TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1247-5p
miRNA Sequence: ACCCGUCCCGUUCGUCCCCGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000793chr1423673 420 ----24601 4120
NM_001005473chr5--15588 --26422 997
NM_001007023chr1423673 420 ----24601 4120
NM_001010867chr185613 5565 5336 2191 2167 1499 1319 31 ----21325 306
NM_001037165chr768622 6114 5885 5861 2970 2522 22266 1571 28910 8391 28191 1191
NM_001106chr378965 6822 3577 3069 1942 1788 646 --27532 3429 26982 6405
NM_003099chr15--26122 4383 35348 1130 254 25510 4735
NM_005197chr1442187 1949 1661 884 --22200 2193 --
NM_013989chr1423673 420 ----24601 4120
NM_015995chr1531706 873 257 14464 23753 1408 24623 3515
NM_032482chr1962346 2267 713 116 101 37 --22382 336 1122
NM_032826chr765328 5258 1383 1371 1108 689 ----14333
NM_033224chr767937 7812 6781 6377 6186 2919 --15143 24971 1861
NM_148955chr15--26122 4383 35348 1130 254 25510 4735
NM_152826chr15--26122 4383 35348 1130 254 25510 4735
NM_175624chr1235281 2770 2275 ----26689 1526
NM_175625chr1235281 2770 2275 ----26689 1526