TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1248
miRNA Sequence: ACCUUCUUGUAUAAGCACUGUGCUAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_000217chr12124858 4750 4540 4405 4345 4168 4149 1842 1801 1734 1711 909 13412 ----
NM_000259chr1596109 4950 4793 4765 4532 4348 2114 1519 123 1266 31405 389 269 2286 278
NM_000337chr595957 5935 5717 5581 5543 4850 1432 1157 961 35303 4173 650 11390 14394
NM_000368chr9124465 4440 4394 3635 3615 3605 3180 2939 1454 847 812 53 53751 1863 1438 818 463 11088 23536 1385
NM_000376chr12102988 2879 2723 2197 2169 1074 956 909 899 261 22481 2475 12753 22485 611
NM_000486chr1293034 2279 1046 855 638 616 609 168 57 22537 622 22111 624 1309
NM_000599chr2244035 4013 3779 3702 3690 3660 3539 3343 3229 3182 2979 2963 2882 1826 1797 1780 1601 1587 1477 1334 352 290 278 265 21505 302 23755 3418 1374
NM_000633chr18135075 4031 3499 3339 1941 1627 1615 1425 1406 1135 884 573 475 31273 1237 529 1916 --
NM_000719chr12186611 6594 5892 5725 5699 5458 5132 4936 4514 4377 4357 4126 4119 2435 2122 807 437 209 3492 486 463 55735 4806 1503 237 174 --
NM_000721chr182433 2056 772 374 274 134 104 91 21879 113 --196
NM_000793chr14114950 4593 3896 3669 3624 3529 3381 1343 822 712 253 1294 14218 24822 827
NM_000809chr498946 8397 8046 7873 6708 3366 3024 1659 1348 28035 6700 ----
NM_000813chr5104950 4787 4230 3818 1608 1312 916 858 318 290 11132 --12219
NM_000831chr1265582 5459 5346 5076 4981 4906 4772 4500 4379 2452 2400 2314 2157 1932 1856 1369 1249 1079 1034 720 646 624 333 251 154 56 2510 66 35482 4776 3829 --
NM_001001971chr1031073 977 164 1407 --2436 137
NM_001003407chr1064844 4311 3308 1643 1573 190 44996 3917 1375 695 24400 3099 21401 442
NM_001003408chr1064844 4311 3308 1643 1573 190 44996 3917 1375 695 24400 3099 21401 442
NM_001003652chr18108060 7852 5895 5873 3260 3150 2528 1991 1883 216 37601 6409 3480 ----
NM_001003674chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_001003675chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_001003940chr15123754 3299 3236 3195 3092 2418 1551 1530 1440 1198 1076 230 32746 2658 1470 23446 2789 22446 56
NM_001003942chr15123754 3299 3236 3195 3092 2418 1551 1530 1440 1198 1076 230 32746 2658 1470 23446 2789 22446 56
NM_001003943chr15123758 3303 3240 3199 3096 2422 1555 1534 1444 1202 1080 234 32750 2662 1474 23450 2793 22450 60
NM_001005473chr566132 1204 1158 1070 1050 937 72467 1057 1037 988 980 886 705 51208 1011 970 958 946 181080 1028 1024 1020 1008 1004 992 930 926 922 918 914 910 906 902 898 894 890
NM_001005502chr12124580 4573 4488 3793 1890 1737 1548 579 319 295 280 126 --1784 --
NM_001005609chrX113639 3591 3007 2904 2692 1518 1344 586 533 470 450 53252 3192 2556 1170 485 1474 --
NM_001005845chr83222 119 103 --11868 21416 88
NM_001007023chr14114950 4593 3896 3669 3624 3529 3381 1343 822 712 253 1294 14218 24822 827
NM_001007024chr17154395 4191 3821 3467 3068 3034 2892 1707 1458 1060 1021 868 828 262 77 13830 13648 --
NM_001007025chr17154395 4191 3821 3467 3068 3034 2892 1707 1458 1060 1021 868 828 262 77 13830 13648 --
NM_001010846chr183401 3291 3150 2820 2810 1789 1483 724 --2792 592 1972
NM_001010891chr5196632 6382 6029 5905 5028 4922 4886 4726 2481 2432 2197 2154 2083 1704 787 691 160 103 79 66452 5744 5573 2239 869 536 16094 --
NM_001012754chr1341878 1785 1401 632 1666 21382 716 2688 245
NM_001014797chr10208107 7634 7339 6686 6663 6647 6562 6551 6273 5911 5692 5532 5327 5074 3296 1548 1132 877 634 113 26938 2302 26917 2868 16844
NM_001014839chr14811 326 257 56 143 149 --
NM_001014841chr14811 326 257 56 143 149 --
NM_001017440chr7227746 7633 7309 7302 7150 6983 6818 6721 6655 5454 5399 5301 3224 3187 2931 2439 2377 2261 1808 1206 775 453 13003 33167 1899 481 26141 2608
NM_001017535chr12102988 2879 2723 2197 2169 1074 956 909 899 261 22481 2475 12753 22485 611
NM_001018074chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_001018075chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_001018076chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_001018077chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_001024094chr583633 3329 2664 2640 2580 1580 924 157 ----23350 296
NM_001024455chrX122666 2506 2419 2264 2160 1087 1048 908 585 574 447 130 2897 882 22545 209 1885
NM_001024647chr12137220 7080 5548 5342 2933 2638 2533 1976 854 603 395 133 89 67579 7146 5954 2915 2777 2143 11339 --
NM_001025077chr10106799 6446 5949 5770 5461 2497 1254 524 320 81 2510 91 26859 6467 --
NM_001030288chr16155164 5024 4961 4875 4657 4615 4115 3889 3584 2149 1968 1953 1858 1788 1668 34129 3846 1353 21813 1178 1737
NM_001031695chr22115163 4820 4353 3684 1986 1944 1837 1500 1167 333 100 34368 3659 1396 43455 1398 1010 1001 45405 3538 350 346
NM_001033087chr2072573 774 644 476 398 93 75 22146 110 32753 2148 390 --
NM_001034841chr1685078 4884 1902 1106 657 321 307 102 43853 3715 2099 290 13355 14943
NM_001037165chr7178754 8307 7518 6798 6266 6244 6139 5443 3342 3203 2685 2679 2671 1643 1231 796 304 38055 6305 1585 48677 6656 2818 1647 22614 1334
NM_001038493chr22152 83 2272 94 --41116 1082 279 262
NM_001039547chr3107856 7583 7290 7246 3055 3031 1036 910 130 96 46501 6123 5090 1152 17770 --
NM_001040152chr794225 3968 3934 3576 1772 1662 1533 1289 1012 11587 24286 783 14072
NM_001040429chr1362929 989 736 297 271 262 12227 22350 326 1287
NM_001040441chr195216 4772 4273 1984 1839 1807 1083 985 564 24804 1821 --11382
NM_001042355chr16165281 4903 4617 4604 4432 4420 4252 4034 3745 3664 3375 2133 2126 426 230 185 35002 3420 1960 14744 14437
NM_001042412chr16165281 4903 4617 4604 4432 4420 4252 4034 3745 3664 3375 2133 2126 426 230 185 35002 3420 1960 14744 14437
NM_001042599chr296836 6201 5884 5060 2542 2426 2389 1417 943 56968 2735 263 200 174 --23015 1349
NM_001042603chr12125378 4828 4717 3986 3865 3697 1611 1354 823 725 704 197 34976 3677 441 ----
NM_001042604chr394616 4078 3940 3597 3236 3209 1852 1222 972 13221 ----
NM_001043318chr14103678 3221 3079 1197 975 833 387 380 353 84 --23369 357 23565 547
NM_001048183chr153678 3270 2449 910 595 ----32548 2544 2540
NM_001100108chr1188068 7746 7315 7158 6982 6426 6398 6326 6254 5863 5619 2709 2042 1636 1579 1328 629 173 149 36454 2028 281 --
NM_001106chr3179722 9121 8502 6749 6681 6242 3590 3563 3475 3021 2706 2469 1828 1560 1072 637 470 59747 8404 3514 1939 755 23922 3025 28910 3517
NM_001204chr276984 6898 4720 3051 2924 1689 656 37718 6526 6121 22935 1250 24762 735
NM_001259chr7115680 5082 4856 4784 4669 4371 4202 4148 2055 682 261 15890 14953 --
NM_001271chr15122906 2539 2448 2170 2056 1288 945 754 636 625 571 137 32110 924 265 32160 2112 2060 12630
NM_001387chr5102863 2263 943 756 575 476 448 425 37 23 22731 1183 12477 181
NM_001399chrX113639 3591 3007 2904 2692 1518 1344 586 533 470 450 53252 3192 2556 1170 485 1474 --
NM_001490chr993164 2798 2484 1214 1182 349 294 141 29 22925 1176 1271 134
NM_001543chr5144753 4682 4668 4574 4517 4142 3878 3828 3413 3070 1675 926 533 275 23926 3904 34614 4293 1200 23929 3908
NM_001650chr1893503 3270 3077 2705 2622 1484 1418 1046 786 12904 --1167
NM_001759chr12155211 5148 5068 4650 4492 4482 4246 4202 4149 3924 3766 3671 1704 1450 538 21235 491 44238 4101 3748 474 23303 459
NM_001829chr45776 213 198 36 24 3999 402 207 1666 --
NM_001874chr12124580 4573 4488 3793 1890 1737 1548 579 319 295 280 126 --1784 --
NM_001918chr1209173 8640 8170 7866 7738 7682 6515 5748 3595 3514 3497 3412 3391 3013 2788 1981 1968 1830 1174 1073 68207 6020 3300 2886 1536 1181 23217 1019 --
NM_001945chr591295 1278 1187 1022 430 367 215 77 49 11216 --2390 378
NM_002126chr1793899 3471 3206 1590 1520 1441 1396 1330 876 33311 3044 884 13155 --
NM_002223chr12123933 3270 3198 3005 2968 2482 1518 752 691 432 272 243 1295 13250 --
NM_002313chr1064844 4311 3308 1643 1573 190 44996 3917 1375 695 24400 3099 21401 442
NM_002387chr5104425 3996 3854 3246 3201 1398 722 553 104 67 33158 1612 92 11215 --
NM_002451chr973681 3014 2995 1491 1037 350 29 --1537 53629 3594 3282 2739 2681
NM_002581chr995259 4767 4715 1961 1686 1635 1055 1015 626 11357 24687 1345 1151
NM_002612chr731414 1338 1322 41329 647 542 500 21295 650 21544 1304
NM_002698chr19132988 2971 2887 2843 2160 2077 1854 1099 894 783 686 390 368 21949 773 22858 360 12917
NM_002737chr17126472 5976 5380 5223 5129 4654 4181 1868 1683 928 711 439 55839 5535 2568 2284 1209 --14608
NM_002760chrY125336 4393 4383 4118 4063 2072 1888 1572 1139 816 803 216 21121 160 32352 1780 398 14456
NM_002886chr3134920 4401 4058 3710 3234 3165 1679 1161 599 527 512 380 356 2520 487 1372 --
NM_003010chr1792127 1932 1863 986 866 850 658 434 44 1380 22071 761 1489
NM_003034chr12188079 7448 7259 7234 7177 7111 6996 6954 6816 6270 6156 5861 5853 5421 4957 2309 1596 123 28013 5052 --26959 69
NM_003043chr3133793 3224 3126 2686 2618 1551 1463 1440 895 877 693 669 628 34113 932 817 2838 586 13109
NM_003099chr15206293 6138 6013 5514 5499 4915 4836 4738 4640 4430 4159 4138 2048 1987 1403 1020 997 987 650 471 46461 5548 4287 621 44973 4897 4780 688 --
NM_003108chr2146940 5853 5157 2710 2512 2239 2232 2224 1792 1351 441 401 144 61 12301 --12304
NM_003123chr16155164 5024 4961 4875 4657 4615 4115 3889 3584 2149 1968 1953 1858 1788 1668 34129 3846 1353 21813 1178 1737
NM_003204chr1771782 1699 1392 1251 312 153 50 3444 382 318 2372 338 4394 390 386 370
NM_003320chr11104294 3308 3176 2983 564 542 399 353 336 326 1346 ----
NM_003326chr182462 1034 569 435 427 418 126 91 ------
NM_003468chr274245 3380 3333 1683 1620 569 153 2661 132 23598 138 --
NM_003507chr2121711 1430 815 771 764 719 293 233 178 137 119 47 --21479 1434 1455
NM_003983chr16114007 3667 3367 3163 1680 1526 1268 377 204 96 32 --1941 24240 312
NM_004028chr1893503 3270 3077 2705 2622 1484 1418 1046 786 12904 --1167
NM_004338chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_004397chr1194152 4110 3984 3395 1334 1296 1120 323 295 23829 3096 --2284 176
NM_004441chr341108 1050 336 31 51055 909 357 347 24 1349 --
NM_004586chrX115007 4661 4198 3867 3506 3394 3299 2070 1659 967 860 ----11768
NM_004801chr271414 1014 446 425 376 318 105 --11341 21335 128
NM_004823chr1911200 21512 1356 --41520 1516 1214 1211
NM_004834chr282385 2301 2134 1257 551 532 433 418 --1411 12306
NM_004871chr17154395 4191 3821 3467 3068 3034 2892 1707 1458 1060 1021 868 828 262 77 13830 13648 --
NM_004956chr794320 4047 4007 3944 3613 2972 1473 1385 227 23347 251 14115 --
NM_004992chrX228153 7602 7539 7291 6572 6564 5792 5248 3215 2984 2848 2726 2634 2598 2259 2098 2005 1579 1421 921 663 513 1856 25737 2576 --
NM_004992chrX228153 7602 7539 7291 6572 6564 5792 5248 3215 2984 2848 2726 2634 2598 2259 2098 2005 1579 1421 921 663 513 1856 25737 2576 --
NM_005044chrX83858 3123 2893 1679 1221 968 665 33 11756 31095 677 215 12975
NM_005056chr12145622 5072 4961 4230 4109 3941 3441 1855 1598 1067 969 948 441 154 35220 3921 685 ----
NM_005076chr1123390 3241 3225 3016 2797 2787 1616 1304 1237 1057 463 148 1280 41443 1410 467 300 11408
NM_005188chr11158151 8027 7760 7589 7396 6672 6402 5329 5282 2938 1992 1241 1075 1016 72 16227 26164 5371 1471
NM_005197chr14116068 5968 5806 4464 4283 2035 864 706 600 387 206 34298 2311 496 24107 1905 35131 3974 1966
NM_005235chr296836 6201 5884 5060 2542 2426 2389 1417 943 56968 2735 263 200 174 --23015 1349
NM_005238chr1183248 3117 2690 1383 1240 1005 921 441 22884 238 --32765 1020 787
NM_005359chr18116400 6304 5405 4909 4592 4079 2455 1728 815 804 391 16145 16097 --
NM_005399chr1124311 4200 3248 3199 3052 3039 1236 697 325 221 86 36 13612 33679 1485 225 --
NM_005497chr17176144 5675 5453 5412 5334 4429 4399 2387 2308 2058 2000 1188 1059 962 546 536 255 22365 591 1593 --
NM_005504chr12166532 6106 5734 5671 5357 5318 5299 5279 4962 4077 2342 1941 1632 1434 1015 586 11720 14203 --
NM_005715chr652779 1995 1915 913 448 22024 437 11888 32651 645 479
NM_005828chr17115046 4796 4345 4286 3699 3317 2036 2011 1624 773 73 23430 3379 14041 23998 1250
NM_005840chrX127646 7370 7235 6029 5414 4776 3049 2649 1994 1984 1553 78 37443 6751 1161 35418 2022 1232 --
NM_005895chr12153987 3920 3864 3795 3691 3040 2845 2831 1436 1179 1137 888 864 126 40 11250 11520 --
NM_005901chr18108060 7852 5895 5873 3260 3150 2528 1991 1883 216 37601 6409 3480 ----
NM_005902chr15154334 3803 3751 3490 3386 3095 2871 1778 1260 1173 830 417 400 99 55 41789 1666 1603 732 11827 --
NM_005920chr1113881 3627 3184 2581 935 800 792 783 687 281 207 33610 3535 409 23634 321 13302
NM_005935chr4105290 4866 4499 4369 4336 3460 3372 1601 206 108 64272 4031 1264 780 737 414 34362 4033 897 --
NM_005937chr17123068 2931 2880 2760 1566 891 648 578 486 379 263 174 33690 2802 2667 33724 3461 433 1239
NM_005941chr8113954 3235 2610 2561 2547 1117 934 545 314 300 140 ----23072 3068
NM_005955chr195362 4674 3345 1558 1505 918 487 461 46 34589 4429 3527 21739 944 14021
NM_006141chr1652103 2078 1903 1052 279 1445 42191 2043 298 179 2503 500
NM_006212chr1145242 5176 5097 4942 3705 1978 1956 1811 1280 1138 1084 1076 1024 88 34346 1571 275 1558 24569 555
NM_006252chr177546 7026 6192 5998 2480 1511 442 57423 2371 2023 1710 577 11712 15975
NM_006282chr20144159 4052 3937 3823 3468 1706 1487 1167 1101 1065 953 807 696 146 13481 13472 13680
NM_006283chr8124335 3879 3849 3692 3127 1769 1255 1241 712 434 207 187 1591 1476 --
NM_006306chrX185786 5754 5709 5585 5485 5216 4856 4747 4714 4192 2313 2155 1474 1100 1083 714 651 147 25731 412 23594 218 --
NM_006544chr1496089 5727 5238 4642 4541 1816 1556 978 310 14996 --15018
NM_006546chr17175290 5226 4858 4690 4508 4473 4323 4291 4182 4072 1976 1774 1502 943 686 629 271 35399 4065 1930 42590 1510 633 294 26334 1948
NM_006720chr1064844 4311 3308 1643 1573 190 44996 3917 1375 695 24400 3099 21401 442
NM_006738chr15134372 4189 3833 3349 3029 1575 1394 1176 1141 1065 904 844 675 22888 183 53988 3837 3605 469 185 --
NM_006924chr1753845 3351 3275 1690 1421 21738 460 13121 1450
NM_006955chr1082109 1371 1040 752 499 472 192 71 22849 2640 13163 12852
NM_006988chr213830 463 152 --271 47 21135 873
NM_007050chr20177935 7842 6996 6911 6734 6532 5444 3198 2837 2663 2557 2267 2143 2030 1838 1065 120 11292 66969 6170 2961 2635 1899 951 --
NM_007078chr1082155 1194 1099 1057 983 739 508 109 1338 32331 1937 652 12019
NM_007137chrX94642 4548 4144 3836 1870 1443 862 853 189 22092 489 15379 1324
NM_007200chr15134372 4189 3833 3349 3029 1575 1394 1176 1141 1065 904 844 675 22888 183 53988 3837 3605 469 185 --
NM_007249chr13138829 7779 7240 7116 6230 3509 3293 2832 2584 922 781 708 507 27797 2293 32701 1500 142 --
NM_007350chr1294416 3652 3576 3546 1633 1307 826 214 46 14274 --23172 3168
NM_012096chr361404 1184 897 638 414 65 ----21199 94
NM_012104chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_012104chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_012153chr1172520 1949 1596 811 622 355 146 --22406 2205 11831
NM_012192chr1191830 1805 1777 940 922 744 457 432 189 22371 291 32263 875 25 2646 22
NM_012199chr1113445 3408 3221 3184 2849 1739 856 573 496 444 79 34182 4028 450 24030 3575 188
NM_012214chr2116404 6286 6140 4755 4497 4489 4211 4144 4016 1466 470 24160 4111 --15522
NM_012219chr3123255 2751 2251 2215 2037 1282 940 709 622 208 173 128 --21291 122 11989
NM_012316chr1135142 4819 4537 4342 4219 3895 1816 1293 1256 1213 1140 1027 487 23601 2094 33458 2213 221 25306 307
NM_012334chr5124628 4281 4129 4116 3748 3230 1602 1420 1004 471 455 392 13711 21898 259 13812
NM_013255chr7178293 7776 7528 7297 7000 6640 6563 6224 6174 5740 5603 3306 1849 1415 1326 953 821 38178 6348 5628 ----
NM_013382chr14152303 2215 2091 2083 1962 1954 1937 1887 1716 1706 1640 475 275 100 88 11699 1594 11992
NM_013989chr14114950 4593 3896 3669 3624 3529 3381 1343 822 712 253 1294 14218 24822 827
NM_014048chr16124978 4555 4261 3942 3616 3305 2086 1901 1027 1016 303 134 --14675 --
NM_014155chr11126810 6722 6387 5750 4590 2616 2606 2579 2557 512 177 30 15942 1629 25619 2600
NM_014284chr14811 326 257 56 143 149 --
NM_014293chr22143892 3803 3611 3579 3385 3353 2822 1627 929 919 907 699 680 448 22572 964 33568 2591 2543 12589
NM_014309chr22115153 4810 4343 3674 1976 1934 1827 1490 1157 323 90 34358 3649 1386 43445 1388 1000 991 45395 3528 340 336
NM_014331chr4147280 6011 5521 5501 5352 2613 2300 1520 1265 918 708 603 460 113 ------
NM_014721chr6156380 6302 6206 5479 5387 4649 4607 2940 2842 2819 2778 931 805 282 124 ----1198
NM_014730chr1294726 4701 4525 4467 4116 3394 3295 144 133 53854 3616 1554 955 854 24210 848 33970 2091 1535
NM_014730chr1294726 4701 4525 4467 4116 3394 3295 144 133 53854 3616 1554 955 854 24210 848 33970 2091 1535
NM_014732chr16105871 5457 4580 4079 1447 972 861 846 798 555 52161 660 576 301 28 14099 23943 289
NM_014737chr20103150 3081 2929 2840 1646 1373 1326 949 795 64 42696 860 552 480 21570 486 1237
NM_014747chr1175620 5529 5478 5454 4666 4146 3945 3898 2324 2009 1890 1854 1575 871 835 663 304 15372 34687 1003 968 22131 1909
NM_014795chr231117 130 110 1123 --11304
NM_014864chr184076 2978 2757 1730 1526 1515 631 624 1557 13065 13504
NM_014873chr1124840 4482 4261 4140 3877 3680 3506 3203 3118 1759 1120 266 --24078 1517 13280
NM_014877chr17147507 6940 6859 5771 5637 5098 5021 2338 1937 1929 1263 1066 779 285 --17017 --
NM_014904chr1083659 3508 3321 3204 2662 2470 1122 665 ----363 59 55
NM_014912chr1083244 2784 2434 2416 2344 846 121 59 --21028 47 --
NM_014935chr163330 2693 2549 1208 715 427 73783 2521 1392 1090 937 784 652 53688 2907 1398 828 786 33449 1396 826
NM_014945chr561420 1391 1346 409 319 206 31814 1652 761 1307 21753 1383
NM_015035chr20146295 5977 5929 5908 5442 4701 4684 4589 4489 2642 2497 1596 1576 559 11011 36358 4999 1425 15453
NM_015051chr993386 3350 2742 2530 2456 2249 2161 1079 816 22551 1052 33273 3160 2446 --
NM_015068chr7103077 2820 2786 2428 1200 1182 624 514 385 141 1439 13138 12924
NM_015071chr5185366 4873 4605 4484 4080 3965 2586 2364 2347 1866 1806 1784 1619 1381 1317 335 244 208 15389 1532 11799
NM_015090chr1185589 4777 4540 4469 4455 4211 4035 3882 2375 2343 1679 1637 1021 993 931 688 52 45 24762 1611 12301 --
NM_015111chr5123696 3430 3382 3201 2997 2597 1455 882 738 135 129 41 51028 655 351 308 260 43501 868 353 262 14093
NM_015215chr172622 1027 702 658 469 319 301 32332 2038 290 22600 2041 --
NM_015234chr631474 458 140 --1428 4421 409 405 401
NM_015247chr16165281 4903 4617 4604 4432 4420 4252 4034 3745 3664 3375 2133 2126 426 230 185 35002 3420 1960 14744 14437
NM_015299chr14123537 3458 3257 2679 2599 2543 1504 1222 356 346 271 199 42955 2842 518 441 1510 13226
NM_015310chr8157690 7477 7145 6413 6399 6272 5957 5948 5482 1749 1382 1373 686 599 21 1235 26711 2536 11049
NM_015313chr11114481 3258 3038 3025 1547 1408 1043 953 539 516 474 33532 1923 523 ----
NM_015328chr753056 2220 841 808 740 12903 22375 1029 3651 530 236
NM_015375chr1124292 4040 3843 3693 3234 3144 3118 1736 867 689 670 657 13581 54488 4424 3813 1636 291 --
NM_015520chr3121811 1732 746 658 603 476 455 344 335 329 284 269 --12781 11822
NM_015569chr174278 3926 3776 3573 3524 732 518 ----24640 3542
NM_015713chr893254 3188 2600 2380 2244 1438 1393 1358 711 --33581 1308 1115 12591
NM_015886chr8105601 5478 5029 4499 3874 2186 973 859 793 311 21679 981 --13690
NM_015905chr73554 534 90 --1578 3240 229 197
NM_016206chr3137139 6553 6532 6097 3557 2910 2519 2244 1577 1556 1441 1077 513 27831 109 18331 --
NM_016257chr1133347 2866 2306 2268 2236 926 836 809 645 635 296 283 34 43312 2766 708 86 ----
NM_016260chr2127452 6723 5441 4840 2577 1641 1588 1128 530 440 199 183 ------
NM_016577chr3124425 4308 3839 3595 2909 2836 1781 1750 1742 1691 1252 786 23684 798 ----
NM_017551chr10102397 2070 2040 954 678 573 377 355 338 303 32296 999 811 31675 872 813 12286
NM_017637chr9178783 8598 8570 8030 7643 7619 7233 7127 6927 6153 5899 5867 3061 1870 1638 745 231 38979 7895 7605 28300 1527 13376
NM_017650chr775701 5480 5353 4508 4425 1948 41 24642 2131 --11295
NM_017736chr1682942 2526 2428 2243 2020 913 551 242 1329 1230 1350
NM_017848chrX134309 3446 3430 2951 1758 1699 1666 1538 1360 1229 1162 198 32 180 --137
NM_017919chr953996 1450 940 571 250 11385 12174 24155 1721
NM_018085chr1267984 7967 7632 7572 7478 7286 6642 6607 5801 5683 5148 5123 5101 3294 3052 2742 2585 2334 2045 2013 1857 1575 967 828 586 365 45538 3030 497 319 17290 13070
NM_018440chr8147441 7163 6615 6316 6120 6080 6028 5496 2653 2105 1689 1410 1213 68 ----16947
NM_018452chr6_random123780 3705 3582 3314 2999 2840 1389 998 706 501 396 207 12958 12663 11419
NM_018660chr861995 1072 845 682 517 56 32481 1241 1117 32484 1243 1064 22965 340
NM_019001chr394616 4078 3940 3597 3236 3209 1852 1222 972 13221 ----
NM_019008chr22133785 3376 3076 2718 2568 2554 2402 1270 1263 1239 1161 1127 261 13211 12473 --
NM_019106chr2283283 2847 2829 2152 1152 1084 561 552 --1542 22983 1041
NM_020122chr2145675 5536 4522 4434 3953 3946 2136 1749 1553 1188 436 422 283 136 --15070 --
NM_020205chr183304 3187 3072 1212 702 580 441 322 23106 2159 43164 3113 380 28 1635
NM_020336chr20113879 3830 3356 3017 2624 2575 2525 1310 566 471 391 1465 23784 2529 --
NM_020440chr183375 3110 2913 2138 2098 977 940 56 2890 29 53114 2366 810 797 352 1902
NM_020443chr1176911 6313 4403 4344 4288 2555 2334 2270 1751 1736 1419 1176 712 519 427 140 121 55755 2365 1091 129 111 25562 5083 26248 187
NM_020466chr6114440 4217 3098 1656 1546 1369 1333 882 506 338 218 14751 --11374
NM_020699chr195046 3674 3379 1922 1662 1627 1615 778 592 22061 1092 24460 1708 1620
NM_020717chrX84890 4366 4078 3043 1961 921 639 292 63716 1270 957 939 519 383 21911 1494 31056 926 581
NM_020718chr16106506 6365 5448 5181 4825 2469 1275 1045 771 625 1382 1629 2389 385
NM_020752chr10102431 2409 2030 1869 1828 1149 1046 415 185 147 --128 21787 85
NM_020772chr17128511 8294 6808 6233 6111 6001 3066 2552 1662 1252 1114 1090 15594 18006 --
NM_020774chr18176090 5917 5830 5749 5695 5046 4917 4670 4445 4375 3839 3811 1913 539 433 412 257 ----15087
NM_020778chr15134767 4338 4203 3777 3408 3162 1708 1567 1554 1054 111 98 49 --34738 4350 962 11581
NM_020844chr8106025 5769 5696 5337 1550 1213 986 647 559 238 31124 851 725 26824 6462 --
NM_020956chr19174493 4423 4388 4302 4248 4180 4172 4092 3741 3546 1319 1155 809 797 616 451 110 34269 3531 3423 64682 4497 4290 4160 3534 2952 --
NM_021090chr22134905 4833 4817 4336 3678 3665 1995 1948 1784 1590 1321 1312 1206 24966 3385 23207 1545 11900
NM_021120chrX133159 2998 2665 2583 2386 2190 2134 2063 1165 1110 816 768 699 21193 335 22747 794 13079
NM_021813chr655182 4063 3941 3891 3809 34209 4191 1812 35018 3756 1795 13955
NM_021815chr262813 1205 897 778 768 317 1166 --12552
NM_021905chr65831 506 407 357 221 32270 793 769 12185 3346 211 199
NM_021911chr5104950 4787 4230 3818 1608 1312 916 858 318 290 11132 --12219
NM_022048chr15156013 5267 5149 4658 2396 2389 1831 1541 1285 935 482 428 145 124 81 41317 1141 457 418 21501 449 --
NM_022091chr692664 2365 1085 623 500 369 347 182 28 11104 12469 12467
NM_022166chr16126010 5193 4838 4650 4274 4167 3974 1566 1325 1203 145 56 34448 2184 2148 25233 1985 14328
NM_022456chr12137220 7080 5548 5342 2933 2638 2533 1976 854 603 395 133 89 67579 7146 5954 2915 2777 2143 11339 --
NM_022648chr2204096 4080 3789 3609 3526 3476 3219 3192 3091 2972 1699 1447 1440 940 915 311 217 159 120 38 54225 3443 335 143 90 13082 23163 93
NM_022841chr1522193 1803 1844 --32536 1049 1046
NM_022898chr14114668 4289 4120 3734 3292 3112 1327 1268 1004 482 391 14310 --13363
NM_023923chr153678 3270 2449 910 595 ----32548 2544 2540
NM_024408chr192781 2543 838 781 733 725 368 155 126 12462 21438 842 11452
NM_024749chr142090 1638 812 751 173 126 22048 1474
NM_024770chr2136264 6253 6206 6106 5794 5527 5100 1964 1267 1152 1094 1059 97 15534 --16574
NM_024817chr15135981 5790 4523 4415 4269 4242 4224 4113 2364 2065 1506 1386 823 75614 5477 5035 4967 4343 3632 1461 24920 415 14196
NM_024953chr1262751 2386 816 723 578 428 1969 2695 686 1973
NM_024989chr287052 5200 1754 1192 723 589 305 103 --26274 1196 159
NM_025179chr1184640 4573 4430 4045 3602 3509 3373 3309 3139 3125 3020 1947 1739 1260 938 600 249 134 33049 1698 72 14505 132
NM_030647chr7115758 4629 4325 4215 4027 3884 2293 1667 1573 491 204 --25603 211 1209
NM_030761chr172536 2429 1676 691 616 331 48 21001 894 21911 375 32174 1965 621
NM_030806chr1199084 8593 7647 7514 7378 6970 6924 6756 3674 3287 2741 2654 1670 1519 1309 932 557 549 113 46916 3228 2663 1676 58377 6852 3069 2669 963 12666
NM_030918chr1165103 4950 4773 4717 3596 3422 1747 1553 1507 908 727 638 571 411 298 109 34942 3952 3512 55137 4203 3954 3942 1533 --
NM_031426chr992714 2510 2418 2237 720 593 414 271 244 32534 631 587 42536 2299 1758 620 --
NM_031427chr14165182 5110 5095 4772 4516 4450 3714 2116 1888 1827 1520 1261 1225 1027 973 454 24672 2010 --25282 1370
NM_031468chr7227746 7633 7309 7302 7150 6983 6818 6721 6655 5454 5399 5301 3224 3187 2931 2439 2377 2261 1808 1206 775 453 13003 33167 1899 481 26141 2608
NM_032047chr332124 514 311 ----22168 2077
NM_032105chr1187928 7634 7489 7476 7454 7036 6374 6085 5900 5733 5684 5143 2588 2356 2222 1300 1226 996 47595 5952 2756 242 15893 27599 1182
NM_032509chr822153 1875 1362 11829 3747 425 421
NM_032873chr1163787 3733 3448 1552 948 358 31244 729 327 13098 2363 23
NM_032932chr17156261 5878 5001 4898 4859 2140 1948 1762 1736 1445 1425 1394 789 269 250 65974 4153 1995 1858 1372 794 31749 1375 796 11790
NM_033133chr17133639 3428 3280 3083 2896 2737 1462 1425 1064 911 683 468 32 146 42864 2518 825 652 13007
NM_033224chr7157697 7517 6199 5282 3227 2959 2948 2775 2255 2247 1856 1660 609 510 226 2118 97 ----
NM_033503chr15123754 3299 3236 3195 3092 2418 1551 1530 1440 1198 1076 230 32746 2658 1470 23446 2789 22446 56
NM_033631chr183607 3089 2989 2802 2787 1558 1007 888 1171 23769 1277 22474 904
NM_052885chr1284467 4372 4124 1721 1019 746 736 49 24093 147 13836 11024
NM_052906chr22274638 4483 4170 4160 4024 3914 3904 3742 3713 3631 3568 2036 1924 1916 1455 1314 1215 1010 849 829 821 537 514 433 338 60 38 34209 1155 405 34648 3221 1157 1325
NM_052907chr12123321 3305 3297 3238 3217 3091 1643 1291 1234 694 541 145 13382 --11576
NM_080669chr17164650 4291 4281 4066 3451 3263 3043 1915 1450 1356 1266 1171 1028 518 32 25 44455 3542 1697 478 34070 496 480 33772 1701 1621
NM_080676chr2072573 774 644 476 398 93 75 22146 110 32753 2148 390 --
NM_080872chr8103756 3294 3202 3155 2714 1287 1187 724 322 66 --2517 204 12475
NM_133170chr20177935 7842 6996 6911 6734 6532 5444 3198 2837 2663 2557 2267 2143 2030 1838 1065 120 11292 66969 6170 2961 2635 1899 951 --
NM_133264chr17143806 3557 3008 1519 1490 1387 1258 1210 1201 1005 898 490 478 419 22978 1053 23932 1027 --
NM_138426chr721648 671 --11622 21633 596
NM_138444chr1384699 4287 1782 1341 1044 1038 876 544 11640 11029 1817
NM_138576chr14114668 4289 4120 3734 3292 3112 1327 1268 1004 482 391 14310 --13363
NM_138735chr271396 1014 446 425 376 318 105 --11323 21317 128
NM_138959chr1116465 4897 4364 2073 1721 1219 1143 1034 845 236 72 36304 1189 164 24377 1729 24503 1726
NM_138971chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_138971chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_138972chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_138972chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_138973chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_138973chr11143863 3655 3250 3144 2955 2885 2821 1177 834 776 590 414 213 206 3603 597 150 12811 12930
NM_144571chr4146857 5900 5855 4767 4675 2811 2800 2698 1794 1731 1270 1241 1176 922 12379 24756 2459 --
NM_144628chr20112773 2724 2195 2101 1115 554 475 449 364 275 189 62746 2137 834 630 429 58 32963 2053 431 12749
NM_144767chr15134372 4189 3833 3349 3029 1575 1394 1176 1141 1065 904 844 675 22888 183 53988 3837 3605 469 185 --
NM_144973chr12165048 5036 4947 4783 4748 4235 3708 3257 2102 1795 1598 1507 1278 1214 1164 353 43530 3340 1069 982 11130 1996
NM_145176chr6113550 3269 2747 2543 2533 2523 2276 1135 784 513 48 22989 171 --12477
NM_145259chr2127141 6740 6307 5936 5777 5037 4708 1633 1123 1086 839 256 --11819 46640 1940 1098 1094
NM_145686chr282385 2301 2134 1257 551 532 433 418 --1411 12306
NM_145687chr282385 2301 2134 1257 551 532 433 418 --1411 12306
NM_148955chr15206293 6138 6013 5514 5499 4915 4836 4738 4640 4430 4159 4138 2048 1987 1403 1020 997 987 650 471 46461 5548 4287 621 44973 4897 4780 688 --
NM_152261chr1272177 1750 965 876 515 468 153 --1377 1906
NM_152263chr195967 4551 4502 4359 4006 3841 3833 2032 537 34514 4329 1449 22082 1568 55046 5035 4824 4434 247
NM_152406chr581625 1150 314 184 98 89 76 55 11639 1307 21159 193
NM_152424chrX124318 4016 3946 3607 3264 3106 3039 1684 1559 1499 1037 70 23981 3365 34495 3984 3239 24750 4493
NM_152455chr1592683 2628 2485 2383 1983 1940 385 193 28 --32100 1953 1923 11124
NM_152470chr18133384 3175 3129 3071 3001 2928 1631 1207 1063 794 763 166 134 42936 779 268 236 32685 844 270 --
NM_152624chr5117384 6518 5405 5155 4559 2742 2476 2413 1779 1502 998 16164 11437 11164
NM_152734chr6165183 4294 4070 3970 3704 3427 1882 1810 1719 923 877 844 559 481 462 370 55346 5215 4692 3555 1735 24189 2194 25218 207
NM_152826chr15206293 6138 6013 5514 5499 4915 4836 4738 4640 4430 4159 4138 2048 1987 1403 1020 997 987 650 471 46461 5548 4287 621 44973 4897 4780 688 --
NM_153050chr22134905 4833 4817 4336 3678 3665 1995 1948 1784 1590 1321 1312 1206 24966 3385 23207 1545 11900
NM_153051chr22134905 4833 4817 4336 3678 3665 1995 1948 1784 1590 1321 1312 1206 24966 3385 23207 1545 11900
NM_170774chr20103150 3081 2929 2840 1646 1373 1326 949 795 64 42696 860 552 480 21570 486 1237
NM_173595chr12124906 4664 4514 4444 4091 3951 3379 3372 1174 1112 458 90 43903 3461 1929 124 23761 1323 13759
NM_173642chr1129059 8543 8101 8087 7720 7141 6409 6391 6143 5777 3458 1398 46579 6421 6350 3490 56423 6352 2259 2194 1620 23572 3569
NM_173808chr153488 2909 2901 1459 744 33140 2928 2871 22894 2886 53760 2883 2863 2850 2769
NM_173872chr43708 145 130 3931 334 139 1598 --
NM_175623chr12137220 7080 5548 5342 2933 2638 2533 1976 854 603 395 133 89 67579 7146 5954 2915 2777 2143 11339 --
NM_175624chr12147315 7175 5643 5437 3028 2733 2628 2071 949 698 490 228 184 87 67674 7241 6049 3010 2872 2238 11434 --
NM_175625chr12147315 7175 5643 5437 3028 2733 2628 2071 949 698 490 228 184 87 67674 7241 6049 3010 2872 2238 11434 --
NM_175736chr12187482 7303 6221 5753 2904 2498 2430 2342 2288 2237 1545 1275 1220 1024 781 726 518 89 37384 2674 326 57362 5757 2908 2502 2442 35702 3062 2942
NM_177972chr11104294 3308 3176 2983 564 542 399 353 336 326 1346 ----
NM_178498chr11113568 2752 1536 1383 1303 1125 1117 1094 823 769 642 11614 22671 1557 --
NM_181481chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_181482chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_181483chr18125722 5228 4743 4638 2656 2194 2069 1701 1192 546 528 337 22829 2250 22531 44 1396
NM_181521chr1696784 6016 5282 5272 5201 2534 1742 1377 1049 27224 1895 45426 2065 579 342 12912
NM_181844chr1762012 1748 1667 1567 1320 440 --11889 21915 1883
NM_182503chr685571 4719 4307 3626 3577 1742 1066 990 23633 1852 14484 15118
NM_182762chr7106018 5359 5170 4626 2503 2154 1748 1702 1595 459 22386 801 1474 24171 1832
NM_194071chr784031 3990 3625 1367 1058 933 834 203 34628 1916 1609 24631 2085 12132
NM_194278chr14103678 3221 3079 1197 975 833 387 380 353 84 --23369 357 23565 547
NM_194283chr594181 4149 3957 3490 3308 2995 2866 2599 774 13794 --23480 2764
NM_198215chr1031073 977 164 1407 --2436 137
NM_198320chr12124580 4573 4488 3793 1890 1737 1548 579 319 295 280 126 --1784 --
NM_198484chr3136159 5725 5574 4872 4845 4699 4649 4641 2320 2093 1511 1372 600 --24097 2463 --
NM_198560chr393521 3115 3064 2964 2651 2586 2354 1525 1288 23022 2346 12766 12338
NM_198581chr2107311 6000 5981 4558 2886 1734 1545 1371 1300 1037 26830 1569 --12956
NM_198686chr14132303 2158 2004 1974 1965 1913 1850 1698 1617 830 695 189 40 32386 967 91 11702 22268 31
NM_198715chr175959 5882 4147 2361 2143 1636 715 36184 5005 4541 26186 4704 14268
NM_198859chr3114984 4277 3997 3821 3723 3221 1229 1201 1175 705 28 21151 1097 45040 4539 1790 1344 14050
NM_198900chr12187482 7303 6221 5753 2904 2498 2430 2342 2288 2237 1545 1275 1220 1024 781 726 518 89 37384 2674 326 57362 5757 2908 2502 2442 35702 3062 2942
NM_199000chr782160 1680 1528 1431 721 487 460 298 ----189
NM_199462chr1124292 4040 3843 3693 3234 3144 3118 1736 867 689 670 657 13581 54488 4424 3813 1636 291 --
NM_203458chr193573 2602 1365 1352 1313 674 504 406 259 23319 450 13459 23256 621
NM_203463chr2124653 4383 4241 3214 3193 1967 1741 1394 939 587 338 170 13965 21431 294 1783
NM_206909chr8157690 7477 7145 6413 6399 6272 5957 5948 5482 1749 1382 1373 686 599 21 1235 26711 2536 11049
NM_207380chr15113659 2830 2807 2762 2636 2623 2572 2388 1068 578 161 43151 2693 2682 538 33205 3138 1461 1612
NM_213589chr295184 4601 3854 2162 1104 892 378 304 295 11220 14503 --