TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-125b-1-3p
miRNA Sequence: ACGGGUUAGGCUCUUGGGAGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr693580 3198 3169 3128 1696 1403 1005 318 34 ------
NM_000202chrX73593 3460 3129 2510 762 506 122 13387 13413 --
NM_000248chr352721 2364 2259 449 133 --12607 --
NM_000259chr15116148 5700 5252 5223 5014 4875 4405 2074 1246 1204 1069 15381 ----
NM_000332chr666263 5419 5397 4777 1033 125 --11651 --
NM_000368chr994557 4028 3836 3657 1631 798 320 246 214 ------
NM_000503chr821753 284 --11275 11603
NM_000555chrX107564 7499 7265 7054 6940 5837 2367 1445 1293 1123 15798 16931 15468
NM_000609chr1062364 2034 1935 1231 1055 428 ----12239
NM_000611chr11126936 6806 6558 6323 6164 5475 4613 2769 2405 2170 965 134 --26469 2316 --
NM_000618chr12106016 5978 4895 4647 2462 2049 1438 576 507 442 ------
NM_000618chr12106016 5978 4895 4647 2462 2049 1438 576 507 442 ------
NM_000633chr1841982 1707 1458 985 21524 302 ----
NM_000719chr12106530 6519 6250 6145 5762 2617 1369 1009 834 473 15633 ----
NM_000816chr54449 217 129 82 ------
NM_000827chr552494 2110 2068 281 265 12060 ----
NM_000829chr1132029 748 518 --1418 --
NM_000901chr441993 514 281 76 ------
NM_000926chr11109446 9031 7299 6798 3105 2964 2171 1772 701 395 16600 ----
NM_001001323chr1273188 2589 2387 2132 1126 518 153 ------
NM_001001419chr595253 5191 4559 4207 1498 1323 1128 881 193 ------
NM_001001420chr595253 5191 4559 4207 1498 1323 1128 881 193 ------
NM_001002026chr3------12467
NM_001002257chr2113509 3395 3036 2842 2786 2242 1376 1067 639 364 350 ------
NM_001002814chr843902 3734 1172 1037 --12925 --
NM_001002860chr1434459 4123 60 --23272 102 --
NM_001004342chr1135568 5005 4724 4612 4420 4184 4114 3725 2426 2358 414 119 83 16064 14516 --
NM_001005404chr1754542 4272 3078 2908 978 22997 2970 11207 --
NM_001005502chr12133927 3745 3606 1909 1828 1488 1446 1308 1244 1207 1029 436 77 13518 ----
NM_001005609chrX93616 3201 1512 1252 1060 716 694 525 393 --1875 --
NM_001007067chr82950 698 1269 --1683
NM_001007068chr82950 698 1269 --1683
NM_001007069chr82950 698 1269 --1683
NM_001007070chr82950 698 1269 --1683
NM_001007097chr9134907 4614 3898 3813 3655 3540 2007 1837 1224 1109 869 347 215 ------
NM_001008392chr3103110 2609 2387 1290 1154 1097 689 615 523 368 --13125 --
NM_001008495chr81296 ----11829
NM_001008738chr562924 2563 2385 2312 1017 994 ------
NM_001009899chr365650 5110 2495 2329 2291 1744 ------
NM_001009909chr1163366 1034 940 709 263 183 ------
NM_001009959chr262243 1820 1747 564 179 153 1913 ----
NM_001010853chr643019 2935 2362 187 --1296 --
NM_001010861chr142359 2223 1937 1034 12177 11047 --
NM_001010888chrX84488 4422 4211 4089 3870 3546 1023 811 ------
NM_001010986chrX51627 716 499 264 243 --11552 --
NM_001011513chr482900 2842 2816 2610 728 686 551 318 ------
NM_001011666chr744727 4391 434 83 ------
NM_001012755chrX104615 4561 4437 3243 3114 1553 783 572 264 150 ------
NM_001013031chr1043348 1163 1077 896 12898 ----
NM_001014797chr1098174 7934 7593 7135 5866 5724 3019 2333 1663 ------
NM_001017395chr363379 2720 673 595 584 558 2766 361 ----
NM_001018065chr964194 3663 755 312 202 146 ------
NM_001018066chr964194 3663 755 312 202 146 ------
NM_001018067chr175040 4169 3942 1850 1781 1020 669 ------
NM_001018068chr175040 4169 3942 1850 1781 1020 669 ------
NM_001018069chr175040 4169 3942 1850 1781 1020 669 ------
NM_001020658chr141640 1603 1293 514 1487 ----
NM_001020658chr141640 1603 1293 514 1487 ----
NM_001023587chr33430 240 220 ----11060
NM_001024372chr842242 1880 1452 487 ------
NM_001024660chr341483 1332 1041 678 11141 ----
NM_001024947chr551030 944 773 420 348 ------
NM_001024956chr1155284 3939 2057 885 696 ------
NM_001029858chr653117 2827 2792 2658 186 ------
NM_001029875chr552508 2085 1998 744 656 155 ----
NM_001030006chr1772325 1757 1681 942 800 793 158 --1135 --
NM_001030055chr1444468 4216 1697 589 --11720 --
NM_001031684chr231238 314 82 --1512 --
NM_001031804chr1643983 3501 1506 159 --11262 --
NM_001032999chr2065283 2140 2098 2019 1958 77 ------
NM_001033045chr2134198 4184 3418 3357 3260 3047 1468 1298 1279 900 687 510 373 ------
NM_001033578chr871999 1700 798 756 622 390 259 ------
NM_001035260chr1051382 1360 1334 1246 129 21070 537 ----
NM_001037317chr142359 2223 1937 1034 12177 11047 --
NM_001039199chr20144766 4422 4380 4242 3883 3626 3490 2014 1740 1340 1285 1210 1035 702 ------
NM_001039350chr721298 373 --1602 2626 589
NM_001039538chr232761 2739 1004 12864 12263 13174
NM_001039547chr3116841 5682 5505 5363 5106 2849 2213 2138 2083 1207 76 ------
NM_001039590chrX43320 2735 1346 530 --1171 --
NM_001039591chrX43320 2735 1346 530 --1171 --
NM_001039618chr1155941 4887 1749 598 287 --15642 --
NM_001039690chr1681782 947 573 508 430 274 186 140 ----1552
NM_001039709chr2065283 2140 2098 2019 1958 77 ------
NM_001039840chrX55231 2023 1723 387 351 14241 ----
NM_001040110chr741768 1354 395 118 ------
NM_001040144chr1681782 947 573 508 430 274 186 140 ----1552
NM_001040146chr1681782 947 573 508 430 274 186 140 ----1552
NM_001040152chr795016 4793 4750 4428 4041 3524 3278 1986 613 21783 682 ----
NM_001040446chr542669 2082 410 125 --32398 235 103 --
NM_001040450chr1582672 2103 1982 1927 1059 684 511 306 --1761 --
NM_001040453chr1582672 2103 1982 1927 1059 684 511 306 --1761 --
NM_001040624chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040625chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040626chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040627chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040628chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040629chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040630chr872504 2307 2117 1960 1851 1725 971 ------
NM_001040712chr932671 2293 615 12481 --1198
NM_001042481chr1452621 2563 2375 2071 1986 ------
NM_001042603chr1254955 4467 4392 1884 981 ----14254
NM_001044385chr263866 2765 1485 1116 571 31 13561 ----
NM_001046chr552980 2140 1127 672 598 ------
NM_001099678chr356042 4761 697 659 481 --14232 1752
NM_001100108chr188012 7095 6667 6210 6078 5438 2256 1381 ------
NM_001106chr347965 6464 1918 1253 ----18151
NM_001121chr1041625 1435 1248 708 --11697 --
NM_001167chrX76214 6039 4179 1255 1203 1006 984 ----16567
NM_001173chr1444468 4216 1697 589 --11720 --
NM_001204chr257238 4850 2733 1330 775 1750 16808 --
NM_001256chr1762820 2800 2523 2403 936 832 22238 1891 ----
NM_001259chr775135 4614 772 596 335 305 243 ------
NM_001282chr1772325 1757 1681 942 800 793 158 --1135 --
NM_001310chr1242562 788 603 315 ------
NM_001364chr1144187 3510 3228 603 ----11105
NM_001387chr543199 2333 2294 2020 ------
NM_001399chrX93616 3201 1512 1252 1060 716 694 525 393 --1875 --
NM_001419chr1974491 4430 3190 1538 1394 1076 312 1297 13357 --
NM_001438chr143629 3606 3390 2877 12819 12299 --
NM_001621chr772370 2176 2001 1105 697 453 21 ------
NM_001621chr772370 2176 2001 1105 697 453 21 ------
NM_001650chr1863916 3822 2889 2557 1261 875 23208 1613 ----
NM_001655chr1182131 2009 1651 858 678 665 591 391 ------
NM_001682chr1262902 2303 2101 1846 840 232 ------
NM_001753chr761540 1238 710 701 605 512 21361 1154 ----
NM_001789chr351287 608 479 422 394 ------
NM_001859chr9123724 3232 3193 3125 2660 2610 2435 1418 672 536 308 190 12810 ----
NM_001874chr12133927 3745 3606 1909 1828 1488 1446 1308 1244 1207 1029 436 77 13518 ----
NM_001895chr201214 ----1200
NM_001936chr721298 373 --1602 2626 589
NM_001939chrX72713 1488 1334 1157 967 802 209 ----13409
NM_001987chr12114028 3984 3702 3384 3141 3106 2979 1550 1200 782 342 12855 1747 14014
NM_001992chr541797 1719 1543 440 --12238 155
NM_002025chrX69165 8034 7998 6202 5856 2864 11965 ----
NM_002061chr171902 1861 1727 1427 1253 599 389 ----11185
NM_002214chr775565 5553 4865 4154 3492 2111 392 24794 832 ----
NM_002264chr373923 3604 3367 1611 1205 1179 540 ------
NM_002271chr1332413 2316 34 --1258 --
NM_002351chrX41649 1622 600 317 ------
NM_002374chr232761 2739 1004 12864 12263 13174
NM_002577chr343981 3184 982 858 ----1110
NM_002581chr985143 4024 2137 1665 1235 973 941 877 --14885 --
NM_002605chr1541183 1048 860 150 ------
NM_002645chr1162954 2401 2318 1227 952 193 ------
NM_002657chr2073768 3700 3515 3433 3107 966 412 12783 ----
NM_002699chr161328 1098 603 232 180 53 ----11291
NM_002731chr133032 2423 1267 ------
NM_002737chr17136619 6315 6041 5870 5372 5331 5248 1382 1170 1074 589 266 71 ----14469
NM_002839chr932671 2293 615 12481 --1198
NM_002858chr11257 ----1293
NM_002906chr1142163 1852 915 395 12015 ----
NM_003016chr1731322 584 38 126 ----
NM_003017chr641371 1169 1086 300 ------
NM_003099chr1575790 5237 5068 2604 2405 2080 110 11343 ----
NM_003108chr277206 6154 5411 2722 1596 1132 431 17147 ----
NM_003137chr672269 1975 1797 1617 163 131 40 ------
NM_003199chr1865622 5368 5147 4954 879 96 --1829 --
NM_003221chr644097 3719 765 630 33591 2637 1084 ----
NM_003281chr185115 4675 4329 3823 1926 747 738 644 11973 12185 --
NM_003298chr3125980 5915 5079 4823 4528 4434 2037 1554 787 689 243 141 1336 12440 --
NM_003400chr2137 ----1710
NM_003412chr362707 2563 1053 980 943 623 ----12746
NM_003423chr1911722 ----1738
NM_003430chr1931274 436 88 1548 ----
NM_003439chr772679 2404 2268 849 807 227 182 13183 ----
NM_003574chr1865284 4288 3683 956 404 344 ------
NM_003583chr1243818 3174 2870 103 ----129
NM_003671chr983638 2770 2443 2425 1054 644 527 408 --13325 --
NM_003759chr421557 770 33553 2700 93 2851 146 --
NM_003768chr131448 1441 120 --31859 1776 110 --
NM_003861chr1452895 2482 1983 1007 228 ------
NM_003899chr1372160 1859 1654 863 550 394 63 ------
NM_003932chr2261879 1836 1645 1260 411 131 ------
NM_003983chr1663891 2707 1645 1532 1094 107 23638 1346 11035 --
NM_004028chr1863916 3822 2889 2557 1261 875 23208 1613 ----
NM_004124chr1443002 2926 2198 452 12910 1485 142
NM_004170chr931856 1495 638 --11209 --
NM_004171chr11109024 7917 7316 6566 5920 5907 2891 900 635 473 26231 5867 29615 2918 --
NM_004331chr872565 2220 1797 1769 184 136 95 ------
NM_004438chr272910 2632 2594 2108 874 646 632 --12860 --
NM_004464chr424256 3973 13822 --1331
NM_004537chr12----132 11546
NM_004586chrX95394 4949 3982 1686 1644 1508 1155 738 409 ------
NM_004588chr1193288 2759 1318 1276 1155 675 196 172 65 11034 ----
NM_004612chr954464 3678 1718 752 306 ------
NM_004654chrY31307 1242 470 ------
NM_004703chr1752334 2192 2077 78 45 ----12171
NM_004726chrX55667 5432 1277 1147 128 --11007 --
NM_004730chr561557 778 772 456 330 122 ----11656
NM_004745chr895751 5568 4810 4531 4507 2443 2236 1601 1537 36125 5779 460 16111 --
NM_004774chr1752243 1193 990 762 604 --23151 2531 --
NM_004815chr184590 4501 4406 4128 3321 3192 1411 669 14394 ----
NM_004834chr243066 3041 2150 2127 ------
NM_004845chrX54178 3806 3288 374 253 --23605 742 --
NM_004857chr1454342 1902 795 660 521 1838 ----
NM_004859chr1743035 762 596 105 1304 ----
NM_004896chr1051297 1275 1249 1161 44 2985 452 ----
NM_004904chr744727 4391 434 83 ------
NM_004976chr11134873 4635 4138 3911 3242 1958 1942 1377 1162 1036 675 585 73 --1333 1744
NM_004992chrX118521 8462 8178 7311 6689 6067 5327 5273 2542 1993 1500 11765 ----
NM_004992chrX118521 8462 8178 7311 6689 6067 5327 5273 2542 1993 1500 11765 ----
NM_005011chr741768 1354 395 118 ------
NM_005023chr531186 1007 544 11493 ----
NM_005056chr1275199 4711 4636 3468 2128 1225 171 ----14498
NM_005065chr1474772 4691 1880 1627 1435 1092 180 ------
NM_005093chr2065283 2140 2098 2019 1958 77 ------
NM_005121chr1752844 1123 490 252 163 ------
NM_005156chr994702 3901 1923 835 574 466 445 228 108 ----14336
NM_005164chr1222670 484 22092 735 ----
NM_005188chr1177112 6139 5077 2959 2610 1732 271 17978 21793 420 --
NM_005197chr14124978 4939 4722 4710 4387 2410 2077 1580 1137 1049 336 324 22478 641 ----
NM_005338chr793892 3646 3604 3469 3236 2543 1288 1211 339 ------
NM_005347chr971696 1330 1280 1123 629 514 233 ------
NM_005359chr1866275 5781 4282 363 297 28 15137 ----
NM_005399chr1104266 4033 2981 1531 1183 935 712 670 611 246 ------
NM_005497chr17115494 5329 5287 5152 4384 4250 1929 939 905 825 21 ------
NM_005591chr1151044 1029 952 522 107 --1173 --
NM_005596chr965031 4230 1781 1450 690 668 ------
NM_005603chr186808 652 587 409 367 233 1703 ----
NM_005625chr82950 698 1269 --1683
NM_005665chr154366 4121 3070 1656 724 --13514 14906
NM_005715chr642614 2090 1840 305 ----1515
NM_005746chr752669 2399 1874 1743 595 ------
NM_005808chr3103110 2609 2387 1290 1154 1097 689 615 523 368 --13125 --
NM_005813chr231854 628 265 12490 22634 2292 --
NM_005819chr173110 2579 2139 1324 1210 432 139 ------
NM_005840chrX107329 7310 6239 5690 5662 5430 4636 2624 2299 1010 --15457 --
NM_005859chr541376 1058 137 130 ------
NM_005899chr1741359 1007 452 394 --11288 11095
NM_005903chr595253 5191 4559 4207 1498 1323 1128 881 193 ------
NM_005909chr534152 3073 2943 --1858 12624
NM_006024chr7------1622
NM_006158chr811520 ----11485
NM_006166chr1232629 2235 480 --11604 --
NM_006203chr555369 3966 1528 1208 1184 15082 13761 --
NM_006206chr432736 1020 367 32151 1174 461 ----
NM_006252chr1147232 6618 6579 6476 6240 5172 5064 5022 4887 2767 2390 1977 639 503 11125 ----
NM_006420chr2033288 2878 2810 ------
NM_006424chr451875 1733 1483 284 264 ----1144
NM_006457chr482900 2842 2816 2610 728 686 551 318 ------
NM_006482chr1243818 3174 2870 103 ----129
NM_006544chr1445493 5030 4462 4242 24423 4333 ----
NM_006599chr1667524 7491 6071 2678 925 822 13041 47959 7215 6454 1560 --
NM_006601chr123217 137 124 --1444 --
NM_006620chr644513 4099 1048 49 11170 ----
NM_006629chr185924 688 449 287 95 ----12020
NM_006722chr352721 2364 2259 449 133 --12607 --
NM_006729chrX54698 4637 4024 3737 1934 2969 836 ----
NM_006750chr1668096 6810 5620 5387 3081 1711 17624 16246 --
NM_006775chr643117 3093 3049 1989 ------
NM_006851chr1252047 931 309 233 157 11809 ----
NM_006852chr1731902 641 105 186 ----
NM_006885chr16103920 3710 3478 3177 3084 2597 1018 757 382 239 13663 ----
NM_006915chrX42341 604 306 220 ------
NM_006918chr1155284 3939 2057 885 696 ------
NM_006922chr232304 2091 1676 ------
NM_006924chr1753879 3501 1327 1143 227 ------
NM_006930chr531386 1277 510 --1529 --
NM_006981chr952424 2390 1985 1877 651 --12953 --
NM_007007chr1263406 3233 1223 829 222 100 ------
NM_007030chr595136 4627 3610 3459 3385 1807 992 408 221 --11360 --
NM_007050chr20138103 7561 7552 7541 7473 7302 6917 5054 3089 1864 1588 818 21 --1580 --
NM_007054chr563613 3275 1370 1328 1193 1024 ------
NM_007064chr341483 1332 1041 678 11141 ----
NM_007073chr674029 3809 3401 3181 2687 2587 1108 11064 ----
NM_007146chr1732708 683 337 --12653 1411
NM_007172chr2262536 2241 2124 583 336 270 ------
NM_007189chr741101 1021 311 145 ----21285 59
NM_007249chr1388802 7495 6485 2651 1798 1266 415 170 11336 ----
NM_007353chr772823 2695 2531 2281 1913 519 418 1234 22904 2267 22223 448
NM_012081chr553323 2310 1053 618 602 ------
NM_012095chr10133449 3417 3200 3158 3023 2926 2913 2849 2679 2375 2201 928 314 ------
NM_012096chr322895 229 13622 11208 --
NM_012104chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_012104chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_012120chr642782 2204 1091 820 ------
NM_012214chr274855 3976 3912 2049 1419 1285 911 ------
NM_012288chr664948 4722 4468 1516 677 122 ------
NM_012294chr764031 3766 2819 1123 512 115 ------
NM_012316chr1115659 5403 4952 4772 4639 4188 3814 3631 1698 429 280 ------
NM_012347chr632400 968 479 1959 ----
NM_012420chr1042254 881 217 82 ------
NM_013231chr1453852 3628 1539 538 216 1644 1598 14226
NM_013257chr871999 1700 798 756 622 390 259 ------
NM_013286chr332614 330 208 12655 23314 2783 --
NM_013316chr73992 932 140 ----11004
NM_014112chr854550 3476 1863 283 238 14201 1990 --
NM_014238chr1731669 1447 101 11720 1468 --
NM_014263chr1041426 1231 1121 514 ------
NM_014382chr321526 1335 21108 278 1153 --
NM_014423chr545575 4433 550 149 --11948 --
NM_014445chr342306 667 358 327 ------
NM_014602chr3------154
NM_014636chr951401 1387 1081 609 596 12897 1357 --
NM_014676chr141640 1603 1293 514 1487 ----
NM_014721chr656292 5636 5564 836 521 170 26402 1593 16921
NM_014755chr274118 3802 3489 2658 1407 869 55 ------
NM_014774chr173105 2864 2753 2060 1016 744 737 12706 ----
NM_014810chr163496 3371 2783 1261 1130 240 ------
NM_014819chr592456 2334 2233 921 768 755 606 476 141 ------
NM_014830chr1253748 3260 3109 2592 1471 13641 11080 12384
NM_014877chr1767568 6537 5879 2601 2171 1613 --1894 13047
NM_014906chr1744133 3858 3010 2509 --1709 --
NM_014923chr1341802 1710 1588 24 ----1347
NM_014934chr1393539 3370 3169 3087 3032 1294 1042 543 470 --13782 1518
NM_014936chr642097 1030 975 927 ----22154 997
NM_014946chr242444 1101 1021 21 1264 ----
NM_014947chr143160 2952 2833 179 1612 --12733
NM_014953chr1364288 4096 2817 1580 1571 163 ------
NM_014991chr441123 948 502 302 ------
NM_015008chr363379 2720 673 595 584 558 2766 361 ----
NM_015033chr962774 2499 2054 599 578 179 ----13137
NM_015035chr20105869 5469 5427 5292 4071 2445 2363 1286 665 656 25654 71 ----
NM_015045chr1032262 2062 2000 11749 ----
NM_015068chr783868 3645 3602 3280 2893 1560 1521 838 1635 11459 --
NM_015071chr536375 1121 955 12582 --14623
NM_015074chr184954 4044 3867 1642 1441 1100 588 100 1534 13821 --
NM_015076chr643920 768 279 262 ------
NM_015090chr186013 5990 4625 4196 2463 2383 1922 184 11954 ----
NM_015144chr1662759 2673 2541 586 209 104 1166 ----
NM_015178chr852357 2183 2038 1833 24 ----11745
NM_015215chr142649 2507 877 755 ------
NM_015271chr462809 955 785 452 421 340 1712 ----
NM_015310chr8137953 7260 5772 3222 3106 3059 2306 1835 1624 1445 1429 1396 367 --171 --
NM_015349chr673037 1189 1135 994 596 321 219 --12497 --
NM_015359chr842883 2683 1987 1952 3541 256 62 21993 1180 --
NM_015375chr1104431 4163 3452 3261 1937 1895 1778 1097 894 852 24179 1814 ----
NM_015455chr563884 3497 2589 905 641 553 ------
NM_015550chr773542 3357 3077 2436 967 131 69 ------
NM_015640chr175040 4169 3942 1850 1781 1020 669 ------
NM_015886chr875687 5548 5127 4164 1976 1825 168 ------
NM_016009chr174630 4261 3608 3382 1549 1278 58 ------
NM_016131chr242014 1878 1489 85 ------
NM_016206chr378879 7331 7232 6141 2504 2414 882 11101 ----
NM_016221chr551673 852 589 391 50 1902 ----
NM_016235chr1621417 1290 ----11323
NM_016248chr1343827 3712 3161 740 ------
NM_016255chr652097 1045 485 408 185 --13268 --
NM_016260chr265913 5850 5551 5129 1868 522 --11313 --
NM_016322chr943189 2519 2402 1201 --11002 --
NM_016824chr1041625 1435 1248 708 --11697 --
NM_016831chr142334 2295 879 477 ------
NM_016952chr1174108 4053 3720 3502 2602 2593 774 12672 ----
NM_017423chr471834 1562 424 114 96 74 25 ------
NM_017637chr978550 8179 7516 6716 2866 1321 339 ----18419
NM_017643chr1732528 2392 2331 --12938 --
NM_017658chr1443939 3868 3860 1557 11307 ----
NM_017719chr352414 2039 1913 760 321 --12226 --
NM_017799chr1431874 1851 23 --11671 --
NM_017919chr9105441 4083 4009 1220 1064 1022 861 817 354 292 11872 ----
NM_017925chr971894 1648 1534 1287 445 376 116 ------
NM_017938chrX22112 1580 11567 --11870
NM_017944chr1182774 2423 2353 2309 870 539 266 102 ------
NM_017958chr293065 2835 2606 774 724 613 576 146 39 ------
NM_018085chr1238162 7551 6567 6303 6261 6126 5698 5298 5226 4975 3140 2659 1795 1753 1618 1485 1331 1275 1195 854 751 621 111 --15091 --
NM_018126chr411553 ----1350
NM_018184chr341904 854 162 41 ------
NM_018195chr1152138 1914 1587 753 495 ------
NM_018243chr452872 2825 2598 2566 1264 22554 385 21061 141 --
NM_018287chr104858 531 520 455 ------
NM_018313chr352670 2375 990 903 630 ------
NM_018342chr4------11707
NM_018373chr1446006 4552 3980 955 11206 ----
NM_018374chr754984 4432 1639 431 161 ------
NM_018425chr1062503 2384 2243 1890 1834 424 12521 ----
NM_018440chr867795 7280 7024 6343 6163 786 17263 13139 --
NM_018638chr1234508 438 272 --23907 3730 --
NM_018963chr2121426 133 ----1375
NM_018970chr782686 2601 2563 2215 2165 489 159 40 ------
NM_018976chr1252920 2765 2346 2332 1153 ------
NM_019083chr121579 195 --11410 --
NM_019903chr1041625 1435 1248 708 --11697 --
NM_020116chr441470 1178 597 56 11539 ----
NM_020122chr2104898 4727 3746 3693 3651 1905 1872 1358 1134 681 ----1879
NM_020148chr1862817 2657 2559 2534 2369 2196 --11054 --
NM_020178chr17162 ----1347
NM_020338chr1073628 3458 3220 2684 606 397 292 --22973 865 --
NM_020340chr672197 2058 1899 566 264 246 90 --12098 --
NM_020357chr351610 1593 1364 371 362 ------
NM_020673chr2067517 6324 5713 5118 2510 832 21473 1175 13085 --
NM_020711chr262243 1820 1747 564 179 153 1913 ----
NM_020718chr1664234 2122 1547 1159 742 347 --14568 --
NM_020752chr1042640 1008 438 266 12683 ----
NM_020774chr1866177 5611 1555 1527 1173 226 14389 ----
NM_020783chr1842327 2297 711 574 ------
NM_020796chr552710 1874 697 530 452 33045 2807 2457 ----
NM_020918chr1033357 2879 1055 13384 22706 242 --
NM_020921chr1441393 1292 573 89 11091 --11419
NM_020948chr143537 3430 3339 3267 ------
NM_020962chr1552276 2134 2066 1541 619 ------
NM_021033chr1353485 2458 753 610 60 --21026 1015 --
NM_021061chr864244 4172 3706 3490 132 88 13408 ----
NM_021072chr542470 1656 613 293 1837 1897 --
NM_021083chrX52487 2460 2323 1375 113 ----1377
NM_021090chr22114767 4570 4145 3812 3806 3604 3538 1932 1910 729 63 ------
NM_021255chr1452584 1519 1406 280 62 1465 ----
NM_021813chr685465 4489 4047 3733 2216 1884 1213 916 23634 1868 ----
NM_021961chr1157054 6970 1775 1157 692 36760 4831 294 11175 --
NM_021964chr376274 5660 5335 4773 4201 1076 143 ------
NM_022041chr1651756 474 397 118 34 --1967 --
NM_022048chr1566070 4774 2429 2118 1297 944 14978 ----
NM_022166chr1694218 3920 2501 1822 1493 1346 301 290 179 ------
NM_022459chr1355054 1621 1099 994 867 ----15360
NM_022473chr15134198 4113 4106 3089 2950 2819 1474 1432 1303 1219 843 767 325 ------
NM_022771chr1221075 830 --1703 --
NM_022781chr953291 2770 2699 1105 807 ------
NM_022841chr1542005 1911 1824 754 ------
NM_022898chr1454438 4414 4271 4205 3627 1172 31376 351 145 --
NM_023076chr1662882 2716 1204 1154 862 264 ------
NM_024086chr1773250 3170 2814 2772 2639 2601 965 13650 ----
NM_024513chr373828 3638 3017 2615 1483 751 185 ------
NM_024561chr1341373 1131 571 436 ------
NM_024665chr384615 4266 3648 3120 1748 1572 1305 67 --11721 --
NM_024674chr183107 2955 2783 2457 2430 1294 1149 252 12634 ----
NM_024721chr851934 1747 1000 552 94 ------
NM_024770chr2136510 6321 5293 5191 2446 2117 2075 1940 1934 1363 1340 1306 669 ------
NM_024812chr842136 1774 1346 381 ------
NM_024817chr1575240 5007 4824 4362 2372 1714 1207 15399 11747 --
NM_024834chr1021980 1942 ----1697
NM_024989chr277852 7690 6523 3229 3034 1711 1017 ------
NM_025054chr833180 3147 2690 1738 ----
NM_025057chr1461328 1093 929 484 240 113 ------
NM_025073chr184425 4162 3930 3847 3600 1590 1556 1216 ----14248
NM_025138chr1341313 1166 559 117 ------
NM_025146chr32864 462 1914 --12147
NM_025179chr164196 1857 867 666 420 236 --13920 --
NM_030625chr1052240 1702 992 388 264 ------
NM_030647chr795434 5274 5146 4912 4338 4134 2368 1886 740 1137 12313 11318
NM_030648chr495316 5098 4510 4248 3923 3389 2036 1625 481 ------
NM_030674chr1265636 4282 1925 1024 605 283 25467 5150 ----
NM_030751chr1041311 548 459 200 --187 --
NM_030751chr1041311 548 459 200 --187 --
NM_030918chr185203 4854 4355 4122 1430 965 749 206 35025 1773 1767 ----
NM_030964chr563576 3229 2857 2452 717 40 ----12886
NM_031244chr61871 ----1931
NM_031442chrX43118 2911 928 859 ------
NM_031483chr2072929 2254 1284 1004 806 765 732 ----13196
NM_031845chr232761 2739 1004 12864 12263 13174
NM_031847chr232761 2739 1004 12864 12263 13174
NM_031858chr1741359 1007 452 394 --11288 11095
NM_031862chr1741359 1007 452 394 --11288 11095
NM_032012chr975108 4973 3779 3559 2012 1446 599 ------
NM_032041chr872504 2307 2117 1960 1851 1725 971 ------
NM_032121chrX52202 2053 1106 566 218 ----12080
NM_032208chr243627 3133 1092 838 ------
NM_032226chr93843 216 61 ------
NM_032303chr941668 1441 1350 243 ----21698 1688
NM_032440chr1032377 2232 1811 ----11132
NM_032581chr751662 1645 629 38 28 ------
NM_032824chr2------1223
NM_032859chr1343869 3799 3338 988 ------
NM_032873chr1174297 3590 3516 3190 2826 1541 544 ------
NM_033133chr17103557 3120 2422 2295 1248 1215 644 234 153 115 ------
NM_033143chr434587 4304 249 14153 --1662
NM_033224chr7147558 6323 6164 5827 5463 5114 3022 1670 1538 1437 757 674 310 218 ------
NM_033331chr983638 2770 2443 2425 1054 644 527 408 --13325 --
NM_033480chr632400 968 479 1959 ----
NM_033481chr632400 968 479 1959 ----
NM_033512chr843092 2961 2908 2478 ------
NM_052885chr1233380 1179 1045 13181 ----
NM_052886chr842124 1749 1573 1319 ------
NM_052898chr831891 1706 1484 11842 ----
NM_052904chr641426 953 391 167 ------
NM_052906chr22115051 4879 4539 4498 3934 3668 3446 1381 1260 799 129 ------
NM_052918chr1043547 1362 1276 1095 13097 ----
NM_052937chr821881 750 ----1368
NM_053016chr987266 6608 4913 3193 3151 2728 2010 314 --1670 17893
NM_053023chr1132695 338 332 1841 ----
NM_053042chr432990 867 332 22820 157 12571 --
NM_080867chr14105028 4484 4321 3867 3229 1386 1278 911 752 616 ----14449
NM_130391chr932671 2293 615 12481 --1198
NM_130392chr932671 2293 615 12481 --1198
NM_130393chr932671 2293 615 12481 --1198
NM_130797chr721298 373 --1602 2626 589
NM_133170chr20138103 7561 7552 7541 7473 7302 6917 5054 3089 1864 1588 818 21 --1580 --
NM_133264chr1763668 3170 2957 925 325 82 ------
NM_133334chr475107 5064 4551 1506 1247 852 617 14439 1195 --
NM_133372chr562924 2563 2385 2312 1017 994 ------
NM_133445chr983530 1506 1193 1011 535 326 286 270 ------
NM_138444chr131170 31439 1431 379 13149 --
NM_138459chr643513 2329 756 109 --11033 --
NM_138468chr2105042 4930 4859 3922 3880 2346 2211 1560 1384 1004 --186 14177
NM_138576chr1454438 4414 4271 4205 3627 1172 31376 351 145 --
NM_138713chr1667524 7491 6071 2678 925 822 13041 47959 7215 6454 1560 --
NM_138714chr1667524 7491 6071 2678 925 822 13041 47959 7215 6454 1560 --
NM_138971chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_138971chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_138972chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_138972chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_138973chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_138973chr1173676 3536 3111 2857 1143 1093 935 --12711 --
NM_139207chr121679 --132 22220 589
NM_139279chr242946 678 120 82 23353 1417 142 --
NM_139312chr1041426 1231 1121 514 ------
NM_144567chr152744 2525 2369 1784 556 ------
NM_144571chr475354 5329 4883 2647 2616 698 603 11619 ----
NM_144578chr1462191 1846 684 486 434 424 1887 ----
NM_144599chr1564568 3683 1564 1182 912 521 --1262 --
NM_144657chrX4603 512 476 265 ------
NM_144778chr1342534 2157 1728 920 ------
NM_144973chr1284084 2054 1822 1533 1491 1341 1157 176 --15128 --
NM_145013chr1182927 2908 2614 2066 2029 1839 136 23 ------
NM_145176chr653301 2960 2344 896 153 ----11295
NM_145206chr1082149 1028 617 514 457 304 286 106 13129 ----
NM_145259chr255065 2507 875 603 152 --14980 --
NM_145307chr1054132 4091 3657 1027 517 ------
NM_145320chr773542 3357 3077 2436 967 131 69 ------
NM_145321chr773542 3357 3077 2436 967 131 69 ------
NM_145322chr773542 3357 3077 2436 967 131 69 ------
NM_145686chr243066 3041 2150 2127 ------
NM_145687chr243066 3041 2150 2127 ------
NM_147147chr674029 3809 3401 3181 2687 2587 1108 11064 ----
NM_147156chr1041199 205 123 90 --1257 --
NM_148571chr174827 815 266 201 11563 1642 --
NM_148955chr1575790 5237 5068 2604 2405 2080 110 11343 ----
NM_152267chr2272322 2055 1818 1499 959 733 178 1159 ----
NM_152330chr1452621 2563 2375 2071 1986 ------
NM_152388chr263866 2765 1485 1116 571 31 13561 ----
NM_152442chr1231409 1163 879 ----11185
NM_152529chr2134198 4184 3418 3357 3260 3047 1468 1298 1279 900 687 510 373 ------
NM_152556chr741972 970 658 93 ----11672
NM_152624chr595361 5322 5238 5080 2692 2302 1092 696 187 ----16109
NM_152678chr362516 1955 1936 978 936 801 ------
NM_152826chr1575790 5237 5068 2604 2405 2080 110 11343 ----
NM_153050chr22114767 4570 4145 3812 3806 3604 3538 1932 1910 729 63 ------
NM_153051chr22114767 4570 4145 3812 3806 3604 3538 1932 1910 729 63 ------
NM_153260chr1551446 1423 1078 945 614 ------
NM_153619chr1593529 3340 3330 3302 2293 2215 838 694 682 11168 1239 12697
NM_153645chr2262536 2241 2124 583 336 270 ------
NM_153810chr1074976 4341 3988 3673 3643 3123 546 ------
NM_153825chr441798 1554 1400 1353 ------
NM_170709chr871999 1700 798 756 622 390 259 ------
NM_170719chr1341313 1166 559 117 ------
NM_172058chr821753 284 --11275 11603
NM_172059chr821753 284 --11275 11603
NM_172060chr821753 284 --11275 11603
NM_172071chr155735 4731 2568 1459 1452 ----12789
NM_173198chr952424 2390 1985 1877 651 --12953 --
NM_173200chr952424 2390 1985 1877 651 --12953 --
NM_173214chr1667524 7491 6071 2678 925 822 13041 47959 7215 6454 1560 --
NM_173353chr122143 82 1606 --1194
NM_173454chr1541183 1048 860 150 ------
NM_173511chr263816 3782 3680 2835 1107 1003 ------
NM_173576chr1042225 833 814 786 ------
NM_173642chr168893 8439 6379 5855 2319 1956 16983 16821 13143
NM_173694chrX51693 782 565 330 309 --11618 --
NM_173808chr11812 ----13652
NM_173829chr5125371 5321 4657 4529 4403 4072 3937 1647 1542 1456 1399 1274 --14320 13930
NM_177559chr201214 ----1200
NM_177560chr201214 ----1200
NM_178011chr1063202 2775 2730 1024 235 45 ------
NM_178135chr431389 530 469 ----11220
NM_178140chr552630 2295 2142 846 182 ------
NM_178151chrX107564 7499 7265 7054 6940 5837 2367 1445 1293 1123 15798 16931 15468
NM_178152chrX107564 7499 7265 7054 6940 5837 2367 1445 1293 1123 15798 16931 15468
NM_178153chrX107564 7499 7265 7054 6940 5837 2367 1445 1293 1123 15798 16931 15468
NM_178585chr441123 948 502 302 ------
NM_181521chr1685564 5517 4751 2308 1716 1695 1463 1347 ------
NM_181874chr32293 133 --275 62 --
NM_182485chr453675 2919 1394 1134 1025 ------
NM_182511chr1851372 957 915 565 198 ------
NM_182551chr2113509 3395 3036 2842 2786 2242 1376 1067 639 364 350 ------
NM_182646chr453675 2919 1394 1134 1025 ------
NM_182700chr741325 387 266 250 21758 633 ----
NM_182830chr1452239 2065 1511 1426 695 ----1551
NM_182898chr744727 4391 434 83 ------
NM_182899chr744727 4391 434 83 ------
NM_182948chr133032 2423 1267 ------
NM_183238chr1223241 1120 11328 33885 3669 3289 --
NM_183397chr2085095 4230 4201 1912 1870 1735 1321 50 ----11772
NM_194071chr795176 4484 3715 2021 1274 674 638 339 36 --1439 --
NM_194285chr1173030 2908 2866 2729 1184 1177 437 ------
NM_194286chr1276175 5915 5678 5513 4079 2403 1891 26004 1141 ----
NM_194314chr165045 1474 1125 882 651 364 ------
NM_194328chr953291 2770 2699 1105 807 ------
NM_194329chr953291 2770 2699 1105 807 ------
NM_194330chr953291 2770 2699 1105 807 ------
NM_194332chr953291 2770 2699 1105 807 ------
NM_194434chr1865284 4288 3683 956 404 344 ------
NM_198158chr352721 2364 2259 449 133 --12607 --
NM_198159chr352721 2364 2259 449 133 --12607 --
NM_198177chr352721 2364 2259 449 133 --12607 --
NM_198178chr352721 2364 2259 449 133 --12607 --
NM_198320chr12133927 3745 3606 1909 1828 1488 1446 1308 1244 1207 1029 436 77 13518 ----
NM_198468chr631066 916 867 --14444 --
NM_198513chr831887 1661 134 --11353 --
NM_198567chr54370 169 142 108 ------
NM_198859chr353954 3363 1985 1610 1598 ------
NM_198903chr54449 217 129 82 ------
NM_198904chr561843 1699 449 217 129 82 ------
NM_198956chr741325 387 266 250 21758 633 ----
NM_198968chr1393539 3370 3169 3087 3032 1294 1042 543 470 --13782 1518
NM_199072chr73673 446 116 1624 --11974
NM_199421chr14105028 4484 4321 3867 3229 1386 1278 911 752 616 ----14449
NM_199436chr242444 1101 1021 21 1264 ----
NM_199462chr1104431 4163 3452 3261 1937 1895 1778 1097 894 852 24179 1814 ----
NM_201567chr351287 608 479 422 394 ------
NM_203329chr11126936 6806 6558 6323 6164 5475 4613 2769 2405 2170 965 134 --26469 2316 --
NM_203330chr11126936 6806 6558 6323 6164 5475 4613 2769 2405 2170 965 134 --26469 2316 --
NM_203331chr11126936 6806 6558 6323 6164 5475 4613 2769 2405 2170 965 134 --26469 2316 --
NM_203413chr172744 69 ----1230
NM_203446chr2152424 2214 538 394 59 2637 523 ----
NM_203459chr141640 948 554 372 --1501 --
NM_206594chr143629 3606 3390 2877 12819 12299 --
NM_206595chr143629 3606 3390 2877 12819 12299 --
NM_206854chr633273 1943 501 1265 1495 --
NM_206855chr624238 1466 11230 11460 --
NM_206909chr8137953 7260 5772 3222 3106 3059 2306 1835 1624 1445 1429 1396 367 --171 --
NM_207012chr10133449 3417 3200 3158 3023 2926 2913 2849 2679 2375 2201 928 314 ------
NM_207303chr1044129 2563 1534 144 1780 22689 692 --
NM_207304chr1342421 2044 1615 807 ------
NM_207406chr465239 4732 3957 2451 2036 744 16056 ----
NM_207422chrX31300 550 530 1484 --152
NM_207429chr1161969 1818 1597 951 753 375 ------
NM_213589chr274889 4809 3962 3748 2214 1745 707 ------