 12039 35863 960 99 26056 5719
NM_201433chr1775597 5489 4993 4818 4796 1765 754 12039 35863 960 99 26056 5719
NM_203342chr143074 2301 1366 1280 12864 21391 977 --
NM_203343chr143074 2301 1366 1280 12864 21391 977 --
NM_203422chr1141081 914 203 43 21032 65 123 --
NM_206909chr867821 7446 7205 6608 3348 963 ------
NM_207111chr792382 1759 1071 923 894 822 352 327 163 22013 434 ----
NM_207116chr792382 1759 1071 923 894 822 352 327 163 22013 434 ----
NM_207380chr1583402 2984 2587 570 430 365 283 32 11365 ----