TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1255a
miRNA Sequence: AGGAUGAGCAAAGAAAGUAGAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511229 --1183 1461
NM_000044chrX1372 ------
NM_000051chr111222 21019 30 21231 675 12190
NM_000081chr121659 136 --11636 --
NM_000084chrX105401 5034 2174 1843 1793 1763 1532 1405 1085 529 --15380 27011 2521
NM_000088chr171156 ------
NM_000089chr72700 694 ------
NM_000091chr242011 986 877 35 --1883 --
NM_000092chr2114326 3963 3921 3709 3463 3330 3159 3109 1550 339 92 ----11492
NM_000097chr32845 214 --1327 --
NM_000109chrX32244 916 629 21757 814 ----
NM_000110chr111037 ------
NM_000112chr565025 5012 4718 1871 1413 583 24252 1810 ----
NM_000115chr1331818 933 219 22325 834 ----
NM_000125chr631489 582 55 13088 11536 --
NM_000135chr161996 --1342 --
NM_000138chr1552294 1003 853 814 548 ------
NM_000139chr1172857 2820 2638 2506 2446 2291 2189 12676 ----
NM_000151chr1721576 601 11819 11703 --
NM_000153chr1431099 424 326 ------
NM_000158chr32564 228 --1554 --
NM_000161chr1421698 1337 ------
NM_000163chr521888 1812 11494 11867 --
NM_000176chr582705 2625 2533 2469 2418 663 561 113 ------
NM_000189chr252296 836 467 151 70 1698 --1554
NM_000208chr1973906 3730 3625 1812 1799 1357 142 --34542 1604 746 1521
NM_000212chr1741884 1595 526 365 1713 21915 411 1990
NM_000216chrX74064 3548 3051 2730 1550 499 283 12907 --13878
NM_000217chr1265384 4064 3729 1785 1662 1572 15305 15201 14419
NM_000222chr4----11355 --
NM_000228chr1----134 --
NM_000242chr1032542 2025 822 2874 798 ----
NM_000245chr741678 1410 410 160 1486 ----
NM_000248chr323066 715 ------
NM_000259chr1576213 4036 2436 1599 897 538 158 --1217 --
NM_000264chr963339 3264 3068 2879 2553 957 ------
NM_000267chr1723003 394 1746 --1732
NM_000271chr181519 --1250 --
NM_000276chrX32229 1630 699 --11871 --
NM_000277chr123282 217 67 1316 ----
NM_000293chr162631 309 ------
NM_000304chr173871 428 393 1719 ----
NM_000314chr1011062 --23297 3206 --
NM_000317chr111319 ------
NM_000319chr123430 257 200 --1826 --
NM_000321chr1331542 1470 494 ------
NM_000330chrX2923 287 32248 2240 2143 11584 --
NM_000332chr6116107 5734 5689 5638 5450 5402 2757 2537 1967 1479 39 25179 1580 46508 5905 2834 2357 11169
NM_000337chr5106241 5655 5608 4830 4277 4158 2651 1582 1317 1303 35988 2180 383 11281 14306
NM_000353chr16------1184
NM_000369chr1431830 1656 613 ------
NM_000386chr171655 --1234 --
NM_000393chr211904 --2469 158 1720
NM_000397chrX21583 676 22182 1936 --1979
NM_000408chr243472 2350 729 233 --12768 --
NM_000434chr6----1212 --
NM_000441chr721611 1572 --2167 91 --
NM_000449chr12964 81 --11049 --
NM_000451chrX31992 1479 465 12137 --12133
NM_000459chr92650 319 ------
NM_000461chr353942 1367 1125 875 55 43797 2826 901 484 21481 1425 --
NM_000462chr1511793 ----11810
NM_000474chr71521 ------
NM_000480chr1121633 1085 --11425 --
NM_000486chr1253264 2589 2501 735 418 --12241 11972
NM_000489chrX63413 2936 2158 1101 855 381 22364 1211 12829 --
NM_000495chrX31104 855 76 ------
NM_000503chr821627 178 11678 --11510
NM_000522chr721096 987 ------
NM_000533chrX21964 466 ------
NM_000538chr132359 210 11414 --1342
NM_000544chr6_cox_hap153119 2234 2176 694 667 ------
NM_000555chrX87846 7835 7625 5830 5450 5237 2190 405 36531 3018 2588 27295 3043 --
NM_000574chr141255 1152 494 66 ------
NM_000585chr42461 222 ------
NM_000599chr251418 1241 876 769 90 --11091 --
NM_000614chr111170 ------
NM_000615chr1132196 833 130 --1952 --
NM_000618chr1235895 4280 2176 42194 2077 1309 380 25648 1283 --
NM_000618chr1235895 4280 2176 42194 2077 1309 380 25648 1283 --
NM_000619chr122532 94 ------
NM_000633chr1844808 4579 4472 3731 33462 774 486 23642 2110 --
NM_000671chr431226 890 328 1137 1870 --
NM_000680chr82338 147 ------
NM_000719chr1246627 6352 2103 2018 35405 4579 117 14137 --
NM_000726chr231354 70 26 1992 ----
NM_000767chr191945 2610 42 11409 --
NM_000794chr521063 273 --134 --
NM_000800chr521613 1436 ------
NM_000806chr531270 716 657 11932 ----
NM_000808chrX1775 --1247 --
NM_000813chr542051 1937 1142 809 11008 1366 --
NM_000814chr1583441 1646 1380 1185 977 706 582 392 1348 ----
NM_000826chr432045 1865 297 ------
NM_000829chr1142223 1653 730 290 --22069 908 --
NM_000831chr176187 4969 4237 4078 976 520 190 --24860 1699 --
NM_000860chr411485 --11167 --
NM_000868chrX42335 2276 777 335 12595 --1475
NM_000875chr1596044 5567 5503 5439 5337 5129 2807 759 615 21245 555 --12719
NM_000876chr61261 --2916 572 --
NM_000899chr1253731 3660 3509 412 273 1212 --12892
NM_000908chr51191 ------
NM_000926chr1199406 9155 9074 7861 7355 7041 2013 1329 980 48655 7656 2980 1681 27992 3770 38311 3761 274
NM_000933chr2041706 1476 610 500 ------
NM_000944chr432041 1919 692 --11551 --
NM_000945chr23777 661 287 --11311 --
NM_000950chrX53550 1180 1150 544 182 2511 174 ----
NM_000956chr144938 848 771 753 --21111 977 --
NM_000964chr172329 293 1993 ----
NM_000966chr121166 ------
NM_000983chr12146 70 ----1378
NM_001001323chr1263191 2943 2877 2796 2192 246 ------
NM_001001331chr322682 2396 1453 ----
NM_001001342chr1031147 1007 477 --11047 --
NM_001001395chr1222767 681 12802 ----
NM_001001433chr2053014 1974 1186 701 478 ------
NM_001001521chr21215 ------
NM_001001552chr12317 26 ------
NM_001001664chr223931 2566 ------
NM_001001668chr1921296 470 23280 2669 23177 88 --
NM_001001870chr171799 ------
NM_001001924chr831828 1697 1288 1598 ----
NM_001001925chr831828 1697 1288 1598 ----
NM_001001931chr831828 1697 1288 1598 ----
NM_001001936chr1031066 905 427 11050 --1435
NM_001001974chr103908 678 230 --1256 1757
NM_001002009chr7262 54 ------
NM_001002010chr7262 54 ------
NM_001002295chr101732 ------
NM_001002296chr841315 1116 362 94 11267 ----
NM_001002860chr1474683 4186 3989 3846 3541 616 83 24337 405 ----
NM_001002909chr1732010 1989 526 --21936 643 --
NM_001003652chr18108612 7634 5253 3247 1481 1444 1013 934 644 129 11742 ----
NM_001003676chr112794 383 ------
NM_001003694chr32483 97 ------
NM_001003760chr653649 3220 3158 2838 807 --31215 1190 1163 13185
NM_001003800chr973450 3183 2758 2726 1400 853 681 ------
NM_001003810chr41180 --123 --
NM_001004065chr933985 3925 3168 13058 --13392
NM_001004317chr674457 4401 4285 4260 3662 1446 811 ------
NM_001004419chr1244469 3416 3400 1352 ------
NM_001005209chr2------1463
NM_001005336chr91181 ------
NM_001005353chr111235 21286 39 ----
NM_001005353chr111235 21286 39 ----
NM_001005375chrY21631 1486 11590 --1627
NM_001005386chr22955 273 ----173
NM_001005404chr1744511 1483 1025 748 ------
NM_001005463chr1022229 588 ------
NM_001005473chr566077 4798 4518 2539 1355 45 35894 2454 505 14535 --
NM_001005474chr331467 1455 1411 11292 ----
NM_001005476chr21744 ----1683
NM_001005732chr212237 128 1189 ----
NM_001005733chr211128 1189 ----
NM_001005739chr22240 29 ------
NM_001005743chr1411103 --11255 --
NM_001005744chr1411103 --11255 --
NM_001005745chr1411103 --11255 --
NM_001005746chr231354 70 26 1992 ----
NM_001005747chr231354 70 26 1992 ----
NM_001005782chr21144 ------
NM_001005845chr841734 1476 323 80 ------
NM_001006623chr221759 1638 1232 ----
NM_001006657chr272417 2288 2117 1162 949 609 114 ----12539
NM_001006665chr12789 687 ------
NM_001007024chr1722902 1353 ----14365
NM_001007025chr1722902 1353 ----14365
NM_001007026chr121338 ------
NM_001007067chr821044 156 --1197 --
NM_001007068chr821044 156 --1197 --
NM_001007069chr821044 156 --1197 --
NM_001007070chr821044 156 --1197 --
NM_001007094chr1043090 2938 497 417 13432 ----
NM_001007097chr955125 4929 4125 3441 113 34388 1244 534 195 --
NM_001007098chr12182 51 1364 ----
NM_001007237chr132535 2025 742 12604 ----
NM_001007246chr2121585 654 ------
NM_001007464chr61133 ------
NM_001007466chr673908 3710 3510 3383 1917 882 467 33650 3279 920 25014 1488 --
NM_001007553chr1185 ------
NM_001007559chr1821375 139 1814 ----
NM_001008220chr531008 668 172 ------
NM_001008225chr71743 ------
NM_001008239chr1823074 1416 22978 1455 150 --
NM_001008392chr321409 681 12464 ----
NM_001008401chr191548 11480 ----
NM_001008408chr762575 1802 1423 1135 961 413 ------
NM_001008495chr831719 1648 766 12115 --11400
NM_001008541chr101567 12147 1670 --
NM_001008541chr101567 12147 1670 --
NM_001008564chr1321731 46 ------
NM_001008567chr9298 32 ------
NM_001008723chr101397 ------
NM_001008726chr1421448 412 ------
NM_001008756chr36985 420 386 357 195 101 12030 12278 --
NM_001008860chr152645 250 ------
NM_001008892chr152645 250 ------
NM_001008894chr152645 250 ------
NM_001009554chr484082 2959 1784 1412 1287 884 654 510 11215 33168 2906 105 13293
NM_001009554chr484082 2959 1784 1412 1287 884 654 510 11215 33168 2906 105 13293
NM_001009899chr355877 1078 878 845 294 15496 ----
NM_001009909chr1143575 3521 2747 187 23448 1444 ----
NM_001009993chr253979 3942 3234 965 713 --13530 --
NM_001010000chr1853110 3028 2438 1257 789 33534 2412 928 ----
NM_001010888chrX24217 4181 14349 44118 3087 2811 1414 --
NM_001010895chr941957 1705 625 469 ------
NM_001010971chr12156 131 --1302 --
NM_001010986chrX42236 818 413 41 12133 1396 --
NM_001011513chr4103999 3944 3849 2655 1222 1026 926 852 445 274 ------
NM_001011537chr341714 335 245 64 ------
NM_001011553chr72644 616 1101 ----
NM_001011645chrX1372 ------
NM_001011663chr103859 851 386 ------
NM_001011666chr785848 5661 5350 5179 4959 4435 1822 300 1800 ----
NM_001011708chr232671 2240 939 12769 ----
NM_001011713chr1441380 605 129 30 ------
NM_001011720chr841373 1254 1148 170 21346 494 ----
NM_001011885chr151460 11444 11723 --
NM_001012279chr6----1154 --
NM_001012393chr1184930 4874 4512 4334 4133 980 306 299 1228 33787 3369 621 11838
NM_001012456chr7127 ------
NM_001012478chr191623 --169 --
NM_001012506chr31118 ------
NM_001012968chrX42395 1762 1074 492 ------
NM_001013438chr3----1705 --
NM_001013439chr3----1551 --
NM_001013659chr1944068 2053 372 355 11656 ----
NM_001013703chr15176 ----129
NM_001013734chr62717 690 ------
NM_001014445chr171693 ------
NM_001014797chr1068154 8033 3078 1141 986 773 26948 6611 17416 --
NM_001014812chr15----1396 --
NM_001015045chr42700 631 11867 --1333
NM_001015508chr82232 68 ------
NM_001015877chrX22670 2243 13109 ----
NM_001015881chrX187 --21211 366 --
NM_001015892chr51158 1195 ----
NM_001017368chr1742317 2296 581 392 12073 --1938
NM_001017371chr21497 ------
NM_001017395chr352812 2767 2622 626 409 1185 ----
NM_001017402chr1----134 --
NM_001017415chr12182 87 1254 ----
NM_001017416chr12182 87 1254 ----
NM_001017424chr121318 482 1139 ----
NM_001017425chr121318 482 1139 ----
NM_001017440chr7107971 7944 5967 5521 5012 2061 1197 844 305 177 15548 33105 3021 897 27994 1685
NM_001017926chr8----11735 --
NM_001017977chr11311 ------
NM_001017995chr574865 3739 3318 1715 1514 507 82 11910 13851 --
NM_001018064chr911549 21873 172 --11403
NM_001018065chr985747 5397 5162 4338 3941 2125 1237 1100 16040 11611 --
NM_001018066chr985747 5397 5162 4338 3941 2125 1237 1100 16040 11611 --
NM_001018067chr145146 3503 1853 690 21949 112 ----
NM_001018068chr145146 3503 1853 690 21949 112 ----
NM_001018069chr145146 3503 1853 690 21949 112 ----
NM_001018070chr112302 26 ------
NM_001018074chr582705 2625 2533 2469 2418 663 561 113 ------
NM_001018075chr582705 2625 2533 2469 2418 663 561 113 ------
NM_001018076chr582705 2625 2533 2469 2418 663 561 113 ------
NM_001018077chr582705 2625 2533 2469 2418 663 561 113 ------
NM_001020658chr12453 406 11223 128 --
NM_001020658chr12453 406 11223 128 --
NM_001022chr19----135 --
NM_001023567chr151692 --1438 --
NM_001024071chr143720 359 163 ------
NM_001024094chr582705 2625 2533 2469 2418 663 561 113 ------
NM_001024218chr14----1326 --
NM_001024455chrX31659 923 550 ------
NM_001024649chr51849 11111 --12210
NM_001024666chrX133 ------
NM_001024809chr172329 293 1993 ----
NM_001024948chr123369 741 ------
NM_001025068chr3----11772 --
NM_001025069chr3----11772 --
NM_001025076chr10125883 5840 4912 3839 2447 2410 1672 815 584 114 69 30 12049 14759 1219
NM_001025077chr10117241 7198 6270 5197 3030 2173 1942 1472 1427 1048 30 --16117 11577
NM_001025079chr332704 2561 1098 --1604 --
NM_001025081chr18------11025
NM_001025090chr18------11025
NM_001025092chr18------11025
NM_001025101chr18------11025
NM_001025105chr521402 372 ------
NM_001025107chr162213 1750 1688 944 161 74 ------
NM_001025107chr162213 1750 1688 944 161 74 ------
NM_001025108chr233076 2564 1381 12670 13611 --
NM_001025233chr1232726 1051 502 1394 11081 --
NM_001025266chr324699 3213 11926 1656 --
NM_001025389chr1121633 1085 --11425 --
NM_001025390chr1121633 1085 --11425 --
NM_001025580chrX43392 3354 2873 704 --11371 --
NM_001025603chr12964 81 --11049 --
NM_001029858chr642540 2288 59 36 ------
NM_001029859chr1122416 1623 1358 ----
NM_001029860chr81298 ------
NM_001029863chr632880 2060 973 --13167 --
NM_001029875chr552733 2182 1886 958 537 ------
NM_001029891chrX1853 ----1256
NM_001030006chr1742072 936 663 337 --42621 2359 2054 558 --
NM_001030007chr1632911 1038 29 12785 122 --
NM_001030055chr1443998 705 569 277 24755 4565 ----
NM_001030059chr10197 ------
NM_001030287chr141168 294 48 37 ------
NM_001031623chr631724 1629 1322 ------
NM_001031665chr193363 288 130 1114 ----
NM_001031690chr722496 1935 22178 167 22113 471 --
NM_001031695chr2254674 4322 1216 736 640 ------
NM_001031717chr32176 51 ------
NM_001031723chr42464 67 ------
NM_001031740chr12317 35 ------
NM_001031804chr1644218 3663 3454 3260 1424 2881 875 --
NM_001031812chr531953 69 44 ------
NM_001031835chr161309 ------
NM_001032221chr921785 491 --11202 1524
NM_001032296chr1352742 960 857 760 49 ----12730
NM_001032380chr1021726 490 1766 21415 1235 --
NM_001032394chr64886 623 484 23 ----173
NM_001032999chr2074768 4280 4152 1202 898 848 714 --11060 13837
NM_001033045chr264379 4089 3548 1175 718 258 ------
NM_001033047chr432279 2256 2161 22564 762 161 --
NM_001033087chr2043230 2087 972 248 12067 ----
NM_001033117chr323178 1716 13935 13276 --
NM_001033564chr641291 352 244 59 ------
NM_001033578chr821858 103 ----12306
NM_001033910chr142175 1984 1804 634 12109 ----
NM_001033925chr101417 22176 1863 ----
NM_001034025chr121206 ----1793
NM_001034837chr5----1259 --
NM_001034838chr5----1259 --
NM_001034841chr1675249 4594 4089 3625 2063 1850 700 --24866 1485 --
NM_001035chr111133 1983 11036 --
NM_001035003chr451215 1166 1140 352 225 ------
NM_001035004chr451215 1166 1140 352 225 ------
NM_001035511chr13802 644 599 11361 ----
NM_001035512chr15909 751 706 68 25 11468 ----
NM_001035513chr15909 751 706 68 25 11468 ----
NM_001037172chr311158 --11111 --
NM_001037334chr1862303 2065 1893 482 434 113 --12430 --
NM_001037954chr1151342 1085 977 360 214 11194 12348 11190
NM_001038493chr221044 75 --2627 610 --
NM_001038640chr152142 82 ------
NM_001038702chr552686 2570 2246 814 681 --1851 --
NM_001038707chr121798 691 --42180 1900 1537 697 --
NM_001038707chr121798 691 --42180 1900 1537 697 --
NM_001039111chr3----1182 --
NM_001039199chr2064671 4514 3432 3407 2018 501 ------
NM_001039348chr2----1910 --
NM_001039349chr2----1910 --
NM_001039538chr252246 1300 1155 359 85 --1116 --
NM_001039570chr2234696 2928 201 ------
NM_001039571chr2234696 2928 201 ------
NM_001039590chrX31565 1206 141 ------
NM_001039591chrX31565 1206 141 ------
NM_001039618chr1135771 2087 24 11689 15477 --
NM_001039690chr1652044 1836 1467 232 223 ----12210
NM_001039693chr263827 3394 2856 2804 551 387 11278 ----
NM_001039709chr2074768 4280 4152 1202 898 848 714 --11060 13837
NM_001039840chrX74607 3994 3848 1960 1499 1457 338 15859 12299 --
NM_001039916chr121921 1229 1352 --
NM_001039917chr121921 1229 1352 --
NM_001039918chr121921 1229 1352 --
NM_001039919chr121921 1229 1352 --
NM_001039920chr121921 1229 1352 --
NM_001039937chr1343034 2914 1139 1089 12790 12713 --
NM_001040056chr16----2570 122 1576
NM_001040097chr71158 ------
NM_001040098chr71158 ------
NM_001040099chr71158 ------
NM_001040110chr7------11872
NM_001040142chr222344 1820 1874 --2689 578
NM_001040143chr222344 1820 1874 --2689 578
NM_001040144chr1652044 1836 1467 232 223 ----12210
NM_001040146chr1652044 1836 1467 232 223 ----12210
NM_001040152chr773423 3171 3162 1387 351 117 90 34487 4369 509 159 --
NM_001040153chr131753 ------
NM_001040158chr5------1120
NM_001040202chr452458 2056 2049 655 357 ------
NM_001040260chr431129 910 265 --21095 900 --
NM_001040261chr431129 910 265 --21095 900 --
NM_001040273chr1022087 575 11740 22062 310 --
NM_001040280chr631282 1015 595 ------
NM_001040284chr16135657 5140 4935 4635 4133 3936 3832 2168 1308 1296 851 638 307 13850 21097 1013 --
NM_001040402chr412533 --12912 --
NM_001040409chr22644 365 ------
NM_001040458chr551316 347 275 197 121 1333 1730 --
NM_001040619chr141618 498 487 352 1419 ----
NM_001040665chr795037 4940 4798 4674 4465 4457 3857 1008 963 14136 ----
NM_001040666chr75739 642 500 167 159 ------
NM_001040708chr82726 182 ------
NM_001042355chr1645181 4635 1350 1027 1714 11406 11769
NM_001042368chr91121 ------
NM_001042403chr12----1957 --
NM_001042404chr131931 471 408 ------
NM_001042412chr1645181 4635 1350 1027 1714 11406 11769
NM_001042492chr1723003 394 1746 --1732
NM_001042494chr1563599 3525 1278 472 429 72 --13162 11192
NM_001042495chr1563599 3525 1278 472 429 72 --13162 11192
NM_001042496chr1563599 3525 1278 472 429 72 --13162 11192
NM_001042497chr1563599 3525 1278 472 429 72 --13162 11192
NM_001042506chrX21316 317 ------
NM_001042510chr872127 1864 1360 535 393 288 130 ------
NM_001042511chr872127 1864 1360 535 393 288 130 ------
NM_001042550chr941856 1632 141 22 1404 1170 --
NM_001042555chr1244638 3556 1815 1322 13304 1654 13334
NM_001042599chr2127791 6917 6893 6810 6307 5924 5622 4955 3032 2724 2172 2024 36061 6057 1546 37777 7627 866 --
NM_001042601chr323038 2179 11998 1405 --
NM_001042603chr1254724 1980 1727 1061 643 33726 899 667 12063 --
NM_001042604chr364765 4660 4270 1789 1307 1019 24455 655 ----
NM_001042632chr2022183 638 ----12428
NM_001042633chr2022183 638 ----12428
NM_001042646chr331857 1245 644 --1354 --
NM_001042728chr121166 ------
NM_001042749chrX21401 1285 1586 1693 --
NM_001042750chrX21401 1285 1586 1693 --
NM_001042751chrX21401 1285 1586 1693 --
NM_001042762chr73985 785 333 ------
NM_001043318chr1443774 3013 1644 1534 12544 22635 1183 --
NM_001043351chr142175 1737 1424 503 --1846 --
NM_001044385chr273142 2768 2708 2491 1573 612 202 11584 12797 --
NM_001044722chr531953 69 44 ------
NM_001044723chr531953 69 44 ------
NM_001046chr53999 780 741 21057 360 ----
NM_001048183chr123521 3144 ----13535
NM_001049chr1452418 2148 1686 1555 370 --1382 --
NM_001071775chr1321329 1222 ------
NM_001079874chr141727 1448 1414 532 11530 ----
NM_001083620chr432043 1863 296 ------
NM_001099678chr372206 929 917 632 110 97 91 24504 151 1868 --
NM_001100108chr1116995 6965 6778 5838 5140 5100 2337 2228 2146 1534 159 13173 27656 1711 --
NM_001106chr378084 7547 7511 7043 3481 2551 1768 39563 6497 3403 18373 --
NM_001111chr162213 1750 1688 944 161 74 ------
NM_001121chr1031559 174 167 ------
NM_001122679chr511229 --1183 1461
NM_001128chr1632911 1038 29 12785 122 --
NM_001148chr421762 1717 ------
NM_001167chrX75720 5232 1361 1195 1110 960 322 1198 ----
NM_001173chr1443998 705 569 277 24755 4565 ----
NM_001200chr2021165 920 --1961 --
NM_001204chr2117175 6441 6343 5599 5281 4906 1848 1769 1041 691 90 46249 2689 2412 1220 24931 2597 --
NM_001222chr10------1759
NM_001249chr141421 --1309 --
NM_001256chr1732611 670 106 ------
NM_001259chr745105 4102 2470 2283 15303 26089 5392 11065
NM_001265chr132313 262 ------
NM_001271chr1542790 2272 661 590 --13075 --
NM_001274chr112336 78 1133 1276 --
NM_001282chr1742072 936 663 337 --42621 2359 2054 558 --
NM_001289chrX1640 ------
NM_001290chr42669 376 ------
NM_001304chr1783669 3317 2729 2699 1498 1456 1321 1264 ------
NM_001305chr71806 ------
NM_001310chr1232698 759 115 12911 13001 --
NM_001332chr531279 1084 412 ----1576
NM_001343chr531730 688 141 ------
NM_001345chr12----1216 --
NM_001364chr1143714 3335 1846 383 14282 13106 --
NM_001380chr10191 1841 1745 1999
NM_001381chr21415 ------
NM_001387chr553176 2743 2141 1943 1122 --32855 2527 2085 --
NM_001391chr1841105 487 357 40 ------
NM_001419chr1924385 81 1341 ----
NM_001420chr1932946 2191 258 ------
NM_001423chr1211906 ----11573
NM_001427chr722053 1448 ------
NM_001438chr142277 789 291 202 22522 916 32974 377 361 --
NM_001440chr821980 557 --2800 544 --
NM_001448chrX51177 1145 524 314 29 11703 --1163
NM_001449chrX31254 893 493 11285 ----
NM_001455chr644600 4389 915 625 13699 24713 3922 1304
NM_001482chr153690 113 66 1828 1637 --
NM_001493chrX2710 103 --1189 --
NM_001497chr942241 1842 1041 88 1129 --12220
NM_001530chr1461096 733 368 303 206 46 ------
NM_001542chr132535 2025 742 12604 ----
NM_001543chr564523 4510 4240 4178 1893 333 12947 11951 --
NM_001546chr64927 182 144 137 ------
NM_001554chr11107 --1131 --
NM_001587chrX32229 1630 699 --11871 --
NM_001609chr1084155 3997 3261 1805 1720 1134 602 574 24045 729 1382 13233
NM_001616chr233116 2564 1222 13205 ----
NM_001629chr13----1247 135
NM_001635chr731077 1045 374 1922 2990 203 --
NM_001649chrX12465 2435 431 2635 417 --
NM_001655chr1121916 806 1749 --11596
NM_001656chr521453 1339 ------
NM_001659chr1262482 2130 1016 861 582 216 --12219 12115
NM_001674chr141168 294 48 37 ------
NM_001682chr1252905 2657 2591 2510 1906 ------
NM_001683chr322682 2396 1453 ----
NM_001690chr332282 2214 449 --32548 319 77 --
NM_001694chr16----157 --
NM_001695chr834299 3590 1651 13220 11416 --
NM_001701chr951469 1291 1272 1243 1224 11259 --11339
NM_001706chr3182 1108 1955 --
NM_001709chr11----1789 --
NM_001729chr4155 ------
NM_001730chr13----1243 --
NM_001730chr13----1243 --
NM_001742chr731869 1860 1175 2232 228 --11371
NM_001743chr23156 134 73 1434 ----
NM_001746chr51849 11111 --12210
NM_001755chr1622219 2205 ------
NM_001759chr1275218 4898 3875 3830 3494 3458 1648 11717 ----
NM_001761chr16----11766 1483
NM_001777chr332704 2561 1098 --1604 --
NM_001788chr72644 616 1101 ----
NM_001789chr341281 545 448 303 --11381 11323
NM_001797chr162574 101 ------
NM_001798chr1211136 ------
NM_001806chr1932909 995 604 ------
NM_001812chr41309 ------
NM_001829chr43796 752 657 185 ----
NM_001830chrX41401 1330 991 75 13447 11387 1610
NM_001839chr1----2744 559 --
NM_001844chr121119 ------
NM_001854chr111018 11201 1333 1340
NM_001858chr6145021 3805 3749 1960 1870 940 927 807 446 401 352 276 204 77 --13364 --
NM_001880chr2137 ------
NM_001892chr521402 372 ------
NM_001895chr202787 299 ------
NM_001901chr6261 29 ------
NM_001903chr51693 ------
NM_001918chr168532 6856 6743 2878 818 77 39164 7497 2170 27011 2467 17726
NM_001935chr24932 215 157 43 ------
NM_001938chr121177 77 1148 ----
NM_001940chr121338 ------
NM_001962chr5----176 1457
NM_001987chr1244328 3158 2747 359 1368 23803 3278 --
NM_002006chr495675 4962 4841 4185 3831 3536 1074 395 26 1130 ----
NM_002009chr1522405 738 ------
NM_002010chr132443 409 ------
NM_002015chr1332833 2053 1134 12998 ----
NM_002024chrX21598 839 22133 326 ----
NM_002025chrX128957 8914 7585 6064 3123 2592 2470 2371 1769 1707 1170 1140 28827 6473 ----
NM_002026chr21869 1708 ----
NM_002032chr111294 ------
NM_002033chr1173814 3779 3746 2906 2874 797 774 ------
NM_002035chr1843718 2894 1395 1126 22851 2625 --21260 779
NM_002040chr2122290 1170 1476 --12095
NM_002045chr31395 ------
NM_002051chr101732 ------
NM_002056chr21788 1359 ----
NM_002061chr131225 778 157 ------
NM_002074chr11425 --11387 --
NM_002076chr1263207 3051 2252 1022 568 278 1508 ----
NM_002077chr942116 1577 503 196 21355 1348 ----
NM_002078chr33666 551 53 1134 ----
NM_002092chr4114945 4689 4345 4222 4035 3681 3316 3260 1684 883 316 --14062 --
NM_002126chr1754024 3575 2954 2698 244 13027 13857 --
NM_002137chr741722 1524 650 112 ------
NM_002138chr41180 --123 --
NM_002148chr21269 ------
NM_002158chr222697 2469 2801 645 23613 2415 --
NM_002182chr352221 1992 758 724 70 32728 2665 699 41844 618 492 432 --
NM_002192chr71495 ------
NM_002205chr12----2924 55 --
NM_002214chr785692 5313 4482 3676 1574 919 322 153 --11926 --
NM_002222chr341150 1000 921 542 ------
NM_002223chr1222632 34 ------
NM_002228chr11783 ----1332
NM_002232chr131134 136 97 ------
NM_002242chr241591 1380 364 358 2774 485 ----
NM_002247chr10146 ------
NM_002254chr221590 930 11454 271 66 21777 562
NM_002264chr3114889 4814 3627 3071 1714 1304 1233 1209 1138 986 124 34177 3682 1780 1349 --
NM_002265chr171843 ------
NM_002268chr331600 515 376 11876 ----
NM_002271chr13----12117 1633
NM_002284chr121566 ------
NM_002285chr233076 2564 1381 12670 13611 --
NM_002312chr13146 ------
NM_002345chr121171 ------
NM_002350chr83396 103 44 ----11265
NM_002355chr1211272 --194 --
NM_002356chr642143 896 680 205 12647 ----
NM_002374chr252246 1300 1155 359 85 --1116 --
NM_002385chr18------11025
NM_002387chr554974 4492 3646 1729 1005 34508 4438 4055 1396 13916
NM_002397chr552099 1968 1611 1396 543 11729 --12057
NM_002399chr151458 ------
NM_002408chr141700 ------
NM_002431chr14----1235 --
NM_002445chr8274 43 11292 11156 --
NM_002451chr912903 ----22966 1334
NM_002460chr622754 1257 --22517 972 --
NM_002465chr121310 ------
NM_002479chr1------2199 152
NM_002500chr21514 11296 ----
NM_002515chr1452065 2037 1790 1439 663 11597 ----
NM_002519chr11----1374 --
NM_002522chr1753661 3511 3266 1562 380 ------
NM_002524chr12753 302 ------
NM_002545chr1184930 4874 4512 4334 4133 980 306 299 1228 33787 3369 621 11838
NM_002547chrX64290 4122 4003 2781 1308 211 34095 3902 3128 ----
NM_002576chr112443 24 ------
NM_002577chr343451 3117 3021 394 ------
NM_002581chr965546 5449 5026 2171 1739 1208 25482 4264 21220 1214 --
NM_002594chr2052183 2044 1966 781 315 1256 ----
NM_002609chr521565 105 1453 --1535
NM_002613chr1645321 4681 4612 1952 --21173 732 --
NM_002628chr34428 376 176 37 --11181 --
NM_002634chr171186 1214 --1844
NM_002641chrX1661 1133 ----
NM_002645chr1122321 858 ----12343
NM_002648chr61332 --1141 --
NM_002649chr741542 1223 362 229 --1448 11134
NM_002655chr865014 3812 1710 955 740 375 24517 3541 --14499
NM_002656chr61933 ------
NM_002657chr2053258 3000 2728 1518 1136 --1974 11278
NM_002667chr62170 58 ------
NM_002692chr14132 ------
NM_002698chr1932746 1119 204 1948 2211 196 --
NM_002709chr233576 845 562 1237 ----
NM_002716chr1173654 3324 2623 1013 970 413 189 2620 266 --1108
NM_002717chr82497 173 --1440 --
NM_002718chr322622 119 21760 980 ----
NM_002726chr61331 ------
NM_002731chr192934 2734 1926 1175 1163 920 522 142 108 --12887 1732
NM_002736chr742107 1729 715 444 ------
NM_002745chr2244438 4281 3970 3794 13433 24176 2943 1106
NM_002748chr1511222 21183 388 1812 --
NM_002764chrX1883 1667 2204 143 --
NM_002806chr14------1338
NM_002822chr1241713 1192 1158 74 1737 ----
NM_002835chr71606 1629 ----
NM_002843chr1153107 1246 908 663 208 12171 ----
NM_002845chr181660 ------
NM_002847chr72357 229 ------
NM_002857chr152387 2136 1963 767 123 ----1825
NM_002858chr121090 299 --1551 --
NM_002906chr1132048 676 446 ------
NM_002912chr62829 85 --1206 --
NM_002942chr311096 ------
NM_002953chr12789 687 ------
NM_002956chr1221094 465 1459 ----
NM_002957chr953600 3518 2586 2441 441 ----13095
NM_002993chr42911 686 ------
NM_002994chr431939 652 584 ------
NM_002996chr1621958 761 --158 --
NM_003001chr15909 751 706 68 25 11468 ----
NM_003010chr1762354 1906 1804 1522 786 66 --1223 --
NM_003017chr6----2971 512 --
NM_003034chr1253101 2600 2434 2282 1170 47881 7324 5936 2754 11386 15984
NM_003036chr1----1461 --
NM_003042chr361597 1581 1538 1511 1387 294 ----11394
NM_003043chr364272 4021 1232 1020 607 402 --11185 --
NM_003091chr20----1181 --
NM_003096chr2----1173 --
NM_003098chr201482 ------
NM_003108chr256544 5472 4810 4618 1422 26473 4929 ----
NM_003111chr21497 ------
NM_003128chr21943 ------
NM_003133chr11349 ------
NM_003137chr641656 830 622 481 11569 ----
NM_003144chr612186 --11842 --
NM_003161chr1783556 3398 2652 2521 866 559 359 259 13428 ----
NM_003184chr831057 1049 219 ------
NM_003185chr201396 --1224 --
NM_003187chr51158 1195 ----
NM_003188chr62688 285 ------
NM_003199chr1863822 3764 3478 2125 2040 1568 1244 13734 1898
NM_003203chr241837 1684 561 479 ----11594
NM_003204chr1721109 360 ----1108
NM_003211chr1241780 462 364 225 --1699 --
NM_003216chr2232049 901 98 --22607 465 --
NM_003217chr1251413 801 392 195 52 1340 ----
NM_003221chr633606 2763 982 1878 ----
NM_003246chr1551763 1723 1526 782 686 22010 1354 ----
NM_003250chr171351 ------
NM_003255chr1762641 2379 2084 1919 917 436 --2202 109 --
NM_003262chr374980 3922 3798 1924 1765 1229 435 1212 --33317 1354 245
NM_003268chr1125 ------
NM_003269chr611307 ------
NM_003298chr363949 3898 641 580 434 132 23821 2328 25239 2316 14923
NM_003304chr341516 1359 1080 1010 ------
NM_003305chr41345 ------
NM_003315chr17186 ------
NM_003319chr21629 --133 --
NM_003320chr1184110 4091 4070 3828 3518 2962 1658 385 ------
NM_003336chrX1391 ------
NM_003337chr5257 30 ------
NM_003338chr102473 394 ------
NM_003339chr511178 11468 1107 --
NM_003340chr421314 360 1147 3158 106 80 --
NM_003342chr1752991 2673 2579 2558 413 ----13248
NM_003347chr2221952 934 1286 1918 --
NM_003348chr1251314 1270 1136 1123 212 ------
NM_003352chr21144 ------
NM_003360chr4141 ------
NM_003368chr12182 87 1254 ----
NM_003369chr1142690 2463 1100 315 --1799 --
NM_003390chr1121064 393 1183 ----
NM_003392chr334120 2864 1476 11298 23394 623 --
NM_003400chr25771 736 689 556 196 ------
NM_003404chr201821 ----11511
NM_003406chr82649 208 162 21627 30 --
NM_003409chr1821431 1212 1990 ----
NM_003410chrX42071 2028 738 391 ----178
NM_003412chr342835 2303 881 676 1905 ----
NM_003413chrX21696 1274 11486 ----
NM_003418chr31566 ------
NM_003421chr1043090 2938 497 417 13432 ----
NM_003435chr19128 --1295 --
NM_003442chr11143 ------
NM_003452chr91973 --1765 --
NM_003458chr341322 883 835 664 12463 32971 2671 1347 13706
NM_003463chr652834 2607 2255 928 318 12294 11362 --
NM_003471chr332378 1477 209 11967 --1706
NM_003483chr1242549 2400 877 108 1628 ----
NM_003489chr2113050 2477 437 ----
NM_003537chr6121 ------
NM_003566chr1243243 2293 2129 190 ------
NM_003567chr1152 ------
NM_003574chr1834854 4821 547 13916 1514 1414
NM_003576chr1352742 960 857 760 49 ----12730
NM_003580chr81568 ------
NM_003583chr1233429 2680 111 --12974 --
NM_003590chr263188 2912 2840 314 216 201 13231 1570 13412
NM_003603chr431631 1594 1419 ------
NM_003607chr173437 2814 2800 2686 365 235 64 14056 1893 --
NM_003615chr333948 1327 308 23532 2985 ----
NM_003617chr1104882 4099 3873 3805 3352 1834 1783 1535 173 27 21743 1502 14813 11208
NM_003620chr172728 142 1903 --1991
NM_003628chr21744 ----1683
NM_003630chr61184 ------
NM_003632chr17----1216 1109
NM_003663chr343292 3026 2737 755 22728 1174 ----
NM_003671chr943271 3043 2966 489 ------
NM_003672chr131339 584 53 1621 ----
NM_003679chr173407 2726 2352 2274 1198 521 232 3607 588 558 ----
NM_003705chr21700 --1332 --
NM_003718chr71522 ------
NM_003722chr32889 290 11091 ----
NM_003732chr5------1103
NM_003743chr232148 883 309 11796 ----
NM_003744chr1411103 --11255 --
NM_003749chr1322299 213 ------
NM_003750chr102932 234 ------
NM_003758chr152507 26 11426 ----
NM_003758chr152507 26 11426 ----
NM_003759chr453807 3068 2988 1271 785 13889 ----
NM_003762chr121455 957 ------
NM_003763chr2053014 1974 1186 701 478 ------
NM_003768chr1138 ----1188
NM_003772chr112155 30 1808 ----
NM_003778chr31107 ------
NM_003787chr1821389 368 21347 518 ----
NM_003816chr841348 1090 471 401 ------
NM_003822chr122897 1079 1925 1739 12125
NM_003829chr911103 ----1149
NM_003831chr1811631 --1202 --
NM_003840chr862098 1731 435 419 360 35 --11552 --
NM_003846chr13809 576 59 --2591 79 1682
NM_003848chr3288 62 --1852 --
NM_003861chr1412243 --12442 --
NM_003870chr1521947 79 ------
NM_003872chr232674 2106 35 --2519 267 1647
NM_003873chr1011913 1274 ----
NM_003884chr3------1535
NM_003885chr1732560 707 143 ------
NM_003899chr13--11711 32311 975 257 --
NM_003913chr654028 3929 3548 3530 702 ------
NM_003916chrX21330 1216 1133 ----
NM_003930chr742395 287 147 117 11588 ----
NM_003941chr742540 817 259 157 ------
NM_003947chr341229 996 469 400 ------
NM_003958chr673737 3226 3022 2951 2668 2509 448 13519 --23857 3794
NM_003966chr5187628 7408 6745 6212 5398 4871 4784 4770 2978 2674 2640 2485 1962 1645 1502 1034 548 248 --36867 1983 1855 17823
NM_003968chr32569 458 ------
NM_003971chr171576 ------
NM_003994chr1253731 3660 3509 412 273 1212 --12892
NM_004006chrX32244 916 629 21757 814 ----
NM_004007chrX32244 916 629 21757 814 ----
NM_004009chrX32244 916 629 21757 814 ----
NM_004010chrX32244 916 629 21757 814 ----
NM_004011chrX32244 916 629 21757 814 ----
NM_004012chrX32244 916 629 21757 814 ----
NM_004013chrX32244 916 629 21757 814 ----
NM_004014chrX32244 916 629 21757 814 ----
NM_004015chrX32244 916 629 21757 814 ----
NM_004016chrX32158 830 543 21671 728 ----
NM_004017chrX32244 916 629 21757 814 ----
NM_004018chrX32158 830 543 21671 728 ----
NM_004020chrX32244 916 629 21757 814 ----
NM_004021chrX32158 830 543 21671 728 ----
NM_004022chrX32158 830 543 21671 728 ----
NM_004023chrX32158 830 543 21671 728 ----
NM_004024chr141527 407 396 261 1328 ----
NM_004081chrY21631 1486 11590 --1627
NM_004089chrX187 --21211 366 --
NM_004094chr1442846 2151 1133 227 32592 2072 1856 ----
NM_004096chr1052164 1345 690 570 172 --11636 --
NM_004105chr2----1910 --
NM_004112chr17----1699 --
NM_004124chr1451332 685 576 565 166 ----13406
NM_004130chr31120 ------
NM_004136chr1552955 591 544 452 110 22602 929 --1117
NM_004170chr931357 504 56 --21907 1407 --
NM_004171chr11169667 8612 8408 7383 7306 6529 6259 5963 3794 3280 2942 2796 2666 1686 1051 968 38162 3361 1083 13184 13112
NM_004172chr551387 465 189 101 69 11397 180 1612
NM_004183chr11------1741
NM_004215chr81599 ------
NM_004226chr2121 ------
NM_004229chrX82099 1634 1609 1552 1494 845 595 157 1171 21923 851 --
NM_004232chr1842787 2584 671 236 13783 ----
NM_004233chr631282 1015 595 ------
NM_004263chr221561 272 --11760 --
NM_004274chr1463141 3026 2846 2168 1265 33 --177 --
NM_004296chr1443937 3681 501 356 ----1297
NM_004298chr5121 ------
NM_004327chr223966 430 254 --1739 --
NM_004349chr82333 115 --162 1967
NM_004370chr631823 1412 596 --2817 524 11474
NM_004379chr241503 1391 1219 486 1145 ----
NM_004380chr1652373 2214 1845 1801 858 --12406 --
NM_004384chr531953 69 44 ------
NM_004385chr5130 ------
NM_004392chr1321701 735 --12430 --
NM_004397chr1163448 2914 2863 710 490 91 --33774 3323 414 11258
NM_004405chr21676 --2846 46 --
NM_004408chr91105 ------
NM_004423chr342536 2469 503 417 12277 32421 742 367 --
NM_004429chrX2413 407 ------
NM_004432chr921771 920 ------
NM_004437chr142252 990 762 180 --33630 1161 447 --
NM_004438chr252542 1163 530 408 246 --12247 149
NM_004458chrX31865 1770 105 --11685 --
NM_004459chr1752057 1882 501 491 436 ------
NM_004464chr434200 3478 540 44173 3980 2828 1089 23384 917 --
NM_004475chr172221 104 --1238 --
NM_004482chr22916 843 ------
NM_004498chr15----1354 --
NM_004500chr1442047 1537 1528 389 1342 21381 29 --
NM_004506chr6137 ------
NM_004529chr931063 355 183 --21451 1057 --
NM_004561chr112644 189 ------
NM_004563chr141154 --142 --
NM_004586chrX44457 1936 1460 918 ------
NM_004598chr523256 2681 --22995 2535 --
NM_004600chr1----1462 --
NM_004612chr943897 1790 514 326 ------
NM_004615chrX1330 ----1835
NM_004619chr142175 1984 1804 634 12109 ----
NM_004630chr1121030 794 ------
NM_004634chr32483 97 ------
NM_004637chr33982 859 312 ------
NM_004642chr12160 ------
NM_004643chr141815 ------
NM_004661chr531108 1029 920 ------
NM_004663chr151264 1162 --11209
NM_004673chr131460 1365 166 --11111 --
NM_004686chr851448 722 641 535 431 ------
NM_004687chr1751990 1501 1453 807 605 --11428 --
NM_004703chr1732200 546 414 --149 --
NM_004723chr11823 --1920 1385
NM_004726chrX24939 822 ----15579
NM_004734chr1353077 3011 2815 387 192 ----13238
NM_004738chr2042565 1693 733 565 ------
NM_004740chr17291 50 --1122 --
NM_004742chr32592 123 ------
NM_004745chr8126899 6629 6576 6488 6041 5518 4823 4278 2383 2239 1418 28 36461 5583 4564 36244 4842 1676 --
NM_004748chr1574079 3687 2819 1438 1426 1149 553 1545 ----
NM_004755chr142151 102 ----1158
NM_004757chr4194 --1486 --
NM_004768chr13827 83 48 ------
NM_004772chr53498 429 181 1459 ----
NM_004774chr1752836 2162 1123 891 375 --12394 --
NM_004776chr2043037 2183 1056 756 --22424 935 --
NM_004779chr54871 354 279 68 ------
NM_004796chr1422009 550 ------
NM_004798chr2033614 2529 1320 ------
NM_004800chr13149 ------
NM_004805chr231151 999 316 --1291 --
NM_004808chr1022850 187 ----12755
NM_004815chr194641 4469 4424 4050 3763 1975 1493 1028 143 33906 3434 971 14086 --
NM_004820chr8------162
NM_004831chr19----1423 --
NM_004834chr231240 970 177 12428 ----
NM_004841chr11854 --11159 --
NM_004857chr14104700 4118 4054 3388 1870 1779 1462 1216 1182 102 33889 3869 1131 ----
NM_004866chr563350 1475 1242 1021 537 400 24616 769 ----
NM_004869chr1821343 404 ------
NM_004871chr1722902 1353 ----14365
NM_004874chr81325 ------
NM_004893chr5------1120
NM_004898chr452336 1972 1137 878 368 --12620 --
NM_004902chr20154 --1171 --
NM_004904chr785848 5661 5350 5179 4959 4435 1822 300 1800 ----
NM_004906chr61493 ------
NM_004921chr132204 2078 630 2703 515 198 --
NM_004926chr1421173 521 ------
NM_004929chr821123 530 1123 1140 --
NM_004932chr531525 657 586 21446 70 ----
NM_004936chr952842 2778 2546 1978 191 ------
NM_004938chr93923 838 456 1403 3852 289 179 --
NM_004949chr1852103 1882 1740 420 320 ------
NM_004956chr754475 3807 3716 1834 1428 21555 1422 ----
NM_004961chrX31538 599 476 --11163 --
NM_004965chr21122 --1143 --
NM_004973chr621414 1227 ------
NM_004976chr1144817 4419 3987 1874 --23929 632 14100
NM_004985chr1264143 3655 1817 1604 507 353 11070 ----
NM_004992chrX127932 6264 6002 5515 3092 2955 2833 2107 2031 2013 1298 1252 12895 13085 12689
NM_004992chrX127932 6264 6002 5515 3092 2955 2833 2107 2031 2013 1298 1252 12895 13085 12689
NM_004999chr664440 4242 3141 1542 844 227 24411 2824 1272 --
NM_005006chr24952 931 720 293 ------
NM_005011chr7------11872
NM_005020chr73493 68 49 ------
NM_005028chr1021859 1793 11523 196 --
NM_005056chr1264968 2224 1971 1305 887 83 33970 1143 911 ----
NM_005065chr1444045 3707 3473 1994 --11464 --
NM_005087chr3----1551 --
NM_005093chr2074768 4280 4152 1202 898 848 714 --11060 13837
NM_005095chr142170 2045 1602 1467 ------
NM_005096chrX1474 --195 --
NM_005110chr5137 ------
NM_005114chr41469 --1559 --
NM_005126chr321774 280 11437 ----
NM_005135chr1563599 3525 1278 472 429 72 --13162 11192
NM_005151chr1862303 2065 1893 482 434 113 --12430 --
NM_005156chr954947 4666 4595 1372 361 14195 11721 --
NM_005159chr1521500 89 21542 283 22139 83 --
NM_005161chr1132251 1554 798 --32135 458 421 --
NM_005168chr21506 --1139 --
NM_005184chr1921299 362 --1208 11416
NM_005188chr11108121 7855 5689 3259 3160 3090 1835 1795 1767 873 11447 36038 3015 636 --
NM_005197chr1456132 5465 5032 4930 4479 15630 24246 513 --
NM_005220chr1731454 571 308 --11478 --
NM_005230chr12129 ------
NM_005233chr33866 495 60 --11722 --
NM_005235chr2127791 6917 6893 6810 6307 5924 5622 4955 3032 2724 2172 2024 36061 6057 1546 37777 7627 866 --
NM_005241chr311283 ----1118
NM_005245chr41192 1539 ----
NM_005256chr11--1220 --1954
NM_005264chr101908 ------
NM_005277chr44616 555 249 102 ------
NM_005329chr1632245 2186 1723 ------
NM_005337chr121348 ------
NM_005359chr18105351 4508 4013 2422 2378 1845 1833 350 276 32 45950 4059 835 549 25256 3978 --
NM_005369chrX156 --1246 --
NM_005370chr19----11321 --
NM_005373chr131501 1250 209 ------
NM_005374chr1731998 1808 1680 --11770 1665
NM_005389chr6----198 --
NM_005392chr9------11555
NM_005398chr1031232 1143 1026 ------
NM_005399chr172774 1280 1212 1186 958 565 455 ------
NM_005400chr242765 2185 969 227 2891 806 ----
NM_005402chr73635 519 25 ------
NM_005406chr1811477 ------
NM_005407chr1411279 --1211 --
NM_005418chr111142 --1575 --
NM_005429chr4124 ------
NM_005433chr1822668 2198 --12713 --
NM_005436chr1063747 3207 2813 712 421 320 13714 --140
NM_005460chr51389 ------
NM_005465chr142038 1320 335 32 --11628 --
NM_005475chr1243177 2759 2258 1052 1188 ----
NM_005497chr1796062 4558 4056 2458 1933 1717 1318 1248 277 15426 14635 1636
NM_005502chr983061 3015 2182 2145 1276 762 362 340 12752 13075 1421
NM_005504chr12126594 6346 5886 5464 5052 5023 4268 4250 4222 2285 1232 1047 35351 2515 436 35837 4351 2050 --
NM_005512chr1121681 1535 --11290 --
NM_005520chr5------1300
NM_005522chr731003 471 79 1202 1351 --
NM_005544chr23374 271 123 1168 ----
NM_005558chr13662 384 95 --1777 --
NM_005575chr52710 21 1159 ----
NM_005578chr375055 4336 3465 1956 1856 312 106 --21839 892 --
NM_005596chr975838 5569 5064 4636 2527 2227 1796 ------
NM_005599chr121164 346 ------
NM_005603chr1831252 532 96 --11577 --
NM_005610chr11319 ------
NM_005613chr142077 1845 1484 187 198 11603 --
NM_005625chr821044 156 --1197 --
NM_005637chr1821375 139 1814 ----
NM_005638chrX31765 599 169 2652 271 1406 --
NM_005639chr1241751 1596 1424 183 ------
NM_005647chrX53427 3353 2775 167 128 --12354 --
NM_005651chr42297 289 1322 ----
NM_005652chr1621087 465 ------
NM_005664chr152969 244 --1424 --
NM_005665chr144461 1939 1618 159 13666 ----
NM_005668chr574548 4357 3366 3008 2924 310 282 ------
NM_005684chr1164 ------
NM_005709chr111442 --1279 --
NM_005717chr12398 219 ------
NM_005722chr22955 273 ----173
NM_005724chr151554 ------
NM_005725chr131888 154 73 ------
NM_005739chr1552282 2174 1877 248 48 1631 ----
NM_005740chr22----151 --
NM_005748chr1223412 470 --12773 1904
NM_005754chr51906 1369 ----
NM_005756chrX2212 95 ------
NM_005788chr113671 584 144 ------
NM_005789chr171299 1763 12170 1150
NM_005797chr112249 200 --11443 --
NM_005808chr321409 681 12464 ----
NM_005819chr132832 1117 914 --2490 347 --
NM_005822chr621853 1495 ------
NM_005826chr1191 ------
NM_005828chr1735022 3912 712 --11555 1389
NM_005832chr33557 380 57 --1262 11277
NM_005840chrX85949 5492 5444 5205 2378 1943 641 538 --47341 6902 5696 68 --
NM_005843chr231506 286 211 ------
NM_005845chr1341736 1358 426 293 ----1148
NM_005851chr11174 ------
NM_005853chr161568 ------
NM_005863chr1031281 575 299 ------
NM_005868chr752417 2000 1633 553 195 1934 1577 11658
NM_005871chr105976 833 188 55 24 ------
NM_005895chr1243937 3418 3379 48 --12975 --
NM_005896chr22804 259 1699 ----
NM_005898chr1172560 2365 2333 828 584 222 129 --13153 --
NM_005901chr18108612 7634 5253 3247 1481 1444 1013 934 644 129 11742 ----
NM_005909chr523474 244 191 ----
NM_005910chr1754048 3569 2954 1206 204 --13784 11371
NM_005911chr2----1490 --
NM_005935chr4135263 4158 4020 3760 3409 3347 1719 1512 1463 1208 696 383 83 ------
NM_005941chr854189 3819 3609 3502 753 23390 239 --12996
NM_005943chr631313 1175 1126 ------
NM_005955chr165445 4936 3957 1588 1238 935 --11819 --
NM_005957chr124480 3820 --33559 870 862 --
NM_005962chr101567 12147 1670 --
NM_005962chr101567 12147 1670 --
NM_005964chr1731171 490 231 ------
NM_005966chr2--21995 229 --197
NM_005986chr1332793 2663 433 12854 11962 --
NM_006007chr943312 3092 1255 713 1571 12901 --
NM_006011chr1564265 3576 2854 2770 1262 1023 1202 13758 12898
NM_006016chr622158 151 ------
NM_006036chr24924 701 484 380 ------
NM_006047chr2063258 2577 596 466 354 284 12268 ----
NM_006055chr282720 2640 2618 2560 2491 2485 1272 1186 32159 1131 148 23045 2976 --
NM_006058chr5133 --1266 --
NM_006080chr762913 2785 2361 2138 2081 2026 1566 ----
NM_006095chr431239 1117 839 13357 1122 --
NM_006099chr1----2772 144 --
NM_006113chr141727 1448 1414 532 11530 ----
NM_006135chr11486 ------
NM_006136chr711005 11133 ----
NM_006148chr1752848 2822 2776 2472 604 ------
NM_006153chr3----1203 --
NM_006154chr1572726 2502 2493 2410 2280 1956 1923 --12561 --
NM_006166chr1232225 1058 657 ------
NM_006180chr911549 21873 172 --11403
NM_006183chr12296 39 ------
NM_006191chr122622 270 --141 --
NM_006194chr141489 ------
NM_006195chr931148 957 519 1217 ----
NM_006197chr831910 661 304 ----21691 22
NM_006203chr573911 1934 1226 653 302 190 100 --11664 11314
NM_006237chr1322058 104 ------
NM_006245chr61349 ------
NM_006252chr166583 4995 4970 3006 2929 897 27177 5543 --15228
NM_006256chr132279 1029 182 ------
NM_006258chr101986 ------
NM_006265chr821487 168 ------
NM_006266chr91121 ------
NM_006267chr251869 1212 692 450 29 ------
NM_006281chr821060 875 ------
NM_006281chr821060 875 ------
NM_006282chr2054740 4123 3544 1118 890 33818 1394 748 ----
NM_006283chr843855 3679 3407 312 14862 14800 175
NM_006298chr683384 2750 2717 2699 2674 2573 1278 1181 --1965 --
NM_006306chrX114792 4357 2034 2019 1604 1461 1309 561 533 275 248 44504 4500 547 527 2987 913 34370 1501 1372
NM_006315chr444310 1643 1537 220 23481 1713 ----
NM_006317chr51819 --1644 --
NM_006320chr43849 223 186 --1996 --
NM_006321chr332217 1555 818 ------
NM_006325chr123305 120 88 ------
NM_006364chr141306 ------
NM_006371chr365069 4908 4612 4586 1574 562 11034 1537 --
NM_006375chrX31683 1657 119 ------
NM_006380chr1744287 3959 971 587 --12739 --
NM_006386chr2222453 461 1330 --12273
NM_006389chr11127 ------
NM_006420chr202893 243 --11333 12909
NM_006449chr232177 2088 796 21972 1634 ----
NM_006451chr51803 1793 1306 --
NM_006457chr4103999 3944 3849 2655 1222 1026 926 852 445 274 ------
NM_006459chr1051752 1597 357 203 105 1482 11547 --
NM_006465chr15----2796 77 --
NM_006469chr1----11447 11175
NM_006482chr1233429 2680 111 --12974 --
NM_006489chr1452065 2037 1790 1439 663 11597 ----
NM_006496chr151873 1604 618 475 374 ------
NM_006516chr141517 1505 1451 1018 --11469 --
NM_006517chrX61781 1615 1543 1447 168 47 11733 1753 --
NM_006519chr6146 --189 --
NM_006526chr2042083 1524 478 75 ------
NM_006534chr2032674 2326 1041 ------
NM_006536chr13958 952 401 ------
NM_006538chr283976 3293 3191 2987 2675 901 733 173 --11233 --
NM_006546chr1744528 4362 2635 1158 ----15463
NM_006547chr742142 2072 1405 373 --11586 --
NM_006557chr931664 1474 1234 ------
NM_006561chr10125883 5840 4912 3839 2447 2410 1672 815 584 114 69 30 12049 14759 1219
NM_006570chr92259 127 1398 ----
NM_006572chr1753132 2620 1332 1098 186 ----12922
NM_006575chr14------11313
NM_006582chr1180 ------
NM_006587chr441497 1174 592 347 11064 ----
NM_006595chr1132018 362 118 --11893 --
NM_006599chr1686831 5879 5827 5292 5266 3219 2211 1430 27909 6714 ----
NM_006602chr201705 1640 --1190
NM_006603chrX21401 1285 1586 1693 --
NM_006609chr23801 446 337 150 ----
NM_006620chr694468 3799 3793 3384 3210 3199 3145 802 780 --23819 1503 1809
NM_006621chr13624 133 120 21404 143 ----
NM_006624chr1021766 736 21450 804 ----
NM_006626chr932023 135 87 22039 1092 1203 --
NM_006628chr15114059 4003 3402 3198 3006 2857 1813 1681 327 63 38 186 ----
NM_006629chr1842454 1872 1800 736 ------
NM_006636chr22644 365 ------
NM_006642chr1154 --1258 --
NM_006646chr1322944 2765 ------
NM_006650chr531008 668 172 ------
NM_006654chr1244638 3556 1815 1322 13304 1654 13334
NM_006658chr72252 89 1390 --1973
NM_006698chr2071122 553 506 494 352 278 145 ------
NM_006703chr6----1334 --
NM_006706chr52555 253 ------
NM_006710chr23837 206 27 1963 ----
NM_006717chr922537 1259 --23384 3237 --
NM_006718chr61933 ------
NM_006722chr323066 715 ------
NM_006727chr52488 119 ------
NM_006729chrX74847 4357 3783 1900 663 616 591 34583 3852 403 --11450
NM_006731chr985795 4795 4543 2263 2031 1436 828 140 35568 2254 769 13551 --
NM_006732chr1931538 1384 776 --1623 --
NM_006744chr10124 ------
NM_006751chr2--1661 --1214
NM_006759chr21215 ------
NM_006761chr17----1609 --
NM_006766chr822336 477 22181 1874 --1237
NM_006769chr1249 34 ------
NM_006772chr641672 1393 1243 314 ------
NM_006775chr652537 2326 1983 287 269 11180 11992 --
NM_006777chrX32833 2337 231 --1582 --
NM_006791chr15--1472 --1409
NM_006851chr121860 --1175 142
NM_006852chr1752066 915 670 552 170 --1729 --
NM_006854chr741850 1647 1546 191 --11954 --
NM_006856chr1261045 1007 795 727 221 67 1700 172 --
NM_006857chr21291 1338 140 --
NM_006861chr121739 --31656 1309 490 --
NM_006885chr1654248 4228 1324 993 973 13502 ----
NM_006888chr1443546 2983 1069 106 13078 ----
NM_006895chr231451 293 58 11499 21772 189 189
NM_006901chr152362 71 ----181
NM_006920chr221257 411 1766 ----
NM_006922chr21932 --12332 --
NM_006924chr1733306 2703 1330 ----14411
NM_006941chr2211079 ------
NM_006947chr431613 309 103 ------
NM_006948chr212831 718 --11955 --
NM_006950chrX1810 --1130 --
NM_006951chr101327 ------
NM_006965chr182913 896 ------
NM_006999chr5----1190 --
NM_007005chr93615 111 58 ------
NM_007008chr22187 31 ------
NM_007010chr1711292 ----11491
NM_007011chr1596119 5839 5805 5770 2643 1806 1780 1566 725 25981 2690 16045 --
NM_007013chr841006 217 161 88 1339 ----
NM_007029chr81113 ------
NM_007034chr11741 ------
NM_007042chr332449 1651 393 22629 34 ----
NM_007052chrX2598 69 ----1563
NM_007106chr1382840 2455 2040 828 789 390 321 144 --12545 --
NM_007114chr332354 1190 278 --12310 --
NM_007118chr52816 109 --125 --
NM_007125chrY11447 ------
NM_007146chr172613 186 ----11938
NM_007158chr1185 ------
NM_007159chr311525 ------
NM_007174chr125803 607 590 308 233 --22016 30 --
NM_007175chr863426 2789 2505 2469 347 274 13008 ----
NM_007181chr19----1142 --
NM_007203chr933985 3925 3168 13058 --13392
NM_007212chr122247 555 ------
NM_007216chr112897 384 1178 ----
NM_007222chr8----11735 --
NM_007236chr1532112 405 250 --190 --
NM_007238chr20104364 4329 3610 3274 3024 1957 1450 419 334 110 ------
NM_007245chr16------1763
NM_007249chr13188629 8577 8325 8285 7745 7636 5779 5748 5731 2894 2142 2067 1881 1818 844 693 605 402 36914 5706 3481 43266 2602 1478 726 --
NM_007250chrX------1393
NM_007270chr72578 338 --21523 1416 --
NM_007276chr7--11074 --1700
NM_007279chr191623 --169 --
NM_007350chr1254178 3420 3254 802 183 ------
NM_007372chr172734 149 ------
NM_007373chr1031425 399 59 --11214 --
NM_007375chr162790 2318 2193 696 544 305 ----1636
NM_012062chr121253 ------
NM_012069chrX2360 126 11733 ----
NM_012072chr2064427 4171 3558 1830 1300 932 1799 33585 2960 2892 --
NM_012081chr553593 2645 2591 1207 1147 12826 ----
NM_012095chr1032497 1349 1316 13395 --1345
NM_012098chr921551 95 --11175 --
NM_012104chr1143437 2529 1420 783 11122 22395 686 --
NM_012104chr1143437 2529 1420 783 11122 22395 686 --
NM_012117chr121116 ------
NM_012120chr652276 1870 919 672 525 ------
NM_012137chr162327 2034 1795 1004 946 283 22830 153 32809 2654 2382 --
NM_012141chr1343034 2914 1139 1089 12790 12713 --
NM_012158chr1311562 ------
NM_012164chr946461 5839 1216 278 35421 2445 1706 22965 592 --
NM_012199chr144584 4447 3851 3273 13471 22875 1558 1944
NM_012210chr941251 1134 1048 408 1553 ----
NM_012214chr256356 4289 2397 961 698 45203 4938 2033 1735 12355 25576 4267
NM_012215chr1051850 1677 1279 1271 371 ------
NM_012223chr221331 1270 1353 ----
NM_012224chr431109 442 56 1248 ----
NM_012234chr333397 3107 1426 22431 825 1679 --
NM_012243chr11869 ------
NM_012247chr104778 277 92 55 1240 ----
NM_012248chr161216 ------
NM_012250chr111885 --146 --
NM_012255chr20132 1314 ----
NM_012257chr721093 1007 ------
NM_012262chr164935 4105 3980 3622 1924 1077 23598 3189 21290 656 --
NM_012281chr751990 1875 1664 1602 666 ------
NM_012282chrX2808 675 --3104 49 40 --
NM_012287chr364310 3960 3278 2777 843 386 14037 ----
NM_012288chr6125429 5135 5081 5042 3664 1908 1809 1741 1384 1106 1017 370 --14173 --
NM_012297chr44916 497 466 44 12381 1543 --
NM_012300chr521949 252 ------
NM_012301chr751702 1592 1545 1407 900 22019 347 ----
NM_012302chr121182 787 ------
NM_012311chr101455 ------
NM_012316chr164172 4068 3720 2170 434 397 13746 ----
NM_012333chr141521 1065 372 244 ------
NM_012334chr573525 3045 2901 1821 1158 1020 569 14614 ----
NM_012340chr201188 ------
NM_012343chr52820 277 ------
NM_012397chr1851751 1718 1206 559 232 2579 79 ----
NM_012414chr11602 ------
NM_012416chr911138 ------
NM_012417chr171593 ------
NM_012419chr6----1236 --
NM_012433chr21248 --1272 --
NM_012446chr52594 77 ------
NM_012448chr17133 --1666 --
NM_012460chr14----171 --
NM_012473chr223502 468 235 ------
NM_012479chr71392 --1421 3691 514 343
NM_012482chr12659 465 ------
NM_012484chr54705 288 258 34 --1216 --
NM_013230chrY1102 1709 ----
NM_013236chr224500 394 374 55 2992 920 ----
NM_013238chr1351717 1470 1248 390 120 1706 1716 --
NM_013243chr15--11017 1305 1325
NM_013255chr7138683 8114 7245 6940 6430 6126 5553 2871 2605 2578 2114 1995 505 68692 8056 6140 3547 3487 880 23558 187 --
NM_013257chr821858 103 ----12306
NM_013261chr443019 2872 2829 872 ------
NM_013269chr1244396 3343 3327 1279 ------
NM_013283chr52676 322 ------
NM_013302chr1634475 3902 1419 13474 ----
NM_013341chr232671 2240 939 12769 ----
NM_013351chr171725 ------
NM_013374chr332240 550 516 11928 22053 936 --
NM_013381chr121618 31740 875 182 ----
NM_013410chr111235 21286 39 ----
NM_013411chr122565 37 1764 12234 11992
NM_013437chr831144 304 259 11136 ----
NM_013444chrX21127 833 ------
NM_013446chr73931 322 279 --11090 --
NM_013447chr1943739 3575 1309 206 13733 ----
NM_013449chr1242712 2557 1120 313 --12266 1595
NM_014011chr231644 1604 1015 12049 ----
NM_014016chr311318 1111 ----
NM_014028chr633158 3096 1041 ------
NM_014048chr1623884 3438 45063 4740 2034 1038 14021 24109 249
NM_014057chr921519 108 --1449 11451
NM_014089chr1321731 46 ------
NM_014106chr1521158 1110 --11983 1311
NM_014112chr843358 3338 1824 534 ----1116
NM_014117chr1612604 --11083 --
NM_014141chr755377 4845 1890 1324 1215 14804 ----
NM_014155chr1177558 6943 5900 5653 5570 2894 1854 11700 --16949
NM_014181chr242137 1081 899 276 ------
NM_014217chr121318 482 1139 ----
NM_014243chr43191 165 110 ----11987
NM_014251chr7184 1147 1815 --
NM_014252chr13153 ------
NM_014253chrX31595 815 358 --11920 --
NM_014263chr1021254 169 21372 151 21236 91 --
NM_014294chr821180 1144 ------
NM_014302chr7127 ------
NM_014309chr2254664 4312 1206 726 630 ------
NM_014325chr1251464 887 803 694 568 ----11744
NM_014331chr4127641 7436 6716 6341 5862 4856 4787 2605 2470 1851 806 296 37707 1237 697 ----
NM_014345chr6----2904 90 --
NM_014361chr11------1166
NM_014379chr821024 690 1143 1110 --
NM_014393chr831718 168 53 --176 --
NM_014411chr732011 266 258 --11599 --
NM_014415chr341562 1553 1327 554 ------
NM_014445chr34972 875 164 141 22235 2168 156 --
NM_014456chr102510 285 ------
NM_014458chr131183 1078 542 --1249 --
NM_014470chr12----1540 --
NM_014494chr1641905 1792 422 269 ------
NM_014498chr31293 ------
NM_014500chrX1297 ------
NM_014517chr341841 1802 1560 1407 11256 ----
NM_014548chr1551654 1646 1551 1063 575 11049 ----
NM_014574chr1431260 439 166 ------
NM_014585chr241205 1180 482 341 ------
NM_014592chr5----1259 --
NM_014606chr421262 996 --1398 --
NM_014607chr241763 1743 1346 456 ------
NM_014612chr931347 1318 510 ------
NM_014614chr251295 1157 318 112 36 1381 ----
NM_014629chr821351 324 ------
NM_014636chr973874 1696 1661 1259 1010 739 573 43906 3335 3323 2760 1213 --
NM_014647chr163634 378 121 12015 ----
NM_014660chr731038 936 285 --125 --
NM_014670chr231211 635 473 ------
NM_014676chr12453 406 11223 128 --
NM_014683chr1731485 357 345 11831 --1423
NM_014686chr191990 ------
NM_014690chr722496 1935 22178 167 22113 471 --
NM_014694chr9------1624
NM_014701chr1553171 3006 2500 642 68 --13250 --
NM_014702chr633111 2917 207 ------
NM_014705chr721306 226 ------
NM_014707chr742047 1623 649 253 ------
NM_014711chr1662127 1730 434 368 211 108 ------
NM_014713chr21430 ------
NM_014720chr1031700 248 49 11138 160 --
NM_014721chr6107495 6841 6448 6161 5089 4818 4685 2046 262 39 --25719 1184 --
NM_014726chr17------11216
NM_014729chr81652 --21556 492 --
NM_014730chr1254225 3382 798 555 293 11505 1207 1173
NM_014730chr1254225 3382 798 555 293 11505 1207 1173
NM_014735chrX31914 584 378 ------
NM_014743chr443061 2536 983 912 ------
NM_014746chr223684 957 --2816 751 --
NM_014747chr155289 1764 1606 1175 793 25187 3887 45058 4891 942 134 --
NM_014755chr243215 1560 1416 928 1171 ----
NM_014758chr1112462 1480 12106 --
NM_014764chr1211058 11154 1971 --
NM_014770chr12----1508 --
NM_014771chr162867 778 ------
NM_014774chr142989 2266 777 306 22732 819 12468 --
NM_014776chr1283059 2743 2510 2422 1044 995 844 656 1931 12460 --
NM_014781chr81179 ----164
NM_014787chr142154 1929 914 146 ----11805
NM_014795chr231280 989 495 ------
NM_014802chr12141 ------
NM_014803chr103817 734 418 ------
NM_014810chr133268 1402 1068 --22622 770 --
NM_014812chr131931 471 408 ------
NM_014819chr541949 904 290 259 ------
NM_014820chr321976 1915 ------
NM_014822chr41104 ------
NM_014824chr112812 710 --3426 401 316 --
NM_014826chr173437 2814 2800 2686 365 235 64 14056 1893 --
NM_014828chr1452493 2306 885 566 98 12434 ----
NM_014832chr1342068 1910 1394 156 ------
NM_014836chr1021726 490 1766 21415 1235 --
NM_014838chr2231127 1086 732 ----11914
NM_014839chr112570 ------
NM_014840chr1273305 3068 2615 2598 2240 667 628 1341 ----
NM_014844chr1432979 2633 1101 1144 --1294
NM_014850chr323178 1716 13935 13276 --
NM_014860chr221637 520 32662 1724 1720 1665 2945 625
NM_014864chr164224 3976 3585 2795 1113 943 11571 34064 3784 238 11756
NM_014869chr351501 1059 1038 582 478 ------
NM_014872chr912013 11472 --12074
NM_014873chr193691 3378 1953 1894 682 670 366 286 136 ------
NM_014877chr1767709 7531 7406 7293 7109 1103 22065 79 12449 17502
NM_014883chr42700 631 11867 --1333
NM_014887chr132635 609 ------
NM_014897chr1743156 2884 1156 1074 22899 195 ----
NM_014904chr1053908 3703 3123 1486 635 13718 --13444
NM_014909chr1433920 3754 397 --43926 3884 3400 2892 --
NM_014912chr102976 313 11001 11382 --
NM_014918chr1561603 1541 1131 1107 1071 489 ------
NM_014924chr1432763 906 836 ----12508
NM_014926chr32912 459 ------
NM_014932chr321777 1335 1234 1682 11976
NM_014938chr1232408 930 710 --12165 --
NM_014939chr1811347 ----1618
NM_014949chr11733 --11010 --
NM_014951chr1042517 2076 1628 374 22005 1716 1594 --
NM_014953chr1324167 1484 --1298 --
NM_014961chr421613 745 12216 ----
NM_014988chr432112 938 677 21985 1880 ----
NM_014990chr1421350 517 11274 ----
NM_014991chr42962 321 42670 2646 2642 1143 1340 --
NM_014992chr144692 282 110 34 ------
NM_014999chr1221580 1118 ----11351
NM_015000chr1212266 --22215 2127 --
NM_015001chr11811 ------
NM_015002chr1221706 321 ----22298 786
NM_015008chr352812 2767 2622 626 409 1185 ----
NM_015009chr31752 ------
NM_015017chr12117 109 ------
NM_015020chr1643813 3645 784 738 23749 958 ----
NM_015023chr121389 1120 ------
NM_015025chr21827 ----12337
NM_015026chr1254573 4496 4203 847 837 13895 ----
NM_015039chr152793 946 634 179 91 23993 2879 --23800 1637
NM_015042chr1552833 2808 1478 1085 109 11063 34266 3086 2744 --
NM_015044chr1633213 280 270 22288 390 2798 786 --
NM_015045chr103472 116 106 ------
NM_015057chr132645 44 ------
NM_015064chr1293291 3010 2943 2805 2706 2653 2286 1439 474 32490 1010 46 13260 --
NM_015068chr731107 1092 239 23339 3221 ----
NM_015071chr554886 4653 1467 296 174 25732 5242 1162 --
NM_015074chr154552 3693 3475 1763 60 13634 13142 --
NM_015075chrX2652 186 --21662 94 --
NM_015076chr642974 1740 1577 724 1697 13606 --
NM_015086chr12----21462 124 11322
NM_015091chr142275 180 ------
NM_015093chr621732 196 ------
NM_015097chr362226 1829 1748 722 265 60 ------
NM_015110chr942458 1619 1532 518 1247 ----
NM_015113chr1732271 1681 33 ----172
NM_015115chr412533 --12912 --
NM_015132chr721397 770 11255 1157 1164
NM_015137chr822478 2298 11800 1558 --
NM_015138chr1552587 2199 738 485 134 1249 ----
NM_015141chr362701 2168 942 673 384 106 --1230 --
NM_015149chr152170 1951 885 759 224 ------
NM_015153chr62557 174 ------
NM_015155chr1032856 1036 279 13319 ----
NM_015156chr1453683 3226 3187 1324 45 13144 --12796
NM_015161chr1641148 496 346 227 --1503 --
NM_015191chr1152709 2575 2394 2099 638 ------
NM_015192chr2033013 1993 499 ------
NM_015199chr312341 12035 22924 2764 --
NM_015200chr421030 715 1412 ----
NM_015206chr1562994 2973 2458 1346 1149 540 23125 1281 1720 --
NM_015208chr1843491 3195 920 737 ------
NM_015215chr12773 545 ----1996
NM_015216chr521075 1047 ------
NM_015225chr912955 --12334 12293
NM_015230chr431866 1752 585 ------
NM_015236chr431468 1110 287 ------
NM_015247chr1645181 4635 1350 1027 1714 11406 11769
NM_015250chr931752 1485 331 ------
NM_015252chr23711 341 73 ------
NM_015271chr434115 1739 1521 11243 --22851 167
NM_015272chr1651781 1484 672 409 399 ----11649
NM_015278chr671193 1124 762 730 474 389 80 13448 ----
NM_015282chr232671 826 77 11996 1886 --
NM_015285chr1832306 2260 2177 2769 48 1691 --
NM_015286chr1532123 573 533 12449 1842 --
NM_015299chr1423921 3609 --13370 --
NM_015310chr888199 7962 7134 6675 3318 3005 2817 861 22077 1250 ----
NM_015313chr1121553 356 54573 4214 3882 3803 3414 --11792
NM_015315chr573243 2672 2615 2388 1236 521 319 13410 ----
NM_015317chr212376 1137 12484 --
NM_015328chr763012 2384 1922 1133 1121 279 13000 ----
NM_015335chr1232015 1857 1006 12618 ----
NM_015346chr1411743 ------
NM_015347chr1272667 2302 2102 1985 901 568 228 12413 ----
NM_015349chr652573 2147 2133 253 129 ------
NM_015355chr1731267 617 57 11434 ----
NM_015365chrX43392 3354 2873 704 --11371 --
NM_015367chr2231520 551 181 --1605 --
NM_015387chr251915 1380 731 716 303 ------
NM_015393chr443504 3490 2584 1256 11419 --158
NM_015396chr32157 70 ------
NM_015401chr122718 148 ------
NM_015404chr9172 --1499 --
NM_015415chr11193 ------
NM_015419chrX2456 342 1248 ----
NM_015429chr341093 1044 974 30 ------
NM_015435chr81542 ------
NM_015436chr442665 912 890 178 32181 760 87 --12469
NM_015441chr11327 ------
NM_015446chr141704 1028 338 329 ------
NM_015447chr92819 782 1105 2616 191 --
NM_015457chr111923 ------
NM_015460chr32705 619 11569 --1159
NM_015484chr11779 1846 ----
NM_015488chr271648 1542 687 227 121 78 66 --1366 --
NM_015509chr122365 245 --1333 --
NM_015520chr312544 ------
NM_015535chr272981 2764 1306 708 252 212 119 ------
NM_015541chr3----194 --
NM_015548chr61707 --1883 --
NM_015550chr711165 23473 1157 13598 --
NM_015553chr675047 4647 1412 1332 1321 710 177 --15003 1619
NM_015555chr631724 1629 1322 ------
NM_015564chr542864 2761 2647 690 ------
NM_015569chr154417 4060 965 338 138 13806 34109 625 146 --
NM_015575chr252819 2727 2312 974 125 21110 301 12350 --
NM_015576chr342981 486 331 147 1798 1451 1965
NM_015578chr1921908 305 --1196 --
NM_015602chr111608 2496 151 11366 --
NM_015627chr111493 --11266 --
NM_015630chr21242 147 ----
NM_015640chr145146 3503 1853 690 21949 112 ----
NM_015652chr10187 ------
NM_015660chr72266 224 ------
NM_015678chr1341606 1525 1112 87 11421 ----
NM_015686chrX11779 11711 --1210
NM_015695chr621900 469 --1615 --
NM_015719chr193729 142 128 ------
NM_015832chr18----1159 --
NM_015840chr162213 1750 1688 944 161 74 ------
NM_015841chr162213 1750 1688 944 161 74 ------
NM_015872chr1----21620 146 --
NM_015879chr18118585 6763 6205 5329 2791 2240 1622 1386 1347 726 303 15308 76254 5751 5261 3328 2444 1538 454 11558
NM_015892chr102956 714 --12202 --
NM_015894chr20------11561
NM_015902chr81616 ------
NM_015906chr154515 4022 3413 3090 545 --11233 --
NM_015912chr852487 2314 2092 2025 2008 1239 ----
NM_015913chr1124 180 1111 --
NM_015933chr33206 176 43 ------
NM_015952chr61133 ------
NM_015955chr21174 ------
NM_015957chr111356 ------
NM_015986chr173515 355 95 ------
NM_015995chr1535374 4931 988 14151 15008 --
NM_016009chr143416 3336 1214 367 24691 1080 14568 --
NM_016018chr832175 1808 676 2111 61 12788 --
NM_016021chr632814 269 111 1477 1504 --
NM_016025chr1611275 11251 21743 307 1723
NM_016040chr132700 2365 1095 ------
NM_016057chr123184 98 27 2480 68 1399 --
NM_016072chr123815 631 25 1742 --11514
NM_016075chr1343173 2639 2630 2117 ------
NM_016076chr152340 2071 1076 1049 650 23128 219 22616 718 12245
NM_016083chr653927 2874 2703 2674 141 1720 ----
NM_016096chr872127 1864 1360 535 393 288 130 ------
NM_016099chr841315 1116 362 94 11267 ----
NM_016104chr61133 ------
NM_016107chr52940 545 164 ----
NM_016127chr8151 1526 ----
NM_016131chr262298 1536 955 470 285 149 1585 1111 --
NM_016132chr1553255 2811 2679 2142 2103 1211 ----
NM_016133chr221025 188 ------
NM_016144chr53126 45 26 ------
NM_016205chr42931 119 ------
NM_016206chr377348 3278 2969 2947 1824 542 358 48037 7899 2221 1000 1215 22212 2147
NM_016221chr532246 1880 613 1470 11570 --
NM_016235chr1631213 401 319 ------
NM_016252chr23927 764 380 ------
NM_016255chr663217 2555 2415 1163 1144 358 --23061 412 --
NM_016257chr153510 3121 2592 2396 674 1493 12161 13083
NM_016260chr257037 5135 2901 2476 1871 11105 ----
NM_016263chr1941189 751 339 153 ------
NM_016271chr1831967 855 163 ------
NM_016272chr221683 --11866 --
NM_016275chr332016 1855 1750 --22082 912 --
NM_016281chr1231193 957 363 ------
NM_016289chr222315 794 --11920 --
NM_016308chr131935 1775 1565 ------
NM_016312chr121381 1184 ----
NM_016322chr962992 2891 2565 626 75 26 ----12999
NM_016334chr11405 ------
NM_016338chr5----1394 --
NM_016340chr52973 97 ------
NM_016356chr642880 2682 2471 2393 12601 ----
NM_016376chr1784250 4202 3770 2734 1521 1239 714 225 --1707 --
NM_016396chr1552860 2524 2257 422 122 12481 ----
NM_016448chr141847 602 348 290 21438 1294 ----
NM_016475chr141501 1998 ----
NM_016485chr62658 158 ------
NM_016489chr7262 54 ------
NM_016507chr1722034 102 --33062 2345 643 --
NM_016516chr22240 29 ------
NM_016519chr41487 ------
NM_016530chr1533366 2919 713 --1610 --
NM_016531chr484057 3102 2809 1639 1594 1081 563 526 2885 140 ----
NM_016544chr253039 2797 1543 1531 380 1112 1260 --
NM_016559chr321420 1120 --11522 --
NM_016577chr364265 3473 3334 3063 1296 422 13912 23578 1711 --
NM_016587chr7--11074 --1700
NM_016596chr122718 148 ------
NM_016603chr54763 364 301 114 ------
NM_016607chrX41331 677 470 280 ------
NM_016608chrX1373 ------
NM_016625chr32388 125 ------
NM_016626chr181615 ------
NM_016631chr211409 ----1731
NM_016821chr33507 449 57 ------
NM_016823chr171378 --1506 --
NM_016824chr1031559 174 167 ------
NM_016827chr33753 528 28 ----1193
NM_016829chr33808 583 83 ----1248
NM_016834chr1754048 3569 2954 1206 204 --13784 11371
NM_016835chr1754048 3569 2954 1206 204 --13784 11371
NM_016841chr1754048 3569 2954 1206 204 --13784 11371
NM_016929chr6114222 3976 3724 3367 3311 3073 1581 1443 1375 1360 426 24292 3949 1121 --
NM_016936chr1621864 674 11471 21605 1463 --
NM_016952chr1134092 2596 1232 1476 13260 23004 2616
NM_016954chrX1150 ------
NM_017410chr1221154 340 --1392 --
NM_017423chr421701 176 11381 ----
NM_017426chr41153 --1469 --
NM_017488chr221396 1040 ------
NM_017548chr351882 632 449 355 68 ------
NM_017582chr131679 1354 103 --1476 11828
NM_017594chr932868 2355 2311 22397 347 13001 --
NM_017628chr4104725 4419 4029 3767 3666 3336 3249 1958 1150 515 55236 4789 3696 1723 1131 22118 1236 --
NM_017634chr861359 1235 767 682 210 51 11698 ----
NM_017637chr998191 7863 7210 6140 3526 3430 1965 1305 871 --69082 8322 6666 3411 2807 1327 --
NM_017641chr121919 ----1373
NM_017643chr1742149 965 690 596 ------
NM_017644chr351674 1373 1111 1071 768 ------
NM_017650chr754001 2065 987 726 602 35423 1770 1402 15001 --
NM_017651chr6----11371 --
NM_017658chr1433795 3501 553 14183 ----
NM_017679chr172593 101 ------
NM_017693chr1321641 539 ------
NM_017694chr241617 577 205 135 1437 ----
NM_017703chr19139 ------
NM_017709chr131651 1271 871 23486 578 --12974
NM_017714chr203674 311 284 ------
NM_017736chr1642852 2377 939 340 --12276 --
NM_017740chr1611416 11764 180 --
NM_017778chr831035 476 21 ------
NM_017787chr1011944 --1240 --
NM_017790chr93540 415 126 1630 --1442
NM_017798chr204878 463 229 87 --1348 --
NM_017799chr1441665 200 111 29 11935 11731 --
NM_017801chr361966 1041 1009 320 305 220 21823 386 11596 --
NM_017811chr942730 2142 1076 508 ------
NM_017813chr885788 5196 4866 4452 4125 1722 851 419 11648 14795 --
NM_017824chr1032563 756 157 --135 --
NM_017831chr1834681 4244 4086 13343 ----
NM_017836chr32534 29 ------
NM_017845chr41256 ------
NM_017847chr132085 1451 765 131 ----
NM_017848chrX53943 3745 3264 2994 387 21881 758 ----
NM_017866chr81763 ------
NM_017880chr2----1290 --
NM_017902chr1044624 4614 3623 1565 11483 --11250
NM_017907chr112528 39 ------
NM_017910chr2----1263 --
NM_017913chr91459 ------
NM_017919chr993785 3663 2281 2215 2055 1608 1372 847 838 ------
NM_017933chr231614 1085 265 1643 ----
NM_017935chr42243 165 ------
NM_017938chrX31835 1790 1493 ----11553
NM_017944chr1132699 2382 445 2817 725 ----
NM_017952chr274477 4336 3916 3200 1297 946 409 13942 ----
NM_017958chr232668 2337 111 --21975 223 --
NM_018026chr112969 958 11440 21313 1138 --
NM_018027chr1042729 1231 1111 167 12946 ----
NM_018030chr182968 88 1991 ----
NM_018061chr131764 1168 641 ------
NM_018084chr262217 1190 951 816 364 188 22553 386 ----
NM_018092chr1641496 1140 1051 220 ------
NM_018096chr171693 ------
NM_018120chr821337 343 ------
NM_018128chr1721013 515 ------
NM_018131chr102743 199 ------
NM_018133chr33651 582 293 ------
NM_018155chr332669 2497 1350 ------
NM_018157chr1272920 2585 2395 2306 1118 247 128 1898 ----
NM_018195chr1111903 ------
NM_018198chr111315 ------
NM_018201chr912480 --1744 --
NM_018206chr161303 ------
NM_018211chr121570 57 21789 76 --1873
NM_018221chr23309 145 59 140 ----
NM_018237chr101279 ------
NM_018241chr42968 909 --1815 --
NM_018246chr851778 654 535 114 71 12811 --12000
NM_018247chr673094 2714 1011 867 813 478 26 22364 545 11927 --
NM_018254chr131695 1686 731 --160 --
NM_018263chr242623 2377 1707 850 ------
NM_018266chr31342 11070 1270 --
NM_018270chr20------1603
NM_018293chr332951 2378 1817 11021 ----
NM_018310chr8126 ------
NM_018312chr1132096 1942 844 ------
NM_018327chr2021755 1201 --1471 --
NM_018330chr1021578 538 ------
NM_018332chr1611388 --1545 --
NM_018343chr51123 ------
NM_018348chr162422 131 1121 ----
NM_018351chr1284420 4372 4256 4078 3950 3800 124 49 34104 3526 1593 ----
NM_018361chr864080 3727 3537 1618 589 441 1973 ----
NM_018362chr1132962 2885 805 ----23619 477
NM_018364chr143360 2645 1058 697 2688 681 1191 --
NM_018368chr6199 ------
NM_018371chr831468 578 319 21384 1235 --1978
NM_018373chr1464064 4040 4019 2562 1305 701 26329 5042 1828 --
NM_018374chr774868 4754 3236 1815 1802 795 543 ------
NM_018388chrX3988 915 375 ------
NM_018398chr32248 127 ------
NM_018403chr364084 3265 1575 277 127 58 13764 ----
NM_018424chr971868 1713 1648 1564 1447 444 200 ------
NM_018429chr542460 2351 2299 187 ------
NM_018439chr1852147 1061 521 445 157 2593 244 ----
NM_018440chr8108684 7112 5720 2850 2772 2335 2245 1778 1631 473 18482 46863 856 789 293 --
NM_018442chr11311 ------
NM_018448chr1241231 964 939 379 ------
NM_018449chr92528 498 --138 --
NM_018452chr6_random53405 3348 3329 783 149 22792 1452 ----
NM_018482chr81684 11892 12485 --
NM_018490chr112434 77 --171 --
NM_018566chr154526 4379 4002 1151 566 --31912 1093 688 --
NM_018569chr41189 ------
NM_018638chr1243815 1474 999 972 13674 --15496
NM_018640chr1222767 681 12802 ----
NM_018650chr12584 562 11667 1913 --
NM_018652chr152142 82 ------
NM_018682chr73581 458 142 ------
NM_018685chr731058 247 43 21109 184 ----
NM_018704chr161792 1769 1661 1372 1312 326 148 1829 --
NM_018710chr841287 1204 155 83 ------
NM_018712chr1141570 986 133 45 1191 2447 364 --
NM_018834chr51401 ------
NM_018841chr183940 3931 3401 2698 2677 1183 670 487 ------
NM_018847chr91314 ------
NM_018945chr642666 1048 984 722 33090 1350 580 --12640
NM_018958chr1542854 1090 91 62 --13826 --
NM_018970chr732864 2010 846 --22650 1275 23182 644
NM_018976chr1232264 764 184 1802 ----
NM_018979chr1222325 1963 11061 ----
NM_018999chr1073864 3480 3298 701 400 194 108 1992 13053 --
NM_019001chr364765 4660 4270 1789 1307 1019 24455 655 ----
NM_019008chr2272922 2668 2491 1388 1096 860 801 --11446 --
NM_019022chr1842926 2395 2322 726 12970 11136 --
NM_019027chr432365 1913 240 --32035 1803 723 --
NM_019049chr12558 537 1666 ----
NM_019063chr251816 1512 1467 890 684 ----1393
NM_019072chr524137 3320 ------
NM_019083chr131085 127 25 21637 228 ----
NM_019084chr10------1386
NM_019087chr52553 60 --21750 134 --
NM_019094chr1253784 2828 1156 583 68 --11016 1379
NM_019102chr71128 ------
NM_019102chr71128 ------
NM_019106chr2242572 2487 2443 845 23257 2383 --12298
NM_019116chr1663762 3406 1264 1105 621 551 --11452 --
NM_019593chr2032611 2160 63 1535 22879 2310 --
NM_019609chr20197 ------
NM_019610chr121747 383 ----11412
NM_019843chr22166 ------
NM_019848chrX123 ------
NM_019903chr1031559 174 167 ------
NM_020122chr256029 4211 3810 1428 647 11534 43979 3974 2215 685 15189
NM_020141chr162195 1675 567 362 336 312 1961 ----
NM_020150chr104683 677 498 146 --22165 1602 --
NM_020177chr55970 836 807 263 120 ------
NM_020178chr17--21012 907 --2311 114
NM_020188chr161266 ------
NM_020193chr1111318 1882 ----
NM_020205chr143224 2960 686 62 ----1737
NM_020225chr4----133 --
NM_020226chr42748 715 ----1185
NM_020228chr1132315 2085 168 32231 905 564 --1137
NM_020239chr121798 691 --42180 1900 1537 697 --
NM_020240chr552686 2570 2246 814 681 --1851 --
NM_020245chr673814 3616 3416 3289 1823 788 373 33556 3185 826 24920 1394 --
NM_020309chr19----152 --
NM_020336chr2043888 3763 1235 626 31495 889 511 13525 --
NM_020337chr452963 806 779 759 739 --1675 --
NM_020346chr1131751 1607 295 1208 1324 --
NM_020347chr332026 1498 196 --1298 --
NM_020390chr354908 3799 1535 301 103 --13515 --
NM_020420chrY21631 1486 11590 --1627
NM_020432chr711543 --1818 --
NM_020441chr112302 26 ------
NM_020443chr166991 6923 4743 4232 2579 1394 25100 1711 14825 15573
NM_020449chrX1689 ------
NM_020455chr64886 623 484 23 ----173
NM_020463chr2------11153
NM_020473chrX1661 1133 ----
NM_020474chr1821428 652 ------
NM_020532chr22187 31 ------
NM_020546chr552884 2651 2281 599 460 --31982 506 382 --
NM_020640chr35830 352 324 246 169 ------
NM_020644chr11----1748 --
NM_020673chr20116467 6387 5573 5501 2949 2412 2406 2264 2024 1315 528 11404 22185 620 16830
NM_020690chr5------1128
NM_020699chr194923 4717 4469 4444 4206 3353 922 59 43 --15221 --
NM_020704chr741609 800 418 341 32519 1941 810 1614 --
NM_020718chr1686193 5858 5102 4371 2158 2134 1194 1162 26004 2098 35571 1947 1023 15591
NM_020728chr731207 1010 467 --12541 --
NM_020734chr1253089 3033 2591 2131 2077 23136 2249 ----
NM_020739chr1574079 3687 2819 1438 1426 1149 553 1545 ----
NM_020742chrX62149 2029 1679 887 179 159 ------
NM_020748chr1742013 1578 769 273 ------
NM_020749chr831828 1697 1288 1598 ----
NM_020752chr1031895 985 500 --1945 --
NM_020766chrX34329 3144 148 23016 1017 11301 --
NM_020772chr1778552 8019 7852 7316 5580 1272 968 18104 16555 --
NM_020774chr1895703 5274 5209 2372 2276 1427 865 371 360 36049 5025 2463 ----
NM_020776chr1853089 3017 2231 305 151 12777 31137 461 452 12522
NM_020779chr272417 2288 2117 1162 949 609 114 ----12539
NM_020783chr1832129 1661 320 1396 ----
NM_020791chr1741255 1106 563 431 --1963 --
NM_020794chr111311 ------
NM_020806chr14----1326 --
NM_020810chr1441114 710 657 641 ------
NM_020819chr6--1138 --140
NM_020824chr102496 120 ------
NM_020826chr1173337 3163 2950 2514 1448 877 136 13042 2219 80 --
NM_020834chr1441898 1407 1283 564 ------
NM_020856chr191377 ------
NM_020860chr43394 201 52 ------
NM_020861chr631326 487 31 --1935 --
NM_020865chr3150 ------
NM_020866chr132951 424 ----1360
NM_020870chr442063 1867 1714 1592 ------
NM_020871chrX32214 1633 851 11807 ----
NM_020873chr31228 ------
NM_020899chr1721696 529 ------
NM_020918chr1042768 2289 1340 524 23282 460 --1836
NM_020921chr1473578 3295 3228 2276 2270 1382 983 --12700 --
NM_020935chr293511 3417 3083 1802 1652 854 795 454 210 13944 --13989
NM_020940chr1032084 1899 464 ------
NM_020948chr143453 628 332 254 21365 275 12495 1882
NM_020951chr1942317 1696 444 129 21988 512 32304 2082 245 --
NM_020962chr1552415 2373 1885 1858 795 ------
NM_020975chr1041828 1813 767 641 ----11414
NM_020977chr421762 1717 ------
NM_020981chr21214 ----1617
NM_021005chr151248 ------
NM_021007chr222344 1820 1874 --2689 578
NM_021033chr1333328 3162 266 13270 ----
NM_021038chr333217 3196 1113 ------
NM_021069chr431631 1594 1419 ------
NM_021079chr1753173 781 729 505 422 12358 22322 962 1539
NM_021097chr273051 2690 2558 2060 756 569 545 13059 ----
NM_021120chrX73145 2878 2812 2564 751 617 70 ----1218
NM_021129chr10147 ----1108
NM_021136chr14171 ------
NM_021140chrX1334 ------
NM_021145chr72933 176 2827 274 1869 --
NM_021155chr1952908 2168 1958 1190 403 ------
NM_021160chr6------1164
NM_021183chrX52522 1991 1910 753 469 --1893 --
NM_021188chr141352 ------
NM_021190chr12205 145 ------
NM_021191chr1231875 286 163 --12470 --
NM_021229chr1241081 884 146 137 ------
NM_021237chr31222 --1303 --
NM_021239chr1431166 926 184 11087 ----
NM_021249chr1441587 1172 261 236 1453 --11389
NM_021255chr1422986 798 1650 1743 --
NM_021574chr223966 430 254 --1739 --
NM_021622chr103908 678 230 --1256 1757
NM_021627chr321000 856 1356 ----
NM_021643chr21582 ------
NM_021647chr484082 2959 1784 1412 1287 884 654 510 11215 33168 2906 105 13293
NM_021648chr642776 2253 1704 800 ------
NM_021728chr142838 239 --1113 --
NM_021813chr675758 4852 4577 1611 1032 537 76 --24858 512 --
NM_021814chr641536 1218 135 36 ------
NM_021911chr542051 1937 1142 809 11008 1366 --
NM_021912chr1583441 1646 1380 1185 977 706 582 392 1348 ----
NM_021914chr1432177 1875 600 21542 358 22005 580 --
NM_021943chr61627 --1447 --
NM_021946chrX1130 --21078 189 --
NM_021947chr1741385 1186 1060 440 ------
NM_021949chrX52694 2168 1151 1030 109 1580 1500 --
NM_021956chr61599 11036 ----
NM_021959chr62984 191 ------
NM_021960chr142141 1811 1112 940 ------
NM_021961chr11117347 6915 5432 5281 2691 2599 1441 1078 1054 665 506 15684 1743 15933
NM_021964chr385440 4777 4014 2653 1719 1324 1203 1009 36338 2024 1685 ----
NM_021967chr5129 151 --1987
NM_021984chrX31538 599 476 --11163 --
NM_021987chrX31538 599 476 --11163 --
NM_021990chrX31538 599 476 --11163 --
NM_021999chr131132 ------
NM_022037chr21681 1159 ----
NM_022041chr1612581 ------
NM_022048chr15116341 6256 5273 4815 4689 4453 2067 1414 953 553 75 35406 1001 300 21787 1131 11694
NM_022049chr151856 1780 1541 1479 380 ------
NM_022054chr141843 ------
NM_022068chr181607 --1565 --
NM_022093chr12696 258 ------
NM_022116chr73985 785 333 ------
NM_022124chr10------1182
NM_022140chr572314 2278 2141 1982 1721 1570 1487 21793 541 12234 --
NM_022166chr1666068 5529 5006 4635 4245 1295 35489 5025 4289 11772 15347
NM_022169chr1111414 --11382 11250
NM_022173chr21681 1159 ----
NM_022351chr863711 3481 3455 3364 3015 53 22852 2680 --11353
NM_022373chr71253 ------
NM_022374chr22498 466 ------
NM_022459chr1335533 5209 1387 36292 2119 1767 --11209
NM_022465chr121624 --21158 234 --
NM_022469chr113080 --1488 --
NM_022475chr44599 105 79 51 ------
NM_022495chr14151 ------
NM_022572chr271648 1542 687 227 121 78 66 --1366 --
NM_022574chr711382 ----11361
NM_022648chr233936 3335 1103 1630 24561 1267 --
NM_022716chr161932 1071 769 544 414 78 32661 2328 258 12194 --
NM_022726chr621745 403 --1330 --
NM_022735chr1------1211
NM_022739chr171915 ------
NM_022748chr772887 2279 2131 1838 1134 1020 201 11990 22104 2049 --
NM_022753chr152473 2420 1111 666 136 22597 1841 ----
NM_022763chr362959 2853 1980 952 559 293 11088 12738 --
NM_022781chr973053 2752 2658 1263 1247 279 41 ------
NM_022783chr8------1275
NM_022831chr111856 --21445 335 --
NM_022832chr442521 932 814 555 ----12411
NM_022838chrX1241 ------
NM_022841chr1532263 871 315 11959 ----
NM_022843chr1331195 1041 55 ------
NM_022845chr1622173 2159 ------
NM_022898chr1484362 3554 3095 1848 1316 1168 704 524 11114 ----
NM_022912chr222880 1966 --2833 40 12290
NM_022913chr52301 244 ------
NM_022918chr1151703 1387 640 353 39 11714 ----
NM_022977chrX31865 1770 105 --11685 --
NM_022978chr5129 151 --1987
NM_023923chr123521 3144 ----13535
NM_023929chr821943 1933 21715 983 ----
NM_023948chr71158 ------
NM_024007chr533034 3004 1220 --2975 779 --
NM_024045chr10--164 --1172
NM_024052chr1732413 2056 968 ----12069
NM_024090chr431355 628 584 --11293 --
NM_024094chr81737 --1127 --
NM_024293chr2----2304 292 --
NM_024295chr861718 1697 1625 1529 1496 364 ----1190
NM_024325chr2031132 982 143 --11065 --
NM_024345chr985850 5508 4564 2010 990 900 487 207 1162 ----
NM_024408chr163181 2568 896 712 547 72 ------
NM_024416chr921519 108 --1449 11451
NM_024423chr1824171 375 ------
NM_024482chr1180 ------
NM_024491chr35584 520 144 138 115 ------
NM_024507chr16----136 --
NM_024513chr353688 3595 3396 2773 1268 131 12723 --
NM_024523chr731231 416 177 1513 1858 --
NM_024524chr33994 822 175 22809 223 ----
NM_024548chr31295 ------
NM_024563chr521932 732 ------
NM_024582chr411090 ------
NM_024595chr1------2776 203
NM_024612chr1731080 919 159 ------
NM_024613chr81495 --1627 --
NM_024631chr111196 ----180
NM_024636chr752386 2114 2023 1986 1101 1936 ----
NM_024639chr651841 740 416 179 58 ------
NM_024645chr82429 66 1621 1604 --
NM_024665chr354623 4224 2945 2904 1078 14417 --14217
NM_024674chr12914 768 --13065 --
NM_024692chr211280 ----1541
NM_024699chr82692 320 ------
NM_024721chr852688 2668 2506 766 442 ------
NM_024740chr1163551 3423 3323 3168 1155 274 ----11286
NM_024742chr162776 568 ------
NM_024744chr21510 22584 266 1308 --
NM_024761chr9124896 4696 4664 3890 3452 3367 2032 1633 1184 1056 781 383 11301 ----
NM_024770chr2106295 5477 4729 4284 4218 2662 2302 1902 1002 409 14376 15462 --
NM_024792chr171272 1938 --11138
NM_024817chr1555499 5415 882 645 503 24128 751 --35459 5439 5376
NM_024828chr91122 ------
NM_024852chr13634 560 172 ------
NM_024874chr121229 1180 ------
NM_024913chr731265 692 452 ------
NM_024920chr441119 1033 464 67 ------
NM_024926chr71231 ------
NM_024930chr522502 2236 1699 ----
NM_024944chr2121216 464 ------
NM_024946chr1611691 11235 11111 11382
NM_024947chr3107916 6531 6043 3454 3257 2979 2595 1531 1112 169 38448 6785 2205 ----
NM_024948chr103247 237 189 ------
NM_024949chr485043 4935 3854 1733 1054 936 762 30 13233 14043 13604
NM_024953chr1212151 --1206 --
NM_024989chr277285 6971 6415 5874 2847 2146 370 15617 37168 5092 1599 27800 7251
NM_025054chr841615 1448 1114 1039 --14022 --
NM_025073chr154428 3805 1109 910 821 21405 496 11118 --
NM_025074chr4------1162
NM_025134chr1611776 ------
NM_025138chr13--11297 11338 --
NM_025152chr142796 476 ------
NM_025160chr122758 110 --11263 13560
NM_025164chr1182188 2080 1898 1629 891 823 457 143 1838 ----
NM_025179chr164560 3365 3029 1242 675 325 33396 1123 209 24413 794 --
NM_025187chr161983 --21325 1108 --
NM_025191chr123136 542 ------
NM_025195chr831789 1464 1185 --2630 438 --
NM_025202chr231048 150 75 --1920 --
NM_025208chr1112472 ----12326
NM_025211chr92245 229 ------
NM_025221chr451215 1166 1140 352 225 ------
NM_025235chr1042249 655 521 94 1512 ----
NM_025236chr6177 --1721 --
NM_025238chr151257 11241 11520 --
NM_025246chr3124 ------
NM_025268chr141154 ------
NM_030567chr5----1114 --
NM_030594chr1541297 446 436 278 ------
NM_030621chr1432926 1264 226 24147 1697 ----
NM_030623chr231668 1459 27 21376 667 ----
NM_030625chr1041644 971 718 95 --12089 12082
NM_030627chr583732 1352 963 816 657 486 58 21 ------
NM_030629chr1621961 1570 ------
NM_030647chr796272 5897 4703 4181 1941 1831 1689 820 813 1682 14500 --
NM_030648chr465227 5146 3457 2212 2135 1106 ------
NM_030650chr264069 3559 3238 2915 1592 1233 --13175 13131
NM_030670chr1231545 1504 1450 ------
NM_030671chr1231545 1504 1450 ------
NM_030751chr1031736 369 59 ------
NM_030751chr1031736 369 59 ------
NM_030753chr171290 --1191 --
NM_030755chr1473059 2880 2773 2763 1148 850 367 ------
NM_030759chr102312 114 ----1190
NM_030762chr122815 759 --1196 --
NM_030786chr141790 1349 221 125 ------
NM_030806chr1139166 8367 7143 6553 6272 6218 3450 3434 3405 3180 2331 2018 1819 36542 6485 794 13467 16407
NM_030816chr163409 3397 2934 2337 1160 433 ------
NM_030820chr61999 ------
NM_030881chr2222453 461 1330 --12273
NM_030885chr352260 1550 337 220 107 ------
NM_030913chr11509 ------
NM_030915chr221935 531 11857 11868 --
NM_030918chr145379 4605 4570 4229 34825 1164 679 1829 --
NM_030920chr151862 1854 1789 341 147 ------
NM_030922chr152645 250 ------
NM_030939chr631014 328 139 ------
NM_030952chr111001 --1395 --
NM_031243chr741722 1524 650 112 ------
NM_031267chr71522 ------
NM_031268chr1645321 4681 4612 1952 --21173 732 --
NM_031289chr122991 226 ------
NM_031296chr442336 846 722 102 ------
NM_031309chr8--11575 2736 286 --
NM_031314chr1442047 1537 1528 389 1342 21381 29 --
NM_031365chr242073 1048 939 97 --1945 --
NM_031366chr242073 1048 939 97 --1945 --
NM_031369chr41180 --123 --
NM_031370chr41180 --123 --
NM_031372chr41466 11528 ----
NM_031412chr1211149 11007 --1915
NM_031419chr331467 1455 1411 11292 ----
NM_031427chr14145796 5586 5525 4815 4090 3897 3774 3672 1972 1584 1549 1380 896 679 34653 3912 2311 2136 130 --
NM_031435chr1273390 3331 3201 3087 1328 540 38 22126 625 ----
NM_031438chr52583 503 --153 --
NM_031442chrX63105 2961 2245 2233 1277 636 13202 1425 12452
NM_031445chr262877 1292 1179 659 632 208 23156 2632 1666 --
NM_031461chr822205 418 1373 ----
NM_031468chr7107971 7944 5967 5521 5012 2061 1197 844 305 177 15548 33105 3021 897 27994 1685
NM_031472chr11169 ------
NM_031483chr2073181 3064 2908 2813 545 489 137 1937 23134 1290 --
NM_031845chr252246 1300 1155 359 85 --1116 --
NM_031847chr252246 1300 1155 359 85 --1116 --
NM_031889chr421939 731 11827 1593 --
NM_031892chrX3910 894 33 ----1739
NM_031911chr432656 2295 1955 ------
NM_032052chr222574 334 ------
NM_032102chr1142547 2291 417 173 ------
NM_032121chrX4455 441 345 209 ----1366
NM_032128chr41724 ------
NM_032147chr12----1957 --
NM_032154chr103859 851 386 ------
NM_032160chr1883774 2835 1637 1346 1018 753 466 326 14036 1437 --
NM_032181chr21201 ----1583
NM_032182chr102463 279 1664 ----
NM_032199chr1063325 2443 1408 1331 1003 621 21313 251 12510 --
NM_032208chr253137 2637 2499 1308 905 11245 ----
NM_032211chr1021216 279 --1952 --
NM_032221chr201244 1236 2227 47 --
NM_032228chr1153497 2318 560 518 77 ------
NM_032231chr15----1272 --
NM_032246chr151175 ------
NM_032268chr1622012 266 --22798 2431 --
NM_032281chr1932946 2191 258 ------
NM_032288chr341714 335 245 64 ------
NM_032291chr141770 1350 1243 139 11899 1255 --
NM_032293chr9----1282 --
NM_032320chr112786 533 1655 163 --
NM_032321chr242799 1259 347 212 ------
NM_032328chr12432 74 ------
NM_032352chr142309 149 1371 ----
NM_032373chr1033798 530 54 35617 5228 4780 14359 14990
NM_032411chr21193 ------
NM_032420chr52357 187 ------
NM_032440chr1052286 2078 1186 873 798 1475 11868 --
NM_032445chr153903 812 267 --11935 --
NM_032446chr553830 3265 1502 1227 368 --11485 --
NM_032449chr152440 2158 1928 1026 811 12459 --1101
NM_032457chr42423 369 21242 837 --13839
NM_032458chrX33000 2573 321 13439 ----
NM_032498chrX185 ------
NM_032499chr1541527 300 225 178 ------
NM_032505chr321847 160 1893 2463 39 --
NM_032510chr1832290 1613 80 1962 ----
NM_032523chr21129 ------
NM_032550chr1031066 905 427 11050 --1435
NM_032578chr1021348 451 11553 ----
NM_032581chr731877 580 84 21655 1338 ----
NM_032622chr42422 219 21392 135 1585 11221
NM_032682chr373472 3366 3249 2972 2652 970 576 --1777 --
NM_032747chr10177 --137 --
NM_032801chr1132548 1770 476 ----1112
NM_032804chr103805 725 581 --12099 --
NM_032810chr1021025 53 ------
NM_032828chr1974506 4489 3983 3900 1267 1062 434 21979 1590 14296 --
NM_032837chr171803 12176 22020 274 --
NM_032859chr1333549 2515 201 13352 13260 --
NM_032866chr1553024 2033 545 319 34 12108 32761 2524 632 --
NM_032871chr11--1669 21321 1193 --
NM_032892chr15----1256 --
NM_032895chr171799 ------
NM_032947chr531261 375 84 1149 1167 --
NM_032968chrX33596 2719 250 ------
NM_032969chrX33596 2719 250 ------
NM_032973chrY43592 2714 1390 250 ------
NM_032978chr1841105 487 357 40 ------
NM_032979chr1841105 487 357 40 ------
NM_032981chr1841105 487 357 40 ------
NM_032982chr762084 1862 1798 954 913 147 32362 863 423 ----
NM_033014chr921519 108 --1449 11451
NM_033020chr154515 4022 3413 3090 545 --11233 --
NM_033055chr111041 ------
NM_033083chr332557 1259 702 --43301 2563 2225 204 --
NM_033089chr201512 11380 2381 43 --
NM_033127chr11221 --127 --
NM_033129chr202718 216 ------
NM_033135chr1112472 ----12326
NM_033136chr521794 1617 ------
NM_033137chr521794 1617 ------
NM_033143chr434531 3809 871 44504 4311 3159 1420 23715 1248 --
NM_033150chr121119 ------
NM_033181chr653927 2874 2703 2674 141 1720 ----
NM_033211chr541980 1402 289 195 ------
NM_033221chr941859 1061 129 25 1220 41847 902 517 364 --
NM_033225chr832558 587 205 12241 --1977
NM_033255chr133364 166 30 ------
NM_033261chr101148 2546 372 1200 --
NM_033290chrX33641 853 339 12811 1397 --
NM_033331chr943271 3043 2966 489 ------
NM_033360chr1254264 3776 1725 628 474 11191 ----
NM_033364chr341897 1823 249 194 11460 ----
NM_033380chrX31104 855 76 ------
NM_033381chrX31104 855 76 ------
NM_033389chr17134309 4259 3686 3489 3324 3299 3213 3204 3166 3156 1834 1742 316 1499 14745 --
NM_033394chr231449 1134 77 11060 ----
NM_033402chr81506 ------
NM_033420chr19----11168 --
NM_033425chr1151342 1085 977 360 214 11194 12348 11190
NM_033429chr1542132 2032 1104 583 1627 12239 --
NM_033495chrX2410 315 ------
NM_033505chr266236 6167 4572 2635 2326 1554 11506 ----
NM_033512chr872486 2462 2148 1141 1134 710 333 1424 21873 1156 --
NM_033540chr31353 ------
NM_033551chr573243 2672 2615 2388 1236 521 319 13410 ----
NM_033624chr1221706 321 ----22298 786
NM_033644chr521949 252 ------
NM_033645chr521949 252 ------
NM_033656chr2165657 4826 2218 1720 1037 1009 15774 25866 3863 --
NM_052818chr1352180 2036 1728 436 379 12139 ----
NM_052827chr1211136 ------
NM_052834chr1832306 2260 2177 2769 48 1691 --
NM_052854chr111615 --1193 --
NM_052879chr1233949 765 168 ------
NM_052885chr12125003 4813 4449 4173 3536 1983 1728 1419 1205 906 516 473 ------
NM_052898chr841310 1275 549 77 11823 ----
NM_052900chr831259 1140 483 11652 ----
NM_052905chr221179 298 ------
NM_052907chr1264185 3802 3724 1511 470 305 1676 ----
NM_052910chr1331821 1794 1591 --11772 --
NM_052918chr1043567 3329 2670 71 1975 ----
NM_052934chr132220 826 605 --12262 --
NM_052937chr842028 1799 1783 95 12392 ----
NM_052965chr151060 351 303 138 69 ------
NM_052978chr1441595 1390 658 601 ------
NM_053001chr81271 ------
NM_053016chr9117303 7168 6141 2557 2215 1964 1031 998 917 195 144 26972 1913 11828 --
NM_053024chr32498 359 --11503 --
NM_053043chr762575 1802 1423 1135 961 413 ------
NM_053064chr1413061 1997 ----
NM_053281chrX1277 ------
NM_054016chr13620 313 249 139 11275 --
NM_054016chr13620 313 249 139 11275 --
NM_054016chr13620 313 249 139 11275 --
NM_054110chr31235 ------
NM_054114chr6--1640 --1693
NM_057169chr1283059 2743 2510 2422 1044 995 844 656 1931 12460 --
NM_057170chr1283059 2743 2510 2422 1044 995 844 656 1931 12460 --
NM_057175chr41146 --1251 12357
NM_057178chr1742317 2296 581 392 12073 --1938
NM_078469chr101103 2524 419 ----
NM_078487chr953145 3081 2849 2281 494 ------
NM_080415chr171644 --1746 --
NM_080552chr20----1586 --
NM_080597chr182968 88 1991 ----
NM_080617chr202953 76 128 ----
NM_080629chr111018 11201 1333 1340
NM_080630chr111018 11201 1333 1340
NM_080645chr631823 1412 596 --2817 524 11474
NM_080666chr1421448 412 ------
NM_080670chr5----1652 --
NM_080672chr202414 60 1386 ----
NM_080676chr2043230 2087 972 248 12067 ----
NM_080678chr22628 168 1521 ----
NM_080737chrX31219 1205 167 ------
NM_080738chr141658 1629 1367 308 ------
NM_080759chr1321701 735 --12430 --
NM_080760chr1321701 735 --12430 --
NM_080867chr1464960 1891 1115 799 727 679 --11853 --
NM_080874chr421851 750 ----1486
NM_130439chr101567 12147 1670 --
NM_130439chr101567 12147 1670 --
NM_130806chr13186 ------
NM_130830chr342536 1431 1365 59 ------
NM_130838chr1511793 ----11810
NM_130839chr1511793 ----11810
NM_133259chr21711 1795 1682 --
NM_133264chr1723363 409 1853 33837 3327 171 --
NM_133334chr475622 5247 4361 1044 448 435 206 11056 24451 1820 --
NM_133378chr21629 --133 --
NM_133432chr21629 --133 --
NM_133437chr21629 --133 --
NM_133445chr953268 2370 1309 538 398 11295 11109 11163
NM_133452chr193801 318 189 ------
NM_133459chr1831991 1205 714 ------
NM_133468chr752295 2215 1891 1747 1580 32518 2105 704 12028 --
NM_133476chr121921 1229 1352 --
NM_133486chrX1404 ------
NM_133493chr674244 4049 3933 3513 1794 424 315 24480 3831 --24680 3689
NM_133496chr194386 4164 3906 3691 3652 3139 1414 1229 440 11434 1358 --
NM_133498chr191123 ------
NM_133499chrX1880 --1200 1644
NM_133507chr123622 381 198 1870 ----
NM_133645chr61246 3629 481 471 ----
NM_133647chr1563599 3525 1278 472 429 72 --13162 11192
NM_134268chr171997 --41137 1131 1119 1113 --
NM_134325chr141755 597 361 140 --21797 553 --
NM_134442chr241503 1391 1219 486 1145 ----
NM_138270chrX63413 2936 2158 1101 855 381 22364 1211 12829 --
NM_138286chr1944081 1697 837 376 --11546 --
NM_138292chr111222 21019 30 21231 675 12190
NM_138328chr1753002 2920 2513 692 76 23209 2855 ----
NM_138333chr932623 2472 276 --12231 --
NM_138348chr565929 5052 4700 2540 1851 1622 12006 25253 2281 1194
NM_138357chr1061660 1617 1358 1348 1153 563 ------
NM_138423chr152783 52 --11521 --
NM_138426chr72645 110 21590 215 ----
NM_138462chr91178 ------
NM_138468chr254590 2001 1894 1064 975 36109 1319 623 1952 15427
NM_138473chr1244777 4627 4304 1494 --34975 741 731 --
NM_138554chr962725 2183 894 783 580 275 --12607 --
NM_138576chr1484362 3554 3095 1848 1316 1168 704 524 11114 ----
NM_138609chr5------1120
NM_138610chr5------1120
NM_138621chr283976 3293 3191 2987 2675 901 733 173 --11233 --
NM_138638chr1432177 1875 600 21542 358 22005 580 --
NM_138713chr1686831 5879 5827 5292 5266 3219 2211 1430 27909 6714 ----
NM_138714chr1686831 5879 5827 5292 5266 3219 2211 1430 27909 6714 ----
NM_138731chr1463728 3217 3210 1661 1217 612 31319 195 60 ----
NM_138927chr211882 ------
NM_138931chr3182 1108 1955 --
NM_138970chr1422009 550 ------
NM_138971chr1143437 2529 1420 783 11122 22395 686 --
NM_138971chr1143437 2529 1420 783 11122 22395 686 --
NM_138972chr1143437 2529 1420 783 11122 22395 686 --
NM_138972chr1143437 2529 1420 783 11122 22395 686 --
NM_138973chr1143437 2529 1420 783 11122 22395 686 --
NM_138973chr1143437 2529 1420 783 11122 22395 686 --
NM_139048chr32203 174 ------
NM_139072chr2146 ------
NM_139157chr111142 --1575 --
NM_139167chr82465 442 ------
NM_139168chr521420 1324 21826 1318 1215 --
NM_139182chr431866 1752 585 ------
NM_139207chr1232033 2024 1954 1226 ----
NM_139244chr63832 730 313 ------
NM_139279chr233526 596 85 --1721 --
NM_139283chr1242181 2153 434 32 1179 ----
NM_139312chr1021254 169 21372 151 21236 91 --
NM_139316chr731077 1045 374 1922 2990 203 --
NM_139321chr2044064 3575 1218 442 13458 23835 2710 11114
NM_139323chr201821 ----11511
NM_144567chr122397 2152 22486 475 ----
NM_144568chr14----1669 --
NM_144571chr456235 5915 5846 5382 2514 11857 ----
NM_144578chr1455173 1677 873 583 211 13357 13433 --
NM_144594chr122162 72 ------
NM_144595chr131753 ------
NM_144599chr1564306 4144 3395 1631 1570 244 34317 3903 486 ----
NM_144628chr20123046 2831 2576 2480 2321 1961 1877 1037 974 827 638 489 --12715 --
NM_144632chr241956 1826 827 586 1851 ----
NM_144635chr311236 ------
NM_144642chr31206 ------
NM_144643chr41417 ------
NM_144726chr531035 435 166 ------
NM_144775chr1774144 3490 3418 3199 1932 1782 1554 14938 ----
NM_144778chr1341971 1844 369 324 1828 --12670
NM_144949chr231644 1604 1015 12049 ----
NM_144963chr842430 1971 1674 165 ------
NM_144973chr121757 14590 35226 4911 1321 --
NM_144975chr1711126 --2505 42 --
NM_145052chrX2976 151 --11055 --
NM_145055chr1823074 1416 22978 1455 150 --
NM_145056chr19----1273 --
NM_145206chr1053221 2941 1212 772 78 ------
NM_145243chr1150 ------
NM_145246chr1021146 222 --1983 --
NM_145259chr286983 6038 5917 5471 4928 4889 4868 1262 26024 187 1238 11879
NM_145263chr422236 263 11598 ----
NM_145269chr8122 ------
NM_145274chr172957 27 ----2819 697
NM_145284chrX1211 11974 11787 --
NM_145301chr171589 ------
NM_145307chr1054548 3409 3055 581 380 ----2506 484
NM_145320chr711165 23473 1157 13598 --
NM_145321chr711165 23473 1157 13598 --
NM_145322chr711165 23473 1157 13598 --
NM_145331chr62688 285 ------
NM_145332chr61836 ------
NM_145333chr61836 ------
NM_145341chr102510 285 ------
NM_145644chr21360 ------
NM_145686chr231240 970 177 12428 ----
NM_145687chr231240 970 177 12428 ----
NM_145690chr82649 208 162 21627 30 --
NM_145728chr1532123 573 533 12449 1842 --
NM_145733chr223361 276 232 21046 172 --187
NM_145739chr21129 ------
NM_145759chr142175 1984 1804 634 12109 ----
NM_145793chr101908 ------
NM_145804chr1111392 --1158 --
NM_145861chr141658 1629 1367 308 ------
NM_145891chr1621118 563 ------
NM_145892chr1621118 563 ------
NM_145893chr1621240 685 ------
NM_147150chr933985 3925 3168 13058 --13392
NM_147175chrX21626 881 --1848 1818
NM_147181chr451215 1166 1140 352 225 ------
NM_147182chr451215 1166 1140 352 225 ------
NM_147183chr451215 1166 1140 352 225 ------
NM_147233chr232148 883 309 11796 ----
NM_148957chr1312609 1523 ----
NM_152133chr6--1640 --1693
NM_152222chr11--1669 21321 1193 --
NM_152233chr1441587 1172 261 236 1453 --11389
NM_152261chr1222136 826 2657 145 12401 --
NM_152267chr223774 237 142 --12223 --
NM_152277chr52771 713 --1613 --
NM_152280chr143278 2616 818 93 ------
NM_152282chr311158 --11111 --
NM_152292chr432240 2134 1623 --12014 --
NM_152300chr1711292 ----11491
NM_152305chr341544 508 412 131 31668 838 306 11802 --
NM_152329chr141134 ------
NM_152332chr1442656 892 595 577 1760 12506 --
NM_152365chr11386 ------
NM_152387chr241055 818 190 33 ------
NM_152388chr273142 2768 2708 2491 1573 612 202 11584 12797 --
NM_152407chr543233 2963 926 176 12848 1587 13147
NM_152409chr532731 2483 1239 ------
NM_152424chrX53284 2944 1540 996 664 1826 ----
NM_152437chr1222085 688 1815 11603 --
NM_152442chr1231429 141 47 ------
NM_152470chr1854063 3954 3681 518 469 1881 22863 811 --
NM_152475chr1952285 2267 1763 662 46 4686 682 549 339 22074 163 --
NM_152478chr194621 196 185 46 ------
NM_152493chr1------11137
NM_152523chr22725 102 2592 42 ----
NM_152525chr21147 ------
NM_152529chr264379 4089 3548 1175 718 258 ------
NM_152545chr41276 ------
NM_152556chr72595 455 ------
NM_152588chr1231880 621 505 ------
NM_152594chr1561939 1743 1581 1543 682 138 ----1637
NM_152622chr522847 881 12443 1265 --
NM_152624chr567048 6354 6269 4644 1822 1237 --16290 --
NM_152641chr1242888 2343 911 248 12007 --22581 2184
NM_152666chr13546 274 222 ------
NM_152682chr461703 1687 1346 1327 442 363 --1308 --
NM_152695chrX32297 1549 1436 21840 422 12165 --
NM_152716chr1131071 554 314 --1372 --
NM_152722chr1121817 1517 ----11568
NM_152726chr13----1427 --
NM_152739chr71719 ------
NM_152744chr753531 2813 2606 1312 538 ------
NM_152745chr73845 723 183 ------
NM_152756chr584342 3667 3585 3548 3159 1582 825 809 23212 1136 ----
NM_152758chr822976 157 ------
NM_152761chrX162 ------
NM_152785chr36985 420 386 357 195 101 12030 12278 --
NM_152787chrX21453 701 183 ----
NM_152835chr14975 557 327 144 ------
NM_152838chr2063258 2577 596 466 354 284 12268 ----
NM_152860chr121505 --1222 --
NM_152903chr1352762 2689 2193 1761 917 11019 ----
NM_152919chr1943739 3575 1309 206 13733 ----
NM_152924chr1596119 5839 5805 5770 2643 1806 1780 1566 725 25981 2690 16045 --
NM_152995chr41108 ------
NM_152999chr795037 4940 4798 4674 4465 4457 3857 1008 963 14136 ----
NM_153020chr611184 --1615 --
NM_153035chr121971 535 ------
NM_153042chr621458 153 ------
NM_153183chrX11237 --1118 11072
NM_153184chr351562 377 282 169 64 ------
NM_153207chr1243276 2926 1631 1387 ------
NM_153223chr531381 447 216 ------
NM_153235chr6--22120 153 --11648
NM_153261chr1651462 1144 642 473 168 ----1304
NM_153262chr133099 2117 1189 ------
NM_153321chr173871 428 393 1719 ----
NM_153322chr173871 428 393 1719 ----
NM_153343chr42745 543 --12297 --
NM_153347chr1142738 2521 1707 412 ------
NM_153367chr1023321 1200 --13743 --
NM_153485chr5121 ------
NM_153607chr522216 69 153 ----
NM_153619chr1531460 1272 1077 33469 987 609 1466 --
NM_153649chr142175 1737 1424 503 --1846 --
NM_153686chr432369 1913 545 11575 12384 --
NM_153687chr121156 1139 292 87 --
NM_153689chr21757 12382 1508 --
NM_153695chr92192 94 ------
NM_153702chr4----1202 --
NM_153713chr1194 ------
NM_153756chr121894 504 188 --11407
NM_153757chr42470 341 ------
NM_153810chr1064967 4723 4505 4265 3141 1753 24453 3913 ----
NM_153819chr11----131 --
NM_153828chr22187 31 ------
NM_170607chr1711400 --11201 --
NM_170662chr3------1520
NM_170665chr1244124 3729 1680 1035 23751 813 1288 --
NM_170674chr151458 ------
NM_170675chr152400 134 ------
NM_170676chr152400 134 ------
NM_170677chr151458 ------
NM_170679chr531280 1257 141 ------
NM_170692chr11854 --11159 --
NM_170706chr152793 946 634 179 91 23993 2879 --23800 1637
NM_170709chr821858 103 ----12306
NM_170719chr13--11297 11338 --
NM_170721chr1741274 1257 174 147 --11050 --
NM_170731chr11----1789 --
NM_170732chr11----1789 --
NM_170733chr11----1789 --
NM_170734chr11----1789 --
NM_170735chr11----1789 --
NM_170769chr6177 --1721 --
NM_172058chr821627 178 11678 --11510
NM_172059chr821627 178 11678 --11510
NM_172060chr821627 178 11678 --11510
NM_172069chr232134 2078 243 ------
NM_172070chr21597 ----1283
NM_172071chr1167013 6213 6139 6042 5977 5796 5646 5508 4912 2949 2905 2593 2425 726 591 437 ------
NM_172127chr461808 1646 1432 783 330 189 --11617 --
NM_172128chr461764 1602 1388 739 286 145 --11573 --
NM_172159chr332378 1477 209 11967 --1706
NM_172160chr332378 1477 209 11967 --1706
NM_172169chr10------1759
NM_172170chr10------1759
NM_172171chr10------1759
NM_172173chr10------1759
NM_172174chr42461 222 ------
NM_172178chr122169 42 ------
NM_172315chr151458 ------
NM_172316chr151458 ------
NM_172337chr142838 239 --1113 --
NM_172375chr14----1823 --
NM_173039chr112247 99 ------
NM_173214chr1686831 5879 5827 5292 5266 3219 2211 1430 27909 6714 ----
NM_173355chr2--1421 --1103
NM_173469chr154517 257 181 141 ------
NM_173470chrX31875 905 595 --12050 --
NM_173473chr1042632 1725 728 662 1345 ----
NM_173475chr1611241 1658 1690 --
NM_173495chrX21747 38 12417 --1343
NM_173510chr2232384 2365 789 ------
NM_173511chr223597 974 12818 21316 242 --
NM_173519chr831407 701 515 ------
NM_173546chr3136 ----1583
NM_173554chr101315 ------
NM_173560chr61213 ------
NM_173570chr332127 1882 573 --1507 --
NM_173576chr105371 352 179 123 50 --161 --
NM_173582chr11116203 6086 5990 5156 4992 4560 4361 2486 2426 1725 691 14175 1102 12394
NM_173595chr1243633 1822 879 813 ------
NM_173602chr1253774 2615 898 275 121 23523 1041 33397 2417 127 --
NM_173631chr1911346 --21136 212 --
NM_173642chr1109176 7493 6870 6620 2146 2025 1539 1464 898 552 21435 850 ----
NM_173644chr2021457 1395 178 --11669
NM_173667chr522218 289 ------
NM_173694chrX42302 884 479 107 22199 1583 1462 --
NM_173808chr153728 3204 1065 912 144 34315 3395 3357 13820 --
NM_173809chr1031147 1007 477 --11047 --
NM_173822chr241548 608 174 73 --121 --
NM_173825chr372919 2901 2627 1248 1042 361 103 --157 --
NM_173829chr576088 5814 5744 4044 2405 2066 144 24082 345 ----
NM_173851chr863957 3798 3659 3054 2535 299 32655 2548 846 13711 --
NM_173854chr151956 1538 957 836 130 --22091 1757 --
NM_173872chr43728 684 589 ------
NM_174887chr171334 ------
NM_174916chr1531944 664 264 1281 1763 --
NM_175056chr311971 --1506 --
NM_175566chr11------1166
NM_175624chr1296872 6734 6618 6540 5046 2689 2636 1276 714 ------
NM_175625chr1296872 6734 6618 6540 5046 2689 2636 1276 714 ------
NM_175634chr82333 115 --162 1967
NM_175635chr82333 115 --162 1967
NM_175636chr82333 115 --162 1967
NM_175736chr12156674 6660 6003 5649 5497 5148 5005 4900 4884 2653 2205 1903 1619 563 449 26025 1639 35717 5491 5339 --
NM_175737chr4139 ------
NM_175854chr1322749 78 11996 12102 188
NM_175856chr53516 301 48 ------
NM_175884chr731316 1232 985 11453 ----
NM_175907chr1832474 945 297 11792 11039 --
NM_175920chr52710 21 1159 ----
NM_176812chr201730 ------
NM_176814chr72598 433 ------
NM_176863chr171299 1763 12170 1150
NM_177422chr13634 560 172 ------
NM_177424chr12664 261 1652 --1672
NM_177438chr1432926 1264 226 24147 1697 ----
NM_177539chr12302 201 --1185 --
NM_177553chr11--1220 --1954
NM_177559chr202787 299 ------
NM_177560chr202787 299 ------
NM_177947chrX41331 677 470 280 ------
NM_177948chrX41331 677 470 280 ------
NM_177972chr1184110 4091 4070 3828 3518 2962 1658 385 ------
NM_177974chr152783 52 --11521 --
NM_177999chr953719 3275 3239 2927 207 23346 3034 12894 --
NM_178011chr1072966 2213 2202 1014 955 809 800 12430 22535 273 11213
NM_178037chr1293291 3010 2943 2805 2706 2653 2286 1439 474 32490 1010 46 13260 --
NM_178038chr1293291 3010 2943 2805 2706 2653 2286 1439 474 32490 1010 46 13260 --
NM_178123chr221012 112 ------
NM_178126chr1741389 717 439 381 11486 ----
NM_178151chrX87846 7835 7625 5830 5450 5237 2190 405 36531 3018 2588 27295 3043 --
NM_178152chrX87846 7835 7625 5830 5450 5237 2190 405 36531 3018 2588 27295 3043 --
NM_178153chrX87846 7835 7625 5830 5450 5237 2190 405 36531 3018 2588 27295 3043 --
NM_178175chrX5703 588 190 151 84 --1676 --
NM_178190chr11101 ------
NM_178191chr121442 1054 ------
NM_178450chr51513 ------
NM_178498chr1154070 3658 3524 888 583 --12858 1950
NM_178505chr1073553 3060 2750 2681 2518 767 545 ------
NM_178509chr1734043 2906 392 --22551 2537 --
NM_178565chr811694 ------
NM_178583chr43812 355 193 1672 ----
NM_178585chr42962 321 42670 2646 2642 1143 1340 --
NM_178842chr1542154 1507 801 376 --1502 --
NM_180976chr61349 ------
NM_180977chr61349 ------
NM_180989chr1312048 12182 22314 318 --
NM_181054chr1471242 879 514 449 352 192 166 ------
NM_181291chr141733 ------
NM_181310chr631878 435 294 1283 ----
NM_181332chrX62149 2029 1679 887 179 159 ------
NM_181351chr1132196 833 130 --1952 --
NM_181354chr841545 1158 671 462 --11113 --
NM_181358chr111392 --11000 13548
NM_181359chr141749 881 669 308 --22431 93 --
NM_181361chr33557 380 57 --1262 11277
NM_181457chr22496 360 ------
NM_181459chr22395 259 ------
NM_181460chr22442 306 ------
NM_181504chr563941 2750 2628 1620 1578 939 12831 1219 --
NM_181507chr112897 384 1178 ----
NM_181508chr112897 384 1178 ----
NM_181521chr1656891 2053 1821 1718 1099 24404 2426 36470 1526 472 --
NM_181523chr563941 2750 2628 1620 1578 939 12831 1219 --
NM_181524chr563941 2750 2628 1620 1578 939 12831 1219 --
NM_181571chr1011104 1101 ----
NM_181659chr2032674 2326 1041 ------
NM_181659chr2032674 2326 1041 ------
NM_181670chr1221413 476 ------
NM_181671chr172904 691 ------
NM_181704chr2131293 912 78 ------
NM_181705chr555724 5609 4380 991 768 25819 1314 ----
NM_181706chr1132287 1615 949 21922 1853 ----
NM_181723chr831871 352 261 12008 ----
NM_181762chrX1391 ------
NM_181777chrX1391 ------
NM_181782chr64802 789 424 130 --1100 --
NM_181784chr232456 1706 50 11778 168 31866 1696 308
NM_181836chr562155 1880 940 880 776 203 12426 ----
NM_181838chr511178 11468 1107 --
NM_181873chr12195 27 ------
NM_181886chr421314 360 1147 3158 106 80 --
NM_181887chr421314 360 1147 3158 106 80 --
NM_181888chr421314 360 1147 3158 106 80 --
NM_181889chr421314 360 1147 3158 106 80 --
NM_181890chr421314 360 1147 3158 106 80 --
NM_181891chr421314 360 1147 3158 106 80 --
NM_181892chr421361 407 1194 3205 153 127 --
NM_181893chr421314 360 1147 3158 106 80 --
NM_181897chr322622 119 21760 980 ----
NM_182314chrX31683 1657 119 ------
NM_182484chr2131293 912 78 ------
NM_182503chr655413 3496 1471 718 131 34246 2190 1449 14675 --
NM_182607chrX11718 --1128 1716
NM_182641chr1752057 1882 501 491 436 ------
NM_182691chr731044 459 106 11346 174 --
NM_182692chr731044 459 106 11346 174 --
NM_182700chr731866 764 275 ------
NM_182717chr1021509 1004 1506 ----
NM_182718chr1011104 1101 ----
NM_182719chr1011104 1101 ----
NM_182720chr1021509 1004 1506 ----
NM_182721chr1021509 1004 1506 ----
NM_182722chr1021509 1004 1506 ----
NM_182723chr1021509 1004 1506 ----
NM_182724chr1011104 1101 ----
NM_182725chr1011104 1101 ----
NM_182758chr1543856 2569 1566 242 1213 22882 525 23381 2922
NM_182762chr796070 5462 5231 5052 856 815 776 542 255 24965 1315 --15354
NM_182763chr142130 1800 1101 929 ------
NM_182767chr1221368 87 ----11684
NM_182769chr1011104 1101 ----
NM_182770chr1011104 1101 ----
NM_182771chr1011104 1101 ----
NM_182772chr1011104 1101 ----
NM_182789chr51803 1793 1306 --
NM_182796chr52676 322 ------
NM_182797chr2041726 1496 630 520 ------
NM_182830chr1441881 763 720 275 --1595 --
NM_182831chr16158 ----11346
NM_182850chr1011104 1101 ----
NM_182853chr1021509 1004 1506 ----
NM_182894chr1411583 ----1198
NM_182898chr785848 5661 5350 5179 4959 4435 1822 300 1800 ----
NM_182899chr785848 5661 5350 5179 4959 4435 1822 300 1800 ----
NM_182920chr321175 362 ------
NM_182931chr73581 458 142 ------
NM_182944chr14----1307 --
NM_182948chr192934 2734 1926 1175 1163 920 522 142 108 --12887 1732
NM_182977chr52820 277 ------
NM_183011chr1021509 1004 1506 ----
NM_183012chr1021509 1004 1506 ----
NM_183013chr1021509 1004 1506 ----
NM_183060chr1011104 1101 ----
NM_183078chr673643 3132 2928 2857 2574 2415 354 13425 --23763 3700
NM_183244chr202414 60 1386 ----
NM_183246chr202414 60 1386 ----
NM_183323chr51803 1793 1306 --
NM_183380chr61707 --1883 --
NM_183397chr20104588 4553 3834 3498 3248 1674 643 558 334 197 ------
NM_183419chr81542 ------
NM_184234chr20154 --1171 --
NM_194071chr784892 4491 4227 4172 3651 1796 1578 539 13944 11162 13956
NM_194278chr1443774 3013 1644 1534 12544 22635 1183 --
NM_194282chr422996 1106 1912 ----
NM_194283chr533211 2885 2620 22640 70 ----
NM_194285chr1152138 1137 612 542 82 ------
NM_194286chr1295263 5015 4638 4349 2394 2026 1555 244 200 25670 1330 25154 1897 --
NM_194291chr852868 1057 1002 248 226 12153 11010 --
NM_194301chr1421178 345 11102 ----
NM_194328chr973053 2752 2658 1263 1247 279 41 ------
NM_194329chr973053 2752 2658 1263 1247 279 41 ------
NM_194330chr973053 2752 2658 1263 1247 279 41 ------
NM_194332chr973053 2752 2658 1263 1247 279 41 ------
NM_194356chr1231487 150 103 1523 --11777
NM_194434chr1834854 4821 547 13916 1514 1414
NM_197941chr532975 585 38 ------
NM_197977chr91973 --1765 --
NM_198057chrX187 --21211 366 --
NM_198066chr1452798 2757 1213 952 350 --11190 --
NM_198074chr121164 246 --11297 --
NM_198081chr653011 2938 2872 2758 2366 --12308 --
NM_198120chr81599 ------
NM_198123chr831259 1140 483 11652 ----
NM_198124chr831259 1140 483 11652 ----
NM_198128chr1831967 855 163 ------
NM_198158chr323066 715 ------
NM_198159chr323066 715 ------
NM_198177chr323066 715 ------
NM_198178chr323066 715 ------
NM_198189chr23837 206 27 1963 ----
NM_198195chr32569 458 ------
NM_198204chr1711400 --11201 --
NM_198205chr1711400 --11201 --
NM_198215chr1021000 920 11313 ----
NM_198225chr1021726 490 1766 21415 1235 --
NM_198240chr1221094 465 1459 ----
NM_198268chr111392 --11000 13548
NM_198269chr111392 --11000 13548
NM_198270chrX32202 1268 870 ------
NM_198390chr1621961 1570 ------
NM_198392chr651968 1931 1896 849 173 1249 1590 --
NM_198395chr51906 1369 ----
NM_198399chr3----11772 --
NM_198400chr1572726 2502 2493 2410 2280 1956 1923 --12561 --
NM_198446chr1125 ------
NM_198449chr55571 462 180 143 66 ------
NM_198465chrX12955 ------
NM_198468chr684209 3491 3461 3438 3005 1621 1557 678 44235 3785 858 312 --23510 921
NM_198511chrX41829 1721 1266 374 ------
NM_198513chr831943 1550 1484 11500 ----
NM_198542chr19------2118 39
NM_198549chr122783 319 ------
NM_198581chr286910 6162 5661 4868 2828 2654 1135 830 11868 --12487
NM_198715chr175917 4883 4668 2055 1570 1558 510 --16255 14081
NM_198793chr332700 2557 1094 --1600 --
NM_198794chr14------11313
NM_198859chr343936 3368 1964 320 --14905 --
NM_198900chr12156674 6660 6003 5649 5497 5148 5005 4900 4884 2653 2205 1903 1619 563 449 26025 1639 35717 5491 5339 --
NM_198902chr151554 ------
NM_198904chr541770 1515 623 431 --11595 --
NM_198935chr2063280 3190 2804 2110 395 139 2650 46 12701 --
NM_198956chr731866 764 275 ------
NM_199000chr741766 545 247 236 --12214 --
NM_199005chr94740 416 179 58 ------
NM_199040chr1253784 2828 1156 583 68 --11016 1379
NM_199072chr753273 2923 2779 2318 119 ------
NM_199131chr1022875 2315 --1216 12990
NM_199188chr1233949 765 168 ------
NM_199189chr51401 ------
NM_199190chr1233949 765 168 ------
NM_199324chr433220 1215 558 21252 208 ----
NM_199421chr1464960 1891 1115 799 727 679 --11853 --
NM_199437chr1132315 2085 168 32231 905 564 --1137
NM_199438chr1132315 2085 168 32231 905 564 --1137
NM_199439chr1132315 2085 168 32231 905 564 --1137
NM_199478chrX21964 466 ------
NM_199482chr251915 1380 731 716 303 ------
NM_201266chr232674 2106 35 --2519 267 1647
NM_201279chr232674 2106 35 --2519 267 1647
NM_201435chr12130 ----152
NM_201444chr12----1216 --
NM_201445chr12----1216 --
NM_201548chr221210 561 1999 ----
NM_201554chr12----1216 --
NM_201559chr644600 4389 915 625 13699 24713 3922 1304
NM_201567chr341281 545 448 303 --11381 11323
NM_201591chr44616 555 249 102 ------
NM_201592chr44616 555 249 102 ------
NM_201599chrX1474 --195 --
NM_201624chr12117 109 ------
NM_203301chr141678 ------
NM_203342chr142252 990 762 180 --33630 1161 447 --
NM_203343chr142252 990 762 180 --33630 1161 447 --
NM_203394chr1242541 2406 441 149 1114 ----
NM_203403chr93953 410 48 --1166 --
NM_203446chr2132130 997 455 ------
NM_203454chr141040 489 315 292 ------
NM_203458chr163805 3035 2781 2467 2335 1013 21420 479 13379 1129
NM_203459chr132269 1898 51 ------
NM_203464chr111235 21286 39 ----
NM_203467chr141216 ------
NM_203499chr172734 149 ------
NM_203504chr44916 497 466 44 12381 1543 --
NM_203505chr44916 497 466 44 12381 1543 --
NM_205860chr122897 1079 1925 1739 12125
NM_206594chr142277 789 291 202 22522 916 32974 377 361 --
NM_206595chr142277 789 291 202 22522 916 32974 377 361 --
NM_206839chr15--1472 --1409
NM_206852chr14171 ------
NM_206853chr642581 2565 2531 33 13449 ----
NM_206854chr673842 3826 3792 3312 1294 809 731 14710 ----
NM_206855chr694807 4791 4757 4277 2259 1774 1696 534 264 15675 ----
NM_206857chr14171 ------
NM_206876chr233576 845 562 1237 ----
NM_206909chr888199 7962 7134 6675 3318 3005 2817 861 22077 1250 ----
NM_206937chr13146 ------
NM_207012chr1032497 1349 1316 13395 --1345
NM_207043chr142299 2208 2031 1895 22094 1755 1798 --
NM_207044chr142299 2208 2031 1895 22094 1755 1798 --
NM_207047chr142299 2208 2031 1895 22094 1755 1798 --
NM_207170chr11779 1846 ----
NM_207292chr333217 3196 1113 ------
NM_207293chr333217 3196 1113 ------
NM_207294chr333217 3196 1113 ------
NM_207295chr333217 3196 1113 ------
NM_207296chr333217 3196 1113 ------
NM_207297chr343242 3221 1138 35 ------
NM_207303chr10--33261 674 105 22921 614 --
NM_207304chr1341858 1731 256 211 1715 --12557
NM_207325chr1942090 1858 831 209 11796 ----
NM_207337chr12138 ------
NM_207343chr11----1211 --
NM_207362chr21579 ------
NM_207372chr1042437 838 707 553 --2179 73 --
NM_207406chr486386 5232 5042 4113 2095 1583 1049 96 44215 1666 1549 1335 35276 4862 1915 14269
NM_207411chr832790 1453 1039 23502 2966 23446 358 --
NM_207422chrX21250 201 1160 --11306
NM_207445chr1561748 1717 1622 1593 341 209 11468 12067 --
NM_207469chr2021659 145 41631 217 158 154 ----
NM_207520chr22187 31 ------
NM_207521chr22187 31 ------
NM_207577chr1122810 1068 1582 32520 2424 111 --
NM_207647chr972449 2275 2218 1970 725 395 268 1448 ----
NM_212464chr1541690 1447 826 67 ----11583
NM_212474chr21869 1708 ----
NM_212475chr21869 1708 ----
NM_212476chr21869 1708 ----
NM_212478chr21869 1708 ----
NM_212482chr21869 1708 ----
NM_212543chr31107 ------
NM_212558chr984099 3459 3258 3122 2819 1318 833 471 21688 763 12783 11072
NM_213589chr285584 5322 4231 2116 1465 1195 662 65 ------
NM_213606chr1031088 505 199 ------
NM_213618chr111142 --1575 --