TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-125a-5p
miRNA Sequence: UCCCUGAGACCCUUUAACCUGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr662788 2765 1712 1413 1350 865 --11120 --
NM_000217chr1294663 4608 4495 4464 4402 4294 2125 2034 1501 --14733 11280
NM_000222chr421825 1567 ------
NM_000248chr322508 317 --12610 --
NM_000332chr652704 2208 1035 543 235 --12445 --
NM_000390chrX52485 2353 1255 320 261 ------
NM_000430chr1723479 412 1891 --12369
NM_000489chrX23250 760 ------
NM_000539chr31279 ----1324
NM_000555chrX107234 3049 2143 2097 1878 993 978 903 609 293 --12034 --
NM_000615chr1152892 1098 934 424 365 ------
NM_000719chr12106620 5942 5889 5275 5249 4234 2384 2178 1586 1000 15651 ----
NM_000725chr123901 303 138 --1771 1345
NM_000813chr554627 3858 1209 989 570 --12238 --
NM_000829chr1111863 1237 11516 1647
NM_000875chr1531741 1640 1324 --12048 --
NM_001001395chr121639 ------
NM_001001396chr153526 3132 1797 1485 513 ----24337 2743
NM_001001549chr722811 295 12709 22344 1018 --
NM_001001556chr1521214 43 --135 --
NM_001001664chr243053 1622 563 147 ------
NM_001001924chr821575 811 --1328 --
NM_001001928chr22138325 6929 5875 5853 5187 3316 2801 2648 2317 2082 1879 762 223 17603 12938 11173
NM_001002257chr243208 2470 434 225 ----1649
NM_001003652chr1847616 3458 2910 1929 22486 983 37344 5527 3049 --
NM_001003800chr983679 3169 2923 2673 2402 551 231 202 ------
NM_001004304chr1262870 2744 2524 1075 947 147 12809 --1206
NM_001004419chr1224572 901 --1731 --
NM_001004720chr22882 127 ------
NM_001004722chr231051 296 158 ------
NM_001005386chr232167 1875 448 11851 --2764 531
NM_001005463chr1031910 799 52 ------
NM_001005502chr1244062 4033 1871 576 21955 45 ----
NM_001006115chr322226 248 --3905 767 507 12591
NM_001006665chr12589 197 --1783 --
NM_001007024chr1733394 3013 2840 --33867 3591 1583 --
NM_001008220chr593418 2738 2657 2556 724 464 422 260 248 --12979 13136
NM_001008222chrX51260 1108 463 57 40 11279 ----
NM_001008239chr1842604 1149 285 179 11142 1434 --
NM_001008925chr442465 1271 762 340 ------
NM_001009569chr1011491 ------
NM_001009955chr11367 ------
NM_001010887chr911524 ----21506 434
NM_001010888chrX34074 3312 1181 11281 22883 1837 --
NM_001010898chr141319 1253 788 214 --42489 2331 555 377 13079
NM_001011666chr735777 4183 631 15223 ----
NM_001012755chrX54607 1939 526 422 335 --11715 --
NM_001013031chr1033330 2881 2480 ------
NM_001013399chr61899 ------
NM_001017424chr141662 760 363 23 ------
NM_001018050chr2283309 3208 3055 2791 1375 1285 802 754 22855 877 11243 --
NM_001018108chr1531939 1586 164 ------
NM_001018111chr723792 3411 --31460 837 779 11150
NM_001024460chr6----11173 1205
NM_001024858chr1442624 1190 662 532 12076 11115 12851
NM_001024912chr1961789 1776 1533 1177 713 691 ------
NM_001025077chr1066374 6311 6207 5144 1892 592 16660 145 --
NM_001030055chr1464057 3841 3769 2923 489 65 ------
NM_001032288chr2031343 655 464 ------
NM_001034915chr83524 120 99 ------
NM_001038707chr151983 1703 676 548 274 ----11597
NM_001039457chr11103 ------
NM_001039618chr1155264 4374 3850 1460 692 ------
NM_001040273chr1061807 1663 627 273 266 134 ----1844
NM_001040284chr1684845 4350 3836 2280 1514 606 85 51 --12193 --
NM_001040450chr151126 --12114 --
NM_001040712chr932650 459 317 ------
NM_001042494chr1532747 1355 746 --13218 --
NM_001042537chrX31581 746 551 ------
NM_001042599chr257319 2497 2473 995 974 --26488 2520 11479
NM_001100108chr197631 7023 5880 3271 2700 2678 2383 1633 474 26395 1344 12543 --
NM_001106chr3128961 8362 6948 6422 3720 3258 2950 2525 2052 732 688 394 11031 13691 --
NM_001116chr1672523 2505 2337 675 284 259 159 --32532 937 749 --
NM_001204chr256926 6150 5312 4995 4892 --27244 6332 --
NM_001222chr1021506 629 --1411 --
NM_001248chr3188 --1340 --
NM_001259chr745729 4853 1791 1473 1850 ----
NM_001304chr1731511 1434 501 ------
NM_001315chr621655 285 --11616 --
NM_001419chr1954212 3899 3694 1887 1457 21284 692 13103 --
NM_001427chr711884 --2535 272 --
NM_001655chr1131423 883 584 21904 1350 ----
NM_001659chr1222272 2162 1963 2761 544 --
NM_001664chr31399 ------
NM_001668chr122066 1794 1605 ----
NM_001773chr12289 233 ----1261
NM_001795chr1631462 1100 504 ----11087
NM_001798chr124938 864 826 88 ------
NM_001845chr131935 ------
NM_001859chr953736 3424 3283 2783 2775 ------
NM_001949chr652988 2882 1306 1206 534 ----11192
NM_001977chr4------1209
NM_001987chr1233770 2670 495 23713 3440 14278 --
NM_002033chr1143533 3191 1474 245 13987 1735 14077
NM_002137chr72348 78 1775 11784 --
NM_002139chrX1438 ------
NM_002193chr211680 ------
NM_002239chr21396 ------
NM_002265chr1711162 ------
NM_002268chr31631 11450 ----
NM_002309chr2261007 647 616 441 429 41 --11001 11016
NM_002310chr524548 1370 14577 1631 --
NM_002336chr1244269 4201 1813 1605 --14480 --
NM_002355chr1211248 ----11046
NM_002401chr1762183 2116 1956 970 917 187 1603 --1299
NM_002460chr612489 --12463 1599
NM_002522chr1753063 2763 2429 1467 229 --12897 --
NM_002537chr152373 330 11083 2842 118 1875
NM_002577chr394058 3232 2719 2527 1044 815 263 238 201 12979 ----
NM_002595chr1221324 1302 ------
NM_002613chr1695176 4938 4486 4036 3953 1936 1922 564 212 --12022 --
NM_002655chr813529 --14250 --
NM_002657chr2063363 2931 2669 763 231 159 ----11573
NM_002703chr41322 ----11627
NM_002715chr521037 850 1482 ----
NM_002716chr1133072 2524 1256 --1560 --
NM_002737chr1746334 5639 2655 162 25210 2600 --11092
NM_002740chr352413 2185 765 483 392 ------
NM_002753chr41167 --1640 --
NM_002830chr21250 ------
NM_002886chr374176 3612 3403 3380 1286 1016 289 13176 ----
NM_002945chr173595 263 183 ------
NM_002959chr164245 3636 2998 1740 1027 77 11685 14086 --
NM_003108chr295545 5244 4724 2377 1971 1914 1716 1027 966 15231 47240 2792 2692 2064 --
NM_003137chr62713 82 ------
NM_003173chrX2870 145 ----1951
NM_003178chr342134 2066 2011 1990 ----12081
NM_003189chr152559 2361 559 65 42 ------
NM_003246chr153543 433 368 1710 ----
NM_003257chr15------1572
NM_003342chr1752631 2419 1204 240 37 ----12345
NM_003412chr323009 2120 ------
NM_003489chr2132429 1316 349 12244 --11375
NM_003538chr6152 ------
NM_003539chr6147 ------
NM_003542chr6170 ------
NM_003543chr6154 ------
NM_003545chr6157 ------
NM_003547chr6162 ------
NM_003557chr141497 1267 1242 399 ----11536
NM_003583chr1222979 1024 --13557 --
NM_003607chr154075 3551 3390 1381 137 ----14232
NM_003615chr322555 468 ------
NM_003684chr11116 ------
NM_003794chr31788 ------
NM_003872chr242901 2167 935 669 ------
NM_003901chr1052028 1945 720 390 143 ----11849
NM_003922chr152456 423 ------
NM_003939chr1073914 3610 3263 1651 1444 1202 538 --23509 3406 --
NM_004050chr1471905 1802 1735 880 842 421 218 22295 374 1412 --
NM_004077chr1221342 72 ------
NM_004090chr1733329 1371 611 --12706 --
NM_004133chr822543 66 12411 ----
NM_004229chrX31586 582 141 ------
NM_004311chr1023010 827 --11995 12959
NM_004370chr621663 554 ------
NM_004474chr11137 --1193 2308 81
NM_004475chr171135 ------
NM_004501chr133416 3133 245 ------
NM_004513chr1533038 1427 1268 --21001 72 --
NM_004535chr2021729 1502 ----1315
NM_004588chr1143328 2713 681 427 --12854 --
NM_004612chr923178 482 24793 4503 14563 --
NM_004637chr321136 1119 ------
NM_004774chr1752691 2556 2513 657 550 12749 12061 --
NM_004775chr1822206 613 1840 ----
NM_004841chr11155 ------
NM_004852chr1854984 2385 934 363 331 413320 5521 2411 855 212673 3209 --
NM_004898chr462568 2458 1920 1069 826 404 ------
NM_004915chr211592 ------
NM_004932chr5----1282 11664
NM_004992chrX45940 2897 2002 155 1961 13052 --
NM_005028chr1031697 689 131 ------
NM_005065chr1421234 1117 1170 ----
NM_005068chr641079 1054 566 171 ------
NM_005105chr12889 516 ------
NM_005121chr1743479 1096 938 919 22340 1488 ----
NM_005126chr31729 ------
NM_005154chr15------1542
NM_005156chr954142 3479 1400 904 233 ------
NM_005160chr2232616 838 741 --11094 --
NM_005238chr1142843 1106 231 123 1756 1895 --
NM_005339chr43469 366 324 ------
NM_005342chrX22581 558 --2986 501 --
NM_005406chr182247 115 ------
NM_005433chr1821955 210 1951 ----
NM_005475chr1253033 2290 825 744 604 1817 ----
NM_005477chr1552228 2180 1940 1741 58 ----1759
NM_005479chr103472 420 77 ------
NM_005578chr324629 1738 35060 4901 3835 12006 --
NM_005596chr936185 4429 1306 ----14481
NM_005634chrX1680 ------
NM_005650chr2211277 ------
NM_005668chr534101 3279 2972 ----22931 1834
NM_005785chr1241707 1446 668 173 1652 1277 1508
NM_005868chr761963 1876 1840 1593 801 213 ------
NM_005898chr1143123 2628 265 100 11076 ----
NM_005909chr543553 1663 945 527 ------
NM_005937chr1793623 3457 3345 3101 3016 2663 1027 712 472 --21081 1070 12631
NM_005955chr154992 4381 3898 3441 534 24581 1726 31646 1172 579 --
NM_006190chr211003 ----1275
NM_006252chr175034 4931 2832 2296 930 642 612 ------
NM_006277chr22690 272 ------
NM_006393chr1023321 964 --11531 1539
NM_006464chr212946 --13911 11286
NM_006549chr1242736 1902 944 803 ------
NM_006559chr11471 ------
NM_006609chr262854 2411 1973 1068 1005 478 12012 ----
NM_006738chr1554300 1075 729 253 233 1644 13171 --
NM_006750chr1677436 7071 6385 5908 5085 2336 868 ------
NM_006754chr721155 211 ------
NM_006815chr1251283 1213 939 911 332 ------
NM_006854chr7135 ------
NM_006990chr14724 692 335 197 --22501 1806 --
NM_007007chr1244220 3785 3724 3589 ----1478
NM_007017chr51622 ----1256
NM_007038chr2155969 5458 3873 741 270 ----11627
NM_007114chr312980 ------
NM_007146chr1721767 548 ------
NM_012164chr976147 4985 2828 2438 1419 1176 930 21610 675 1163 --
NM_012199chr143837 3553 3376 1221 13493 13339 --
NM_012231chr131218 443 431 ------
NM_012249chr232848 2623 2424 --1248 --
NM_012294chr753775 3716 1567 206 153 ----13797
NM_012316chr174997 4295 3676 3466 2014 1974 1290 11064 25483 1432 --
NM_012479chr741755 1083 870 749 ----1947
NM_013368chr191131 ------
NM_013374chr322976 2175 --13110 --
NM_013438chr921422 1228 ------
NM_013443chr981137 792 254 233 210 155 121 25 1183 ----
NM_014028chr642037 1208 1193 715 ------
NM_014112chr835468 4809 1798 --15154 11241
NM_014181chr262361 2267 2155 707 618 410 ------
NM_014268chr181952 ------
NM_014294chr82951 404 1229 ----
NM_014500chrX157 124 ----
NM_014603chr1731251 472 53 ------
NM_014682chr822047 1765 ------
NM_014713chr23392 369 74 ------
NM_014727chr191119 ------
NM_014746chr263634 3469 3344 2991 1531 598 1151 ----
NM_014761chr1611131 ------
NM_014774chr133209 2758 794 23200 652 ----
NM_014827chr121498 549 --1677 --
NM_014876chr2242077 2039 678 474 ------
NM_014901chr541761 611 520 278 ------
NM_014953chr1334089 2983 913 22680 265 ----
NM_015044chr1692787 2667 2575 2155 776 739 732 333 36 1209 --1449
NM_015045chr1052023 1803 466 227 21 11723 ----
NM_015074chr193771 3756 3735 3248 3083 1952 1944 1431 799 1607 ----
NM_015075chrX32228 1699 1632 --11459 --
NM_015077chr1754308 3372 3053 788 112 --1960 1862
NM_015092chr1643232 2866 1687 68 --14120 1182
NM_015094chr2244573 3702 3612 530 --33648 1623 848 13816
NM_015097chr311770 ------
NM_015137chr832214 68 21 ------
NM_015173chr431215 381 164 ----1110
NM_015288chr542512 1167 866 316 --1730 11226
NM_015299chr1473740 3038 2802 2780 931 680 600 2868 128 1896 --
NM_015317chr222530 2301 ------
NM_015393chr43637 351 339 13381 --12754
NM_015455chr543132 2739 889 708 --1629 13061
NM_015509chr1231207 563 413 ------
NM_015569chr124728 3816 ------
NM_015695chr641647 845 666 287 --2376 225 --
NM_015719chr19------1746
NM_015831chr72903 811 ----2173 80
NM_015872chr141799 1632 1436 1222 --11741 --
NM_015888chr112471 ------
NM_015995chr1594394 3904 3893 3781 3372 1882 1090 690 126 --24743 1622 1254
NM_016075chr1352263 2163 2015 1001 718 ----11076
NM_016076chr132828 921 135 ------
NM_016089chr351928 1848 1675 1523 644 --32061 813 225 --
NM_016090chr111706 --1194 --
NM_016230chr61415 --159 --
NM_016248chr131285 --13331 --
NM_016436chr2022403 541 1119 --11970
NM_016442chr531579 1470 154 ------
NM_016472chr1441476 1449 400 128 ------
NM_016577chr334305 1734 1236 2986 169 --1770
NM_016605chr511886 --22086 124 2469 317
NM_016628chr101152 ------
NM_017589chr111101 ------
NM_017590chr2241996 1052 78 39 --2801 340 12150
NM_017594chr942399 2347 1251 77 ------
NM_017644chr354844 3444 629 558 433 21778 1493 --13203
NM_017658chr1464537 3801 3029 2994 1265 582 ------
NM_017789chr21593 ----178
NM_017811chr932523 1182 41 1598 --12262
NM_017902chr1045167 4933 3952 1360 13729 55695 4629 4318 1429 1272 25154 4264
NM_017919chr965503 4831 4439 4337 1490 455 --14108 --
NM_018013chr612300 ----1270
NM_018067chr11506 ------
NM_018222chr112415 294 ------
NM_018362chr1132636 2576 1411 ------
NM_018375chr1421589 544 ----1283
NM_018449chr92765 305 ------
NM_018638chr1211321 --11128 --
NM_018963chr211389 ------
NM_019084chr1021755 117 ----1721
NM_019096chr62364 210 ----11020
NM_019610chr11446 ------
NM_020122chr294869 4774 4080 4040 3663 2246 979 834 97 22066 1717 ----
NM_020309chr194729 370 275 105 --2898 173 --
NM_020340chr622209 608 ------
NM_020348chr1032712 817 505 --11824 --
NM_020432chr731708 456 91 ------
NM_020440chr152275 2105 1192 543 118 --1877 --
NM_020530chr221278 ------
NM_020644chr111347 ------
NM_020673chr2056461 5446 5268 2783 2392 ----11377
NM_020752chr1042258 2008 1928 822 ------
NM_020770chr111035 --1823 1373
NM_020772chr1788469 7886 5886 5398 2860 2534 2023 1477 --12274 --
NM_020774chr1825783 4667 12489 14693 --
NM_020810chr1423416 79 ----1268
NM_020834chr1431749 1222 127 11562 1233 11349
NM_020897chr11928 ----11197
NM_020918chr1022405 845 ------
NM_020921chr1411079 ----1904
NM_020935chr243977 3520 1174 248 --1122 1957
NM_021064chr62262 63 ------
NM_021090chr2284914 4809 3374 1541 1231 805 759 623 11461 1947 --
NM_021116chr798386 7878 7567 3354 3297 2760 2383 2053 313 12767 48139 6032 1856 712 --
NM_021205chr1--1757 --1186
NM_021238chr1221519 546 ------
NM_021255chr1443645 3071 3064 521 ----13030
NM_021960chr152425 2335 1847 964 537 ----12620
NM_021964chr376128 5412 5337 2302 2247 2026 330 ------
NM_022062chr11163 ------
NM_022156chr17------179
NM_022461chr331097 978 495 --11375 --
NM_022465chr1232427 1184 741 --32238 1035 877 --
NM_022719chr2253776 3541 2779 532 334 --22923 86 --
NM_022730chr211012 --1211 --
NM_023010chrX2725 80 ------
NM_024076chr1951972 1844 1728 1697 300 --11955 32035 621 557
NM_024090chr431619 647 185 --133 1141
NM_024345chr974728 2069 1486 1345 1306 948 46 14133 ----
NM_024430chr1831733 1531 247 ----11801
NM_024519chr16147 ------
NM_024524chr32598 43 --12472 --
NM_024586chr12227 36 ----1126
NM_024674chr172877 2603 2316 2226 788 429 115 ----1808
NM_024923chr331303 561 430 ----21206 406
NM_024954chr102145 89 ------
NM_025054chr834085 2782 2710 ----13004
NM_025074chr432031 1950 1145 11110 ----
NM_025083chr1551933 1418 1308 1300 310 --11589 12013
NM_025134chr1642398 2172 645 522 ------
NM_025191chr142694 2500 1078 262 ------
NM_030621chr1423673 3470 ------
NM_030627chr531425 627 27 ------
NM_030637chr142113 84 ------
NM_030647chr764747 3862 2285 1950 538 260 15320 ----
NM_030648chr433909 2013 1652 44565 2081 2068 1759 ----
NM_030766chr121868 --1200 1982
NM_030806chr1128572 8288 7087 6817 6741 5690 3484 3303 2923 2651 1869 1377 37644 6999 3060 38250 5741 5706 --
NM_030915chr231521 576 311 ----12330
NM_030918chr165109 2180 2155 2060 1920 1744 --34517 4486 4299 --
NM_031483chr2043480 3049 2957 2944 1607 ----
NM_032229chr131188 ----1156
NM_032242chr372848 2272 2180 1250 1028 253 102 --2753 228 --
NM_032315chr11227 ------
NM_032440chr1032768 840 829 ------
NM_032445chr1511835 ------
NM_032457chr433458 1094 673 21109 867 ----
NM_032487chr31479 1331 ----
NM_032521chr2012641 ------
NM_032548chr31396 ------
NM_032558chr92413 111 1511 ----
NM_032601chr2------1242
NM_032622chr411496 ------
NM_032857chr15------1188
NM_032873chr1154531 4370 725 514 253 11083 ----
NM_032982chr721984 76 ----1107
NM_033224chr745153 1627 1201 547 ------
NM_033285chr843977 3706 1130 605 14134 1399 --
NM_033419chr1721593 607 ----21587 398
NM_033427chr71286 ------
NM_033512chr821097 374 ------
NM_033540chr31794 --1156 --
NM_033631chr143695 2774 2553 145 13432 13813 --
NM_052851chr1311511 ----22032 31
NM_052910chr132875 816 ------
NM_078476chr631468 691 292 1377 ----
NM_080546chr92634 395 ------
NM_080621chr201865 ----11046
NM_080738chr121581 1274 ------
NM_130809chr522406 2278 --22902 460 --
NM_130830chr333588 3551 2576 --33940 2877 1442 --
NM_133264chr173769 335 26 --13483 --
NM_138426chr761958 1543 835 533 507 385 ------
NM_138473chr1285005 4510 4398 3280 1929 1290 1119 803 24688 3147 13576 --
NM_138771chr731128 192 81 11566 ----
NM_139283chr121528 ------
NM_144571chr435750 1163 107 ------
NM_144599chr1545105 4744 3770 3651 ----13948
NM_144775chr1731693 1315 1147 --2606 41 --
NM_145351chr171474 ------
NM_145753chr321139 27 ------
NM_152253chr2264133 2715 1597 880 536 190 ------
NM_152263chr144526 1133 505 404 15949 --151
NM_152284chr8------1799
NM_152383chr21424 --1110 --
NM_152409chr523276 1306 13385 1177 --
NM_152446chr141931 ------
NM_152455chr1552663 2309 1919 656 102 12472 --12868
NM_152653chr3----1465 1667
NM_152744chr752469 2329 2288 671 592 23466 2614 2736 25 --
NM_152756chr533051 2831 387 ------
NM_152787chrX41529 1314 555 69 ------
NM_152890chr14448 280 131 27 ------
NM_153262chr132021 553 530 --12713 --
NM_153267chr91823 --1163 --
NM_153347chr1162295 2223 1875 698 681 182 --11743 2906 874
NM_170606chr7------1553
NM_173473chr1032231 1930 458 1183 --1745
NM_173475chr161451 ------
NM_173531chr1922869 865 1664 ----
NM_173595chr1295022 4713 4451 4050 1145 952 886 514 77 ------
NM_173808chr132950 544 537 13271 ----
NM_173822chr222163 1471 ------
NM_175054chr12146 ------
NM_175056chr352164 1461 716 452 251 --1259 --
NM_175061chr7174 ------
NM_175630chr22657 638 ------
NM_175709chr2232920 1060 189 11140 22340 1170 12282
NM_175736chr1266787 5786 3016 2043 1948 83 11851 41931 1239 916 256 24907 419
NM_175871chr192697 203 ----164
NM_176871chr872991 2745 2560 2543 581 204 154 ------
NM_178554chr363491 2937 1272 1221 887 185 --22458 1204 --
NM_181358chr111679 ----14075
NM_182487chr943601 2773 483 350 23895 368 24133 3964 1998
NM_182488chr132883 194 --1108 --
NM_182765chr101633 ------
NM_182767chr124502 386 215 103 ------
NM_182970chr2054151 3406 3321 3065 436 24227 4042 13705 --
NM_197956chr92740 641 --31709 522 129 11480
NM_198504chr32695 251 ----1784
NM_198513chr831502 1462 649 11832 ----
NM_198560chr383369 3197 3153 3103 3018 2623 907 671 ------
NM_199044chr132359 1007 658 --21112 259 --
NM_201521chr62377 163 --1144 --
NM_203301chr1421231 345 ------
NM_203390chr82559 414 --1571 --
NM_203394chr1252423 2085 1811 549 434 ------
NM_207371chr1041322 1299 1100 238 ------
NM_212559chrX1666 ----1698