TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-126-3p
miRNA Sequence: UCGUACCGUGAGUAAUAAUGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000368chr954765 4399 3447 1722 759 ----11475
NM_018440chr868663 8496 5559 1284 825 177 12359 ----
NM_021961chr1177481 7296 7145 4534 2250 1204 213 ------
NM_030650chr231494 980 101 2595 532 --1503
NM_144778chr132499 196 ----1714
NM_207304chr132386 83 ----1601